Journal of Gerontology: BIOLOGICAL SCIENCES
Cite journal as: J Gerontol A Biol Sci Med Sci. 2010 November;65A(11):1145–1156
doi:10.1093/gerona/glq147
© The Author 2010. Published by Oxford University Press on behalf of The Gerontological Society of America.
All rights reserved. For permissions, please e-mail: [email protected].
Advance Access published on August 16, 2010
Vasoprotective Effects of Life Span-Extending
Peripubertal GH Replacement in Lewis Dwarf Rats
Zoltan Ungvari,1 Tripti Gautam,1 Peter Koncz,1 Jim C. Henthorn,1 John T. Pinto,2 Praveen Ballabh,2
Han Yan,1 Matthew Mitschelen,1 Julie Farley,1 William E. Sonntag,1 and Anna Csiszar1
1Reynolds
Oklahoma Center on Aging, Donald W. Reynolds Department of Geriatric Medicine, University of Oklahoma Health
Sciences Center, Oklahoma City. 2Departments of Biochemistry, Anatomy, and Cell Biology, New York Medical College, Valhalla.
Address correspondence to Anna Csiszar, MD, PhD, Reynolds Oklahoma Center on Aging, Department of Geriatric Medicine, University of Oklahoma
HSC, 975 N. E. 10th Street—BRC 1303, Oklahoma City, OK 73104. Email: [email protected]
In humans, growth hormone deficiency (GHD) and low circulating levels of insulin-like growth factor 1 (IGF-1) significantly increase the risk for cerebrovascular disease. Genetic growth hormone (GH)/IGF-1 deficiency in Lewis dwarf rats
significantly increases the incidence of late-life strokes, similar to the effects of GHD in elderly humans. Peripubertal
treatment of Lewis dwarf rats with GH delays the occurrence of late-life stroke, which results in a significant extension
of life span. The present study was designed to characterize the vascular effects of life span-extending peripubertal GH
replacement in Lewis dwarf rats. Here, we report, based on measurements of dihydroethidium fluorescence, tissue isoprostane, GSH, and ascorbate content, that peripubertal GH/IGF-1 deficiency in Lewis dwarf rats increases vascular oxidative stress, which is prevented by GH replacement. Peripubertal GHD did not alter superoxide dismutase or catalase
activities in the aorta nor the expression of Cu-Zn-SOD, Mn-SOD, and catalase in the cerebral arteries of dwarf rats. In
contrast, cerebrovascular expression of glutathione peroxidase 1 was significantly decreased in dwarf vessels, and this
effect was reversed by GH treatment. Peripubertal GHD significantly decreases expression of the Nrf2 target genes
NQO1 and GCLC in the cerebral arteries, whereas it does not affect expression and activity of endothelial nitric oxide
synthase and vascular expression of IGF-1, IGF-binding proteins, and inflammatory markers (tumor necrosis factor alpha, interluekin-6, interluekin-1b, inducible nitric oxide synthase, intercellular adhesion molecule 1, and monocyte chemotactic protein-1). In conclusion, peripubertal GH/IGF-1 deficiency confers pro-oxidative cellular effects, which likely
promote an adverse functional and structural phenotype in the vasculature, and results in accelerated vascular impairments later in life.
Key Words: Oxidative stress—GH deficiency—GH replacement—Vasoprotection—IGF-1 deficiency.
Received May 17, 2010; Accepted July 19, 2010
Decision Editor: Rafael de Cabo, PhD
D
ISRUPTION of the insulin/insulin-like growth factor 1
(IGF-I) pathway increases life span in invertebrates.
However, effects of decreased growth hormone (GH)/IGF-I
signaling in mammals remain controversial. The cardiovascular system is an important target organ for GH and IGF-1,
and it is well documented that in human patients, growth
hormone deficiency (GHD) and low circulating levels of
IGF-1 significantly increase the risk for cardiovascular and
cerebrovascular diseases (1–6). Although there are mouse
models extant in which disruption of GH/IGF-1 signaling is
associated with lifespan extension (eg, Ames (7) and Snell
dwarf mice (8,9) and male mice heterozygous for the deletion of the IGF-1 receptor (10)), other rodent models with
compromised GH/IGF-1 signaling do not exhibit a longevity phenotype (eg, female mice heterozygous for the deletion of the IGF-1 receptor (10) and genetically GH/
IGF-1–deficient strain of Lewis rats (11)). The Lewis dwarf
rat is a useful model of human GHD as Lewis dwarf rats
have normal pituitary function except for a selective genetic
GH deficiency and they mimic many of the pathophysiological alterations present in human GHD patients (including
mild cognitive impairment (12)). Importantly, GH deficiency in Lewis rats significantly increases the incidence of
late-life strokes (11), similar to the effects of GHD in elderly humans. It is significant that short-term peripubertal
treatment of GH-deficient Lewis dwarf rats with GH decreases the incidence and delays the occurrence of late-life
stroke, which results in a significant (~14%) extension of
life span (11). These findings suggest that peripubertal levels of GH and IGF-I are important for developing an adequate tissue architecture, maintaining vascular health, and
delaying the development of age-related cardiovascular diseases. Although previous studies have established that GH/
IGF-1 deficiency in adult patients and laboratory animals
results in deleterious effects on vascular endothelial and
smooth muscle cells (13–16), there is little or no information available on vascular alterations either in childhood
GHD patients or animal models of peripubertal GHD.
1145
1146
UNGVARI ET AL.
The available data demonstrate that in adult patients and
laboratory animals, the GH/IGF-1 axis is an important regulator of vascular redox homeostasis (13,17,18), although
the specific mechanisms are not well understood. Previously, we demonstrated that in the vasculature of adult GH/
IGF-1–deficient Ames dwarf mice, antioxidant enzymes are
downregulated, which is associated with increased vascular
reactive oxygen species (ROS) levels and impaired endothelial function (13). The present study was designed to
characterize the effects of peripubertal GH/IGF-1 deficiency on vascular redox homeostasis, the abundance and
activity of antioxidant enzymes in the vascular wall, the local IGF-1 system, and the expression of inflammatory mediators in the cerebrovasculature, using Lewis dwarf rats as
a model system. Moreover, we also determined whether life
span-extending peripubertal GH replacement exerts vasoprotective effects in Lewis dwarf rats.
Methods
Animals
In the present study, we used male Lewis rats that are
heterozygous or homozygous for the spontaneous autosomal recessive dw-4 mutation, which causes a decrease in
GH secretion from the pituitary gland (19). Lewis dwarf
(dw-4/dw-4) rats have chronically low levels of GH and
IGF-1 and make an excellent animal model of childhoodonset GHD (19). These rats have a spontaneous mutation
that results in decreased GH secretion from the pituitary
beginning around postnatal Day 26 (9,19,20). Female heterozygous (dw-4/−) Lewis rats were bred with male homozygous Lewis dwarf rats (dw-4/dw-4) to generate
heterozygous (dw-4/−) offspring with a normal phenotype
(“control”, n = 6) or homozygous rats (dw-4/dw-4) with a
dwarf phenotype (“dwarf”). Classification as control or
dwarf was based on their body weight as well as the serum
IGF-1 levels at 33 days of age. Pubertal status was determined by age and the associated changes in growth and
IGF-1 levels. Beginning on Day 35, dwarf rats were divided into two experimental groups: (a) early-onset GHD
given saline (n = 6) and (b) GH replete with GH administered beginning at 5 weeks of age and continued throughout the experimental period of 30 days (termed “GH
replete,” n = 6). Saline or GH (300 mg recombinant porcine GH; Alpharma, Victoria, Australia) was injected subcutaneously twice daily. The heterozygous rats were used
as controls and given saline injections twice daily from 5
weeks of age to the end of the experimental period. Rats
had access to food and water ad libitum and were housed
in pairs in the barrier facility of the University of Oklahoma Health Sciences Center. Animals were fed standard
rodent chow (PicoLab Rodent Diet 20 from Purina Mills
[Richmond, IN], containing 20% protein by mass and 24%
protein by caloric content). All studies were approved by
the Institutional Animal Care and Use Committee.
Measurement of Serum IGF-1
Rats were anesthetized with isofluorane, and serum was
obtained via tail bleed. Total IGF-1 levels in serum were
determined as previously described (12,20–22).
Measurement of Vascular O2− Production
Production of O2− in the aortic wall was determined using dihydroethidium (DHE), an oxidative fluorescent dye,
as we previously reported (23,24). In brief, vessels were
incubated with DHE (3 × 10−6 mol/L; at 37°C for 30 minutes). The vessels were then washed three times, embedded
in optimal cutting temperature media, and cryosectioned.
Red fluorescent images were captured at 20× magnification and analyzed using the Metamorph imaging software
as reported (13). Four entire fields per vessel were analyzed with one image per field. The mean fluorescence intensities of DHE-stained nuclei in the endothelium and
medial layer were calculated for each vessel. Thereafter,
the intensity values for each animal in the group were
averaged.
8-Isoprostane Assay
Total tissue 8-isoprostane content was measured in aorta
homogenates using the 8-isoprostane EIA kit (Cayman
Chemical Company, Ann Arbor, MI) according to the manufacturer’s guidelines.
Determination of Endogenous Glutathione and Ascorbate
Using high-performance liquid chromatography
Electrochemical Detection
Concentrations of redox-active GSH and ascorbate were
measured in aorta homogenates using a Perkin-Elmer highperformance liquid chromatography equipped with an
eight-channel amperometric array detector as described
(25). In brief, 10 mg aliquots of tissue samples were washed
with ice-cold phosphate-buffered saline and homogenized
in 5% (w/v) metaphosphoric acid. Samples were centrifuged at 10,000g for 10 minutes to sediment protein, and
the supernatant fraction was stored for analysis of redoxsensitive compounds. Precipitated proteins were dissolved
in 0.1 N NaOH and stored for protein determination by a
spectrophotometric quantitation method using BCA reagent
(Pierce Chemical Co., Rockford, IL). Concentrations of
GSH and ascorbic acid in supernatant fractions were determined by injecting 5 mL aliquots onto an Ultrasphere 5 u,
4.6 × 250 mm, C18 column and eluting with mobile phase
of 50 mM NaH2PO4, 0.05 mM octane sulfonic acid, and
1.5% acetonitrile (pH 2.62) at a flow rate of 1 mL/min. The
detectors were set at 200, 350, 400, 450, 500, 550, 600,
and 700 mV, respectively. Peak areas were analyzed using
ESA, Inc. (Chelmsford, MA) software, and concentrations
of GSH and ascorbate are reported as nanomoles per
milligram protein.
1147
VASOPROTECTION BY GH/IGF-1
Table 1. Oligonucleotides for Real-Time Reverse Transcriptase–Polymerase Chain Reaction
mRNA Targets
SOD2
SOD1
Gpx-1
Catalase
eNOS
NQO1
GCLC
Sirt1
IGF-1
IGFR
IGFBP1
IGFBP2
IGFBP3
IGFBP4
TNFa
IL-6
IL-1b
iNOS
ICAM-1
MCP-1
Hmox1
HPRT
GAPDH
b-actin
Description
Mn-SOD
Cu,Zn-SOD
Glutathione peroxidase 1
Endothelial nitric oxide synthase
NAD(P)H:quinone oxidoreductase 1
Glutamate-cysteine ligase, catalytic subunit1
Sirtuin (silent mating type information regulation 2 homolog) 1
Insulin-like growth factor 1 (somatomedin C)
Insulin-like growth factor 1 receptor
Insulin-like growth factor–binding protein 1
Insulin-like growth factor–binding protein 2
Insulin-like growth factor–binding protein 3
Insulin-like growth factor–binding protein 4
Tumor necrosis factor alpha
Interleukin 6
Interleukin 1 beta
Inducible nitric oxide synthase
Intercellular adhesion molecule 1
Monocyte chemotactic protein-1
Heme oxygenase 1 (HO-1)
Hypoxanthine phosphoribosyltransferase 1
Glyceraldehyde-3-phosphate dehydrogenase
Beta actin (ACTB)
Sense
Antisense
AGGCAAACGGGTTTCTGAGTGAG
CTCAGGAGAGCATTCCATCATTG
TAGGTCCAGACGGTGTTC
GCCTCACCAGTAATCATCG
TTCCTGACAATCTTCTTC
TGGGATATGAATCAGGGAGAG
GCTTTCTCCTACCTGTTTCTTG
CGCCTTATCCTCTAGTTCCTGTG
CTTGTCAGGGAAAGGGTGTC
AATCACACCACAAGCCAAGC
GATACCAGGAATGCCTTAGG
ATCCAAACAGAAGTCCTAAGC
AGAGAGTTCTTAAATCGG
GAGAGGTAACTAATAGCAACAAG
TGGCAGAGTTCAGTTCCG
CGGTCTGTCAGCATCATCTTCC
GGTGGTTGATGAATGGTT
GTAACAATCTATTCACAAG
CTCCACATGCTGCTTGAT
TGTATTTATATTTGGAAAGAGA
GGAGAGAATCACCTGTTT
CAAGAGGTCTGAGTGTAG
AACCACCAAGCAGAGGAG
TACCCCAACTTCCAATGC
CAGCAATGGTCGGGAC
TCCCGAAACGCTACACT
CACAGCCTGGAGTCTC
GCATCAACCCTAAGGACTTCAG
GGCTGTGAACTCTGTCTC
AAGACAGCGGCAAGTTGAATC
CCAAGGAGTAAGAAACCC
GAAGTGTGACGTTGACAT
GCCTAGACGAGATTATTAGATT
CTATTAAGAGCTGTCATT
GAAGAGCTGAGATGGTAGTATT
TCTATTAGAAGCAGGAAC
GTTACATCACCTAGCATCT
TGTAGTATGTGGTCAATAGAT
CTTGATGGCGGAGAGGAG
GATACCCATCGACAGGAT
ATAGGTAAGTGGTTGCCT
CAATCCACAACTCGCT
CCCTTCTAAGTGGTTGGAA
GGCATCACATTCCAAATCACAC
GGCATCTCCTTCCATTCC
AAGGGACGCAGCAACAGAC
TTGATGGTATTCGAGAGAAGG
ACATCTGCTGGAAGGTG
Antioxidant Enzyme Activities
Activity of antioxidant enzymes and endothelial nitric
oxide synthase (eNOS) in aorta homogenates was measured
using the Glutathione Peroxidase Assay Kit (#703102),
Catalase Assay Kit (#707002), Superoxide Dismutase Assay Kit (#706002), and NOS Activity Assay Kit (#781001)
according to the manufacturer’s guidelines (Cayman Chemical
Company).
Quantitative Real-Time RT-PCR
A quantitative real-time reverse transcriptase–polymerase
chain reaction (RT-PCR) technique was used to analyze
messenger RNA (mRNA) expression of SOD1, SOD2,
glutathione peroxidase 1, catalase, Sirt1, eNOS, the Nrf2/
antioxidant response element target genes NQO1 and GCLC,
components of the local IGF-1 system (IGF-1, IGF-1R,
insulin-like growth factor–binding protein [IGFBP] 1,
IGF-BP2, IGFBP3, and IGFBP4), and inflammatory markers
(including tumor necrosis factor alpha, interluekin-6, interluekin-1b, inducible nitric oxide synthase, intercellular
adhesion molecule 1, and monocyte chemotactic protein-1)
in the middle cerebral arteries, as previously reported
(26–29). In brief, total RNA was isolated with a Mini RNA
Isolation Kit (Zymo Research, Orange, CA) and was reverse
transcribed using Superscript III RT (Invitrogen , Carlsbad,
CA) as described previously (26,30). A real-time RT-PCR
technique was used to analyze mRNA expression using a
Strategen MX3000, as reported (30). Amplification efficiencies were determined using a dilution series of a standard
vascular sample. Quantification was performed using the
efficiency-corrected DDCq method. The relative quantities
of the reference genes GAPDH, hypoxanthine phosphoribosyltransferase 1, and b-actin were determined, and a
normalization factor was calculated based on the geometric
mean for internal normalization. Oligonucleotides used
for quantitative real-time RT-PCR are listed in Table 1.
Fidelity of the PCR reaction was determined by melting
temperature analysis and visualization of the product on a
2% agarose gel.
Data Analysis
Gene expression data were normalized to the respective
control mean values. Statistical analyses of data were performed by Student’s t test or by two-way analysis of variance followed by the Tukey post hoc test, as appropriate.
p < .05 was considered statistically significant. Data are
Table 2. Changes in Body Mass and Serum IGF-1 Levels of
Homozygous Control Rats, GHD Dwarf Rats, and GH-Treated
Dwarf Rats
Serum IGF-1, Body Mass, After Treatment Before (ng/mL)
Treatment (g)
Control
GHD
GH replete
970 ± 96
464 ± 51*
849 ± 110
113 ± 8
84 ± 5*
86 ± 5*
Body Mass, After Treatment (g)
Gain in Body Mass (g)
274 ± 11
170 ± 7*
238 ± 11*
161 ± 8
86 ± 6*
152 ± 8
Notes: See Methods section for description of experimental groups. Serum
level of IGF-1 did not differ between the GHD and GH-replete groups (322 ± 69
and 325 ± 62 ng/mL, respectively) before GH treatment. Data are mean ± standard deviation.
*p < .05 vs respective controls. GH = growth hormone; GHD = growth
hormone deficiency; IGF-1 = insulin-like growth factor 1.
1148
UNGVARI ET AL.
Figure 1. Representative images showing red nuclear dihydroethidium (DHE) fluorescence, representing cellular O2− production, in sections of aortas of control rats
(Panel A), growth hormone–deficient (GHD) dwarf rats (Panel B), and growth hormone (GH)–treated dwarf rats (Panel C). For orientation purposes, overlay of DHE
signal and green autofluorescence of elastic laminae is also shown (right panels; lu: lumen, m: media, and ad: adventitia). Original magnification: 20×; scale bar: 100 mm.
Panel D: summary data for nuclear DHE fluorescence intensities. Data are mean ± standard error of the mean. *p < . 05 vs control, #p < .05 vs GHD. Panel E: total tissue
isoprostane content in the aortas of homozygous control rats, GHD rats, and GH-treated dwarf rats. Data are mean ± standard error of the mean (n = 5–6 in each group).
expressed as means ± standard error of the mean, unless
otherwise indicated.
Results
Serum IGF-1 Levels and Body Weight
IGF-1 levels were measured in serum obtained from
tail blood before and after the 30-day experimental period. Table 2 shows that at the end of the experimental
period, control and dwarf GH-replete rats had significantly higher serum IGF-1 levels compared with the untreated dwarf rats (p ≤ .05, each), indicating that twice
daily administration of GH to the dwarf rats normalized
serum IGF-1.
The control and GH-replete rats expressed the typical
phenotype of adequate GH levels, indicated by comparable
increases in body weight during the experimental period,
whereas untreated dwarf rats gained significantly less
weight than the control group (Table 2).
Vascular Oxidative Stress
Representative fluorescent images of cross sections of
DHE-stained aortas isolated from control, dwarf, and GHreplete rats are shown in Figure 1A–C. Analysis of nuclear
VASOPROTECTION BY GH/IGF-1
1149
Figure 2. High-performance liquid chromatography amperometric analysis of glutathione (GSH) content in homogenates of the aortas of control rats (Panel B),
growth hormone–deficient (GHD) dwarf rats (Panel C), and growth hormone (GH)–treated dwarf rats (Panel D). The peak elution times and patterns of oxidation of a
standard mixture of 10 nmol/mL cysteine (Peak 1), 10 nmol/mL ascorbate (Peak 2), and 10 nmo/L GSH (Peak 3) are shown in panel A. See Methods section for further
details on analytical conditions. Bar graphs represent summary data for GSH (Panel E) and ascorbate (Panel F) content in aortic segments of control, GHD, and GH-replete dwarf rats. Data are normalized to protein content and expressed as mean ± standard error of the mean. *p < . 05 vs control, #p < .05 vs GHD (n = 5–6 in each group).
DHE fluorescent intensities showed that, compared with vessels from control rats, O2− production was significantly
increased in aortas of dwarf rats (Figure 1D). Vascular
O2− generation was significantly reduced by GH treatment (Figure 1D). Vascular 8-isoprostane content also
tended to increase in dwarf rats, yet, the difference did
not reach statistical significance (Figure 1E). Consistent
with the presence of GHD-related oxidative stress, aortic
GSH content and ascorbate concentrations were significantly reduced in dwarf rats (Figure 2E and F). GH treatment normalized GSH content in the aorta of GH-replete
dwarf rats (Figure 2E).
and glutathione peroxidase enzyme activities as compared
with controls (Figure 3A–C).
Antioxidant Enzyme Activities
In dwarf rats and GH-replete animals, we did not detect
any significant changes in superoxide dismutase, catalase,
Vascular Expression of Nrf2 Targets
Cerebral arteries of dwarf rats exhibited a significantly
reduced expression of the known Nrf2 targets GCLC and
Vascular Expression of Antioxidant Enzymes
A quantitative real-time RT-PCR technique was used to
analyze mRNA expression of major antioxidant enzymes in
branches of the middle cerebral artery. We found that expression of Mn-SOD, Cu,Zn-SOD, and catalase (Figure
4A–C) did not differ among the three groups. By contrast,
expression of glutathione peroxidase 1 was significantly decreased in the cerebral arteries of dwarf rats and was significantly increased by GH treatment (Figure 4D)
1150
UNGVARI ET AL.
Vascular Expression of Components of the Local IGF-1
System
Expression of IGF-1 (Figure 7A) was similar in the middle cerebral arteries of control and dwarf rats, whereas expression of insulin-like growth factor 1 receptor was
significantly increased in vessels of dwarf rats (Figure 7B).
Expression of IGFBP1, IGFBP2, and IGFBP4 (Figure 7C,
D, and F) was unchanged in arteries of dwarf animals. Expression of IGFBP3 tended to be decreased in dwarf arteries
as compared with controls, yet the difference did not reach
statistical significance (Figure 7E).
Vascular Expression of Inflammatory Markers
We found that mRNA expression of the inflammatory
markers tumor necrosis factor alpha, interluekin-6, interluekin-1b, inducible nitric oxide synthase, Intercellular adhesion molecule 1, and monocyte chemotactic protein-1 in
the middle cerebral arteries was statistically not different
among the three groups (Figure 8).
Figure 3. Superoxide dismutase activity (Panel A), catalase activity (Panel
B), and glutathione peroxidase activity (Panel C) in homogenates of aortas from
control rats, growth hormone–deficient (GHD) dwarf rats and growth hormone
(GH)–treated dwarf rats. Data are mean ± standard error of the mean (n = 5–6
in each group).
NQO1 compared with vessels from control animals. These
changes were normalized by GH treatment (Figure 5A
and B). Expression of SIRT-1 in dwarf and GH-replete
animals showed similar pattern, SIRT1 being downregulated in arteries of dwarf rats and upregulated by GH repletion (Figure 5C).
Vascular eNOS Expression and Activity
Expression of eNOS mRNA in the middle cerebral arteries
(Figure 6A) and nitric oxide synthase activity in the aortas
(Figure 6B) were not statistically different among the three
groups.
Discussion
The levels of GH and IGF-1 vary substantially throughout the life span. Postnatal GH and IGF-1 levels are low but
increase to higher concentrations immediately before puberty and then progressively decline with increasing age
(31–33). Late-life changes in the endocrine milieu, including the age-related decline of GH/IGF-1 axis, have led to
the formulation of a number of neuroendocrine theories of
aging, which aim to explain peripheral aging on the basis
endocrine dysregulation (34). Recent findings provide key
evidence that changes in peripubertal GH and IGF-1 levels
can also modulate peripheral aging (11), especially in the
vascular system.
Deficits of GH in childhood can be due to a congenital
deficiency (incidence: 1 in every 3,800 live births) or acquired in childhood due to hypothalamic–pituitary tumors.
Previous studies focused on the deleterious effects of GHD
on systemic cardiovascular risk factors in adults but provided little information on vascular effects directly affected
by peripubertal GHD. Here, we demonstrate for the first
time that peripubertal GH/IGF-1 deficiency in Lewis dwarf
rats results in significant changes in vascular redox homeostasis. Measurements of DHE fluorescence (Figure 1A–D)
as well as measurements of tissue isoprostane (Figure 1E),
GSH, and ascorbate content (Figure 2) suggest that peripubertal GH/IGF-1 deficiency increases vascular oxidative
stress. Because rats can synthesize ascorbate, we interpret
the simultaneous decline in tissue ascorbate (35) and GSH
levels as a sign of GHD-induced oxidative stress rather than
a sign of dietary vitamin deficiency. Importantly, a relatively brief peripubertal exposure of Lewis dwarf rats to GH
prevented or attenuated most of the aforementioned prooxidative alterations (Figures 1and 2). These in vivo findings are in complete agreement with the observations that in
VASOPROTECTION BY GH/IGF-1
1151
Figure 4. Quantitative real-time -polymerase chain reaction data showing messenger RNA (mRNA) expression of Cu,Zn-SOD (A), Mn-SOD (B), catalase (C),
and glutathione peroxidase-1 (D) in branches of the middle cerebral arteries of control rats, growth hormone–deficient (GHD) dwarf rats, and growth hormone (GH)–
treated dwarf (GH-replete) rats. Data are mean ± standard error of the mean. *p < .05 vs control, #P < .05 vs GHD (n = 5–6 in each group).
vitro treatment with GH and/or IGF-1 also reduces ROS
production in cultured endothelial cells (13,36). It is significant that the same peripubertal treatment of young Lewis
dwarf rats with GH was previously reported to significantly
postpone the development of age-associated cerebrovascular disease and increase life span (11). Taken together, these
observations raise the possibility that levels of GH present
in the circulation during a brief transitional period starting
around puberty and ending in young adulthood are likely
to influence vascular pathology later in life (11) by modulating vascular redox homeostasis. We speculate that GHD-
induced increased oxidative stress during development likely
modulates the activity of various redox-sensitive pathways
(eg, mitogen activated protein kinases), which affect cerebromicrovascular architecture, the composition of extracellular matrix, and/or elicit epigenetic changes in vascular
endothelial and smooth muscle cells, which will promote
the development of cerebrovascular pathologies later in
life. Importantly, if GHD persists in adulthood, it will
likely exert a progressive deleterious effect on the vasculature (13,37–39). The clinical emphasis on treating childhood-onset GHD currently focuses on the somatic role of
GH in increasing body size (mainly height) during puberty
(40,41). Continued GH treatment during the important
transition period between adolescence and adulthood is
important for the normal development of bone and muscle
in adulthood (20–30 years old) (40,41). In light of the
aforementioned findings, it would be interesting to determine in follow-up studies how peripubertal GH replace-
ment affects late-life cardiovascular morbidity and
mortality in humans.
The underlying mechanisms for elevated ROS production
in the cardiovascular system of GH/IGF-1–deficient rats are
likely multifaceted. Previous studies suggest that GH/IGF-1
deficiency is associated with downregulation of vascular expression of major cellular antioxidant enzymes in adult
Ames dwarf mice (13). In the present study, peripubertal
GH/IGF-1 deficiency did not alter superoxide dismutase or
catalase activities in the aorta nor the expression of Cu,ZnSOD, Mn-SOD, and catalase in the cerebral arteries of
dwarf rats. In contrast, cerebrovascular expression of glutathione peroxidase 1 was significantly decreased in dwarf
vessels, and this effect was reversed by GH treatment. Glutathione peroxidase activity also tended to decrease in aortas of dwarf rats, but the difference did not reach statistical
significance. The hitherto hypothetical concept, named mitochondrial hormesis, suggests that low levels of oxidative
stress may have beneficial effects on the aging process by
upregulating antioxidants. It is significant that in the vasculature free radical detoxification pathways driven by the
transcription factor NF-E2-related factor 2 (Nrf2) play an
important role in maintaining cellular redox homeostasis
under conditions of oxidative stress (42). Nrf2 triggers expression of genes, including NAD(P)H:quinone oxidoreductase 1 (NQO1, a key component of the plasma membrane
redox system and g-glutamylcysteine ligase [GCLC]), via
the antioxidant response element, which attenuate cellular
oxidative stress. The second interesting finding of the present
1152
UNGVARI ET AL.
Figure 6. Quantitative real-time reverse transcriptase–polymerase chain reaction data (Panel A) showing messenger RNA (mRNA) expression of endothelial nitric oxide synthase (eNOS) in branches of the middle cerebral arteries of
control rats, growth hormone–deficient (GHD) dwarf rats, and growth hormone
(GH)–treated dwarf (GH-replete) rats. Panel B depicts nitric oxide synthase activity in homogenates of aortas isolated from control, GHD, and GH-treated
dwarf rats. Data are mean ± standard error of the mean. (n = 5–6 in each group)
Figure 5. Quantitative real-time reverse transcriptase–polymerase chain reaction data showing messenger RNA (mRNA) expression of GCLC (A), NQO1
(B), and SIRT1 (C) in branches of the middle cerebral arteries of control rats,
growth hormone–deficient (GHD) dwarf rats, and growth hormone (GH)–
treated dwarf (GH-replete) rats. Data are mean ± standard error of the mean.
*p < .05 vs control, #p < .05 vs GHD (n = 5–6 in each group).
study is that peripubertal GH/IGF-1 deficiency significantly
decreases expression of both of these Nrf2 target genes in
the cerebral arteries, showing that adaptive induction of antioxidant enzymes in dysfunctional in Lewis dwarf rats. Because the plasma membrane redox system is responsible for
the maintenance of the redox status of ascorbate, we posit
that downregulation of NQO1 may contribute to GHD-induced decreases in ascorbate levels in the vascular wall of
dwarf rats (Figure 2F). Because GCLC is the rate-limiting
enzyme for GSH synthesis, it is likely that this downregulation contributes to the decline of vascular GSH content in
these animals.
Recent studies demonstrate a cross talk between IGF-1
signaling and the prosurvival factor SIRT1 (43,44), both of
which regulate cellular redox status, including mitochondrial ROS production in endothelial cells (45). The finding
that in dwarf rats, vascular expression of SIRT1 is downregulated, whereas it is induced in GH-replete animals raises
the possibility that this pathway also may contribute to the
pro-oxidative effects of peripubertal GHD. Previously, we
found that mitochondrial ROS generation is increased in
arteries of Ames dwarf mice (13); thus, future studies are
warranted to determine whether downregulation of SIRT1 is
associated with an increased mitochondrial oxidative stress
in blood vessels of rats with peripubertal GHD. eNOS is an
important downstream target of both SIRT1 (46) and IGF-1
(13) that confers multifaceted vasoprotective effects. Importantly, low IGF-1 levels were shown to be associated with
downregulation of eNOS both in the vasculature of adult
Ames dwarf mice (13) and arteries of aged rats (26). The
findings that cerebrovascular expression of eNOS and nitric
oxide synthase activity in the aortas are unaffected by peripubertal GH/IGF-1 deficiency in dwarf rats give support to
the view that young organisms have greater ability to adapt
to changes in the endocrine milieu than older animals.
In addition to its endocrine function, IGF-1 also exerts its
biologic effects via autocrine/paracrine pathways, and recent studies suggest that circulating IGF-1 levels and tissue
expression of components of the local IGF-1 system are not
VASOPROTECTION BY GH/IGF-1
1153
Figure 7. Quantitative real-time reverse transcriptase–polymerase chain reaction data showing messenger RNA (mRNA) expression of insulin-like growth factor
1 (IGF-1; A), insulin-like growth factor1 receptor (IGFR; B), insulin-like growth factor–binding protein (IGFBP) 1 (C), IGFBP2 (D), IGFBP3 (E), and IGFBP4 (F)
in branches of the middle cerebral arteries of control rats and growth hormone–deficient (GHD) dwarf rats. Data are mean ± standard error of the mean. *p < .05 vs
control (n = 5–6 in each group).
always correlated (47–49). We found that peripubertal GH/
IGF-1 deficiency did not affect the expression of IGF-1 in
the middle cerebral arteries but upregulated insulin-like
growth factor 1 receptor, which likely represents an adaptive mechanism resulting from IGF-1 deficiency. Expression of IGFBP1, IGFBP2, and IGFBP4 did not change
in the wall of dwarf arteries. As expected, cerebrovascular
expression of IGFBP3 tended to decrease in the dwarf rats
because this is regulated by circulating GH levels. In that
regard, it is significant that in humans, there is a close correlation between peripubertal serum levels of IGF-1 and
IGFBP3 (31) and that GH deficiency in childhood is characterized by decreased levels of IGFBP3 (50).
Recent studies suggest that IGF-1 confers anti-inflammatory vascular effects (17) and that short-term GH treatment
attenuates age-related inflammation, including upregulation
of tumor necrosis factor alpha, in the cardiovascular system
of senescence-accelerated mice (51). Human GH/IGF-1–
deficient dwarfs at adulthood are known to develop premature
atherosclerosis in the cerebral arteries. Importantly, in Lewis
dwarf rats, peripubertal GH replacement, sufficient to raise
IGF-1 levels to that of normal animals during adolescence,
significantly delays cerebrovascular alterations associated
with old age and increases life span (11). To determine
whether peripubertal GH/IGF-1 deficiency promotes vascular
inflammation during adolescence, we assessed the expression of various inflammatory markers in the middle cerebral
arteries of Lewis dwarf rats. We found that expression of
proinflammatory cytokines, chemokines, and adhesion
molecules was unaffected either by peripubertal GH/IGF-1
deficiency or GH treatment (Figure 8). These data provide
additional support for the view that young organisms have
greater ability to adapt to changes in circulating GH/IGF-1
than older animals.
In conclusion, peripubertal GH/IGF-1 deficiency results in
a pro-oxidative cellular environment, which likely promotes
1154
UNGVARI ET AL.
Figure 8. Quantitative real-time reverse transcriptase–polymerase chain reaction data showing messenger RNA (mRNA) expression of tumor necrosis factor alpha (TNFa; A), interleukin (IL)-1b (B), IL-6 (C), monocyte chemotactic protein (MCP)-1 (D), intercellular adhesion molecule (ICAM)-1 (E), and inducible nitric
oxide synthase (iNOS; F) in branches of the middle cerebral arteries of control rats, growth hormone (GH)-replete, and growth hormone–deficient (GHD) dwarf rats.
Data are mean ± standard error of the mean (n = 5–6 in each group).
an adverse functional and structural phenotype in the vasculature that contributes to the development of stroke later in
life. Peripubertal GH treatment of Lewis dwarf rats prevents
these adverse vascular effects during a critical developmental time window, which contributes to the delay of stroke
thereby extending the life span of these animals. Additional
studies are warranted to further characterize the effects of
peripubertal GH treatment on age-related structural and
functional cerebrovascular alteration in Lewis rats. On the
basis of the available data, we predict that beneficial effects
of peripubertal normalization of GH and IGF-1 levels continue regardless of the presence or absence of these hormones during adulthood.
Funding
This work was supported by grants from the National Institutes of
Health (HL-077256 and P01 AG11370), the American Diabetes Associa-
tion (to Z.U.), and the American Federation for Aging Research (to A.C.).
The authors express their gratitude for the support of the Donald W. Reynolds Foundation, which funds aging research at the University of Oklahoma Health Sciences Center under its Aging and Quality of Life Program.
References
1. Rosen T, Bengtsson BA. Premature mortality due to cardiovascular
disease in hypopituitarism. Lancet. 1990;336(8710):285–288.
2. Bates AS, Van’t Hoff W, Jones PJ, Clayton RN. The effect of hypopituitarism on life expectancy. J Clin Endocrinol Metab. 1996;81(3):1169–1172.
3. Bulow B, Hagmar L, Mikoczy Z, Nordstrom CH, Erfurth EM.
Increased cerebrovascular mortality in patients with hypopituitarism.
Clin Endocrinol (Oxf). 1997;46(1):75–81.
4. Tomlinson JW, Holden N, Hills RK, et al. Association between premature mortality and hypopituitarism. West Midlands Prospective Hypopituitary Study Group. Lancet. 2001;357(9254):425–431.
5. Vasan RS, Sullivan LM, D’Agostino RB, et al. Serum insulin-like
growth factor I and risk for heart failure in elderly individuals without
a previous myocardial infarction: the Framingham Heart Study. Ann
Intern Med. 2003;139(8):642–648.
VASOPROTECTION BY GH/IGF-1
6. Laughlin GA, Barrett-Connor E, Criqui MH, Kritz-Silverstein D. The
prospective association of serum insulin-like growth factor I (IGF-I)
and IGF-binding protein-1 levels with all cause and cardiovascular
disease mortality in older adults: the Rancho Bernardo Study. J Clin
Endocrinol Metab. 2004;89(1):114–120.
7. Brown-Borg HM, Borg KE, Meliska CJ, Bartke A. Dwarf mice and
the ageing process. Nature. 1996;384(6604):33.
8. Flurkey K, Papaconstantinou J, Miller RA, Harrison DE. Lifespan
extension and delayed immune and collagen aging in mutant mice
with defects in growth hormone production. Proc Natl Acad Sci U S A.
2001;98(12):6736–6741.
9. Carter CS, Ramsey MM, Sonntag WE. A critical analysis of the role of
growth hormone and IGF-1 in aging and lifespan. Trends Genet.
2002;18(6):295–301.
10. Holzenberger M, Dupont J, Ducos B, et al. IGF-1 receptor regulates
lifespan and resistance to oxidative stress in mice. Nature. 2003;
421(6919):182–187.
11. Sonntag WE, Carter CS, Ikeno Y, et al. Adult-onset growth hormone
and insulin-like growth factor I deficiency reduces neoplastic disease,
modifies age-related pathology, and increases life span. Endocrinology. 2005;146(7):2920–2932.
12. Nieves-Martinez E, Sonntag WE, Wilson A, et al. Early-onset GH
deficiency results in spatial memory impairment in mid-life and
is prevented by GH supplementation. J Endocrinol. 2010;204(1):
31–36.
13. Csiszar A, Labinskyy N, Perez V, et al. Endothelial function and
vascular oxidative stress in long-lived GH/IGF-deficient Ames
dwarf mice. Am J Physiol Heart Circ Physiol. 2008;295(5):
H1882–H1894.
14. Smith JC, Evans LM, Wilkinson I, et al. Effects of GH replacement on
endothelial function and large-artery stiffness in GH-deficient adults:
a randomized, double-blind, placebo-controlled study. Clin Endocrinol (Oxf). 2002;56(4):493–501.
15. Evans LM, Davies JS, Goodfellow J, Rees JA, Scanlon MF.
Endothelial dysfunction in hypopituitary adults with growth hormone
deficiency. Clin Endocrinol (Oxf). 1999;50(4):457–464.
16. Evans LM, Davies JS, Anderson RA, et al. The effect of GH replacement therapy on endothelial function and oxidative stress in
adult growth hormone deficiency. Eur J Endocrinol. 2000;142(3):
254–262.
17. Sukhanov S, Higashi Y, Shai SY, et al. IGF-1 reduces inflammatory
responses, suppresses oxidative stress, and decreases atherosclerosis
progression in ApoE-deficient mice. Arterioscler Thromb Vasc Biol.
2007;27(12):2684–2690.
18. Titterington JS, Sukhanov S, Higashi Y, Vaughn C, Bowers C,
Delafontaine P. Growth hormone-releasing peptide-2 suppresses
vascular oxidative stress in ApoE-/- mice but does not reduce atherosclerosis. Endocrinology. 2009;150(12):5478–5487.
19. Charlton HM, Clark RG, Robinson IC, et al. Growth hormone-
deficient dwarfism in the rat: a new mutation. J Endocrinol.
1988;119(1):51–58.
20. Carter CS, Ramsey MM, Ingram RL, et al. Models of growth hormone
and IGF-1 deficiency: applications to studies of aging processes
and life-span determination. J Gerontol A Biol Sci. 2002;57(5):
B177–B188.
21. Hua K, Forbes ME, Lichtenwalner RJ, Sonntag WE, Riddle DR. Adultonset deficiency in growth hormone and insulin-like growth factor-I
alters oligodendrocyte turnover in the corpus callosum. Glia. 2009;
57(10):1062–1071.
22. Ramsey MM, Ingram RL, Cashion AB, et al. Growth hormone-
deficient dwarf animals are resistant to dimethylbenzanthracine
(DMBA)-induced mammary carcinogenesis. Endocrinology. 2002;
143(10):4139–4142.
23. Csiszar A, Labinskyy N, Orosz Z, Xiangmin Z, Buffenstein R, Ungvari Z. Vascular aging in the longest-living rodent, the naked mole
rat. Am J Physiol. 2007;293(2):H919–H927.
1155
24. Ungvari Z, Csiszar A, Huang A, Kaminski PM, Wolin MS, Koller A.
High pressure induces superoxide production in isolated arteries via
protein kinase C-dependent activation of NAD(P)H oxidase. Circulation. 2003;108(10):1253–1258.
25. Csiszar A, Labinskyy N, Jimenez R, et al. Anti-oxidative and anti-inflammatory vasoprotective effects of caloric restriction in aging: role of
circulating factors and SIRT1. Mech Ageing Dev. 2009;130(8):518–527.
26. Csiszar A, Ungvari Z, Edwards JG, et al. Aging-induced phenotypic
changes and oxidative stress impair coronary arteriolar function. Circ
Res. 2002;90(11):1159–1166.
27. Csiszar A, Labinskyy N, Smith K, Rivera A, Orosz Z, Ungvari Z.
Vasculoprotective effects of anti-TNFalpha treatment in aging. Am
J Pathol. 2007;170(1):388–698.
28. Ungvari ZI, Labinskyy N, Gupte SA, Chander PN, Edwards JG,
Csiszar A. Dysregulation of mitochondrial biogenesis in vascular endothelial and smooth muscle cells of aged rats. Am J Physiol Heart
Circ Physiol. 2008;294(5):H2121–H2128.
29. Ungvari ZI, Orosz Z, Labinskyy N, et al. Increased mitochondrial
H2O2 production promotes endothelial NF-kB activation in aged rat
arteries. Am J Physiol Heart Circ Physiol. 2007;293(1):H37–H47.
30. Csiszar A, Smith K, Labinskyy N, Orosz Z, Rivera A, Ungvari Z.
Resveratrol attenuates TNF-{alpha}-induced activation of coronary
arterial endothelial cells: role of NF-{kappa}B inhibition. Am
J Physiol. 2006;291(4):H1694–H1699.
31. Argente J, Barrios V, Pozo J, et al. Normative data for insulin-like
growth factors (IGFs), IGF-binding proteins, and growth hormonebinding protein in a healthy Spanish pediatric population: age- and
sex-related changes. J Clin Endocrinol Metab. 1993;77(6):1522–1528.
32. Groban L, Pailes NA, Bennett CD, et al. Growth hormone replacement
attenuates diastolic dysfunction and cardiac angiotensin II expression
in senescent rats. J Gerontol A Biol Sci Med Sci. 2006;61(1):28–35.
33. Sonntag WE, Lynch CD, Cooney PT, Hutchins PM. Decreases in cerebral microvasculature with age are associated with the decline in
growth hormone and insulin-like growth factor 1. Endocrinology.
1997;138(8):3515–3520.
34. Everitt AV. The neuroendocrine system and aging. Gerontology.
1980;26(2):108–119.
35. van der Loo B, Bachschmid M, Spitzer V, Brey L, Ullrich V, Luscher TF.
Decreased plasma and tissue levels of vitamin C in a rat model of
aging: implications for antioxidative defense. Biochem Biophys Res
Commun. 2003;303(2):483–487.
36. Thum T, Tsikas D, Frolich JC, Borlak J. Growth hormone induces
eNOS expression and nitric oxide release in a cultured human endothelial cell line. FEBS Lett. 2003;555(3):567–571.
37. Colao A, Di Somma C, Salerno M, Spinelli L, Orio F, Lombardi G.
The cardiovascular risk of GH-deficient adolescents. J Clin Endocrinol
Metab. 2002;87(8):3650–3655.
38. Lanes R, Gunczler P, Lopez E, Esaa S, Villaroel O, Revel-Chion R.
Cardiac mass and function, carotid artery intima-media thickness, and
lipoprotein levels in growth hormone-deficient adolescents. J Clin
Endocrinol Metab. 2001;86(3):1061–1065.
39. Colao A, Di Somma C, Rota F, et al. Common carotid intima-media
thickness in growth hormone (GH)-deficient adolescents: a prospective study after GH withdrawal and restarting GH replacement. J Clin
Endocrinol Metab. 2005;90(5):2659–2665.
40. Clayton P, Gleeson H, Monson J, Popovic V, Shalet SM, Christiansen JS.
Growth hormone replacement throughout life: insights into age-related
responses to treatment. Growth Horm IGF Res. 2007;17(5):369–382.
41. Nilsson AG, Svensson J, Johannsson G. Management of growth hormone
deficiency in adults. Growth Horm IGF Res. 2007;17(6):441–462.
42. Ungvari Z, Bagi Z, Feher A, et al. Resveratrol confers endothelial
protection via activation of the antioxidant transcription factor Nrf2.
Am J Physiol Heart Circ Physiol. 2010;299(1):H18–H24.
43. Lemieux ME, Yang X, Jardine K, et al. The Sirt1 deacetylase modulates the insulin-like growth factor signaling pathway in mammals.
Mech Ageing Dev. 2005;126(10):1097–1105.
1156
UNGVARI ET AL.
44. Vinciguerra M, Santini MP, Claycomb WC, Ladurner AG,
Rosenthal N. Local IGF1 isoform protects cardiomyocytes from hypertrophic and oxidative stresses via SirT1 activity. Aging. 2010;
2(1):43–62.
45. Ungvari Z, Labinskyy N, Mukhopadhyay P, et al. Resveratrol attenuates mitochondrial oxidative stress in coronary arterial endothelial
cells. Am J Physiol Heart Circ Physiol. 2009;297(5):H1876–H1881.
46. Csiszar A, Labinskyy N, Pinto JT, et al. Resveratrol induces mitochondrial biogenesis in endothelial cells. Am J Physiol Heart Circ Physiol.
2009;297(1):H13–H20.
47. Sun LY, Al-Regaiey K, Masternak MM, Wang J, Bartke A. Local expression of GH and IGF-1 in the hippocampus of GH-deficient longlived mice. Neurobiol Aging. 2005;26(6):929–937.
48. Conover CA, Bale LK. Loss of pregnancy-associated plasma
protein A extends lifespan in mice. Aging Cell. 2007;6(5):727–729.
49. Masternak MM, Al-Regaiey KA, Del Rosario Lim MM, et al. Caloric
restriction and growth hormone receptor knockout: effects on expression of genes involved in insulin action in the heart. Exp Gerontol.
2006;41(4):417–429.
50. Maghnie M, Strigazzi C, Tinelli C, et al. Growth hormone (GH) deficiency (GHD) of childhood onset: reassessment of GH status and
evaluation of the predictive criteria for permanent GHD in young
adults. J Clin Endocrinol Metab. 1999;84(4):1324–1328.
51. Forman K, Vara E, Garcia C, Ariznavarreta C, Escames G, Tresguerres
JA. Cardiological aging in SAM model: effect of chronic treatment
with growth hormone. Biogerontology. 2009;11(3):275–286.