PROTEINS THAT MEDIATE COORDINATION OF THE CELL CORTEX AND THE
MEIOTIC SPINDLE IN MAMMALIAN OOCYTES: INSIGHTS INTO CELLULAR
FACTORS AFFECTING SUCCESSFUL REPRODUCTION
By
Lauren Ashley McGinnis
A dissertation submitted to Johns Hopkins University in conformity with
the requirements for the degree of Doctor of Philosophy
Baltimore, Maryland
April, 2016
© 2016 Lauren McGinnis
All Rights Reserved
ABSTRACT
Progression through female meiosis is characterized by two asymmetric
divisions, resulting in an unequal distribution of the cytoplasm between the egg and polar
body. The position of the spindle dictates the site of cytokinesis, thus it is important that
there is accurate coordination between the meiotic spindle and cell cortex. In this
dissertation, we examined myosin-II and novel candidate proteins, IQ-motif containing
GTPase activating protein 3 (IQGAP3) and nexilin, with the goal to understand some of
the molecular basis of the coordination between the spindle and cortex. The metaphase
I spindle fails to be positioned near the cortex in IQGAP3- and nexilin-deficient mouse
oocytes, and a subset of nexilin-deficient oocytes fail to form a spindle. Proteins
implicated in spindle positioning, such as actin and myosin-II, are mislocalized in
IQGAP3- and nexilin-deficient oocytes. We found that IQGAP3 mediates the localization
of mitogen-activated protein kinases 3 and 1 (MAPK3/1) to the spindle, another protein
required for spindle positioning.
Mammalian oocytes with inhibited Rho-kinase (ROCK) activity have reduced
pCofilin and a spindle that fails to migrate to the cortex. While ROCK localization is
unaffected in nexilin-deficient oocytes, levels of the downstream effectors of ROCK,
phosphorylated LIM kinase 1 and 2 (pLIMK1/2), are reduced. pCofilin, the substrate of
pLIMK1/2, is also reduced in nexilin-deficient oocytes. This suggests that nexilin
functions to enable an interaction between ROCK and LIMK1/2. Taken together, these
studies show that IQGAP3 and nexilin are required for progression to metaphase II
arrest.
At metaphase II, MAPK3/1 is required for anchoring the metaphase II spindle and
maintenance of metaphase II arrest. Our work shows that myosin light chain kinase
(MLCK) acts downstream of MAPK3/1 and functions in a similar manner as MAPK3/1.
The spindle drifts away from the cortex in eggs with inhibited MAPK3/1 or MLCK activity,
ii
likely a result of the reduced cortical tension in the spindle-sequestering domain of the
egg. Additionally, eggs with inhibited MAPK3/1 or MLCK activity undergo calciumdependent parthenogenetic activation, which is rescued by increasing the intracellular
zinc concentration. This research presents evidence that MAPK3/1 and MLCK activity
are linked with the regulation of ion homeostasis.
Thesis readers:
Janice Evans, Ph.D. – Advisor
Steven An, Ph.D.
Philip Jordan, Ph.D.
Douglas Robinson, Ph.D.
iii
ACKNOWLEDGEMENTS
First and foremost, I would like to thank my adviser, Dr. Janice Evans, for
allowing me to complete my thesis research in her lab. Her passion for reproductive
biology is inspiring, and I feel confident transitioning into the assisted reproductive
technology field with the repertoire of skills she has instilled in me. I thank all of the past
and current members of the Evans lab for their camaraderie and support.
I thank my thesis committee members, Dr. Pierre Coulombe, Dr. Philip Jordan,
Dr. Steven An, and Dr. Douglas Robinson, for their valuable advice pertaining to my
thesis project and career. I have appreciated the time they have taken to help me reach
this monumental point in my academic career. I thank Dr. Valeria Culotta and Dr. Gary
Ketner for their participation in my thesis proposal exam and preliminary oral
examination.
I greatly appreciate the assistance provided by several labs within the
department. Members of the Jordan lab, Coulombe lab, Matunis lab, Wang lab, and
Leung lab have all been very helpful with regard to reagents, use of equipment, or
advice in experiment design. I thank Shannon Gaston and Sharon Warner for their
assistance with academic affairs, as well as the rest of the BMB staff all that they do for
the students of BMB.
I am blessed to have a fantastic support system of family and friends that are so
encouraging. I am forever grateful to my mother and father for their love, providing me
the means to achieve my dreams, and being my cheerleaders for the past 29 years.
Finally, I thank my husband and best friend, Chris, for his endless love and daily support.
iv
TABLE OF CONTENTS
Page
Abstractii
Acknowledgements...iv
List of Tables.vii
List of Figures..viii
Chapter 1: Literature review.1
I. Overview of mammalian female meiosis...1
II. Temporal regulation of female meiosis.2
III. Spatial regulation of the oocyte cortex during meiosis..9
IV. Spatial regulation of the meiotic spindle...20
V. Summary and introduction to thesis research..25
Chapter 2: MAPK3/1 (ERK1/2) and Myosin Light Chain Kinase in mammalian eggs
affect myosin-II function and regulate the metaphase II state in a calcium- and zincdependent manner
I. Abstract.64
II. Introduction.....65
III. Materials and Methods....68
IV. Results...79
V. Discussion..88
VI. References........93
VII. Figures105
Chapter 3: IQGAP3 mediates metaphase I spindle positioning in mammalian oocytes by
regulating the localization of MAPK3/1 to the spindle
I. Abstract..131
II. Introduction..132
v
III. Materials and Methods..136
IV. Results.147
V. Discussion157
VI. References......165
VII. Figures175
Chapter 4: The actin-binding protein nexilin mediates metaphase I spindle organization
and positioning in mammalian oocytes and affects the phosphorylation of LIMK1/2
I. Abstract......195
II. Introduction...196
III. Materials and Methods..198
IV. Results.212
V. Discussion222
VI. References .227
VII. Figures235
Chapter 5: Discussion..250
Curriculum Vitae277
vi
LIST OF TABLES
Number
Table 4.1
Page
Primer sequences for cloning human cofilin S3E
into pIVT vector234
vii
LIST OF FIGURES
Number
Page
Figure 1.1
Overview of meiotic maturation and egg activation........56
Figure 1.2
Maintenance of metaphase II arrest and regulation of exit from
metaphase II arrest..........58
Figure 1.3
Pathways of interest to thesis research.....60
Figure 1.4
Actin networks that mediate spindle positioning in mouse oocytes......62
Figure 2.1
MAPK3/1 and MLCK inhibition reduces levels of active, phosphorylated
myosin regulatory light chain, affects localization of phosphorylated
myosin regulatory light chain and decreases cortical tension in
metaphase II eggs......105
Figure 2.2
MLCK inhibition does not effect MAPK levels, and MAPK3/1 and MLCK
inhibition reduce pMRLC immunofluorescence .108
Figure 2.3
Spindle localization in U0126-treated and ML-7-treated metaphase II
eggs...110
Figure 2.4
Effects of U0126 or ML-7 treatment in metaphase II eggs...112
Figure 2.5
Calcium dependence of U0126-induced and ML-7-induced
parthenogenetic exit from metaphase II arrest ..114
Figure 2.6
U0126-induced and ML-7-induced parthenogenetic exit from
metaphase II arrest (1.5h).117
Figure 2.7
U0126-induced and ML-7-induced parthenogenetic exit from
metaphase II arrest (8 h)...119
Figure 2.8
Analysis of M-phase phospho-protein levels detected by MPM-2
staining..121
viii
Figure 2.9
Effects of U0126 or ML-7 treatment, ± zinc ionophore, on actin and
pMRLC .124
Figure 2.10
Effects of zinc ionophore treatment on U0126-induced and
ML-7-induced parthenogenetic exit from metaphase II arrest.126
Figure 2.11
Post-ovulatory aged eggs have reduced pMRLC, but similar MRLC,
compared to young eggs, and the extent of spontaneous
parthenogenetic activation is rescued by treatment with a zinc
ionophore.129
Figure 3.1
IQGAP3 localization through meiotic maturation in wild-type
oocytes, and assessment of IQGAP3 knockdown following
siRNA injection...175
Figure 3.2
Phenotypes observed in IQGAP3-deficient oocytes at
eight- or 16 h following exit from prophase I arrest177
Figure 3.3
Localizations of anillin and pMRLC in IQGAP3-deficient oocytes...180
Figure 3.4
MAPK3/1 localization in IQGAP3-deficient metaphase I
oocytes, and IQGAP3 localization in U0126- or ML-7-treated
metaphase I oocytes..182
Figure 3.5
IQGAP3 localization in U0126- or ML-7-treated metaphase II eggs..184
Figure 3.6
Anillin localization in U0126-treated or ML-7-treated metaphase I
oocytes and metaphase II eggs..............186
Figure 3.7
Assessment of anillin mRNA and protein knockdown
in oocytes injected with Anln-targeting siRNA189
Figure 3.8
Illustration of key findings of IQGAP3 in mouse oocytes..191
Figure 3.9
Propose model of IQGAP3 function in mouse oocytes.193
ix
Figure 4.1
Nexilin localization throughout meiotic maturation in wild-type
oocytes and assessment of nexilin following siRNA-mediated
knockdown235
Figure 4.2
Phenotypes observed in nexilin-deficient oocytes at eight- or 16 h
following exit from prophase I arrest237
Figure 4.3
ROCK appears unaffected, but pLIMK1/2 is reduced in nexilin-deficient
oocytes at 8 h following exit from prophase I arrest..240
Figure 4.4
Nexilin-deficient oocytes have less pCofilin at 8 h following
exit from prophase I arrest....242
Figure 4.5
Injection of cRNA encoding human cofilin-S3E disrupts spindle
translocation to the cortex in control oocytes.244
Figure 4.6
Localizations of γ-tubulin, anillin, and phosphorylated myosin
regulatory light chain (pMRLC) in nexilin-deficient oocytes.....246
Figure 4.7
PAK4 localization is unaffected in nexilin-deficient oocytes, and PAK
inhibition does not affect nexilin-localization...248
x
CHAPTER 1
Literature Review
I. OVERVIEW OF MAMMALIAN FEMALE MEIOSIS
Female meiosis is a distinctive process compared to mitosis, due to aspects of its
temporal and spatial regulation. An overview of mammalian female meiosis is provided
in Figure 1.1. The temporal regulation of female meiosis is unique in that there are two
extended meiotic arrests at prophase I and at metaphase II, as well as prolonged
progression through pro-metaphase and metaphase I. The progression of the
mammalian oocyte through meiosis is accompanied by organization and orientation of
the meiotic spindle, which is coordinated with remodeling of the cortex. The spatial
regulation of female meiosis requires accurate coordination between the microtubulebased spindle and the actin-rich cortex, helping to ensure that the oocyte undergoes two
asymmetric cell divisions. In meiosis I, there are two actin-based networks within the
oocyte that ensure the metaphase I spindle becomes positioned adjacent to the cortex.
The two asymmetric divisions are important because the chromosomes must be
segregated evenly between the large egg and small polar body, whereas the other
cellular contents must be distributed so that the egg cytoplasm retains the materials that
were stockpiled during oogenesis to support early embryogenesis (Brunet and Maro,
2005).
The oocyte is arrested at the diplotene stage of prophase I, and this arrest can
last from days to years depending on the species (Mehlmann et al., 2005; Eppig et al.,
2004; Tripathi and Kumar, 2010; Holt et al., 2013). An oocyte arrested at prophase I is
characterized by the presence of an intact germinal vesicle (GV), and oocytes at this
stage are also referred to as a germinal-vesicle intact (GVI) oocyte. Following the
appropriate gonadotropin signals, the GV undergoes germinal vesicle breakdown
1
(GVBD), and a meiotic spindle forms around the chromosomes in the center of the
oocyte. The assembled spindle translocates to the cortex across a network of actin
microfilaments with the assistance of the cytoskeletal-associated protein myosin-II prior
to the first asymmetric division (Schuh and Ellenberg, 2008; Li et al., 2008). Following
first polar body emission, the spindle orients itself parallel to the cortex, an actin-rich cap
forms at the region of the cortex overlying the spindle, and the egg arrests at metaphase
II. The transition from prophase I to metaphase II is called meiotic maturation (Conti et
al., 2012)(Figure 1.1). Fertilization triggers the egg to exit M-phase, spindle rotation, and
the emission of a second polar body resulting in the haploid female gamete (Maro and
Verlhac, 2002; Maro et al., 1984). The events from metaphase II egg to zygote are
referred to as egg activation (Nader et al., 2013)(Figure 1.1).
II. TEMPORAL REGULATION OF FEMALE MEIOSIS
II.A Oogenesis and maintenance of prophase I arrest
A female is born with all of the oocytes she will have in her lifetime. During
embryonic development, the ovarian follicles develop within the ovary, and house
primordial germ cells that will develop into oocytes through a process known as
oogenesis. The ovarian follicle is the functional unit of the ovary, containing an oocyte
surrounded by one or more layers of somatic granulosa cells (Gougeon, 1996; Eppig et
al., 2004; Zeleznik, 2004). During follicular growth, the growing oocyte accumulates
RNA transcripts required for meiotic maturation and embryonic development (Moore et
al., 1974; Sorensen and Wassarman, 1976; Holt et al., 2013). Insights into acquisition of
meiotic competence have come from studies of mouse oocytes. The oocyte is
considered meiotically competent when maturation-promoting protein synthesis including
Cdk1 and cyclin B reaches a threshold (Erickson and Sorensen, 1974; Sorensen and
Wasarman, 1976; Mehlmann et al., 2004; de Vante ́ry et al., 1996; de Vante ́ry et al.,
1997: Kanatsu-Shinohara et al., 2000). In studies examining the biological basis of
2
meiotic competence of mouse oocytes, it was found that meiotically incompetent oocytes
contain 11.3 x106 molecules of cyclin B, and meiotically competent oocytes contain 95.5
x 106 molecules of cyclin B, which is the threshold to induce entry into the first meiotic Mphase (Hampl and Eppig, 1995; Winston, 1997; Hashimoto and Kishimoto, 1988; Ledan
et al., 2001; Kanatsu-Shinohara et al., 2000).
In addition to the acquisition of meiotic competence, the somatic cells divide to
form several layers around the oocyte and a large fluid-filled antrum forms during
follicular growth. Some early antral follicles are recruited to continue growing in a
Follicle Stimulating Hormone (FSH)-dependent manner (Gougeon, 1996; Zeleznik,
2004). The mature ovarian follicle contains two classes of somatic cells, cumulus cells
that surround the oocyte, and mural granulosa cells that form the outer layer and line the
ovarian follicle (Mehlmann, 2005). Prophase I arrest is maintained by the cumulus cells
surrounding the oocyte, because meiosis spontaneously resumes and progresses to
metaphase II arrest when an oocyte is removed from a follicle (Pincus and Enzmann,
1935). The arrest at prophase I is maintained by the level of cAMP within the oocyte
(Conti et al., 2002; Eppig et al. 2004), and there is a resulting decrease in cAMP level
when the oocyte is removed from the follicle (Tornell et al. 1990). Maintenance of
prophase I arrest is achieved in the laboratory through membrane permeable analogs of
cAMP such as diburtryl cyclic AMP (Cho et al., 1974). Meiosis resumes in response to a
mid-cycle surge of luteinizing hormone (LH) from the pituitary gland acting on the LH
receptor on mural granulosa cells (Peng et al., 1991; Eppig et al., 1997).
II.B Regulatory molecules of meiotic maturation
In mitotic cells, M-phase is regulated through the activation and subsequent
inactivation of the maturation-promoting factor (MPF) composed of a p34cdk1 kinase and
its regulatory subunit cyclin B (Masui & Markert, 1971; Lohka et al., 1988, Doree and
Hunt, 2002). MPF activity is controlled by the synthesis and degradation of cyclin B
3
(Murray and Kirschner, 1989). MPF is activated at GVBD, and MPF activity increases
until a plateau is reached at the end of the first M-phase (Choi et al. 1991, Verlhac et al.
1994). MPF activity undergoes a transient decline during the transition between meiosis
I and II required for polar body emission, but is rapidly reactivated and is maintained at a
high level during metaphase II arrest (Masui and Market, 1971; Hampl and Eppig, 1995;
Winston, 1997; Ledan et al., 2001).
II.C Maintenance of metaphase II arrest
Metaphase II arrest is characterized by high MPF activity, sustained Cdk1
activity, and prevention of cyclin B degradation (Madgwick et al., 2006; Shoji et al.,
2006). Metaphase II arrest is maintained through inhibition of the anaphase-promoting
complex (APC), a multimeric E3 ubiquitin ligase that functions in cyclin B and securin
degradation, resulting in sister chromatid separation and exit from metaphase II arrest
(Masui, 2000; Tunquist and Maller, 2003; Jones, 2005; Taylor et al., 2004). APC activity
is inhibited at metaphase II arrest, and becomes active upon exit from metaphase II
arrest.
During metaphase II arrest, APC activity is inhibited by the spindle assembly
checkpoint (SAC) and the zinc-binding early meiotic inhibitor 2 (Emi2) (Schmidt et al.,
2005; Shoji et al., 2006; Tung et al., 2005; Suzuki et al., 2010). SAC proteins were
initially identified in yeast as mutants that were unable to arrest at metaphase following
treatment with pharmacological inhibitors that disrupt the spindle, nocodazole and taxol
(Masui and Markert, 1971; Hoyt et al., 1991). The SAC senses the appropriate
attachment of chromosomes to the spindle, thus delaying sister chromatid separation
and the resulting exit from meiosis until all kinetochores are properly attached
(Musacchio and Hardwick, 2002; Yu, 2002). The SAC is activated if spindle integrity is
compromised during meiosis I or II, as seen in oocytes treated with nocodazole (Kubiak
et al. 1993, Winston et al. 1995, Winston 1997), thus preventing the progression through
4
meiosis until chromosomes are re-aligned. In mouse oocytes, SAC proteins Bub1 and
Mad2 are activated for checkpoint functions during meiosis I and II, and are essential for
progression through meiosis I (Tsurumi et al, 2004). However, it appears that
metaphase II arrest is established independent of the SAC, as mouse eggs expressing
dominant negative mutants of Bub1 and Mad2 still arrest at metaphase II (Tsurumi et al,
2004).
In contrast to the SAC, Emi2 is required for the establishment of metaphase II
arrest. Emi2 expression is first detectable at metaphase I, and increases at metaphase
II to maintain high MPF activity and the prevention of cyclin B1 degradation through
inhibition of the APC in the metaphase II arrested egg (Madgwick et al., 2006). Emi2 is
regulated by zinc binding and Mos-stimulated mitogen-activated protein kinase 1 (also
known as MAPK1, p42mapk, or ERK2), and mitogen-activated kinase 3 (also known as
MAPK3, p44erk1, or ERK1) activity (Dupre et al., 2011; Masui and Markert 1971; Sagata
et al. 1989; Haccard et al. 1993, Colledge et al. 1994; Hashimoto et al. 1994; Verlhac et
al. 1996; Suzuki et al., 2010; Bernhardt et al., 2012). Zinc binding is required for full
Emi2 function. Insights into the importance of zinc binding were discovered when the
ability to establish metaphase II arrest was impaired in mouse oocytes expressing Emi2
with a mutated residue in the zinc-binding region (Suzuki et al., 2010; Bernhardt et al.,
2012). The Mos-MEK-MAPK3/1 pathway is also necessary for the maintenance of
metaphase II arrest, as mos-/- mouse oocytes and eggs treated with the MEK-inhibitor
U0126 undergo parthenogenetic activation (Colledge et al., 1994; Hashimoto et al.,
1994: Verlhac et al., 1996; Madgwick and Jones, 2007; Hirao and Eppig, 1997; Phillips
et al., 2002; Tong et al., 2003; Petrunewich et al., 2009; McGinnis et al., 2015).
II.D Exit from metaphase II arrest
An illustration of exit from metaphase II arrest in context with female meiosis is
shown in Figure 1.2, and signaling pathways contributing to exit from metaphase II arrest
5
are shown in Figure 1.2B (addressed in additional detail below in Sections II.F and III.E).
Eggs exit from metaphase II arrest following fertilization by sperm or by
parthenogenesis. Parthenogenesis is artificial activation in which an egg can exit
metaphase II arrest without being fertilized, and this activation can be induced with
reagents that increase intracellular calcium (i.e. calcium ionophore or strontium chloride).
Following fertilization, sperm releases soluble phospholipase C (PLCζ) that hydrolyzes
phosphatidylinositol 4,5-bisphosphate (PIP2) within the egg to IP3 and diacylglycerol
(Knott et al., 2005; Saunders et al., 2002; Swann et al., 2004). IP3 travels through the
cytoplasm to the IP3 receptor on the endoplasmic reticulum, and releases intracellular
calcium stores. The rise in intracellular calcium initiates a signaling cascade involving
calmodulin-dependent protein kinase II gamma (CaMKIIγ), which binds to and activates
the APC, resulting in exit from metaphase II arrest (Ducibella and Fissore, 2008). In
addition to the rise in intracellular calcium from internal calcium stores, calcium influx
from the extracellular environment is required to complete meiosis II in mouse oocytes
(Miao et al., 2012).
The rise in intracellular calcium results in the rapid degradation of Emi2 following
phosphorylation by CaMKIIγ in Xenopus laevis and mouse oocytes (Schmidt et al.,
2005, Liu and Maller, 2005; Rauh et al., 2005; Hansen et al., 2006; Markoulaki et al.,
2004; Madgwick et al., 2005; Madgwick and Jones, 2007). Phosphorylation of Emi2 by
CaMKIIγ creates a docking site for polo-like kinase 1 (PLK1) to phosphorylate Emi2 at a
second site, which antagonizes the ability of Emi2 ability to interact with the APC (Liu
and Maller, 2005; Rauh et al., 2005; Tung et al., 2005; Hansen et al., 2006). Therefore,
Emi2 can no longer bind and inhibit the APC, thus stimulating APC activity. Following
APC activation, cyclin B is degraded, there is a drastic reduction in MPF activity and a
gradual reduction in MAPK3/1 activity, and sister chromatid cohesions are destroyed
following polyubiquitination of securin (Morgan, 1999; Zachariae and Nasmyth, 1999;
6
Peters, 2002; Verlhac et al., 1994; Moos et al., 1995; Moos et al., 1996; Shoji et al.,
2006; Suzuki et al., 2010). The egg enters the metaphase to anaphase transition,
completes the second asymmetric division, and the first embryonic mitosis (Krauchunas
and Wolfner 2013; Nader et al., 2013).
II.E Post-ovulatory aging
The time window for successful fertilization of mammalian oocytes is
approximately ten hours after ovulation (Fissore et al., 2002; Suarez and Pacey, 2006).
If fertilization does not occur by this time, the egg begins to deteriorate in a process
known as postovulatory aging. It has been shown that postovulatory aging hinders
embryo development following fertilization (Marston and Chang, 1964). In terms of cell
cycle changes, post-ovulatory aged eggs are more likely to undergo spontaneous
activation compared to recently ovulated eggs (Chebotareva et al., 2011; Goud et al.,
2005; Mailhes et al., 1998; Szollosi, 1971; Webb et al., 1986; Xu et al., 1997). This is
due to the significant reduction of MPF and MAPK3/1 activity in post-ovulatory aged
eggs (Xu et al., 1997). Cortical changes that occur during post-ovulatory aging are
discussed in Sections III.A and IV.A.
II.F Ionic regulation of progression through meiosis
Calcium and zinc ions are important secondary messengers that influence cell
cycle events during meiotic maturation and egg activation. During meiotic maturation,
the cytoplasmic calcium concentration remains low due to intracellular calcium stores.
The endoplasmic reticulum is the primary calcium storage organelle in the oocyte, and
regulates intracellular calcium signaling through the storage and release of calcium. The
mitochondria acts to buffer the cytoplasm, such that calcium is pumped into the
mitochondria when the cytoplasmic calcium concentration is too high, and then calcium
is pumped back into the cytoplasm once the cytoplasmic calcium concentration returns
to an acceptable level (Bootman et al. 2001). The calcium concentration in intracellular
7
stores increases from prophase I to metaphase II. This was discovered by comparing
the calcium oscillations between in vitro fertilized GVIs and metaphase II eggs.
Fertilized GVIs had fewer calcium oscillations, and each calcium oscillation had a lesser
duration and lesser amplitude compared to fertilized metaphase II eggs, suggesting that
there is less calcium in the intracellular stores of a GVI compared to a metaphase II egg
(Jones and Carroll, 1995; Mehlmann et al., 1996).
Following fertilization, IP3R-mediated intracellular stores release calcium into the
cytoplasm, resulting in an increase in the concentration of cytoplasmic calcium. The
initial calcium release from the endoplasmic reticulum results in low frequency calcium
oscillations as cytoplasmic calcium is being pumped back into intracellular stores or
pumped out of the egg (Igusa and Miyazaki 1983; Kline and Kline 1992). In addition to
the rise in intracellular calcium from internal calcium stores, calcium influx from the
extracellular environment is required to complete meiosis II in mouse oocytes (Jones et
al., 2007; Miao et al., 2012).
In addition to calcium, intracellular fluxes in zinc concentrations are required for
the meiotic progression of the egg (Kim et al., 2010; Kim et al., 2011; Suzuki et al., 2010;
Bernhardt et al., 2011; Tian and Diaz, 2011; Kong et al., 2012). X-ray fluorescence
microscopy showed that there is a 50% increase in total zinc content in the egg over the
12-14 hours that encompass meiotic maturation, but the zinc content drops by 20%
following fertilization (Kim et al., 2010), suggesting that zinc serves an important function
during meiotic maturation. In fact, zinc is required for the transition to metaphase II
arrest, as an oocyte treated with the zinc chelator TPEN is prematurely arrested at a
telophase I-like state and unable to reestablish MPF activity required for metaphase II
arrest (Kim et al., 2010; Bernhardt et al., 2011). At metaphase II, zinc binds to the zincbinding region of Emi2, which is required for inhibition of the APC (discussed in Section
II.C) (Suzuki et al., 2010; Bernhardt et al., 2012). Studies that manipulated the
8
bioavailability of zinc in mouse oocytes revealed the role of zinc in the maintenance of
metaphase II arrest. Eggs with reduced intracellular zinc following treatment with the
zinc chelator TPEN underwent parthenogenetic activation (Suzuki et al., 2010; Kim et
al., 2011; Bernhardt et al., 2012), whereas metaphase II arrest was maintained in SrCl2activated eggs by raising intracellular zinc concentrations with the zinc ionophore ZnPt
(Kim et al., 2011, Bernhardt et al., 2012). The decrease in zinc bioavailability within the
egg is mediated by zinc efflux out of the cell in the form of a zinc spark (Kim et al., 2011).
Zinc sparks are triggered by calcium oscillations, and are required for the inactivation of
Emi2 and resulting activation of the APC (Kim et al., 2011; Bernhardt et al., 2012).
III. SPATIAL REGULATION OF THE OOCYTE CORTEX DURING MEIOSIS
III.A Cortical reorganization
Over the course of meiotic maturation and egg activation, the spindle undergoes
organization and orientation (discussed below in Section IV.A) and the actin-rich cortex
undergoes remodeling. Cortical reorganization is characterized by a local loss of
microvilli in the region of the cortex overlying the spindle, referred to as the amicrovillar
domain (Johnson et al. 1975), and an accumulation of actin microfilaments under the
plasma membrane, referred to as the actin cap (Maro et al., 1984; Longo and Chen,
1985). Cortical reorganization is dependent on actin and chromosomes, but not on the
microtubules in the spindle (Maro et al., 1986; Van Blerkom and Bell, 1986; Verlhac et
al., 2000; Maro and Verlhac, 2002). MAPK3/1 was determined to be required for cortical
organization from a study in mouse oocytes. Normally, mouse oocytes microinjected
with sperm chromatin undergo cortical reorganization, however cortical reorganization
failed to occur when sperm chromatin was microinjected into mos-/- eggs, which lack
MAPK3/1 activity (Deng et al., 2005). Similar to mos-/- oocytes, post-ovulatory aged
eggs also exhibit cytoskeletal defects, likely a result of reduced MAPK3/1 activity (Xu et
al., 1997). Post-ovulatory aged eggs exhibit cytoskeletal defects including the loss of the
9
cortical actin cap overlying the meiotic spindle or dramatic amicrovillar protrusions (Dalo
et al., 2008; Webb et al., 1986; Wortzman and Evans, 2005). Additionally, the polarity of
the cortex is altered (Brunet and Verlhac, 2011), and the structure and distribution of
microvilli is disrupted in post-ovulatory aged eggs (Longo, 1974; Longo, 1980; Szollosi,
1971; Webb et al., 1986).
III.B Cortical tension
Cell shape changes such as cortical reorganization and cytokinesis tend to be
generated by the actin cytoskeleton, and such shape changes are mediated by the
mechanical properties of the cell. There are multiple methods to study cell behavior in
response to force including atomic force microscopy (AFM), micropipette aspiration
(MPA), laser-tracking microrheology (LTM), compression using an agar overly, needle
poking, laminar flow, and magnetic twisting cytometry (reviewed in Reichl et al., 2005).
One quantitative mechanical property of an oocyte is its effective cortical tension, which
is the force that serves to minimize the surface area to volume ratio, reflecting the
tension and stretch of the cortex (Derganc et al., 2000; Reichl et al., 2008). Micropipette
aspiration is a widely accepted method to measure cortical tension, and the preferred
method in mouse oocytes, since large-scale cell shape changes such as cytokinesis
involve several nN of force and across tens of µm2 of cell surface area (reviewed in Kee
and Robinson, 2013).
During mitosis, cells undergo a rounding and stiffening of the cortex concurrent
with M-phase entry (Matzke et al., 2001; D’Avino et al., 2005; Reichl et al., 2005; Effler
et al., 2007; Kunda et al., 2008; Stewart et al., 2011). At metaphase, the spindle
elongates and is oriented parallel to the cell’s long axis through the help of cortical
myosin-II (Gibson et al., 2011; Minc et al., 2011; Rosenblatt et al., 2004). Prior to
cytokinesis, the central spindle provides cues to the cortex that aid in organization of the
10
cleavage furrow, increasing cortical stiffness in the region of the furrow, and leading to
myosin-II mediated contraction (Reichl et al., 2008).
Despite not undergoing the shape changes seen in mitotic cells, oocytes do
undergo changes in cortical tension with progression through meiosis and these
changes appear to be important for normal cytokinesis. Oocytes undergo a 6-fold
decrease in cortical tension from prophase I to metaphase II arrest (Larson et al., 2010).
At metaphase I, the thickening of cortical actin and exclusion of myosin-II from the cortex
are linked with reduced cortical tension required for positioning of the spindle (Chaigne
et al., 2013). This softening of the cortex at metaphase I is Mos-MAPK3/1-dependent,
based on the observation that cortical tension remains high and myosin-II remains
enriched in the cortex of mos-/- oocytes (Chaigne et al., 2013). Arp2/3, a downstream
effector of MAPK3/1, promotes removal of myosin-II from the cortex, because oocytes
had high cortical tension and the metaphase I spindle remained centrally located in
Arp2/3-inhibited oocytes (Chaigne et al., 2015). There is a narrow permissive range of
cortical tension required for metaphase I spindle positioning adjacent to the cortex
(Chaigne et al., 2015). It is suggested that in oocytes with too high cortical tension, the
cortex can not deform appropriately and the spindle remains centrally localized, and in
oocytes with too low cortical tension, myosin-II can not adequately pull on the cortex and
can not create a large enough force to assist in spindle migration (Chaigne et al., 2015;
discussed more in Section IV.A).
In a metaphase II-arrested egg, a mechanical polarity exists within the egg where
the amicrovillar domain that sequesters the spindle is 2.5-fold more rigid than the
microvillar domain to which sperm bind (Larson et al., 2010). This drastic difference in
cortical tension within the egg suggests that the rigidity of the amicrovillar domain serves
an important function by containing the spindle adjacent to the cortex prior to the second
asymmetric division. In addition to MAPK3/1 and Arp2/3, actin, myosin-II, and the ezrin-
11
radixin-moesin (ERM) family of membrane tether proteins were discovered to mediate
cortical tension, and there is a reduction in cortical tension and spindle defects if any of
these molecules are perturbed (Larson et al., 2010). Upon fertilization and egg
activation, the oocyte undergoes a 1.6-fold increase from metaphase II arrest to
interphase(Larson et al., 2010). Recently, the mechanical properties of an embryo were
found to be predictive of human embryo viability as early as the two-pronuclear (2PN)
stage, suggesting that the developmental potential of an embryo is within the oocyte
prior to fertilization, since the embryo retains a large volume of the oocyte’s cytoplasmic
nutrients following the second meiotic division (Yanez et al., 2016). This novel
assessment of embryo viability will prove beneficial in the selection of early-stage
embryos to implant in a woman’s uterus in an assisted reproductive technology (ART)
clinic.
III.C Myosin-II
As introduced in Section III.B, myosin-II was discovered to be a regulator of
cortical tension in mouse oocytes, and, as will be addressed in further detail below
(Section IV.A), also implicated in aspects of metaphase I spindle positioning. Myosins
are a family of motor proteins that are important for cellular events that require
translocation and force (Holmes, 2007; Mooseker and Foth, 2007; El-Mezgueldi and
Bagshaw, 2007). There are several types of myosins, however the majority of myosins
belong to class II and, in cooperation with actin, make up major contractile proteins in
cardiac, skeletal and smooth muscle. Non-muscle myosin-II resembles their muscle
counterparts, and will be the focus of this thesis work. A functional myosin-II monomer
is a hexamer of two myosin heavy chains (MHC), two regulatory light chains (MRLC)
that regulate myosin activity, and two essential light chains (MELC) that stabilize the
structure of the heavy chains. Myosin-II has two globular heads that have the binding
sites for ATP and actin, and behind the heads is the neck region that binds the two
12
different classes of light chains and acts as a lever to amplify the rotation of the head
(Holmes, 2007). Following the neck is a long alpha-helical coiled coil self-assembles
into bipolar thick filaments (Niederman et al., 1975; Svitkina et al., 1995). The regulation
of bipolar thick filament assembly and contractility is regulated by the phosphorylation of
the MRLC at Ser 19 and Thr 18 (Bosgraaf and van Haastert, 2006; Eggelhoff et al.,
1993). Multiple kinases that phosphorylate MRLC, including myosin light chain kinase
(MLCK), Rho-associated protein kinase/ROK/Rho-kinase (ROCK), p21-activated
kinases (PAKs), citron kinase (Citron-K), integrin-linked kinase (ILK), absent in
melanoma-1 (AIM1), myotonic dystrophy protein kinase-related Cdc42-binding kinase
(MRCKs), and death-associated protein kinases (DAPKs) (Somlyo and Somlyo, 2003;
Matsumara et al., 2001; Murata-Hori et al., 2000; Shohat et al., 2002; Leung et al., 1998;
Komatsu and Ikebe, 2004).
Myosin-II movement along actin filaments is mediated by an ATP hydrolysisdependent power stroke, allowing myosin-II to takes an 8 nm step along the actin
filament (Finer et al, 1994; Murphy et al., 2001). MRLC phosphorylation increases Mg2+ATPase activity to the actin filament by changing the conformation of the myosin head
(Somlyo and Somlyo, 2003; Wendt et al., 2001). Myosin binding causes a
conformational change in the actin filament that allows additional myosin heads to bind
in a cooperative manner.
Of the numerous activating kinases of the MRLC, this thesis research focuses
primarily on the regulation of myosin-II function resulting from the phosphorylation of
MRLC by MLCK, a Ca2+/calmodulin-dependent enzyme (Adelstein, 1983; de Lanerolle
and Paul, 1991). The proposed model to mediate myosin-II function is illustrated in
Figure 1.3B. This pathway incorporating MLCK was selected based on studies showing
the inhibition of MAPK3/1 results in decreased MLCK function, MRLC phosphorylation,
and actin-dependent cell migration (Klemke et al., 1997). Alternatively, a constitutively
13
active form of MEK1/2 activates MAPK3/1 and MLCK, enhances phosphorylation of
MRLC, and enhances cell migration (Klemke et al., 1997).
In mouse oocytes, pMRLC localizes to the cortex in prophase I oocytes and to
the boundaries of the amicrovillar domain in the metaphase II egg (Larson et al., 2010),
colocalizing with actin (Larson et al., 2010) and myosin-II heavy chains IIA and IIB (also
known as MYH9, Maro et al., 1984; Simerly et al., 1998). The phosphorylation of MRLC
and resulting contractility of myosin-II regulates cortical tension, as cortical tension is
reduced in the prophase I oocyte and both domains of the metaphase II egg following
treatment the MLCK-inhibitor ML-7, that acts to inhibit the phosphorylation of MRLC
(Larson et al., 2010).
III.D The Rho GTPase family of proteins
The actin cytoskeleton is regulated by a number of the small GTPase proteins,
RhoA, Rac, and Cdc42, in a variety of cell types (Spiering and Hodgson, 2011). RhoA
activity is influenced by spindle microtubules, since physical manipulation of the mitotic
spindle results in the re-localization of active RhoA (Bement et al., 2005). RhoA is
required for polar body emission based on data showing that inhibition of RhoA with C3
transferase from Clostridium botulinum in blocked polar body emission in Xenopus
oocytes (Aktories and Hall, 1989; Moore et al., 1994). In mouse oocytes, RhoA localizes
to the cortex at prophase I and to the region of the cortex overlying the metaphase I
spindle (Elbaz et al., 2010). The downstream effector of Rho is named Rho-dependent
kinase (ROCK), and mammalian oocytes with inhibited ROCK activity fail to emit the first
polar body (Elbaz et al., 2010; Duan et al. 2014; Lee et al., 2015; Zhang et al., 2014,
discussed in Section IV.C), suggesting that Rho activity is also required for polar body
emission in mouse oocytes.
Another small GTPase, Rac, functions to regulate meiotic spindle stability and
anchoring. During meiotic maturation in mouse oocytes, Rac activity is induced by the
14
polarization of metaphase spindle and chromosomes (Halet and Carroll, 2007). Rac is
required for the completion of meiosis I in mouse oocytes, since the majority of Racinhibited oocytes arrest at metaphase I (Halet and Carroll, 2007). This contrasts with
Rac function in Xenopus oocytes, since Xenopus oocytes expressing a dominant
negative version of Rac1 were able undergo polar body emission (Ma et al., 2006). In
mouse, Rac activity is not required for positioning the metaphase I spindle adjacent to
the cortex, but is required for the regulation of spindle length since spindle elongation is
observed in the majority of Rac-inhibited oocytes (Halet and Carroll, 2007).
At metaphase II, Rac localizes to the region of the cortex overlying the spindle,
which is a similar localization to actin (Halet and Carroll, 2007). Rac is implicated in
anchoring of the metaphase II spindle near the cortex, as eggs with inhibited Rac activity
exhibit spindle detachment from the cortex, which is similar to Arp2/3-, MEK1/2- and
MLCK-inhibited oocytes (Yi et al., 2013; Petrunewich et al., 2009; McGinnis et al., 2015;
Figure 2.3). Finally, Rac is required for second polar body emission as Rac-inhibited
oocytes fail to emit the second polar body following artificial activation (Halet and Carroll,
2007).
The third small GTPase, Cdc42, is not known to play a role in cytokinesis in
mitotic cells, but is required for cytokinesis in female meiosis (Zhang et al., 2008;
Leblanc et al., 2011). In Xenopus oocytes, Cdc42 and RhoA mediate polar body
formation (Ma et al 2006). During polar body emission, Cdc42 localizes to the cap of the
emitting polar body, and RhoA localizes to the contractile ring where myosin-II and actin
are found (Zhang et al., 2008). Inhibition of Cdc42 in Xenopus oocytes results in
improper formation of the contractile ring, and thus failure to undergo polar body
emission (Ma et al., 2006). Cdc42 is implicated in the coordination between the spindle
and cortex in mouse oocytes (Cui et al., 2007; Na and Zernicka-Goetz, 2006). Cdc42
localizes to the spindle starting at metaphase I, and remains localized to the spindle
15
through the second meiotic division (Bielak-Zmijewska et al., 2008). Oocytes injected
with Cdc42-targeting siRNA have abnormal spindles, mislocalized actin, and arrest
prematurely at metaphase I (Cui et al., 2007). Similar to Cdc42-deficient mouse
oocytes, oocytes expressing either a dominant negative or constitutively active mutant of
Cdc42 have a centrally localized spindle with uniform cortical actin at 7 h following exit
from prophase I arrest (Na and Zernicka-Goetz, 2006), a time point when oocytes
normally have a spindle positioned adjacent to the cortex and an enrichment of actin in
the region of the cortex overlying the spindle.
Interestingly, an oocyte-specific deletion of Cdc42 was created using a
Cdc42loxp/loxp mouse, and oocytes exhibited no defect in spindle organization or migration
to the cortex, however polar body emission failed to occur (Wang et al., 2013). The
results observed in vivo using Cdc42loxp/loxp oocytes disagree with in vitro inhibition of
Cdc42, and may be explained by the failure to completely knock down Cdc42 in the
Cdc42loxp/loxp oocyte. The residual level of Cdc42 remaining in the Cdc42loxp/loxp oocyte
may be enough for normal spindle organization and positioning adjacent to the cortex.
Alternatively, Rac activity may be compensating for Cdc42 activity in Cdc42loxp/loxp
oocytes.
III.E Ion transporters and channels in eggs
Ions such as calcium and zinc are involved in the arrest and transitions during
meiosis I and II, most notably metaphase II arrest and exit from metaphase II arrest, as
discussed in Section II.F. An ion homeostasis exists between the intracellular and
extracellular environment, and any alterations to this homeostasis may perturb cell cycle
progression. Ion influx is regulated by ion transporters and channels in the oocyte
plasma membrane, and cytoskeletal function could affect channel or transporter activity
by acto-myosin based effects on mechanosensitive channels (Gu et al., 2014; Martinac
et al., 2014; Plant et al., 2014). The hypothesis that ion signaling is dysfunctional in cells
16
with aberrant cellular mechanics is supported by studies in starfish oocytes that show
the actin cytoskeleton functions in the regulation of intracellular calcium signaling.
Maturing starfish oocytes have an initial rapid release of intracellular calcium from IP3mediated stores that occurs simultaneously as cytoskeletal actin reorganization
(Kyozuka et al., 2008). Inhibition of actin polymerization with jasplakinolide resulted in
an inhibition of the initial rise in intracellular calcium, whereas oocytes treated with the
actin depolymerization agent, latrunculin A, caused a large increase in intracellular
calcium resulting elevation of the fertilization envelope (Kyozuka et al., 2008; Lim et al.,
2002). This study provides evidence that perturbations to the oocyte cytoskeleton may
alter ion signaling.
It is currently unknown what channels or transporters in the egg plasma
membrane mediate calcium influx, however two families of channels have been
considered the main candidates to mediate Ca2+ influx into eggs: store-operated calcium
entry channels (SOCE) and the transient receptor potential (TRP) family of ion channels.
Two critical players in SOCE are the stromal interaction molecule STIM1, an
endoplasmic reticulum (ER) transmembrane sensor (Liou et al., 2005; Roos et al.,
2005), and Orai1, the calcium-release activated current channel (Feske et al., 2006; Vig
et al., 2006; Zhang et al., 2006). Stim1 and Ora1 are expressed in mouse oocytes and
eggs (Miao et al., 2012; Cheon et al., 2013), and have dynamic localization throughout
meiotic maturation that regulate calcium entry into the oocyte (Cheon et al., 2013). The
SOCE becomes active when the concentration of intracellular calcium stores is low, and
as the concentration of intracellular ER calcium rises, calcium entry into the oocyte
through the SOCE decreases as the oocyte progresses through meiosis (Cheon et al.,
2013; Lee et al., 2013). The concentration of calcium in the ER peaks at metaphase II,
when calcium influx into the oocyte is lowest, as the SOCE is down-regulated, but not
inactivated (Cheon et al., 2013; Lee et al., 2013). Down regulation of the SOCE at
17
metaphase II is critical for successful egg- to-embryo transition (Lee et al., 2013).
Cytoskeletal regulation of the SOCE has been previously shown in neuronal cells.
SOCE activity was inhibited following over-polymerization of cortical F-actin, however
became restored after F-actin polymerization was disrupted (Vanoverberge et al., 2012).
This poses the possibility that changes in cytoskeletal actin organization within the
oocyte erroneously affect SOCE activity and intracellular calcium stores.
In addition to the SOCE, mouse eggs contain at least two types of calcium
channels; voltage-gated calcium channels and TRP channels. Voltage-gated calcium
channels have been measured in mature mouse eggs, and become inactivated when
the egg plasma membrane is depolarized following fertilization (Peres, 1987; Igusa and
Miyazaki, 1983; Jaffe and Cross, 1984). Recently, the alpha subunit of the T-type
channel Cav3.2 encoded by Cacna1h was discovered to facilitate calcium entry in mouse
oocytes and eggs (Bernhardt et al., 2015). Cacna1h+/+ eggs have a robust voltagegated inward calcium current that is characteristic of T-type channels, however this
current was undetectable in Cacna1h-/- eggs (Bernhardt et al., 2015). Cacna1h-/- only
have slightly reduced fertility (Bernhardt et al., 2015), suggesting that calcium influx into
the egg is mediated by more than one channel.
Similar to the SOCE, there is precedence that TRP activity is regulated by
cytoskeletal proteins. In contrast to voltage-gated calcium channels, TRP channels are
voltage-insensitive and permeable to calcium (Clapham, 2003; Greka et al., 2003). The
regulation of a TRP-like (TRPL) channel in Drosophila was determined to be dependent
on myosin III (Meyer et al., 2006). A mutated version of myosin III hinders the
endocytosis of a TRPL channel from the rhabdomere to the cell body, allowing TRPL to
remain at the cell surface (Meyer et al., 2006). TRPL endocytosis was also inhibited
when extracellular calcium is removed, allowing calcium to influx into the cell (Meyer et
al., 2006).
18
Some TRP channels are regulated by mechanosensing, a process by which cells
sense and respond to mechanical stress. In smooth muscle cells, TRPC6 channels
respond to a stimulus and translocate to the plasma membrane, remaining there as long
as the stimulus is present (Cayouette and Boulay, 2007; Cayouette et al., 2010). The
question of what channel is allowing calcium into the oocyte is complicated and likely not
due to one specific channel. TRPV3 is expressed in mouse oocytes and eggs and its
expression is increased during meiotic maturation, peaking at metaphase II arrest.
TRPV3 mediates strontium influx, and the resulting SrCl2-induced artificial egg activation
(Carvacho et al., 2013), however it is unknown whether strontium and calcium permeate
the same channel. Fertilization induced calcium oscillation still occurred in Trpv3-/oocytes, suggesting a compensator calcium influx pathway (Carvacho et al., 2013).
In addition to calcium, there is a necessary flux in zinc ions throughout meiotic
maturation and egg activation. Intracellular zinc in somatic cells is regulated by zinc
finger transcription factors like metal response element-binding transcription factor 1
(MTF-1), zinc-binding proteins called metallothioneins (MTs), and integral membrane
zinc transport proteins that move zinc across the plasma membrane (Palmiter, 1998;
Andrews, 2001; Palmiter, 2004; Hirano et al., 2008). There are two families of zinc
transporters in eukaryotic cells known as the ZRT, IRT-like protein (ZIP) family that
regulates zinc uptake into the cytoplasm from the extracellular space or intracellular
stores, and the zinc transporter (ZnT) family that regulates zinc efflux from the
cytoplasm. Zinc accumulation and meiotic progression are dependent upon ZIP6 and
ZIP10 in mouse oocytes that function to import zinc ions across the plasma membrane,
and are required for the oocyte to egg transition (Kong et al., 2014). Oocytes with
inhibited ZIP6 or ZIP10 activity by morpholino injection of incubation in function-blocking
antibodies mimicked parthenogenetic activation observed in oocytes treated with the
zinc chelator TPEN (Kong et al., 2014).
19
IV. SPATIAL REGULATION OF THE MEIOTIC SPINDLE
IV. A Spindle positioning in meiosis I
As introduced in Section I of the literature review, it is important that the spindle
is positioned adjacent to the cortex since the spindle dictates the site of cytokinesis. In
mitotic cells, spindle positioning depends on the interaction between the cortex and
astral microtubules that connect the spindle poles to the cortex, as well as actin and nonmuscle myosin-II (Cowan and Hyman, 2004; Fabritius et al., 2011; Kunda et al., 2008;
Woolner et al., 2008). In mammalian oocytes, there are similarities and also differences
for how this process of spindle positioning and orientation occur. The metaphase I
spindle forms in the center of the cell and migrates toward the periphery of the cortex
moving along its long axis, defined by the spindle pole that is closet to the cortex (Longo
and Chen, 1985; Maro and Verlhac, 2002; Verlhac et al., 2000). The leading pole takes
the shortest distance to the cortex, moving at a velocity of 0.12 mm/minute over a 2-3
hour time period (Verlhac et al., 2000).
Spindle positioning during meiosis I in mammalian oocytes is dependent upon
two actin networks: a cytoplasmic actin meshwork and a dynamic cortical actin network
(Figure 1.4). The cytoplasmic meshwork is nucleated by Formin-2 (Fmn2), a straight
actin nucleator, and its interacting protein, Spire 1/2 (Azoury et al., 2008; Leader et al.,
2002; Dumont et al., 2007; Pfender et al., 2011; Schuh and Ellenberg, 2008; Holubcova
et al., 2013). In the absence or inhibition of Fmn2 or Spire 1/2, the formation of the
cytoplasmic actin meshwork is impaired and spindle migration does not occur (Azoury et
al., 2008; Pfender et al., 2011; Schuh and Ellenberg, 2008; Dumont et al., 2007).
Remodeling of the cytoplasmic meshwork throughout meiotic maturation occurs
concurrently with the degradation of Fmn2 by GVBD and the re-accumulation of Fmn2 at
metaphase I (Azoury et al., 2011).
20
At the time of GVBD, a symmetric actin cloud surrounds the chromatin (Li et al.,
2008; Figures 3.2, 4.2). The formation of the actin cloud requires Fmn2, because
Fmn2-/- oocytes do not form an actin cloud (Li et al., 2008). When the spindle begins to
move away from the center of the oocyte, the symmetric shape of the actin cloud is
altered, with the actin becoming enriched in the region of the cytoplasm opposite the
direction of the chromosomes (Figures 1.1 and 1.4). This process represents symmetrybreaking in the oocyte (Li et al., 2008), and requires a decrease in Fmn2 upon the
resumption of meiosis (Azoury et al., 2011). In oocytes in which Fmn2 is overexpressed,
the metaphase I spindle is arrested in the center of the oocyte in a dense mesh of actin
filaments and is unable to migrate to the cortex (Azoury et al., 2011). Active,
phosphorylated MRLC localizes to the poles of the spindle, and spindle translocation
along the cytoplasmic actin network was determined to be myosin II-dependent (Dumont
et al., 2007; Schuh and Ellenberg, 2008). Oocytes with inhibited MLCK activity have
impaired spindle migration, similar to oocytes treated with antibodies that cross-react
with MYH9 (Schuh and Ellenberg, 2008; Simerly et al., 1998).
As the spindle translocates closer to the cortex, cytoplasmic actin filaments
surrounding the spindle overlap with the cortical actin network (Azoury et al., 2008;
Schuh and Ellenberg, 2008; Chaigne et al., 2012; Chaigne et al., 2013). The thickening
of cortical actin is nucleated by Wave2 and the branched actin nucleator, the Arp2/3
complex, which is triggered by Mos-MAPK3/1 signaling (Verlhac et al., 1996; Kalab et
al., 1996; Chaigne et al., 2013; Chaigne et al., 2015). This change in cortical actin
thickness and exclusion of myosin-II from the cortex is correlated with a drop in cortical
tension (Chaigne et al., 2013; discussed more in Section III.B). Mos-/- oocytes do not
exhibit thickening of cortical actin or spindle translocation to the cortex, similar to Arp2/3inhibited oocytes (Verlhac et al., 2000; Yi et al., 2011; Chaigne et al., 2013). Despite
having a centrally localized spindle, mos-/- oocytes can still undergo cytokinesis resulting
21
in two similarly sized daughter cells, namely an oversized polar body (and by extension
an undersized oocyte) (Verlhac et al., 2000).
While arrested at metaphase II, the spindle must remain anchored near the
cortex prior to the second meiotic division. As mentioned earlier (Section III.D), Rac is
part of the machinery that controls spindle anchoring at this stage (Halet and Carroll,
2007). The active GTP-bound form localizes to the cortex overlying the metaphase II
spindle, and overexpression of an inactive form of Rac in MII oocytes results in a range
of partial to total detachment of the spindle from the cortex (Halet and Carroll, 2007).
The Arp2/3 complex also has been implicated in in the maintenance of spindle position
at metaphase II as oocytes treated with the Arp2/3-inhbiitor CK-666 exhibit loss of
spindle anchoring beneath the cortex (Yi et al., 2011). Spindle anchoring is altered in
the process of post-ovulatory ageing as well (Section II.E), since the metaphase II
spindle of an aged egg can lose its cortical localization and move to the center of the
egg (Eichenlaub-Ritter et al., 1986; Goud et al., 2005; Longo, 1974; Szollosi, 1971;
Webb et al., 1986) or is lost completely (Eichenlaub-Ritter et al., 1986; Goud et al., 2005;
Longo, 1974; Szollosi, 1971; Webb et al., 1986).
IV.B Mos-MEK1/2-MAPK3/1 pathway
The oocyte-specific protein Mos activates MEK1/2, which then activates
MAPK3/1 (Fan and Sun, 2004; Madgwick and Jones, 2007). This pathway is illustrated
in Figure 1.3A. The phosphorylated forms of Mos, MEK1/2, and MAPK3/1 are all
associated with the spindle (Verlhac et al., 1993; Lu et al., 2002; Yu et al., 2007; Xiong
et al., 2007). Similar to the requirement of MAPK3/1 for cortical reorganization in
metaphase II eggs (Deng et al., 2005; Verlhac et al., 2000, discussed in Section III.A),
MAPK3/1 activity is required for microtubule organization during the transition from
meiosis I and II (Verlhac et al., 1996). The oocytes of mos-/- mice have a spindle that
fails to migrate to the cortex, and that become elongated prior to cytokinesis (Verlhac et
22
al., 2000; Hirao and Eppig, 1997). Spindle organization is also disrupted in oocytes
treated with the MEK-inhibitor U0126, and cytokinesis results in two similarly sized
daughter cells, similar to what is seen in mos-/- mice (Tong et al., 2003, Verlhac et al.,
2000).
The MAPK3/1 pathway is also relevant to post-ovulatory aging (Section II.E).
Aged eggs have reduced MAPK3/1 activity (Xu et al., 1997), which likely contributes to
their propensity to exit from metaphase II arrest. Post-ovulatory aged eggs have a
smaller and disorganized spindle, disrupted poles and the presence of astral
microtubules in the center of the spindle along with misaligned chromosomes
(Eichenlaub-Ritter et al., 1986; Goud et al., 2005; Marston and Chang, 1964; Szollosi,
1971; Webb et al., 1986).
IV.C ROCK-LIMK1/2-Cofilin pathway
The RhoA kinase (ROCK)-LIM kinases 1 and 2 (LIMK1/2)-Cofilin pathway has
been implicated in spindle positioning in bovine, porcine, and mouse oocytes (Duan et
al. 2014; Lee et al., 2015; Zhang et al., 2014). ROCKs were the first RhoA effector
molecule discovered, and were identified for their involvement in RhoA-induced stress
fiber and focal adhesion formation through phosphorylation of the MRLC (Leung et al.,
1996; Somylo et al., 2000). ROCKs are serine/threonine protein kinases required for
contraction of the cleavage furrow, and their activity is enhanced following binding of
RhoA (Ishizaki et al., 1996; Matsui et al., 1996; Drechsel et al., 1997: Kosako et al.,
2000; Yasui et al., 1998; Piekny and Mains, 2002). ROCKs phosphorylate and activate
several substrates such as myosin light chain phosphatase (MLCP), the ezrin-radixinmoesin (ERM) family of proteins, and LIMK1/2. In mouse oocytes, inhibition of ROCK,
with RNAi or the specific inhibitor Y-27632, results in failure of the spindle to translocate
to the cortex, no cortical reorganization, and no polar body emission (Duan et al. 2014).
23
Two effector molecules of ROCK are LIMK1 and LIMK2, a family of
serine/threonine kinases (Stanyon and Bernard, 1999). In mitotic cells, the knockdown
of LIMK1 destabilizes the cortical actin organization (Kaji et al., 2008). In addition to
ROCK, LIMK1/2 is phosphorylated by p21-activated kinases (PAK) 1 and 4 on
conserved threonine residues in the activation loop of the kinase domain essential for
kinase activity (Thr-508 for LIMK1 and Thr-505 for LIMK2; Ohashi et al., 2000; Sumi et
al., 2001; Dan et al., 2001; Edwards et al., 1999; Maekawa et al., 1999; Ohashi et al.,
2000). The phosphorylation of LIMK1/2 on this threonine residue enhances the ability of
LIMK1/2 to phosphorylate its only downstream effector molecule cofilin (Maekawa et al.,
1999).
The principal substrate of LIMK1/2 is cofilin, an actin-binding protein that induces
actin filament depolymerization (Bamburg et al., 1980; Nishida et al., 1984). Cofilin
preferentially binds to and severs F-actin filaments, creating a pool of free actin
monomers available for polymerization (Pollard and Borisy, 2003; Kiuchi et al. 2007,
Kiuchi et 2011). There are three types of cofilin: a non-muscle type cofilin-1, muscle
type cofilin-2, and actin depolymerizing factor (ADF) in mammals (Ono, 2007; Poukkula
et al., 2011). The dynamic phosphorylation status of cofilin is very important for
regulation of actin cytoskeleton dynamics (Kiuchi et al. 2011). Cofilin is phosphorylated
at an N-terminal Ser3, which inactivates the severing activity (Agnew et al., 1995;
Moriyama et al., 1996; Arber et al., 1998; Yang et al., 1998; Sumi et al., 1999), and is
dephosphorylated by slingshot phosphatase (Mizuno, 2013).
Active pLIMK1/2 can phosphorylate and inactive cofilin, resulting in an
accumulation and stabilization of actin filaments (Arber et al., 1998; Yang et al., 1998).
In mouse oocytes, inhibition of ROCK activity results in reduced pCofilin (Duan et al.,
2014). The regulation of the actin severing activity of cofilin affects the actin networks
implicated in spindle positioning prior to cytokinesis. Overexpression of a constitutively
24
active form of cofilin results in reduced cortical actin in mouse oocytes, and this is
rescued by co-expression with non-muscle tropomyosin 3 (Tpm3), which presumably
protects cortical actin from depolymerization by cofilin (Jang et al., 2014). This pathway
is summarized in Figure 1.3C.
V. SUMMARY AND INTRODUCTION TO THESIS RESEARCH
This literature review provides background on the unique temporal and spatial
regulation of meiotic maturation and egg activation in the mammalian oocyte. The
temporal regulation of female meiosis ensures oocytes and eggs remain arrested at
prophase I and metaphase II respectively, until the appropriate signal is received to
trigger the progression through meiosis. This research addresses the importance of
myosin-II-function in the metaphase II egg for regulation of metaphase II arrest (Chapter
2). The maintenance of metaphase II arrest and prevention of parthenogenetic
activation is important for reproductive success, as eggs with the inability to maintain
metaphase II arrest are associated with reduced fertility (Colledge et al., 1994;
Hashimoto et al., 1994; Verlhac et al., 1996). Additionally, we show that metaphase II
eggs with inhibited myosin-II function resemble post-ovulatory aged eggs with reduced
MAPK3/1 activity (Chapter 2). Post-ovulatory ageing is an important public health issue
because there has been shown to be reduced reproductive success when eggs are
fertilized at later times after ovulation in many species, including humans (Blandau and
Young, 1939; Blandau and Jordan, 1941; Marston and Chang, 1964; Guerrero and
Lanctot, 1970, Guerrero and Rojas, 1975, Miao et al., 2009, Takahashi et al., 2013,
Tarin et al. , 2000, Wilcox et al. , 1998).
Oocyte viability depends upon the spatial regulation between the meiotic spindle
and cortex that mediates spindle position. The position of the spindle dictates the site of
cytokinesis, and it is crucial that the oocyte undergoes an asymmetric meiotic division to
ensure the unequal distribution of the nutrient-rich cytoplasm stockpiled during
25
oogenesis to daughter cells. The goal of this research is to understand some of the
molecular basis of coordination between the meiotic spindle and cortex. This thesis
identifies two new candidate proteins, IQ-motif containing GTPase activating protein 3
(IQGAP3; Chapter 3) and nexilin (Chapter 4), along with their respective pathways that
converge on spindle integrity and spindle-cortex coordination. Additionally, this work
addresses the importance of myosin-II-function in the maintenance of spindle position
adjacent to the cortex in the metaphase II egg (Chapter 2).
26
VI. REFERENCES
Adelstein RS. “Regulation of contractile proteins by phosphorylation.” The Journal of
Clinical Investigation 72 (1983): 1863-1866.
Agnew BJ, Minamide LS, and Bamburg JR. “Reactivation of phosphorylated actin
depolymerizing factor and identification of the regulatory site.” Journal of
Biological Chemistry 270 (1995): 17582-17587.
Aktories K, Braun U, Rösener S, Just I, and Hall A. “The rho gene product expressed in
E. coli is a substrate of botulinum ADP-ribosyltransferase C3.” Biochemical and
Biophysical Research Communications 158 (1989): 209-213.
Andrews GK. “Cellular zinc sensors: MTF-1 regulation of gene expression.” Biometals
14 (2001): 223-237.
Arber S, Barbayannis FA, Hanser H, Schneider C, Stanyon CA, Bernard O, and Caroni
P. “Regulation of actin dynamics through phosphorylation of cofilin by LIMkinase.” Nature 393 (1998): 805-809.
Azoury J, Lee KW, Georget V, Rassinier P, Leader B, and Verlhac MH. “Spindle
positioning in mouse oocytes relies on a dynamic meshwork of actin filaments.”
Current Biology 18 (2008): 1514-1519.
Azoury J, Lee KW, Georget V, Hikal P, and Verlhac MH. “Symmetry breaking in mouse
oocytes requires transient F-actin meshwork destabilization.” Development 138
(2011): 2903-2908.
Bamburg JR, Harris HE, and Weeds AG. “Partial purification and characterization of an
actin depolymerizing factor from brain.” FEBS Letters 121 (1980): 178-182.
Bement WM, Benink HA, and von Dassow G. “A microtubule-dependent zone of active
RhoA during cleavage plane specification.“ Journal of Cell Biology 170 (2005):
91-101.
27
Bernhardt ML, Kim AM, O’Halloran TV, and Woodruff TK. “Zinc requirement during
meiosis I-meiosis II transition in mouse oocytes is independent of the MOSMAPK pathway.” Biology of Reproduction 84 (2011): 526-536.
Bernhardt ML, Kong BY, Kim AM, O’Halloran TV, and Woodruff TK. “A zinc-dependent
mechanism regulates meiotic progression in mammalian oocytes.” Biology of
Reproduction 86 (2012): 114.
Bernhardt ML, Zhang Y, Erxleben CF, Padilla-Banks E, McDonough CE, Miao YL,
Armstrong DL, and Williams CJ. “CaV3.2 T-type channels mediate Ca2+ entry
during oocyte maturation and following fertilization.” Journal of Cell Science 128
(2015): 4442-4452.
Bezanilla M, and Wadsworth P. “Spindle positioning: actin mediates pushing and
pulling.” Current Biology 19 (2009): R168-R169.
Bielak-Zmijewska A, Kolano A, Szczepanska K, Maleszewski M and, Borsuk E. “Cdc42
protein acts upstream of IQGAP1 and regulates cytokinesis in mouse oocytes
and embryos.” Developmental Biology 322 (2008): 21-32
Blandau RJ, and Jordan ES. “The effect of delayed fertilization on the development of
the rat ovum.” American Journal of Anatomy 68 (1941): 275-291.
Blandau RJ, and Young WC. “The effects of delayed fertilization on the development of
the guinea pig ovum.” American Journal of Anatomy 64 (1939): 303-329.
Bosgraaf L, and van Haastert PJM. “The regulation of myosin II in dictyostelium.”
European Journal of Cell Biology 85 (2006): 969-979.
Bootman MD, Collins TJ, Peppiatt CM, Prothero LS, MacKenzie L, De Smet P, Travers
M, Tovey SC, Seo JT, Berridge MJ, Ciccolini F, and Lipp P. “Calcium signalling-an overview.” Seminars in Cell and Development Biology 12 (2001): 3-10.
28
Brunet S, and Maro B. ”Cytoskeleton and cell cycle control during meiotic maturation of
the mouse oocyte: integrating time and space.” Reproduction 130 (2005); 801811.
Brunet S, and Verlhac MH. “Positioning to get out of meiosis: the asymmetry of division.”
Human Reproduction Update 17 (2011): 68-75.
Carvacho I, Lee HC, Fissore RA, and Clapham DE. “TRPV3 channels mediate
strontium-induced mouse-egg activation.” Cell Reports 5 (2013): 1375–1386.
Cayouette S, and Boulay G. “Intracellular trafficking of TRP channels.” Cell Calcium 42
(2007): 225-232.
Cayouette S, Bousquet SM, Francoeur N, Dupré E, Monet M, Gagnon H, Guedri YB,
Lavoie C, and Boulay G. “Involvement of Rab9 and Rab11 in the intracellular
trafficking of TRPC6.” Biochimica et Biophysica Acta 1803 (2010): 805-812.
Chaigne A, Verlhac MH, and Terret ME. ”Spindle positioning in mammalian oocytes.”
Experimental Cell Research 318 (2012): 1442-1447.
Chaigne A, Campillo C, Gov NS, Voituriez R, Azoury J, Uman ̃a-Diaz C, Almonacid M,
Queguiner I, Nassoy P, Sykes C, Verlhac MH, and Terret ME. “A soft cortex is
essential for asymmetric spindle positioning in mouse oocytes.” Nature Cell
Biology 15 (2013): 958-966.
Chaigne A, Campillo C, Gov NS, Voituriez R, Sykes C, Verlhac MH, and Terret ME. “A
narrow window of cortical tension guides asymmetric spindle positioning in the
mouse oocyte.” Nature Communications 19 (2015): 6027.
Chebotareva T, Taylor J, Mullins JJ, and Wilmut I. “Rat eggs cannot wait: Spontaneous
exit from meiotic metaphase II-arrest.” Molecular Reproduction and Development
78 (2011): 795-807.
29
Cheon B, Lee HC, Wakai T, and Fissore RA. “Ca2+ influx and the store-operated Ca2+
entry pathway undergo regulation during mouse oocyte maturation.” Molecular
Biology of the Cell 24 (2013): 1396-1410.
Cho WK, Stern S, and Biggers JD. “Inhibitory effect of dibutyryl cAMP on mouse oocyte
maturation in vitro.” Journal of Experimental Zoology 187 (1974): 383-386.
Choi T, Aoki F, Mori M, Yamashita M, Nagahama Y, and Kohmoto K. “Activation of
p34cdc2 protein kinase activity in meiotic and mitotic cell cycles in mouse
oocytes and embryos.” Development 113 (1991): 789-795.
Clapham DE. “TRP channels as cellular sensors.” Nature 426 (2003): 517-524.
Colledge WH, Carlton MBI, Udy GB, and Evans MJ. “Disruption of c-mos cause
parthenogenetic development of unfertilized mouse eggs.” Nature 370 (1994):
65-68.
Conti M, Hsieh M, Zamah AM, and Oh JS. “Novel signaling mechanisms in the ovary
during oocyte maturation and ovulation.” Molecular and Cellular Endicrinology
356 (2012): 65-73.
Cowan CR, and Hyman AA. “Centrosomes direct cell polarity independently of
microtubule assembly in C. elegans embryos.” Nature 431 (2004): 92-96.
Cui XS, Li XY, and Kim NH. “Cdc42 is implicated in polarity during meiotic resumption
and blastocyst formation in the mouse.” Molecular Reproduction and
Development 76 (2007): 785-794.
D'Avino PP, Savoian MS, and Glover DM. “Cleavage furrow formation and ingression
during animal cytokinesis: a microtubule legacy.” Journal of Cell Science 118
(2005): 1549-1558.
Dalo DT, McCaffery JM, and Evans JP. “Ultrastructural analysis of egg membrane
abnormalities in post-ovulatory aged eggs.” International Journal of Development
Biology 52 (2008): 535-544.
30
Dan C, Kelly A, Bernard O, and Minden A. “Cytoskeletal changes regulated by the PAK4
serine/threonine kinase are mediated by LIM kinase 1 and cofilin.” Journal of
Biological Chemistry 276 (2001): 115-121.
de Lanerolle P, and Paul RJ. “Myosin phosphorylation/dephosphorylation and regulation
of airway smooth muscle contractility.” American Journal of Physiology 261
(1991): 1-14.
de Vante ́ry C, Gavin AC, Vassalli JD and Schorderet-Slatkine S. “An accumulation of
p34cdc2 at the end of mouse oocyte growth correlates with the acquisition of
meiotic competence.” Developmental Biology 174 (1996): 335-344.
de Vante ́ry C, Stutz A, Vassalli JD, and Schorderet-Slatkine S. “Acquisition of meiotic
competence in growing mouse oocytes is controlled at both translational and
posttranslational levels.” Developmental Biology 187 (1997): 43-54.
Deng M, Williams CJ, and Schultz RM. “Role of MAP kinase and myosin light chain
kinase in chromosome-induced development of mouse egg polarity.”
Developmental Biology 278 (2005): 358-366.
Derganc J, Bozic B, Sventina S, and Zeks B. “Stability analysis of micropipette aspiration
of neutrophils.” Biophysical Journal 79 (2000): 153-162.
Dorée M, and Hunt T. “From Cdc2 to Cdk1: when did the cell cycle kinase join its cyclin
partner?” Journal of Cell Science 115 (2002): 2461-2464.
Drechsel DN, Hyman AA, Hall A, and Glotzer M. ”A requirement for Rho and Cdc42
during cytokinesis in Xenopus embryos.” Current Biology 7 (1997): 12-23.
Duan X, Liu J, Dai XX, Liu HL, Cui XS, Kim NH, Wang ZB, Wang Q, and Sun SC. “RhoGTPase effector ROCK phosphorylates cofilin in actin-meditated cytokinesis
during mouse oocyte meiosis.” Biology of Reproduction 90 (2014): 1-9.
31
Ducibella T, and Fissore R. “The roles of Ca2+, downstream protein kinases, and
oscillatory signaling in regulating fertilization and the activation of development.”
Developmental Biology 315 (2008): 257-279.
Dumont J, Million K, Sunderland K, Rassinier P, Lim H, Leader B, and Verlhac MH.
“Formin-2 is required for spindle migration and for the late steps of cytokinesis in
mouse oocytes Developmental Biology 301 (2007): 254-265.
Dumont J, Petri S, Pellegrin F, Terret ME, Bohnsack MT, Rassinier P, Georget V, Kalab
P, Gruss OJ, and Verlhac MH. “A centriole- and RanGTP-independent spindle
assembly pathway in meiosis I of vertebrate oocytes.” Journal of Cell Biology 176
(2007): 295-305.
Dupré A, Haccard O, and Jessus C. “Mos in the oocyte: how to use MAPK
independently of growth factors and transcription to control meiotic divisions.”
Journal of Signal Transduction 2011(2011): 350-412.
Edwards DC, Sanders LC, Bokoch GM, and Gill GN. “Activation of LIM-kinase by Pak1
couples Rac/Cdc42 GTPase signaling to actin cytoskeletal dynamics.” Nature
Cell Biology 5 (1999): 253-259.
Effler JC, Iglesias PA, and Robinson DN. “A mechanosensory system controls cell
shape changes during mitosis.” Cell Cycle 6 (2007): 30-35.
Egelhoff TT, Lee RJ, and Spudich JA. “Dictyostelium myosin heavy chain
phosphorylation sites regulate myosin filament assembly and localization in vivo.”
Cell 75 (1993): 363-371.
Eichenlaub-Ritter U, Chandley AC, and Gosden RG. “Alterations to the microtubular
cytoskeleton and increased disorder of chromosome alignment in spontaneously
ovulated mouse oocytes aged in vivo: an immunofluorescence study.”
Chromosoma 94 (1986): 337-345.
32
El-Mezgueldi M, Bagshaw CR. in Myosins (ed. Coluccio, L. M.) 55–93 (Springer, The
Netherlands, 2007).
Elbaz J, Reizel Y, Nevo N, Galiani D, and Dekel N. “Epithelial cell transforming protein 2
(ECT2) depletion blocks polar body extrusion and generates mouse oocytes
containing two metaphase II spindles.” Endocrinology 151 (2010): 755-765.
Eppig JJ, Vivieros MM, Marin-Bivens C, and De La Fuente R. “Regulation of mammalian
oocyte maturation.” In The Ovary (2004): 113-129.
Eppig JJ, Wigglesworth K, Pendola F, and Hirao Y. “Murine oocytes suppress
expression of luteinizing hormone receptor messenger ribonucleic acid by
granulosa cells.” Biology of Reproduction 56 (1997): 976-984.
Erickson GF, and Sorensen RA. “In vitro maturation of mouse oocytes isolated from late,
middle, and pre-antral graafian follicles.” Journal of Experimental Zoology 190
(1974): 123-127.
Fabritius AS, Ellefson ML, and McNally FJ. “Nuclear and spindle positioning during
oocyte meiosis.” Current Opinion in Cell Biology 23 (2011): 78-84.
Fan HY, and Sun QY. “Involvement of mitogen-activated protein kinase cascade during
oocyte maturation and fertilization in mammals.” Biology of Reproduction 70
(2004): 535-547.
Feske S, Gwack Y, Prakriya M, Srikanth S, Puppel SH, Tanasa B, Hogan PG, Lewis RS,
Daly M, and Rao A. “A mutation in Orai1 causes immune deficiency by
abrogating CRAC channel function. Nature 441 (2006): 179-185.
Finer JT, Simmons RM, and Spudich JA. “Single myosin molecule mechanics:
piconewton forces and nanometer steps” Nature 368 (1994): 113-119.
Fissore RA, Kurokawa M, Knott J, Zhang M, and Smyth J. “Mechanisms underlying
oocyte activation and postovulatory aging.” Reproduction 124 (2002): 745-754.
33
Gibson WT, Veldhuis JH, Rubinstein B, Cartwright HN, Perrimon N, Brodland GW,
Nagpal R, and Gibson MC. “Control of the mitotic cleavage plane by local
epithelial topology.” Cell 144 (2011): 427-428.
Goud AP, Goud PT, Diamon MP, Van Oostveldt P, and Hughes MR. “Microtubule
turnover in ooplasm biopsy reflects ageing phenomena in the parent oocyte.”
Reproductive BioMedicine Online 11 (2005): 43-52.
Gougeon A. “Regulation of ovarian follicular development in primates: facts and
hypotheses.” Endocrine Reviews 17 (1996): 121-155.
Greka A, Navarro B, Oancea E, Duggan A, and Clapham DE. “TRPC5 is a regulator of
hippocampal neurite length and growth cone morphology.” Nature Neuroscience
6 (2003): 837-45.
Gu Y, and Gu C. “Physiological and pathological functions of mechanosensitive ion
channels.” Molecular Neurobiology 50 (2014): 339-347.
Guerrero R, and Lanctot CA. “Aging of fertilizing gametes and spontaneous abortion:
Effect of the day of ovulation and the time of insemination.” American Journal of
Obstetrics and Gynecology 104 (1970): 263-267.
Guerrero R, and Rojas OI. “Spontaneous abortion and aging of human ova and
spermatozoa.” New England Journal of Medicine 297 (1975): 573-575.
Haccard O, Jessus C, Rime H, Goris J, Merlevede W, and Ozon R. “Mitogen-activated
protein kinase (MAP kinase) activation in Xenopus oocytes: roles of MPF and
protein synthesis.” Molecular Reproduction and Development 36 (1993): 96-105.
Halet G, and Carroll J. “Rac activity is polarized and regulates meiotic spindle stability
and anchoring in mammalian oocytes.” Developmental Cell 12 (2007): 309-317.
Hampl, A, and Eppig JJ. “Analysis of the mechanism(s) of metaphase I arrest in
maturing mouse oocytes.” Development 121 (1995): 925-933.
34
Hansen DV, Tung JJ, and Jackson PK. “CaMKII and polo-like kinase 1 sequentially
phosphorylate the cytostatic factor Emi2/XErp1 to trigger its destruction and
meiotic exit.” Proceedings of the National Academy of Sciences 103 (2006): 608613.
Hashimoto N, and Kishimoto T. “Regulation of meiotic metaphase by a cytoplasmic
maturation-promoting factor during mouse oocyte maturation.” Developmental
Biology 126 (1988): 242-252.
Hashimoto N, Watanabe N, Furuta Y, Tamemoto H, Sagata N, Yokoyama M, Okazaki K,
Nagayoshi M, Takeda N, Ikawa Y, and Aizawa S. “Parthenogenetic activation of
oocytes in c-mos-deficient mice.” Nature 370 (1994): 68-71.
Herbert M, Levasseur M, Homer H, Yallop K, Murdoch A, and McDougall A. “Homologue
disjunction in mouse oocytes requires proteolysis of securin and cyclin B1.”
Nature Cell Biology 5 (2003): 1023-1025.
Hirano T, Murakami M, Fukada T, Nishida K, Yamasaki S, and Suzuki T. “Roles of zinc
and zinc signaling in immunity: zinc as an intracellular signaling molecule.”
Advances in Immunology 97 (2008): 149-176.
Hirao Y, and Eppig JJ. “Parthenogenetic development of Mos-deficient mouse oocytes.
Molecular Reproduction and Development 48 (1997): 391-396.
Holmes, K. C. in Myosins (ed. Coluccio, L. M.) 35–54 (Springer, The Netherlands, 2007).
Holt JE, Lane SI, and Jones KT. “The control of meiotic maturation in mammalian
oocytes.” Current Topics in Developmental Biology 102 (2013): 207-226.
Holubcová Z, Blayney M, Elder K, and Schuh M. “Human oocytes. Error-prone
chromosome-mediated spindle assembly favors chromosome segregation
defects in human oocytes.” Science 348 (2015): 1143-1147.
Hoyt MA, Totis L, Roberts BT. “S. cerevisiae genes required for cell cycle arrest in
response to microtubule function” Cell 66 (1991): 507-517.
35
Igusa Y, and Miyazaki S. “Effects of altered extracellular and intracellular calcium
concentration on hyperpolarizing responses of the hamster egg.” The Journal of
Physiology 340 (1983): 611-632.
Ishizaki T, Maekawa M, Fujisawa K, Okawa K, Iwamatsu A, Fujita A, Watanabe N, Saito
Y, Kakizuka A, Morii N, and Narumiya S. “The small GTP-binding protein Rho
binds to and activates a 160 kDa Ser/Thr protein kinase homologous to myotonic
dystrophy kinase.” The EMBO Journal 15 (1996): 1885-1893.
Jaffe LA, and Cross NL. “Electrical properties of vertebrate oocyte membranes.” Biology
of Reproduction 30 (1984): 50-54.
Jang WI, Jo YJ, Kim HC, Jia JL, Namgoong S, and Kim NH. “Non-muscle tropomyosin
(Tpm3) is crucial for asymmetric cell division and maintenance of cortical integrity
in mouse oocytes.” Cell Cycle 13 (2014): 2359-2369.
Johnson MH, Eager D, Muggleton-Harris AL, and Graves HM. “Mosaicism in the
organisation of concanavalin A receptors on surface membrane of mouse eggs.”
Nature 257 (1975): 321-322.
Jones KT. “Mammalian egg activation: from Ca2+ spiking to cell cycle progression.”
Reproduction 130 (2005): 813-823.
Jones, KT. “Intracellular calcium in the fertilization and development of mammalian
eggs.” Clinical and Experimental Pharmacology and Physiology 34 (2007): 10841089.
Jones KT, Carroll J, and Whittingham DG. “Ionomycin, thapsigargin, ryanodine, and
sperm induced Ca2+ release increase during meiotic maturation of mouse
oocytes.” Journal of Biological Chemistry 270 (1995): 6671-6677.
Kaji N, Muramoto A, and Mizuno K. “LIM Kinase-mediated Cofilin Phosphorylation during
Mitosis Is Required for Precise Spindle Positioning.” Journal of Biological
Chemistry 283 (2008): 4982-4992.
36
Kalab P, Kubiak JZ, Verlhac MH, Colledge WH, and Maro B. “Activation of p90rsk during
meiotic maturation and first mitosis in mouse oocytes and eggs: MAP kinaseindependent and -dependent activation.” Development 122 (1996): 1957-1964.
Kanatsu-Shinohara M, Schultz RM, and Kopf GS. “Acquisition of meiotic competence in
mouse oocytes: absolute amounts of p34cdc2, cyclin B1, cdc25C, and wee1 in
meiotically incompetent and competent oocytes.” Biology of Reproduction 63
(2000): 1610-1616.
Kee YS, and Robinson DN. “Micropipette aspiration for studying cellular
mecahnosensory responses and mechanics.” Methods in Molecular Biology 983
(2013): 367-382.
Kim AM, Vogt S, O’Halloran TV, and Woodruff TK. “Zinc availability regulates exit from
meiosis in maturing mammalian oocytes.” Nature Chemical Biology 6 (2010):
674-681.
Kim AM, Bernhardt ML, Kong BY, Ahn RW, Vogt S, Woodruff TK, and O’Halloran TV.
“Zinc sparks are triggered by fertilization and facilitate cell cycle resumption in
mammalian eggs.” ACS Chemical Biology 6 (2011): 716-723.
Kiuchi T, Ohashi K, Kurita S, and Mizuno K. “Cofilin promotes stimulus-induced
lamellipodium formation by generating an abundant supply of actin monomers.”
Journal of Cell Biology 177 (2007): 465-476.
Kiuchi T, Nagai T, Ohashi K, Watanabe N, and Mizuno K. “Live-cell imaging of G-actin
dynamics using sequential FDAP.” Bioarchitecture 5 (2011): 240-244.
Klemke RL, Cai S, Giannini AL, Gallagher PJ, de Lanerolle P, and Cheresh DA.
“Regulation of cell motility by mitogen-activated protein kinase.” Journal of Cell
Biology 137 (1997): 481-492.
37
Kline D, and Kline JT. “Repetitive calcium transients and the role of calcium in
exocytosis and cell cycle activation in the mouse egg.” Developmental Biology
149 (1992): 80-89.
Knott JG, Kurokawa M, Fissore RA, Schultz RM, and Williams CJ. “Transgenic RNA
interference reveals role for mouse sperm phospholipase Czeta in triggering Ca2+
oscillations during fertilization.” Biology of Reproduction 72 (2005): 992-996.
Komatsu S, and Ikebe M. “ZIP kinase is responsible for the phosphorylation of myosin II
and necessary for cell motility in mammalian fibroblasts.” Journal of Cell Biology
165 (2004): 243-254.
Kong BY, Bernhardt ML, Kim AM, O’Halloran TV, and Woodruff TK. “Zinc maintains
prophase I arrest in mouse oocytes through regulation of the MOS-MAPK
pathway.” Biology of Reproduction 87 (2012): 11.
Kong BY, Duncan FE, Que EL, Kim AM, O’Halloran TV, Woodruff TK. “Maternally –
derived zinc transporters ZIP6 and ZIP10 drive the mammalian oocyte-to-egg
transition.” Molecular Human Reproduction 20 (2014): 1077-1089.
Kosako H, Yoshida T, Matsumura F, Ishizaki T, Narumiya S, and Inagaki M. “Rhokinase/ROCK is involved in cytokinesis through the phosphorylation of myosin
light chain and not ezrin/radixin/moesin proteins at the cleavage furrow.”
Oncogene 19 (2000): 6059-6064.
Krauchunas AR, and Wolfner MF. “Molecular changes during egg activation.” Current
Topics in Development Biology 102 (2013): 267-292.
Kubiak JZ, Weber M, de Pennart H, Winston NJ, and Maro BThe metaphase II arrest
in mouse oocytes is controlled through microtubule-dependent destruction of
cyclin B in the presence of CSF.” The EMBO Journal 12 (1993): 3773- 3778.
Kunda P, Pelling AE, Liu T, and Baum B. “Moesin controls cortical rigidity, cell rounding,
and spindle morphogenesis during mitosis.” Current Biology 18 (2008): 91-101.
38
Kyozuka K, Chun JT, Puppo A, Gragnaniello G, Garante E, and Santella L. “Actin
cytoskeleton modulates calcium signaling during maturation of starfish oocytes.”
Developmental Biology 310 (2008): 426-435.
Larson SM, Lee HJ, Hung PH, Matthews LM, Robinson DN, and Evans JP. “Cortical
mechanics and meiosis II completion in mammalian oocytes are mediated by
myosin-II and Ezrin-Radixin-Moesin (ERM) proteins.” Molecular Biology of the
Cell 21 (2010): 3182-3192.
Leader B, Lim H, Carabatsos MJ, Harrington A, Ecsedy J, Pellman D, Maas R, and
Leder P. “Formin-2, polyploidy, hypofertility and positioning of the meiotic spindle
in mouse oocytes.” Nature Cell Biology 4 (2002): 921-928.
Ledan E, Polanski Z, Terret ME, and Maro B. “Meiotic maturation of the mouse oocyte
requires an equilibrium between cyclin B synthesis and degradation.”
Developmental Biology 232 (2001): 400-413.
Leblanc J, Zhang X, McKee D, Wang ZB, Li R, Ma C, Sun QY, and Liu XJ. “The small
GTPase Cdc42 promotes membrane protrusion during polar body emission via
ARP2-nucleated actin polymerization.” Molecular Human Reproduction 17
(2011): 305-316.
Lee B, Palermo G, and Machaca K. “Downregulation of store-operated Ca2+ entry during
mammalian meiosis is required for the egg-to-embryo transition.” Journal of Cell
Science 126 (2013): 1672-1681.
Lee SR, Xu YN, Jo YJ, Namgoong S, and Kim NH. “The Rho-GTPase effector ROCK
regulates meiotic maturation of the bovine oocyte via myosin light chain
phosphorylation and cofilin phosphorylation.” Molecular Reproduction and
Development 82 (2015): 849-858.
39
Leung T, Chen XQ, Manser E, and Lim L. “The p160 RhoA-binding kinase ROKá is a
member of a kinase family and is involved in the reorganization of the
cytoskeleton.” Molecular Cell Biology 16 (1996): 5313-5327.
Leung T, Chen XQ, Tan I, Manser E, and Lim L. “Myotonic dystrophy kinase-related
Cdc42-binding kinase acts as a Cdc42 effector in promoting cytoskeletal
reorganization.” Molecular Cell Biology 18 (1998): 130-140.
Li H, Guo F, Rubinstein B, and Li R. “Actin-driven chromosomal motility leads to
symmetry breaking in mammalian meiotic oocytes.” Nature Cell Biology 10
(2008): 1301-1308.
Lim D, Lange K, and Santella L. “Activation of oocytes by latrunculin A”. Federation of
American Studied for Experimental Biology 16 (2002): 1050-1056.
Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell JE Jr, and Meyer T. “STIM is a
Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx.” Current
Biology 15 (2005): 1235-1241.
Liu J, and Maller JL. “Calcium elevation at fertilization coordinates phosphorylation of
XErp1/Emi2 by Plx1 and CaMK II to release metaphase arrest by cytostatic
factor.” Current Biology 15 (2005): 1458-1468.
Lohka MJ, Hayes MK, and Maller JL. “Purification of maturation-promoting factor, an
intracellular regulator of early mitotic events.” Proceedings of the National
Academy of Sciences 85 (1988): 3009-3013.
Longo FJ, and Chen DY. “Development of cortical polarity in mouse eggs: involvement
of the meiotic apparatus.” Developmental Biology 107 (1985): 382-394.
Longo FJ. “Ultrastructural changes in rabbit eggs aged in vivo.” Biology of Reproduction
11 (1974): 22-39.
40
Longo FJ. “Organization of microfilaments in sea urchin (Arbacia punctulata) eggs at
fertilization: effects of cytochalasin B.” Developmental Biology 74 (1980): 422433.
Lu H, Guizzetti M, and Costa LG. “Inorganic lead activates the mitogen-activated protein
kinase kinase-mitogen-activated protein kinase-p90(RSK) signaling pathway in
human astrocytoma cells via a protein kinase C-dependent mechanism.” Journal
of Pharmacology and Experimental Therapeutics 300 (2002): 818-823.
Ma C, Benink HA, Cheng D, Montplaisir V, Wang L, Xi Y, Zheng PP, Bement WM, and
Liu XJ. “Cdc42 activation couples spindle positioning to first polar body formation
in oocyte maturation.” Current Biology 16 (2006): 214-220.
Madgwick S, and Jones KT. “How eggs arrest at metaphase II: MPF stabilisation plus
APC/C inhibition equals Cytostatic Factor.” Cell Division 2 (2007): 4.
Madgwick S, Levasseur M, and Jones KT. “Calmodulin -dependent protein kinase II, and
not protein kinase C, is sufficient for triggering cell-cycle resumption in
mammalian eggs.” Journal of Cell Science 118 (2005): 3849-3859.
Madgwick S, Hansen DV, Levasseur M, Jackson PK, and Jones KT “Mouse Emi2 is
required to enter meiosis II by reestablishing cyclin B1 during interkinesis.” The
Journal of Cell Biology 174 (2006); 791-801.
Maekawa M, Ishizaki T, Boku S, Watanabe N, Fujita A, Iwamatsu A, Obinata T, Ohashi
K, Mizuno K, and Narumiya S. “Signaling from Rho to the actin cytoskeleton
through protein kinases ROCK and LIM-kinase.” Science 285 (1999): 895-898.
Mailhes JB, Young D, and London SN. “Postovulatory ageing of mouse oocytes in vivo
and premature centromere separation and aneuploidy.” Biology of Reproduction
58 (1998): 1206-1210.
41
Markoulaki S, Matson S, and Ducibella T. “Fertilization stimulates long- lasting
oscillations of CaMKII activity in mouse eggs.” Developmental Biology 272
(2004): 15-25.
Maro B, and Verlhac MH. “Polar body formation: new rules for asymmetric divisions.”
Nature Cell Biology 4 (2002): E281-283.
Maro B, Johnson MH, Pickering SJ, and Flach G. “Changes in actin distribution during
fertilization of the mouse egg.” Journal of Embryology and Experimental
Morphology 81 (1984): 211-237.
Maro B, Johnson MH, Webb M, and Flach G. “Mechanism of polar body formation in the
mouse oocyte: an interaction between the chromosomes, the cytoskeleton and
the plasma membrane.” Journal of Embryology and Experimental Morphology 92
(1986): 11-32.
Marston JH, and Chang MC. “The fertilizable life of ova and their morphology following
delayed insemination in mature and immature mice.” The Journal of
Experimental Zoology 155 (1964): 237-252.
Martinac B. "The ion channels to cytoskeleton connection as potential mechanism of
mechanosensitivity." Biochimica et Biophysica Acta 1838 (2014): 682-691.
Masui Y, and Markert CL. “Cytoplasmic control of nuclear behavior during meiotic
maturation of frog oocytes." The Journal of Experimental Zoology 177 (1971):
129-145.
Masui Y. “The elusive cytostatic factor in the animal egg.” Nature Review Molecular Cell
Biology 1 (2000): 228-232.
Matsui T, Amano M, Yamamoto T, Chihara K, Nakafuku M, Ito M, Nakano T, Okawa K,
Iwamatsu A, and Kaibuchi K. “Rho-associated kinase, a novel serine/threonine
kinase, as a putative target for small GTP binding protein Rho.” The EMBO
Journal 15 (1996): 2208–2216.
42
Matsumura F, Totsukawa G, Yamakita Y, and Yamashiro S. “Role of myosin light chain
phosphorylation in the regulation of cytokinesis.” Cell Structure and Function 26
(2001): 639-644.
Matzke R, Jacobson K, and Radmacher M. “Direct, high-resolution measurement of
furrow stiffening during division of adherent cells.” Nature Cell Biology 3 (2001):
607-610.
McGinnis LA, Lee HJ, Robinson DN, and Evans JP. “MAPK3/1 (ERK1/2) and Myosin
Light Chain Kinase in Mammalian Eggs Affect Myosin-II Function and Regulate
the Metaphase II State in a Calcium- and Zinc-Dependent Manner.“ Biology of
Reproduction 92 (2015): 146.
Mehlmann LM, Mikoshiba K, and Kline D. “Redistribution and increase in cortical inositol
1,4,5- trisphosphate receptors after meiotic maturation of the mouse oocyte.”
Developmental Biology 180 (1996): 489- 498.
Mehlmann LM, Saeki Y, Tanaka S, Brennan TJ, Evsikov AV, Pendola FL, Knowles BB,
Eppig JJ, and Jaffe LA. “The Gs-linked receptor GPR3 maintains meiotic arrest in
mammalian oocytes.” Science 306 (2004): 1947-1950.
Mehlmann LM. “Stops and starts in mammalian oocytes: recent advances in
understanding the regulation of meiotic arrest and oocyte maturation.”
Reproduction 130 (2005): 791-799.
Meyer NE, Joel-Almagor T, Frechter S, Minke B, and Huber A. “Subcellular translocation
of the eGFP-tagged TRPL channel in Drosophila photoreceptors requires
activation of the phototransduction cascade.” Journal of Cell Science 119 (2006):
2592-2603.
43
Miao YL, Kikuchi K, Sun QY, and Schatten H. “Oocyte aging: cellular and molecular
changes, developmental potential and reversal possibility.” Human Reproduction
Update 15 (2009): 573-585.
Miao Y L, and Williams CJ. “Calcium signaling in mammalian egg activation and embryo
development: the influence of subcellular localization.” Molecular Reproduction
and Development 79 (2012): 742-756.
Minc N, Burgess D, and Chang F. “Influence of cell geometry on division-plane
positioning.” Cell 144 (2011): 414-426.
Mizuno K. “Signaling mechanisms and functional roles of cofilin phosphorylation and
dephosphorylation.” Cellular Signaling 25 (2013): 457-469.
Moore GP, Linten-Moore S, Peters H, and Faber M. “RNA synthesis in the mouse
oocyte.” Journal of Cell Biology 60 (1974): 416-422.
Moore GD, Ayabe T, Visconti PE, Schultz RM, and Kopf GS. “Roles of heterotrimeric
and monomeric G proteins in sperm-induced activation of mouse eggs.”
Development 120 (1994): 3313-3323.
Moos J, Visconti PE, Moore GD, Schultz RM, and Kopf GS. “Potential role of mitogenactivated protein kinase in pronuclear envelope assembly and disassembly
following fertilization of mouse eggs.” Biology of Reproduction 53 (1995): 692699.
Moos J, Xu Z, Schultz RM, and Kopf GS. “Regulation of nuclear envelope assembly/
disassembly by MAP kinase.” Developmental Biology 175 (1996): 358-361.
Mooseker MS, and Foth BJ. in Myosins (ed. Coluccio, L. M.) 1–34 (Springer, The
Netherlands, 2007).
Morgan DO. “Regulation of the APC and the exit from mitosis.” Nature Cell Biology 1
(1999): 47-53.
44
Moriyama K, Iida K, and Yahara I “Phosphorylation of Ser-3 of cofilin regulates its
essential function on actin.” Genes Cells 1 (1996): 73-86.
Murata-Hori M, Fumoto K, Fukuta Y, Iwasaki T, Kikuchi A, Tatsuka M, and Hosoya H.
“Myosin II regulatory light chain as a novel substrate for AIM-1, an aurora/Ipl1prelated kinase from rat.” Journal of Biochemistry 128 (2000): 903-907.
Murphy CT, Rock RS, and Spudich JA. “A myosin II mutation uncouples ATPase activity
from motility and shortens step size.” Nature Cell Biology 3 (2001): 311-315.
Murray AW, and Kirschner MW. “Dominoes and clocks: the union of two views of the cell
cycle.” Science 246 (1989): 614-621.
Mussachio A, and Hardwick KG. “The spindle checkpoint: structural insights into
dynamic signaling.” Nature Reviews Molecular Cell Biology 731 (2002): 731-741.
Na J, and Zernicka-Goetz M. “Asymmetric position and organization of the meiotic
spindle of mouse oocytes requires CDC42 function.” Current Biology 16 (2006):
1249-1254.
Nader N, Kulkarni RP, Dib M, and Machaca K. “How to make a good egg!: The need for
remodeling of oocyte Ca(2+) signaling to mediate the egg-to-embryo transition.:
Cell Calcium 53 (2013): 41-54.
Niederman R, and Pollard TD. “Human platelet myosin. II. In vitro assembly and
structure of myosin filaments.” Journal of Cell Biology 67 (1975): 72-92.
Nishida E, Maekawa S, and Sakai H. “Cofilin, a protein in porcine brain that binds to
actin filaments and inhibits their interactions with myosin and tropomyosin.”
Biochemistry 23 (1984): 5307-5313.
Ohashi K, Nagata K, Maekawa M, Ishizaki T, Narumiya S, and Mizuno K. “Rhoassociated kinase ROCK activates LIM-kinase 1 by phosphorylation at threonine
508 within the activation loop.” Journal of Biological Chemistry 275 (2000): 35773582.
45
Ono S. “Mechanism of depolymerization and severing of actin filaments and its
significance in cytoskeletal dynamics.” International Review of Cytology 258
(2007): 1-82.
Palmiter RD. “The elusive function of metallothioneins.” Proceedings of the National
Academy of Sciences 95 (1998): 8428-8430.
Palmiter RD. “Protection against zinc toxicity by metallothionein and zinc transporter 1.”
Proceedings of the National Academy of Sciences 101 (2004): 4918-4923.
Peng XR, Hsueh AJ, LaPolt PS, Bjersing L, and Ny T. “Localization of luteinizing
hormone receptor messenger ribonucleic acid expression in ovarian cell types
during follicle development and ovulation.” Endocrinology 129 (1991): 32003207.
Peres A. “The calcium current of mouse egg measured in physiological calcium and
temperature conditions.” Journal of Physiology 391 (1987): 573-588.
Peters JM. “The anaphase-promoting complex: proteolysis in mitosis and beyond.”
Molecular Cell 9 (2002): 931-943.
Petrunewich MA, Trimarchi JR, Hanlan AK, Hammer MA, and Baltz JM. “Second meiotic
spindle integrity requires MEK/MAP kinase activity in mouse eggs.” Journal of
Reproduction and Development 55 (2009): 30-38.
Pfender S, Kuznetsov V, Pleiser S, Kerkhoff E, and Schuh M. “Spire-type actin
nucleators cooperate with Formin-2 to drive asymmetric oocyte division.” Current
Biology 21 (2011): 955-960.
Piekny AJ, and Mains PE. “Rho-binding kinase (LET-502) and myosin phosphatase
(MEL-11) regulate cytokinesis in the early Caenorhabditis elegans embryo.”
Journal of Cell Science 115 (2002): 2271-2282.
46
Pincus G, and Enzmann EV. “The comparative behavior or mammalian eggs in vivo and
in vitro: The activation of ovarian eggs.” Journal of Experimental Medicine 62
(1935): 665-675.
Plant TD. "TRPs in mechanosensing and volume regulation." Handbook of Experimental
Pharmacology 223 (2014): 743-766.
Pollard TD, and Borisy GG. “Cellular motility driven by assembly and disassembly of
actin filaments.” Cell 112 (2003): 453-65.
Poukkula M, Kremneva E, Serlachius M, and Lappalainen P. “Actin-depolymerizing
factor homology domain: a conserved fold performing diverse roles in
cytoskeletal dynamics.” Cytoskeleton 68 (2011): 471-490.
Rauh NR, Schmidt A, Bormann J, Nigg EA, and Mayer TU. “Calcium triggers exit from
meiosis II by targeting the APC/C inhibitor XErp1 for degradation.” Nature 437
(2005): 1048-1052.
Reichl EM, Effler JC, and Robinson DN. “The stress and strain of cytokinesis.” Trends in
Cell Biology 15 (2005): 200-206.
Reichl EM, Ren Y, Morphew MK, Delannoy M, Effler JC, Girard KD, Divi S, Iglesias PA,
Kuo SC, and Robinson DN. “Interactions between myosin and actin crosslinkers
control cytokinesis contractility dynamics and mechanics.” Current Biology 18
(2008): 471-480.
Roos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S, Safrina O, Kozak
JA, Wagner SL, Cahalan MD, Veliçelebi G, and Stauderman KA. “STIM1, an
essential and conserved component of store-operated Ca2+ channel function.”
Journal of Cell Biology 169 (2005): 435-445.
Rosenblatt J, Cramer LP, Baum B, and McGee KM. “Myosin II-dependent cortical
movement is required for centrosome separation and positioning during mitotic
spindle assembly.” Cell 117 (2004): 361-372.
47
Sagata N, Watanabe N, Vande Woude GF, and Ikawa Y. “The c-mos proto-oncogene
product is a cytostatic factor responsible for meiotic arrest in vertebrate eggs."
Nature 342 (1989): 512-518.
Saunders CM, Larman MG, Parrington J, Cox LJ, Royse J, Blayney LM, Swann K, and
Lai FA. “PLC zeta: a sperm-specific trigger of Ca2+ oscillations in eggs and
embryo development.” Development 129 (2002): 3533-3544.
Schmidt A Duncan PI, Rauh NR, Sauer G, Fry AM, Nigg EA, and Mayer TU. “Xenopus
polo-like kinase Plx1 regulates XErp1, a novel inhibitor of APC/C activity.” Genes
and Development 19 (2005): 502-513.
Schuh M, and Ellenberg J. “A new model for asymmetric spindle positioning in mouse
oocytes.” Current Biology 18 (2008): 1986-1992.
Shohat G, Shani G, Eisenstein M, and Kimchi A. “The DAP-kinase family of proteins:
study of a novel group of calcium-regulated death-promoting kinases.”
Biochimica et Biophysica Acta 1600 (2002): 45-50.
Shoji S, Yoshida N, Amanai M, Ohgishi M, Fukui T, Fujimoto S, Nakano Y, Kajikawa E,
and Perry AC. “Mammalian Emi2 mediates cytostatic arrest and transduces the
signal for meiotic exit via Cdc20.” The EMBO Journal 25 (2006): 834-845.
Simerly C, Nowak G, de Lanerolle P, and Schatten G. “Differential expression and
functions of cortical myosin IIA and IIB isotypes during meiotic maturation,
fertilization, and mitosis in mouse oocytes and embryos.” Molecular Biology of
the Cell 9 (1998): 2509-2525.
Somlyo AP, and Somlyo AV. “Signal transduction by G-proteins, rho-kinase and protein
phosphatase to smooth muscle and non-muscle myosin II.” Journal of Physiology
522 (2000): 177-185.
48
Somlyo AP, and Somlyo AV. “Ca2+ sensitivity of smooth muscle and nonmuscle myosin
II: modulated by G proteins, kinases, and myosin phosphatase.” Physiological
Reviews 83 (2003): 1325-1358.
Sorensen RA, and Wassarman PM. “Relationship between growth and meiotic
maturation of the mouse oocyte.” Developmental Biology 50 (1976): 531-536.
Spiering D, and Hodgson L. “Dynamics of the Rho-family small GTPases in actin
regulation and motility.” Cell Adhesion and Migration 5 (2011): 170-180.
Stanyon CA, and Bernard O. “LIM-kinase1.” International Journal of Biochemistry and
Cell Biology 31 (1999): 389-394.
Stewart MP, Helenius J, Toyoda Y, Ramanathan SP, Muller DJ, and Hyman AA.
“Hydrostatic pressure and the actomyosin cortex drive mitotic cell rounding.”
Nature 469 (2011): 226-230.
Suarez SS, and Pacey AA. “Sperm transport in the female reproductive tract.” Human
Reproduction Update 12 (2006): 23-37.
Sumi T, Matsumoto K, and Nakamura T. “Cofilin phosphorylation and actin cytoskeletal
dynamics regulated by rho- and Cdc42-activated LIM-kinase 2.” Journal of Cell
Biology 147 (1999): 1519-1532.
Sumi T, Matsumoto K, and Nakamura T. “Specific activation of LIM kinase 2 via
phosphorylation of threonine 505 by ROCK, a Rho-dependent protein kinase.”
Journal of Biological Chemistry 276 (2001): 670-676.
Suzuki T, Suzuki E, Yoshida N, Kubo A, Li H, Okuda E, Amanai M, and Perry ACF.
“Mouse Emi2 as a distinctive regulatory hub in second meiotic metaphase.”
Development 137 (2010): 3281-3291.
Suzuki T, Yoshida N, Suzuki E, Okuda E, and Perry ACF. “Full-term mouse
development by abolishing Zn2+ dependent metaphase II arrest without Ca2+
release.” Development 137 (2010): 2659-2669.
49
Svitkina TM, Verkhovsky AB, and Borisy GG. “Improved procedures for electron
microscopic visualization of the cytoskeleton of cultured cells.” Journal of
Structural Biology 115 (1995): 290-303.
Swann K., Larman MG, Saunders CM, and Lai FA. “The cytosolic sperm factor that
triggers Ca2+ oscillations and egg activation in mammals is a novel
phospholipase C: PLCzeta.” Reproduction 127 (2004): 431-439.
Szollosi D. “Morphological changes in mouse eggs due to aging in the fallopian tube.”
American Journal of Anatomy 130 (1971): 209-225.
Takahashi T, Igarashi H, Amita M, Hara S, Matsuo K, and Kurachi H. “Molecular
mechanism of poor embryo development in postovulatory aged oocytes: mini
review.” The Journal of Obstetrics and Gynaecology Research 39 (2013):
143101439.
Tarin JJ, Perez-Albala S, and Cano A. “Consequences on offspring of abnormal function
in ageing gametes.” Human Reproduction Update 6 (2000): 532-549.
Taylor SS, Scott MI, and Holland AJ. “The spindle checkpoint: a quality control
mechanism which ensures accurate chromosome segregation.” Chromosome
Research 12 (20040: 599-616.
Tian X, and Diaz FJ. “Zinc depletion causes multiple defects in ovarian function during
the periovulatory period in mice.” Endocrinology 153 (2011): 873-886.
Tong C, Fan HY, Chen DY, Song XF, Schatten H, and Sun QY. “Effects of MEK inhibitor
U0126 on meiotic progression in mouse oocytes: microtubule organization,
asymmetric division, and metaphase II arrest.” Cell Research 13 (2003): 375383.
50
To ̈rnell J, Billig H and Hillensjo T. “Resumption of rat oocyte meiosis is paralleled by a
decrease in guanosine 3’,5’-cyclic monophosphate (cGMP) and is inhibited by
microinjection of cGMP.” Acta Physiologica Scandinavica 139 (1990): 511-517.
Tripathi A, Kumar KV, and Chaube SK. “Meiotic cell cycle arrest in mammalian oocytes.”
Journal of Cell Physiology 223 (2010): 592-600.
Tsurumi C, Hoffmann S, Geley S, Graeser R, and Polanski Z. “The spindle assembly
checkpoint is not essential for CSF arrest of mouse oocytes.” Journal of Cell
Biology 167 (2004): 1037-1050.
Tung JJ, Hansen DV, Ban KH, Loktev AV, Summers MK, Adler JR III, and Jackson PK.
“A role for the anaphase-promoting complex inhibitor Emi2/ XErp1, a homolog of
early mitotic inhibitor 1, in cytostatic factor arrest of Xenopus eggs.” Proceedings
of the National Academy of Sciences 102 (2005): 4318-4323.
Tunquist BJ, and Maller JL. “Under arrest: cytostatic factor (CSF)-mediated metaphase
arrest in vertebrate eggs.” Genes and Development 17 (2003): 683-710.
Van Blerkom J, and Bell H. “Regulation of development in the fully grown mouse oocyte:
chromosome-mediated temporal and spatial differentiation of the cytoplasm and
plasma membrane.” Journal of Embryology and Experimental Morphology 93
(1986): 213-238.
Vanoverberghe K, Lehen'kyi V, Thébault S, Raphaël M, Vanden Abeele F, Slomianny C,
Mariot P, and Prevarskaya N. “Cytoskeleton reorganization as an alternative
mechanism of store-operated calcium entry control in neuroendocrinedifferentiated cells.” PLoS One 7 (2012): e45615.
Verlhac MH, De Pennett H, Maro B, Cobb M, and Clarke HJ. “MAP kinase becomes
stably activated at metaphase and is associated with microtubule-organizing
51
centers during meiotic maturation of mouse oocytes.” Developmental Biology 158
(1993): 330-340.
Verlhac MH, Kubiak JZ, Clarke HJ, and Maro B. “Microtubule and chromatin behavior
follow MAP kinase activity but not MPF activity during meiosis in mouse oocytes.”
Development 120 (1994): 1017-1025.
Verlhac MH, Kubiak JZ, Weber M, Géraud G, Colledge WH, Evans MJ, and Maro B.
“Mos is required for MAP kinase activation and is involved in microtubule
organization during meiotic maturation in the mouse.” Development 122 (1996):
815-822.
Verlhac MH, Lefebvre C, Guillaud P, Rassinier P, and Maro B. “Asymmetric division in
mouse oocytes: with or without Mos.” Current Biology 10 (2000): 1303-1306.
Verlhac MH, Lefebvre C, Kubiak JZ, Umbhauer M, Rassinier P, Colledge W, and Maro
B. “Mos activates MAP kinase in mouse oocytes through two opposite
pathways.” The EMBO Journal 19 (2000): 6065-6074.
Vig M, Peinelt C, Beck A, Koomoa DL, Rabah D, Koblan-Huberson M, Kraft S, Turner H,
Fleig A, Penner R, and Kinet JP. “CRACM1 is a plasma membrane protein
essential for store-operated Ca2+ entry.” Science 312 (2006): 1220-1223.
Wang ZB, Jiang ZZ, Zhang QH, Hu MW, Huang L, Ou XH, Guo L, Ouyang YC, Hou Y,
Brakebusch C, Schatten H, and Sun QY. “Specific deletion of Cdc42 does not
affect meiotic spindle organization/migration and homologous chromosome
segregation but disrupts polarity establishment and cytokinesis in mouse
oocytes.” Molecular Biology of the Cell 24 (2013): 3832-3841.
Webb M, Howlett SK, and Maro B. “Parthenogenesis and cytoskeletal organization in
ageing mouse eggs.” Journal of Embryology and Experimental Morphology 95
(1986): 131-145.
52
Wendt T, Taylor D, Trybus KM, and Taylor K. “Three-dimensional image reconstruction
of dephosphorylated smooth muscle heavy meromyosin reveals asymmetry in
the interaction between myosin heads and placement of subfragment 2.”
Proceedings of the National Academy of Sciences 98 (2001): 4361-4366.
Wilcox AJ, Weinberg CR, and Baird DD. “Post-ovulatory ageing of the human oocyte
and embryo failure.” Human Reproduction 13 (1998): 394-397.
Winston NJ, McGuinness O, Johnson MH, and Maro B. “The exit of mouse oocytes from
meiotic M-phase requires an intact spindle during intracellular calcium release.”
The Journal of Cell Science 108 (1995): 143-151.
Winston NJ. “Stability of cyclin B protein during meiotic maturation and the first mitotic
cell division in mouse oocytes.” Biological Cell 89 (1997): 211-219.
Woolner S, O'Brien LL, Wiese C, and Bement WM. “Myosin-10 and actin filaments are
essential for mitotic spindle function.” Journal of Cell Biology 182 (2008): 77-88.
Wortzman GB, and Evans JP. “Membrane and cortical abnormalities in post-ovulatory
aged eggs: analysis of fertilizability and establishment of the membrane block to
polyspermy.” Molecular Human Reproduction 11 (2005): 1-9.
Xiong B, Yu LZ, Wang Q, Ai JS, Yin S, Liu JH, OuYang YC, Hou Y, Chen DY, and Zou
H. “Regulation of intracellular MEK1/2 translocation in mouse oocytes:
cytoplasmic dynein/dynactin-mediated pole- ward transport and cyclin B
degradation-dependent release from spindle poles.” Cell Cycle 6 (2007): 15211527.
Xu, Z, Abbott A, Kopf GS, Schultz RM, and Ducibella T. “Spontaneous activation of
ovulated mouse eggs: time-dependent effects on M-phase exit, cortical granule
exocytosis, maternal messenger ribonucleic acid recruitment, and inositol 1,4,5trisphosphate sensitivity.” Biology of Reproduction 57 (1997): 743-750.
53
Yanez LZ, Han J, Behr BB, Pera RA, and Camarillo DB. “Human oocyte developmental
potential is predicted by mechanical properties within hours after fertilization.”
Nature Communications 7 (2016). 10809.
Yang N, Higuchi O, Ohashi K, Nagata K, Wada A, Kangawa K, Nishida E, and Mizuno K.
“Cofilin phosphorylation by LIM-kinase 1 and its role in Rac-mediated actin
reorganization.” Nature 393 (1998): 809-812.
Yasui Y, Amano M, Nagata K, Inagaki N, Nakamura H, Saya H, Kaibuchi K, and Inagaki
M. “Roles of Rho-associated kinase in cytokinesis; mutations in Rho-associated
kinase phosphorylation sites impair cytokinetic segregation of glial filaments.”
Journal of Cell Biology 143 (1998): 1249-1258.
Yi K, Unruh JR, Deng M, Slaughter BD, Rubinstein B, and Li R. “Dynamic maintenance
of asymmetric meiotic spindle position through ARP2/3- complex-driven
cytoplasmic streaming in mouse oocytes.” Nature Cell Biology 13 (2011): 12511258.
Yu H. “Regulation of APC-Cdc20 by the spindle checkpoint.” Current Opinions in Cell
Biology 14 (2002): 706-714.
Yi K, Rubinstein B, and Li R. “Symmetry breaking and polarity establishment during
mouse oocyte maturation.” Philosophical transactions of the royal society of
London 368 (2013): 20130002.
Yu L, Xiong B, Gao W, Wang C, Zhong Z, Huo L, Wang Q, Hou Y, Liu K, and Liu XJ.
“MEK1/2 regulates microtubule organization, spindle pole tethering and
asymmetric division during mouse oocyte meiotic maturation.” Cell Cycle 6
(2007): 1522-1527.
Zachariae W, and Nasmyth K. “Whose end is destruction: cell division and the
anaphase-promoting complex.” Genes and Development 13 (1999): 2039-2058.
54
Zeleznik AJ. “The physiology of follicle selection.” Reproductive Biology and
Endocrinology 2 (2004): 31.
Zhang SL, Yeromin AV, Zhang XH, Yu Y, Safrina O, Penna A, Roos J, Stauderman KA,
and Cahalan MD. “Genome-wide RNAi screen of Ca2+ influx identifies genes that
regulate Ca2+ release-activated Ca2+channel activity.” Proceedings of the National
Academy of Sciences 103 (2006): 9357-9362.
Zhang X, Ma C, Miller AL, Katbi HA, Bement WM, and Liu XJ. “Polar body emission
requires a RhoA contractile ring and Cdc42-mediated membrane protrusion.”
Developmental Cell 15 (2008): 386-400.
Zhang Y, Duan X, Cao R, Liu HL, Cui XS, Kim NH, Rui R, and Sun SC. “Small GTPase
RhoA regulates cytoskeleton dynamics during porcine oocyte maturation and
early embryo development.” Cell Cycle 13 (2014): 3390-3403.
55
Figure 1.1
Overview of meiotic maturation and egg activation
The oocyte is arrested at prophase I of meiosis in the ovary from before birth until the
time of ovulation. A prophase I oocyte is characterized by the presence of an intact
germinal vesicle (GV), another name for the nucleus. Following the appropriate signals,
the germinal vesicle undergoes germinal vesicle breakdown (GVBD), and the
metaphase I spindle (composed of microtubules; labeled in green) forms in the center of
the oocyte. The cytoplasmic actin meshwork forms a symmetric cloud surrounding the
spindle. When the spindle begins to translocate to the cortex, a symmetry-breaking
event occurs, and the actin cloud becomes asymmetric and lags behind the spindle.
Following emission of the first polar body, the spindle orients itself parallel to the cortex,
an actin cap (labeled in red) forms at the region of the cortex overlying the DNA (labeled
in blue), and the egg is now arrested at metaphase II. The transition from prophase I to
metaphase II is referred to as meiotic maturation. The egg remains arrested at
metaphase II until fertilization triggers the egg to exit from M-phase and complete the
second meiotic division. The events from metaphase II egg to zygote are referred to as
egg activation.
56
Meiotic Maturation
PB1
Prophase I
Metaphase I
GVBD
Anaphase I
Egg Activation
Metaphase II
Anaphase II
57
Telophase II
Telophase I
Metaphase II
Figure 1.2
Maintenance of metaphase II arrest and regulation of exit from metaphase II arrest
(Panel A) A metaphase II-arrested egg has a low intracellular calcium concentration and
high zinc concentration compared to other stages of meiosis. Intracellular zinc binds to
the early mitotic inhibitor 2 (Emi2), which binds and inhibits the anaphase- promoting
complex (APC), preventing progression through meiosis II. (Panel B) Following
fertilization, (1) sperm releases soluble phospholipase C (PLCζ), that hydrolyzes
phosphatidylinositol 4,5-bisphosphate (PIP2) within the egg to IP3 and diacylglycerol. IP3
travels through the cytoplasm to the IP3 receptor on the endoplasmic reticulum (ER), and
(2) releases intracellular calcium stores. (3) The intracellular rise in calcium initiates a
signaling cascade involving calmodulin-dependent protein kinase II gamma (CaMKIIγ),
which binds to and activates the APC, resulting in exit from metaphase II arrest. (4)
Calcium influx from the extracellular environment is required in order to complete
meiosis II in mouse oocytes. (5) The decreased intracellular concentrations of zinc
release Emi2, which can no longer bind and inhibit the APC, resulting in exit from MII
arrest.
58
A
Maintenance of
metaphase II arrest
[Zn2+] = 0.37 nm
[Ca2+] = 0.1 μM
Zn2+
Ca2+
Zn2+
Zn2+
Zn2+
Zn2+
Zn
n22++
Zn2+
Emi2
STOP
APC
Zn2+
Metaphase II
arrest
Ca2+
Ca2+
ER
B
Exit from
metaphase II arrest
Ca2+
Zn2+
Zn2+
Zn2+
= 0.29 nm
[Ca2+] = 1-3 μM
Zn2+
Zn2+
Zn2+
Sperm
DNA
Ca2+
[Zn2+]
Zn2+
Ca2+
Zn2+
4
Zn2+
Ca2+
5
Zn2+
Zn2+
Emi2
Metaphase II
Exit
APC
PLC activity
1
Ca2+
3
Ca2++ Ca2+
2
IP3
IP3R
Ca2+
Ca2+
Ca2+
ER
59
CaMKIIγ
Ca2+
Ca2+
Ca2+
Figure 1.3
Pathways of interest to thesis research
(A) ERK1/2-type MAPKs in eggs have multiple functions in mammalian female meiosis
including cortical reorganization, microtubule organization, cortical softening at
metaphase I, and maintenance of metaphase II arrest. Mos phosphorylates and
activates MEK1/2 which phosphorylates and activates MAPK3/1 (ERK1/2). (B) The
hypothetical model for myosin-II mediated contractility in oocytes. MEK1/2
phosphorylates and activates MAPK3/1. MAPK3/1 activates MLCK, which
phosphorylates MRLC. (C) ROCK phosphorylates and activates LIMK1/2. This
phosphorylation event enhances the ability of LIMK1/2 to phosphorylate its only
downstream effector, cofilin. Cofilin, an actin-binding protein that induces actin filament
depolymerization, is inactivated following phosphorylation. Phosphorylation and
inactivation of cofilin results in increased actin polymerization.
60
A
B
C
MEK1/2
Mos
ROCK
MEK1/2
MAPK3/1
(ERK1/2)
MAPK3/1
(ERK1/2)
Myosin Light
Chain Kinase
Myosin Regulatory
Light Chain
Cortical reorganization
Microtubule organization
Cortical softening at metaphase I
Maintenance of metaphase II arrest
Myosin-mediated
Contractility
61
LIMK1/2
Cofilin
Reduced actin-severing
Increased actin polymerization
Figure 1.4
Actin networks that mediate spindle positioning in mouse oocytes.
Spindle positioning is dependent upon two actin networks; a cytoplasmic actin meshwork
and cortical F-actin. The first actin network that mediates spindle positioning is the
dynamic cytoplasmic actin meshwork (left and middle panel). Dynamic actin filaments
form a symmetric cloud surrounding the spindle. Following a symmetry-breaking event,
the actin cloud becomes asymmetric and lags behind the chromosomes as the spindle
translocates towards the cortex. Polymerization of actin initially pushes the spindle
towards the cortex. As the spindle approaches the cortex, cortical F-actin begins to
thicken (right panel). There is an exclusion of myosin-II from the cortex, and an
associated decrease in cortical tension. Pole-localized myosin-II pulling on actin
contributes to spindle translocation and anchoring beneath the cortex. Figure adapted
from Bezanilla and Wadsworth, 2009.
62
Cytoplasmic Actin
Cortical Actin
Pulling
force
ell
Myosin
F-actin
cloud
Asymmetric
F-actin
cloud
Pushing force
towards cortex
Symmetric
Actin Cloud
Symmetry-Breaking Event
Asymmetric Actin Cloud
63
Pushing force
towards cortex
Cortical actin thickening
Myosin-II exclusion from the cortex
Decreased cortical tension
CHAPTER 2
MAPK3/1 (ERK1/2) and Myosin Light Chain Kinase in mammalian eggs affect
myosin-II function and regulate the metaphase II state in a calcium- and zincdependent manner
I. ABSTRACT
Vertebrate eggs are arrested at metaphase of meiosis II, a state classically
known as cytostatic factor (CSF) arrest. Maintenance of this arrest until the time of
fertilization and then fertilization-induced exit from metaphase II are crucial for
reproductive success. Another key aspect of this meiotic arrest and exit is regulation of
the metaphase II spindle, which must be appropriately localized adjacent to the egg
cortex during metaphase II, and then progress into successful asymmetric cytokinesis to
produce the second polar body. This work examined the MAPKs MAPK3 and MAPK1
(also known as ERK1/2) as regulators of these two related aspects of mammalian egg
biology, specifically testing whether this MAPK pathway affected myosin-II function and
whether myosin-II perturbation would produce some of the same effects as MAPK
pathway perturbation. Inhibition of the MEK1/2-MAPK pathway with U0126 leads to
reduced levels of phosphorylated myosin-regulatory light chain (pMRLC) and causes a
reduction in cortical tension, effects that are mimicked by treatment with the myosin light
chain kinase (MLCK) inhibitor ML-7. These data indicate that one mechanism by which
the MAPK pathway acts in eggs is by affecting myosin-II function. We further show that
MAPK or MLCK inhibition induces loss of normal cortical spindle localization or
parthenogenetic egg activation. This parthenogenesis is dependent on cytosolic and
extracellular calcium, and can be rescued by hyperloading eggs with zinc, suggesting
that these effects of inhibition of MLCK or the MAPK pathway are linked with
dysregulation of ion homeostasis.
64
II. INTRODUCTION
Vertebrate eggs are arrested at metaphase of meiosis II, a state classically
known as cytostatic factor (CSF) arrest (Masui and Markert, 1971). Completion of
meiosis is normally triggered by the fertilizing sperm; this exit from metaphase II arrest is
known as egg activation. Inability to exit from metaphase II arrest upon fertilization is
associated with female infertility (Backs et al., 2010; Oh et. al, 2011). Proper
maintenance of metaphase II arrest in unfertilized eggs is also crucial for reproductive
success, with failure of eggs to maintain metaphase II arrest being associated with
reduced female fertility (Colledge et al., 1994; Hashimoto et al., 1994; Verlhac et al.,
1996; Yesilaltay et. al, 2014). Reduced ability to maintain metaphase II arrest is also
observed in eggs with down-regulated activity of EMI2, CDC25A, or PP2A, with reduced
levels of cytosolic zinc, or undergoing post-ovulatory aging (Shoji et al., 2006; Oh et al.,
2013; Chung et al., 2011; Suzuki et al., 2010; Kim et al., 20133; Bernhardt et al., 2012;
Marston et al., 1964; Lord et al., 2013). A related crucial component of the metaphase II
state is spatial control of the meiotic spindle, to maintain spindle integrity and set up the
asymmetric cytokinesis of second polar body emission. Defects in cytokinesis and the
segregation of oocyte cytoplasmic components are associated with reduced female
fertility (e.g., Ubaldi et al., 2008; De Santis et al., 2005; Sharan et al., 2004; Levi et al.,
2010; Luo et al., 2010). These temporal and spatial aspects of the metaphase II egg are
controlled by interconnected machinery, and our work here has focused on the MAPK
pathway, specifically MAPK1 (mitogen-activated protein kinase 1, also known as
p42mapk or ERK2) and MAPK3 (mitogen-activated kinase 3, also known as ERK1 or
p44erk1).
Control of the metaphase II state in vertebrate eggs is achieved on multiple
levels. Sustained CDK1 activity in the metaphase II egg maintains M-phase, and
decreased CDK1 activity helps mediate exit from metaphase II. A complementary level
65
of control is mediated by the anaphase-promoting complex (APC) (Jones 2011; Homer
2013). The APC is a multimeric E3 ubiquitin ligase; its substrates include cyclin B1 and
securin, which are targeted for 26S proteasomal degradation upon ubiquitylation (Jones
2011; Pines 2006). APC activity is suppressed in the metaphase II egg, then the APC
becomes active upon metaphase II exit. The protein EMI2 (endogenous meiotic inhibitor
2, also known as FBXO43) controls the inactive state of the APC in metaphase II (Shoji
et al., 2006; Tung et al., 2005). EMI2 is regulated by zinc and by the Mos-MEK-MAPK
pathway. The Mos-MEK-MAPK pathway is essential for metaphase II arrest; oocytes
from mos-/- mice and eggs treated with the MEK1/2 inhibitor U0126 undergo
parthenogenetic activation (Colledge et al., 1994; Hashimoto et al., 1994; Verlhac et al.,
1996; Hirao and Eppig, 1997; Phillips et al., 2002; Tong et al., 2003). U0126-induced
parthenogenesis is characterized by CDK1 inactivation and reduced phosphorylation of
EMI2 (Phillips et al., 2002; Miyagaki et al., 2014). Parthenogenetic exit from metaphase
II is also induced in eggs treated with the zinc chelator TPEN (Suzuki et al., 2010; Kim et
al., 2011; Bernhardt et al., 2012). TPEN-induced parthenogenetic activation is
prevented by overexpressing EMI2; this rescue appears to be dependent on zinc binding
to EMI2, as overexpression of EMI2 with a mutation of a residue in the zinc-binding
domain has significantly less of this preventative effect (Suzuki et al., 2010).
Calcium is another major factor controlling exit from metaphase II (reviewed in
(Ducibella et. al, 2008; Miao and Williams, 2012)). In mouse eggs, calcium works
through CaMKIIγ (CAMK2G) (Backs et al., 2010; Chang et al., 2009). EMI2 appears to
be a substrate for CaMKIIγ in mouse eggs (Medvedev et al., 2014), and based on what
is known from Xenopus, this phosphorylation of EMI2 primes EMI2 for degradation
(Tung et al., 2005; Rauh et al., 2005). Interestingly, zinc loss from the egg is associated
with increased cytosolic calcium. Fertilization and parthenogenesis induced by reagents
that increase cytosolic calcium (e.g., SrCl2, calcium ionophore) are accompanied by
66
bursts of efflux of zinc, called “zinc sparks,” and this zinc efflux seems to be required for
inactivation of EMI2 and subsequent activation of the APC (Kim et al., 2011; Bernhardt
et al., 2010).
Transitions in the meiotic cell cycle must be coordinated with the function of the
metaphase II spindle and cortical cytoskeleton, and the Mos-MEK-MAPK pathway also
plays a role in this aspect of oocyte biology. MAPK is active through the two meiotic
divisions in oocytes, and remains high through egg activation after CDK1 activity has
declined in fertilized eggs (Verlhac et al., 1994; Moos et al., 1995; Petrunewich et al.,
2009; Gonzalez-Garcia et al., 2014). Mos-deficient oocytes and oocytes treated with
U0126 during meiotic maturation have cortical cytoskeleton abnormalities and elongated
metaphase I spindles that fail to migrate to the oocyte periphery, setting up aberrant
cytokinesis in the first meiotic division (Colledge et al., 1994; Hashimoto et al., 1994;
Verlhac et al., 1996; Hirao and Eppig, 1997; Tong et al., 2003; Choi et al., 1996;
Chaigne et al., 2013). Metaphase II eggs treated with U0126 develop abnormal
spindles, including loss of normal localization adjacent to the egg cortex (Petrunewich et
al., 2009).
Our study here examines the connection between MAPK3/1 activity and cortical
cytoskeleton function, testing the hypothesis that MAPK3/1 inhibition would result in
abnormal function of non-muscle myosin-II in metaphase II eggs. In other cell types,
MAPK1/3 functions upstream of myosin light chain kinase (MLCK); MLCK
phosphorylates myosin regulatory light chain (MRLC, also known as MYL9), which
enables myosin-II organization into bipolar thick filaments (Klemke et al., 1997; Nguyen
et al., 1999; Vicente-Manzanares et al., 2009). Myosin-II functions in several events of
the mammalian oocyte’s meiotic transitions. The actomyosin cytoskeleton undergoes
significant changes through meiosis I, with cortical tension and actin and myosin-II
rearrangements mediating proper spindle positioning (Chaigne et al., 2013; Larson et al.,
67
2010; Azoury et al., 2011). In meiosis I, MLCK inhibition and other myosin perturbations
impair spindle migration and first polar body emission (Chaigne et al., 2013; Simerly et
al., 1998; Schuh and Ellenberg, 2008). In metaphase II eggs, suppression of MLCK
activity reduces cortical tension, inhibits DNA-induced remodeling of the cortical
cytoskeleton, causes failure of post-fertilization spindle rotation and second polar body
emission, and impairs cortical granule exocytosis and sperm-triggered actomyosin
cytoplasmic movements (Larson et al., 2010; Deng et al., 2005; Matson et al., 2006;
Deng et al., 2007; Ajduk et al., 2011). The work here builds on our work showing that
myosin-II-mediated cell mechanics in the egg cortex play a role in spindle function during
exit from metaphase II (Larson et al., 2010), and tests the hypothesis that MEK-MAPK
pathway perturbation affects myosin-II function in metaphase II eggs. These studies
have uncovered new functions of the actomyosin cytoskeleton and the MEK-MAPK3/1MLCK pathway in mammalian eggs.
III. MATERIALS AND METHODS
Collection and manipulation of ovulated metaphase II eggs
Animals were used in accordance with the guidelines of the Johns Hopkins
University Animal Care and Use Committee. Ovulated metaphase II eggs were
collected from 6-8-week old female CF-1 mice (Harlan, Indianapolis, IN), which were
injected intraperitoneally with 10 IU pregnant mare serum gonadotropin (PMSG;
Calbiochem/Millipore, Billerica, MA) 60 h prior to egg collection, and then with 10 IU
human chorionic gonadotropin (Sigma, St. Louis, MO) 13-14 h prior to egg collection.
Post-ovulatory aged eggs were injected with 10 IU human chorionic gonadotropin 22 h
prior to egg collection. Mice were sacrificed by CO2 inhalation and cervical dislocation.
Oviducts were removed and placed in Whitten's medium (109.5 mM NaCl, 4.7 mM KCl,
1.2 mM KH2PO4, 1.2 mM MgSO4, 5.5 mM glucose, 0.23 mM pyruvic acid, 4.8 mM lactic
acid hemicalcium salt (Whitten, 1971)) supplemented with 7 mM NaHCO3 and 15 mM
68
HEPES (referred to hereafter as WH medium), as well as 0.025% Type IV-S
hylauronidase (Sigma) and 3 mg/ml BSA (Sigma). Cumulus-egg complexes were
released from the oviducts, and cumulus cells were dissociated from eggs by gentle
pipetting through a thin-bore pipette. Cumulus-free eggs were transferred through 50 μl
drops of WH supplemented with 0.05% polyvinyl alcohol (referred to hereafter as
WH/PVA; Sigma) to wash off residual hylauronidase. Eggs were cultured in Whitten's
medium supplemented with 22 mM NaHCO3 and 0.05% polyvinyl alcohol (referred to
hereafter as WB/PVA), in 5% CO2 in air. The zona pellucida (ZP) was removed with a
brief incubation (~10-15 sec) in acidic culture medium compatible buffer (116.4 mM
NaCl, 5.4 mM KCl, 10 mM HEPES, 1 mM NaH2PO4, 0.8 mM MgSO4, pH 1.5). After ZP
removal, ZP-free eggs were washed through several drops of WB/PVA, and then
cultured in WB/PVA in 5% CO2 in air.
The MEK inhibitor U0126 (Cell Signaling Technologies, Danvers, MA; which
inhibits MEK1/2, also known as mitogen-activated protein kinase kinase 1 and 2, or
MAP2K1/2 (Favata et al., 1998)) was used to treat metaphase II eggs as previously
described (Phillips et al., 2002; Petrunewich et al., 2009; Yu et al., 2007; Nabti et al.,
2014). U0126 was made up as a stock of 10 mM in DMSO, and used to treat eggs at a
concentration 50 μM, based on previous work showing that parthenogenetic activation of
eggs by U0126 was dose-dependent through 8 h of treatment, whereas 100 μM U0126
was cytotoxic to eggs (Phillips et al., 2002). The myosin light chain kinase (MLCK)
inhibitor ML-7 (Sigma; ML-7 inhibits MYLK and the skeletal muscle form, MYLK2) was
used as previously described (Larson et al., 2010; Matson et al., 2006). ML-7 was made
up as a stock of 10 mM in DMSO, and used to treat eggs at a concentration 15 μM
based on past studies of the dose-dependence of ML-7 effects on metaphase II eggs
(Matson et al., 2006). DMSO at a concentration of 0.5% was used as a solvent control.
DMSO, U0126, and ML-7 were diluted in WB/PVA for the treatment of eggs; eggs were
69
cultured in 5% CO2 in air for the times specified (see text and figure legends). ML-7
treatment was done in four-well Nunclon Δ-treated plates (Fisher Scientific; Pittsburgh,
PA) without mineral oil overlay, as done previously (Larson et al., 2010; Matson et al.,
2006; Markoulaki et al., 2004). For some experiments here, eggs were pre-loaded with
the calcium chelator BAPTA-AM (Calbiochem, La Jolla, CA) by culturing eggs in
WB/PVA medium containing 5 µM BAPTA-AM for 60 min as previously described
(Kolega et al., 2004); BAPTA-AM-loaded eggs were washed through five drops of
WB/PVA and allowed to recover for 15 min prior to treatment with U0126, ML-7, or the
solvent control DMSO. For culture of eggs in conditions deficient in extracellular calcium,
calcium-deficient WB/PVA was prepared replacing the 4.8 mM lactic acid hemicalcium
salt with DL-lactic acid sodium salt (Sigma) (Gardner et al., 2007). For some
experiments, eggs were pre-treated with the zinc ionophore zinc pyrithione (ZnPT;
Sigma-Aldrich, St. Louis, MO) by culturing eggs in WB/PVA medium containing 10 µM
ZnPT for 5 min, without an overlay of mineral oil (Kim et al., 2001; Bernhardt et al., 2010;
Kryzak et al., 2013). ZnPT-treated eggs were then washed through five drops of
WB/PVA and allowed to recover for 15 min prior to treatment with U0126, ML-7, or the
solvent control DMSO. For the data presented in Figure 2.11, half of the post-ovulatory
aged eggs were untreated and cultured for 2 h, the other half were treated with 10 µM
ZnPT for 5 min, washed through five drops of WB/PVA and cultured for 2 h.
For a subset of experiments, metaphase II eggs were inseminated in vitro, so
that they would to be induced to undergo normal sperm-induced egg activation. Sperm
were collected from an 8-week old male CD-1 retired breeder by dissecting out the
cauda epididymis and upper 1 cm of vas deferens tissue. Tissue was minced in 125 µl
drops of WB supplemented with 15 mg/ml BSA (EmbryoGro Bovine Albumin; referred to
hereafter as W-B/15), and cultured in 5% CO2 in air for 10 min. Following sperm swimout, 125 μl of this sperm suspension was placed at the bottom of a culture tube of 750 ml
70
W-B/15 and incubated in 5% CO2 in air. After 45 min, the top 220 μl of medium from this
tube, containing a swim-up preparation of sperm, was removed and placed in a fresh
culture tube. Sperm were allowed to capacitate for a total of 3 h. Inseminations were
performed for 3 h in 10 µl drops of W-B/15, containing ten ZP-free- eggs and 100,000
sperm/ml, after which eggs were pipetted through three drops of W-B/15 to remove
loosely attached sperm.
Measurements of effective cortical tension by micropipette aspiration
ZP-free eggs treated with 0.5% DMSO or 50 µM U0126 were subjected to
micropipette aspiration and the effective tension (Teff ) calculated as previously described
in Larson et. al, 2010.
Immunoblotting
General method
Samples of metaphase II egg proteins were prepared by lysing eggs in 10 μl
SDS-PAGE sample buffer (65 mM Tris-HCl, 10% glycerol, 3.0% SDS, 0.02%
bromophenol blue, 2% β-mercaptoethanol pH 6.8, supplemented with 100 μM sodium
orthovanadate to inhibit phosphatase activity) and heated at 100°C for 10 min. Proteins
were separated on SDS-PAGE gels for 90 min at a constant voltage of 120 volts. Gels
were transferred to Immobilon-P PVDF membrane (Millipore) for 75 min at a constant
voltage of 100 volts. Membranes were blocked at room temperature for 2 h in 10 % cold
water fish gelatin (Sigma) in Tris-buffered saline with 0.1% Tween-20 (Sigma) (referred
to hereafter as TBS-T). Membranes were washed with TBS-T at 120 rpm for 15 min,
and then incubated overnight at 4°C in primary antibody (diluted in TBS-T with 3% BSA
and 0.02% NaN3). Membranes were washed for 30 min in TBS-T, treated with
SuperSignal West Pico Chemiluminescent Substrate (Pierce Chemical
Company/Thermo Scientific, Rockford, IL) for 5 min, and then exposed to X-ray film
(Research Products International Corporation, Mount Prospect, IL). Film was scanned
71
using an HP Laser Jet 3390 scanner (Hewlett-Packard Company) and band intensity
was analyzed using ImageJ software (http://rsb.info.nih/gov/ij/). For each blot, an
appropriate exposure time was selected to ensure that no signals were saturated. The
rectangular selection tool was used to select each band and peak intensity was
determined. The area under each peak was calculated as a measure of band intensity.
Band intensities were reported as mean value in arbitrary units (A.U) ± SEM for each
group.
Anti-pMRLC immunoblot
Samples of metaphase II egg proteins were prepared by lysing 90 eggs in 10 μl
SDS-PAGE sample buffer (65 mM Tris-HCl, 10% glycerol, 3.0% SDS, 0.02%
bromophenol blue, 2% β-mercaptoethanol pH 6.8, supplemented with 100 μM sodium
orthovanadate to inhibit phosphatase activity) and heated at 100°C for 10 min. Proteins
were separated on a 12.5% SDS-PAGE gel for 90 min at a constant voltage of 120 volts.
Gel was transferred to Immobilon-P PVDF membrane for 75 min at a constant voltage of
100 volts. Membrane was blocked at room temperature for 2 h in 10 % cold water fish
gelatin in TBS-T. Membranes were washed with TBS-T at 120 rpm for 15 min, and then
incubated overnight at 4°C in anti-pMRLC antibody (catalog #3672, Cell Signaling
Technologies) diluted to 75 ng/ml in TBS-T with 3% BSA and 0.02% NaN3. Membrane
was washed for 30 min in TBS-T, and then incubated for 2 h at room temperature in goat
anti-rabbit immunoglobulin G (IgG) horseradish peroxidase-conjugated secondary
antibody (GAR-HRP, Jackson Immunoresearch; 400 ng/ml) diluted in TBS-T with 5%
BSA. Membrane was washed for 30 min in TBS-T, treated with SuperSignal West Pico
Chemiluminescent Substrate for 5 min, and then exposed to X-ray film.
Anti-MRLC immunoblot
Samples of metaphase II egg proteins were prepared by lysing 90 eggs in 10 μl
SDS-PAGE sample buffer (65 mM Tris-HCl, 10% glycerol, 3.0% SDS, 0.02%
72
bromophenol blue, 2% β-mercaptoethanol pH 6.8) and heated at 100°C for 10 min.
Proteins were separated on a 12.5% (SDS-PAGE gels for 90 min at a constant voltage
of 120 volts. Gel was transferred to Immobilon-P PVDF membrane for 75 min at a
constant voltage of 100 volts. Membrane was blocked at room temperature for 2 h in 10
% cold water fish gelatin in TBS-T. Membrane was washed with TBS-T at 120 rpm for
15 min, and then incubated overnight at 4°C in anti-MRLC antibody (catalog #3671, Cell
Signaling Technologies) diluted to 125ng/ml in TBS-T with 3% BSA and 0.02% NaN3.
Membrane was washed for 30 min in TBS-T, and then incubated for 2 h at room
temperature in goat anti-rabbit immunoglobulin G (IgG) horseradish peroxidaseconjugated secondary antibody (GAR-HRP, Jackson Immunoresearch; 400 ng/ml)
diluted in TBS-T with 5% BSA. Membrane was washed for 30 min in TBS-T, treated
with SuperSignal West Pico Chemiluminescent Substrate for 5 min, and then exposed to
X-ray film.
Anti-MAPK3/1 immunoblot
Samples of metaphase II egg proteins were prepared by lysing 35 eggs in 10 μl
SDS-PAGE sample buffer (65 mM Tris-HCl, 10% glycerol, 3.0% SDS, 0.02%
bromophenol blue, 2% β-mercaptoethanol pH 6.8) and heated at 100°C for 10 min.
Proteins were separated on a 10% SDS-PAGE gels for 90 min at a constant voltage of
120 volts. Gel was transferred to Immobilon-P PVDF membrane for 75 min at a
constant voltage of 100 volts. Membrane was blocked at room temperature for 2 h in 10
% cold water fish gelatin in TBS-T. Membrane was washed with TBS-T at 120 rpm for
15 min, and then incubated overnight at 4°C in anti-MAPK3/1 primary antibody (catalog
#4695, Cell Signaling Technologies) diluted to 98 ng/ml. Membrane was washed for 30
min in TBS-T, and then incubated for 2 h at room temperature in goat anti-rabbit
immunoglobulin G (IgG) horseradish peroxidase-conjugated secondary antibody (GARHRP, Jackson Immunoresearch; 400 ng/ml) diluted in TBS-T with 5% BSA. Membrane
73
was washed for 30 min in TBS-T, treated with SuperSignal West Pico Chemiluminescent
Substrate for 5 min, and then exposed to X-ray film.
pMAPK3/1 immunoblot
Samples of metaphase II egg proteins were prepared by lysing 35 eggs in 10 μl
SDS-PAGE sample buffer (65 mM Tris-HCl, 10% glycerol, 3.0% SDS, 0.02%
bromophenol blue, 2% β-mercaptoethanol pH 6.8, supplemented with 100 μM sodium
orthovanadate to inhibit phosphatase activity) and heated at 100°C for 10 min. Proteins
were separated on a 10% SDS-PAGE gels for 90 min at a constant voltage of 120 volts.
Gel was transferred to Immobilon-P PVDF membrane (Millipore) for 75 min at a constant
voltage of 100 volts. Membrane was blocked at room temperature for 2 h in 10 % cold
water fish gelatin in TBS-T. Membrane was washed with TBS-T at 120 rpm for 15 min,
and then incubated overnight at 4°C in anti-pMAPK3/1 antibody (catalog # 4370, Cell
Signaling Technologies) diluted to 0.15 µg/ml in TBS-T with 3% BSA and 0.02% NaN3.
Membrane was washed for 30 min in TBS-T, and then incubated for 2 h at room
temperature in goat anti-rabbit immunoglobulin G (IgG) horseradish peroxidaseconjugated secondary antibody (GAR-HRP, Jackson Immunoresearch; 400 ng/ml)
diluted in TBS-T with 5% BSA. Membrane was washed for 30 min in TBS-T, treated
with SuperSignal West Pico Chemiluminescent Substrate for 5 min, and then exposed to
X-ray film.
Immunofluorescence and fluorescence microscopy
General method
ZP-free eggs were fixed in 4.0% paraformaldehyde prepared in a 130 mM KCl,
25 mM HEPES, 3 mM MgCl2, 0.06% Triton-X, pH 7.4, for 30 min at 37°C. Eggs are
washed through a drop of PBS, and permeabilized for 15 min in PBS solution containing
0.1% Triton X-100 (Sigma). Fixed and permeabilized eggs were then incubated for 60
min in a blocking solution (PBS containing 0.1% BSA (Sigma), 10% normal goat serum
74
(Invitrogen), and 100 μM sodium orthovandate), and then primary antibody diluted in this
same blocking solution overnight at 4°C. Eggs were washed for 30 min through three
drops of blocking solution, then incubated in secondary antibody for 2 h. Eggs were
washed 3 times over 45 min in blocking solution. Eggs were mounted in 10 μl
Vectashield mounting medium (Vector Laboratories) supplemented with 1.5 μg/ml DAPI
(Sigma).
Imaging was performed on Zeiss Axio Observer Z1 Fluorescence microscope
with a Zeiss Axiocam MRm camera, Apotome optical sectioning and AxioVision software
(Carl Zeiss, Inc). Analysis of the fluorescent intensity of pMRLC and actin signals in the
egg cortex was performed using plot profile line scan analysis in ImageJ software, using
a line of sufficient width to capture the cortical staining with anti-pMRLC antibody or
phalloidin) and starting the scan at the point of the cortex opposite the maternal DNA.
Analysis of the effects of U0126 or ML-7 treatment on the location of the spindle was
performed by viewing each egg by focusing through to optically step from pole to pole.
Quantification of the distance of the spindle from the egg periphery was performed on
the subset of eggs in which the spindle was observed to be within ~6 µm of the equator,
with images taken in the focal plane of the equator of the egg. The distance was
measured using AxioVision software, specifically using the point of the maternal DNA on
the metaphase plate closest to the egg periphery as the start point, and the egg
perimeter as the end point (see Figure 2.3A-C). An egg was classified as having a "MII
drifted spindle" if the DNA was aligned along the metaphase II plate and the spindle
measured 12.5 μm or greater from the cortex.
The intensity of MPM-2 staining was quantified using ImageJ software
(http://rsb.info.nih/gov/ij/). Images used for quantification of the MPM-2 signal were
taken near the equator of the egg and avoiding the metaphase II spindle (since the
metaphase II spindle was labeled by MPM-2 staining). A region of interest (ROI)
75
covering the entire egg was defined, and the fluorescence signal within this egg ROI was
calculated (using the integrated density measurement in ImageJ, a product of the ROI
area and ROI mean gray value). Background fluorescence signal values were obtained
for each image from an identically sized ROI taken outside of the egg; this background
fluorescence signal value was calculated as the mean fluorescence of the background
ROI multiplied by the area of the ROI. The corrected total cell fluorescence value for
each egg was calculated as the integrated density of the egg ROI minus the background
fluorescence signal value.
pMRLC labeling
ZP-free eggs were fixed in 4.0% paraformaldehyde prepared in a 130 mM KCl,
25 mM HEPES, 3 mM MgCl2, 0.06% Triton-X, pH 7.4, for 30 min at 37°C. Eggs are
washed through a drop of PBS, and permeabilized for 15 min in PBS solution containing
0.1% Triton X-100. Fixed and permeabilized eggs were then incubated for 60 min in a
blocking solution, and then anti-pMRLC antibody (catalog #3675, Cell Signaling
Technologies) diluted to 100 ng/ml in this same blocking solution overnight at 4°C. Eggs
were washed for 30 min through three drops of blocking solution, then incubated in
secondary antibody (7.5 μg/ml goat-anti-mouse IgG-FITC) for 2 h. Eggs were washed 3
times over 45 min in blocking solution. Eggs were mounted in 10 μl Vectashield
mounting medium supplemented with 1.5 μg/ml DAPI.
β-tubulin labeling
ZP-free eggs were fixed in 4.0% paraformaldehyde prepared in a 130 mM KCl,
25 mM HEPES, 3 mM MgCl2, 0.06% Triton-X, pH 7.4, for 30 min at 37°C. Eggs are
washed through a drop of PBS, and permeabilized for 15 min in PBS solution containing
0.1% Triton X-100. Fixed and permeabilized eggs were then incubated for 60 min in a
blocking solution, and then anti-β-tubulin antibody (catalog #1799, Epitomics) diluted to
76
1.35 μg/ml in this same blocking solution for 90 min. Eggs were washed for 30 min
through three drops of blocking solution, then incubated in secondary antibody (7.5
μg/ml donkey-anti-rabbit IgG-Texas Red; Jackson Immunoresearch) for 2 h. Eggs were
washed 3 times over 45 min in blocking solution. Eggs were mounted in 10 μl
Vectashield mounting medium supplemented with 1.5 μg/ml DAPI.
MPM-2 and β-tubulin double labeling
ZP-free eggs were fixed in 4.0% paraformaldehyde prepared in a 130 mM KCl,
25 mM HEPES, 3 mM MgCl2, 0.06% Triton-X, pH 7.4, for 30 min at 37°C. Eggs are
washed through a drop of PBS, and permeabilized for 15 min in PBS solution containing
0.1% Triton X-100. Fixed and permeabilized eggs were then incubated for 60 min in a
blocking solution, and 100 μM sodium orthovandate, and then in anti-MPM-2 antibody
(Davis et al., 1983) (Millipore) diluted to 1.25 µg/ml in this same blocking solution
overnight at 4°C. Eggs were washed for 30 min and incubated in anti-β-tubulin antibody
(catalog #1799, Epitomics) diluted to 1.35 μg/ml in blocking solution for 90 min. Eggs
were washed for 30 min through three drops of blocking solution, then incubated in
secondary antibody (7.5 μg/ml goat-anti-mouse IgG-FITC; 7.5 μg/ml donkey-anti-rabbit
IgG-Texas Red; Jackson Immunoresearch) for 2 h. Eggs were washed 3 times over 45
min in blocking solution. Eggs were mounted in 10 μl Vectashield mounting medium
supplemented with 1.5 μg/ml DAPI.
α-tubulin labeling
ZP-free eggs were fixed in 4.0% paraformaldehyde prepared in a 130 mM KCl,
25 mM HEPES, 3 mM MgCl2, 0.06% Triton-X, pH 7.4, for 30 min at 37°C. Eggs are
washed through a drop of PBS, and permeabilized for 15 min in PBS solution containing
0.1% Triton X-100. Fixed and permeabilized eggs were then incubated for 60 min in
blocking solution, and then anti-α-tubulin monoclonal supernatant (clone 12G10;
77
developed by Joseph Frankel and E. Marlo Nelson, obtained from the Developmental
Studies Hybridoma Bank developed under the auspices of the NICHD and maintained
by The University of Iowa, Department of Biology, Iowa City, IA) diluted 1:5 in this same
blocking solution for 90 min. Eggs were washed for 30 min through three drops of
blocking solution, then incubated in secondary antibody (7.5 μg/ml goat-anti-mouse IgGFITC) for 2 h. Eggs were washed 3 times over 45 min in blocking solution. Eggs were
mounted in 10 μl Vectashield mounting medium supplemented with 1.5 μg/ml DAPI.
pMRLC and Filamentous-actin double labeling
ZP-free eggs were fixed in 4.0% paraformaldehyde prepared in a 130 mM KCl,
25 mM HEPES, 3 mM MgCl2, 0.06% Triton-X, pH 7.4, for 30 min at 37°C. Eggs are
washed through a drop of PBS, and permeabilized for 15 min in PBS solution containing
0.1% Triton X-100. Fixed and permeabilized eggs were then incubated for 60 min in a
blocking solution, and then anti-pMRLC antibody (catalog #3675, Cell Signaling
Technologies) diluted to 100 ng/ml in this same blocking solution overnight at 4°C. Eggs
were washed for 30 min through three drops of blocking solution, then incubated in
secondary antibody (7.5 μg/ml goat-anti-mouse IgG-FITC) and in Acti-stain phalloidin555 (140 nM ; Cytoskeleton) for 2 h. Eggs were washed 3 times over 45 min in blocking
solution. Eggs were mounted in 10 μl Vectashield mounting medium supplemented with
1.5 μg/ml DAPI.
Live-cell time-lapse imaging
ZP-free eggs were loaded with DAPI by culturing in WB/PVA medium containing
with 1 μg/ml DAPI for 90 min, then washed through 3 drops of WB/PVA medium. DAPIloaded eggs were placed in 10 μl drops of WB/PVA containing either 0.5 % DMSO, 15
μM ML-7, or 50 μM U0126, in poly-L-lysine-coated MatTek 35 mm glass bottom culture
dishes (MatTek; Ashland, MA), covered with mineral oil. Imaging was performed with
cells at 37°C in 5% CO2 in an environmental control unit, on a Zeiss Observer Z1
78
fluorescence microscope with a Zeiss Axiocam MRm camera, Apotome optical
sectioning and AxioVision software (Carl Zeiss, Inc). Images were acquired using Zeiss
EC Plan-Neofluar 40X objective (numerical aperture 1.3) every 5 min for 3 h, collecting
z-stacks of approximately ten optical sections per egg.
Statistical analyses
Analyses were performed using StatView 5.0 (SAS Institute, Cary, NC). A pvalue less than 0.05 was considered significant. Error bars in figures represent the
standard error of the mean. Kruskal-Wallis tests with Bonferroni-Dunn post hoc testing
were used to analyze immunoblot band intensity data. A one-way analysis of variance
(ANOVA) with Fisher's projected least significant difference post-hoc test was used to
analyze MPM-2 fluorescent intensities. Chi-squared (χ2) tests were used to compare
rates of spontaneous activation. The non-parametric Mann-Whitney U-test was used to
test for statistical significance in effective cortical tension measurements.
IV. RESULTS
Inhibition of the MAPK3/1 pathway in eggs contributes to reduced function of
myosin-II
As noted in the Introduction, MAPK3/1 has multiple functions in metaphase II
eggs, and has been implicated as functioning upstream of MLCK (Klemke et al., 1997;
Nguyen et al., 1999; Deng et al., 2005). We set out to examine the connection between
MAPK signaling and myosin-II function in eggs, and to ascertain the potential
implications of this pathway for metaphase II arrest. U0126 was used to inhibit the
MAPK pathway, through inhibition of the MAPK-activating kinases MEK1 and MEK2
(also known as mitogen-activated protein kinase kinase 1 [MAP2K1] and mitogenactivated protein kinase kinase 2 [MAP2K2], respectively). Studies here used a U0126
dose of 50 μM, based on previous studies of U0126-induced parthenogenetic egg
activation and the finding that doses of 100 µM and higher became cytotoxic to eggs
79
with prolonged cultured time (Phillips et al., 2002). ML-7 was used to inhibit MLCK,
using a dose of 15 μM based on past work (Larson et al., 2010; Matson et al., 2006).
Multiple other studies have used U0126 or ML-7 on mouse oocytes as well (Tong et al.,
2003; Petrunewich et al., 2009; Gonzalez-Garcia et al., 2014; Chaigne et al., 2013;
Schuh and Ellenberg, 2008; Deng et. al., 2005; Deng et al., 2007; Nabti et al., 2014; Li et
al., 2008).
We assessed the effects of these drug treatments on the myosin-II-based
cytoskeleton in three ways. First, immunoblotting revealed U0126-treated and ML-7treated eggs had ~50% the levels of active, phosphorylated myosin regulatory light chain
(pMRLC) compared to control eggs treated with the solvent DMSO (Figure 2.1A, B).
Control, U0126-treated, and ML-7-treated eggs had comparable amounts of total MRLC
(Figure 2.1A, C). Control experiments with anti-MAPK3/1 antibodies and antiphosphoMAPK3/1 (pMAPK3/1) antibodies verified that ML-7 treatment of metaphase II
eggs did not alter MAPK3/1 protein levels or phosphorylation (Figure 2.2A-C), and that
U0126 treatment reduced phosphoMAPK3/1 protein levels (data not shown). Second,
immunofluoresence and image analysis revealed that U0126 or ML-7 treatment affected
pMRLC localization in metaphase II eggs. pMRLC was detected in control metaphase II
eggs in the boundaries of the amicrovillar domain overlying the meiotic spindle (Figure
2.1D, E, J). However, in U0126-treated and ML-7-treated eggs, this pMRLC signal was
greatly reduced (Figure 2.1F-J). Third, as an additional assessment of actomyosin
function in U0126-treated eggs, we examined cortical tension using micropipette
aspiration, providing insight into contractility of the cortical cytoskeleton (Larson et al.,
2010; Derganc et al., 2000; Reichl et al., 2008). Our previous work showed that
treatment of eggs with 15 µM ML-7 reduced effective tension (Teff) in metaphase II eggs
by ~50% in the amicrovillar domain (over the maternal DNA) and microvillar domain (the
domain away from the maternal DNA, and to which sperm bind and fuse) (Larson et al.,
80
2010). U0126-treated metaphase II eggs had similar decreased effective cortical
tension in the amicrovillar and microvillar domains (Figure 2.1J; U0126 treatment
resulted in effective cortical tension being reduced to 56% of control levels in the
microvillar domain, and to 48% of control levels in the amicrovillar domain). Taken
together, these data suggest that inhibition of the MAPK pathway in metaphase II eggs
contributed to dysfunction of non-muscle myosin-II, in a fashion that has similarities to
inhibition of MLCK.
Inhibition of MEK/12 with U0126 or of MLCK with ML-7 causes loss of spindle
localization adjacent to the cortex in a subset of drug-treated metaphase II eggs
Eggs were treated with the solvent control DMSO, 50 µM U0126, or 15 µM ML-7,
and then imaged by time-lapse microscopy or fixed after 3 h treatment and stained to
label the DNA and meiotic spindle, as well as mitotic phospho-proteins (addressed in
more detail below). In eggs exposed to the solvent DMSO, the maternal DNA was
localized directly beneath the cortex for duration of imaging, for a total of 3 h of treatment
(Figure 2.3A, D). However, in a subset of U0126-treated and ML-7-treated eggs, the
metaphase II spindle drifted away from its normal cortical location (Figure 2.3B,C,E,F;
identified as "MII drifted spindle" in Figures 2.4, 2.5, 2.6 2.7, 2.10), in agreement with
another study of MEK inhibition in eggs (Petrunewich et al., 2009). This drifted spindle
phenomenon was observed in 24% of ML-7-treated eggs and 24% of U0126-treated
eggs (Figure 2.4B, C), whereas none of the control eggs had a metaphase II spindle that
drifted from its cortical location (Figure 2.4A). DMSO-treated eggs had spindles that
were a maximum of 10.5 µm from the cortex (mean 5.2 ± 0.4 µm; Figure 2.3G). U0126treated eggs had spindles that were an average of 20.2 ± 2.1 µm from the cortex,
although these fell into two distinct groups: eggs with spindles that were a similar
distance as in DMSO-treated eggs, categorized as "normal MII" (average 6.4 ± 0.8 µm;
range 1.8-11.5 µm), and eggs with spindles that were significantly farther from the
81
cortex, categorized as MII drifted spindle" (average, 32.9 ± 1.4 µm; range 23.5-40.5 µm)
(Figure 2.3G). A similar trend was observed in ML-7-treated eggs. ML-7-treated eggs
had spindles that were an average of 13.9 ± 1.4 µm from the cortex (Figure 2.3G), with a
subset of eggs with spindles that were categorized as "normal MII" (average 5.4 ± 0.5
µm; range 0.8-11.3 µm), and the remaining eggs categorized as MII drifted spindle"
(average, 28.3 ± 1.6 µm; range 15.6-46.4 µm). Complementary studies assessed the
time dependence of this spindle drift, examining eggs fixed at 1.5 or 8 h after the start of
drug treatment (Figures 2.6, 2.7). At the 1.5 h time point, 18/52 ML-7-treated eggs and
4/28 of U0126-treated eggs showed signs of spindle drift (Figure 2.6). At the 8 h time
point, 12/45 ML-7-treated eggs and 5/120 U0126-treated eggs showed signs of spindle
drift (Figure 2.7). A likely explanation for the smaller number of U0126-treated eggs
having mislocalized spindles is that the majority of U0126-treated eggs at this 8 h time
point exited from metaphase II arrest (in agreement with other work (Phillips et al., 2002;
Petrunewich et al., 2009), and addressed below).
Inhibition of MEK/12 with U0126 or of MLCK with ML-7 causes spontaneous
parthenogenetic exit from metaphase II arrest in a subset of drug-treated eggs
A second phenotype detected in U0126-treated eggs is exit from metaphase II
arrest (Phillips et al., 2002). In our studies here, 54% of U0126-treated eggs were in
anaphase or telophase of meiosis II after 3 h after the start of drug treatment (Figure
2.4C). Interestingly, we also observed exit from metaphase II arrest in 34% of the ML-7treated eggs (Figure 2.4B). Further studies assessed the time dependence of this exit
from metaphase II arrest. At 1.5 h after the start of drug treatment, none of the DMSO
control eggs had exited from metaphase II arrest, whereas 10% (5/52) of ML-7-treated
eggs and 29% (8/28) of U0126-treated eggs exited from metaphase II arrest (Figure
2.6). At 8 h after the start of drug treatment, none of the DMSO control eggs had exited
from metaphase II arrest, whereas 58% (26/45) of ML-7-treated eggs and 93%
82
(112/120) of U0126-treated eggs exited from metaphase II arrest (Figure 2.7). The
majority of the eggs that had exited from metaphase II arrest at this 8 h time point had
progressed to a pronuclear-like stage (Figure 2.7), in agreement with previous work
(Phillips et al., 2002; Petrunewich et al., 2009).
U0126-induced or ML-7-induced parthenogenetic exit from metaphase II arrest is
dependent on calcium
Fertilization-induced exit from metaphase II arrest is triggered by an increase in
cytosolic calcium (reviewed in Miao and Williams, 2012). Additionally, extracellular
calcium is required for fertilization-induced meiosis II completion in mouse and for
increased intracellular Ca2+ and egg activation in Drosophila induced in vitro by
ovulation-mimicking stimuli (Miao et al., 2010; Horner and Wolfner, 2008; Kaneuchi et
al., 2015), suggesting that calcium influx is involved in these egg activation events.
Therefore, we tested the hypotheses that (a) U0126-induced or ML-7-induced exit from
metaphase II arrest was dependent on calcium in the egg cytoplasm, and (b) U0126induced or ML-7-induced exit from metaphase II arrest was dependent on extracellular
calcium.
Experiments testing whether intracellular calcium played a role in U0126-induced
or ML-7-induced egg activation used eggs pre-treated with the calcium chelator BAPTAAM, followed by treatment with U0126 or ML-7. We used a dose of 5 μM BAPTA-AM, as
this prevents any detectable increase in cytosolic calcium following fertilization or
treatment with conventional parthenogenetic stimuli, such as the calcium ionophore
A23187 or SrCl2 (Gardner et al., 2007; Kline and Kline 1992). As a control here, we
confirmed that fertilized BAPTA-AM-loaded eggs remained in metaphase II (Figure 2.5B)
(Kline and Kline, 1992). Pre-loading eggs with BAPTA-AM prior to treatment with U0126
or ML-7 dramatically reduced the extent of exit from metaphase II arrest at 3 h after the
start of drug treatment. Only 2% of ML-7-treated eggs and 7% of U0126-treated eggs
83
that had been pre-loaded with BAPTA-AM exited from metaphase II arrest, versus 31%
of ML-7-treated eggs and 55% of U0126-treated eggs that were not treated with BAPTAAM (Figure 2.5C, D4, with Figure 2.5H summarizing the effects on metaphase II exit with
U0126 or ML-7 ("Drug alone" column, which are part of the data in Figure 2.4) as
compared to BAPTA-AM loading prior to drug treatment ["Drug + Ca2+ manipulation"
column]; asterisk denotes p < 0.05). It is worth noting that the drift of the metaphase II
spindle from its normal cortical position occurred to comparable extents in U0126-treated
and ML-7-treated eggs with and without BAPTA-AM (Figures 2.4, 2.5), suggesting this
spindle drift phenomenon induced by MAPK3/1 or MLCK inhibition is not dependent on
intracellular calcium.
Experiments testing whether extracellular calcium played a role in U0126induced or ML-7-induced egg activation used eggs cultured in Ca2+-deficient medium.
We observed that a reduced extent of U0126-induced or ML-7-induced exit from
metaphase II arrest occurred in eggs cultured in Ca2+-deficient medium as compared to
eggs cultured in medium containing Ca2+ (Figure 2.5F, G, H). Following 3 h of inhibitor
treatment in Ca2+-deficient medium, only 4% of ML-7-treated eggs exited from
metaphase II arrest (Figure 2.5F), as compared to 36% of ML-7-treated eggs cultured in
Ca2+-containing medium (Figure 2.5H summarizes the effects on metaphase II exit with
drug treatment in Ca2+-containing medium ("Drug alone" column, which are part of the
data in Figure 2.4) as compared to drug treatment in Ca2+-deficient medium ["Drug +
Ca2+ manipulation" column]; asterisk denotes p < 0.05). In eggs treated with U0126,
28% of eggs in Ca2+-deficient medium underwent parthenogenetic activation as
compared to 54% of U0126-treated eggs cultured in parallel in Ca2+-containing medium
(Figure 2.5H; asterisk denotes p < 0.05, comparing Ca2+-deficient versus Ca2+containing conditions). DMSO-treated control eggs in Ca2+-deficient medium remained
at metaphase II (Figure 2.5E). To assess the time dependence of these effects on
84
metaphase II exit, eggs were examined at 1.5 h or 8 h after the start of drug treatment in
eggs preloaded with BAPTA-AM or cultured in Ca2+-deficient medium (Figures 2.6, 2.7).
There was a very modest extent of exit from metaphase II arrest after 1.5 h treatment
with ML-7 or U0126 in Ca2+-deficient medium (Figure 2.6; 1/57 eggs and 3/30 eggs
respectively). The extent of exit from metaphase II arrest at the 8 h time point was
roughly comparable in Ca2+-deficient medium and Ca2+-containing medium and with and
without BAPTA-AM loading prior to ML-7 or U0126 treatment (Figure 2.7), suggesting
that parthenogenetic egg activation in response to protracted inhibition of MAPK or
MLCK is less dependent on extracellular calcium than is parthenogenesis after 1.5-3 h of
ML-7 or U0126 treatment.
To complement assessment of the maternal DNA and meiotic spindle (i.e.,
metaphase, anaphase, or telophase), we examined M-phase status by quantifying
mitotic phospho-epitopes detected in immunofluorescence with the monoclonal antibody
MPM-2 (Davis et al., 1983). The MPM-2 signal was quantified in individual eggs in each
experimental group, and normalized to control metaphase II eggs, defined as 1 (black
bar, labeled "Met II (DMSO)" in Figure 2.8G). Metaphase II eggs have high CDK1
activity and thus, had strong MPM-2 signals (Figure 2.8B, G) (McGinnis et al., 2010).
Other controls were prophase I oocytes and early embryos fixed at 3 h after
insemination. Prophase I oocytes, with low CDK1 activity, had very faint MPM-2 signals
(Figure 2.8A; Figure 2.8G, blue bar). Early embryos, with declining CDK1 activity with
exit from metaphase II arrest, had decreased MPM-2 signals (Figure 2.8C; Figure 2.8G.,
blue bar). Representative eggs treated with ML-7 or U0126 are also shown, with a
metaphase II spindle that has drifted from the cortex (Figure 2.8D), or that had
progressed to anaphase II or telophase II following 3 h of inhibitor treatment (Figure
2.8E, F). MPM-2 levels in eggs treated with U0126 or ML-7 were ~ 55% the MPM-2
levels detected in control metaphase II eggs (p < 0.05, blue bars). In contrast, U0126-
85
treated and ML-7-treated eggs that were either pretreated with the calcium chelator
BAPTA-AM (Figure 2.8G, green bars) or cultured in Ca2+ deficient medium (Figure 2.8G,
red bars) had MPM-2 levels that were similar to MPM-2 levels in control metaphase II
eggs.
Treatment with a zinc ionophore rescues U0126-induced or ML-7-induced exit
from metaphase II arrest
The data above suggest that U0126-induced or ML-7-induced parthenogenetic
activation and a loss of M-phase phospho-proteins were dependent on calcium. As
noted in the Introduction, another contributor to metaphase II arrest and exit from this
arrest is zinc; zinc appears to act on EMI2, a zinc-binding protein that is an inhibitor of
the APC (Suzuki et al., 2010; Kim et al., 2011; Bernhardt et al., 2012; Suzuki et al.,
2010). Decreased cytosolic zinc is important for exit from metaphase II arrest, as
treatment of eggs with the zinc ionophore zinc pyrithione (ZnPT) prior to SrCl2-induced
activation significantly reduces the extent of progression to pronuclear stage, indicative
of mitotic interphase (Kim et al., 2011; Bernhardt et al., 2012). We therefore tested the
hypothesis that U0126-induced and ML-7-induced parthenogenesis could be rescued by
manipulating zinc levels in the egg. Eggs were hyperloaded with zinc by treating with
ZnPT (Kim et al., 2010; Bernhardt et al., 2012) prior to treating the eggs with U0126 or
ML-7.
The effects of these treatments on the egg actomyosin cytoskeleton were
assessed. DMSO-treated eggs have F-actin enriched in the amicrovillar domain over
the metaphase II spindle, with pMRLC at the boundary of the amicrovillar domain (Figure
2.9A, and line scan analysis of these signals in Figure 2.9D, G.). On the other hand,
ML-7-treated eggs (Figure 2.9B, E, H) and U0126-treated eggs (Figure 2.9 C, F, I) do
not show this enrichment of actin and pMRLC in the amicrovillar domain. Similar data
were obtained for eggs treated with ZnPT prior to culture in DMSO, U0126 or ML-7,
86
indicating that the ZnPT treatment did not rescue normal actin or pMRLC localization in
the ML-7-treated or U-126-treated eggs (Figure 2.9J-R). In addition, we verified that
effective cortical tension of ZnPT-treated eggs was similar compared to untreated control
eggs (microvillar domains: 0.94 ± 0.04 nN/µm for control, 0.96 ± 0.03 nN/µm for ZnPTtreated; amicrovillar domains, 2.22 ± 0.10 nN/µm for control, 2.29 ± 0.11 nN/µm for
ZnPT-treated; n = 10 eggs for each experimental group). These data showed that unlike
U0126 or ML-7 treatment, the ZnPT treatment used here did not affect cortical tension in
eggs.
ZnPT treatment reduced parthenogenesis in ML-7-treated and U0126-treated
eggs. Only 3% of U0126+ZnPT-treated eggs exited from metaphase II arrest compared
to 88% of U0126-treated eggs exiting from metaphase II arrest (p < 0.05; Figure 2.10C,
F). This trend held for the ML-7-treated eggs, with 5% of ML-7+ZnPT-treated eggs
exited from metaphase II arrest, compared to 21% of ML-7-treated eggs exiting from
metaphase II arrest (Figure 2.10B, E; p = 0.06). We also assessed M-phase status,
through analysis MPM-2 signal intensities (see also Figure 2.8). Eggs treated with ML-7
or U0126 had reduced MPM-2 levels as compared to control metaphase II eggs (Figure
2.10G; 76% and 49% respectively, p < 0.05). On the other hand, eggs pre-treated with
ZnPT prior to treatment with ML-7 or U0126 had MPM-2 levels that were similar to
control metaphase II eggs, consistent with zinc hyperloading via ZnPT treatment
suppressing ML-7- or U0126-induced parthenogenesis.
Post-ovulatory aged eggs have reduced pMRLC compared to young eggs, and
extent of spontaneous parthenogenetic activation is rescued by treatment with a
zinc ionophore
Ovulated metaphase II eggs that remain in the oviduct for an extended time
without being fertilized undergo a process known as post-ovulatory ageing. These eggs
are a naturally occurring case of eggs that have reduced MAPK3/1 activity (Xu et al.,
87
1997; Abbott et al., 1998). Recent work of ours has added to what is known about the
various cytoskeletal abnormalities of post-ovulatory aged eggs (discussed in Chapter 1
Section II.E). Similar to ML-7-treated and U0126-treated metaphase II eggs (Figure 2.1,
Larson et al., 2010), post-ovulatory aged eggs have reduced cortical tension in both the
amicrovillar and microvillar domains of the egg compared to freshly ovulated eggs
(Mackenzie et al., 2016). With this knowledge, the amount of pMRLC was examined in
post-ovulatory aged and young eggs. Immunoblot analysis showed that aged eggs have
a 70% reduction in the levels of pMRLC compared to young eggs (Figure 2.11A, C).
However, there are similar levels of total MRLC in aged and young eggs (Figure 2.11B,
C).
In addition to cytoskeletal defects, post-ovulatory aged eggs undergo
spontaneous parthenogenetic activation to a greater extent than compared to young
eggs (Chebotareva et al., 2011; Goud et al., 2005; Mailhes et al., 1998; Szollosi, 1971;
Webb et al., 1986; Xu et al., 1997). Since post-ovulatory aged eggs have reduced
pMRLC expression, similar to ML-7 or U0126-treated oocytes as shown in Figure 2.1AC, we tested the hypothesis that the exit from metaphase II arrest observed in postovulatory aged eggs can be rescued by treatment with ZnPt. Aged eggs were collected
and treated with ZnPT for 10 min (control aged eggs were treated with DMSO), then
cultured for 2 h. After 2 h, 71% of control aged eggs underwent spontaneous activation,
compared to 41% of ZnPT-treated aged eggs (Figure 2.11D). There was a statistically
significant difference between the untreated and ZnPT-treated aged eggs (p = 0.003).
We can conclude that spontaneous parthenogenetic activation observed in aged eggs
can be rescued by treatment with ZnPt.
V. DISCUSSION
This work presents evidence that the MAPK3/1 pathway affects myosin-II
dependent functions in metaphase II mouse eggs. U0126-treated eggs have reduced
88
levels of phosphorylated myosin regulatory light chain (pMRLC) as compared to control
eggs, and have reduced effective cortical tension. This U0126-induced reduction in
cortical tension is similar to what we observe in ML-7-treated eggs (Larson et al., 2010),
which have similarly reduced pMRLC levels (Figure 2.1). Interestingly, MAPK3/1 activity
also can affect cortical tension at a different time in meiosis, albeit by what may be a
different mechanism. In meiosis I, MAPK3/1 activity increases after germinal vesicle
breakdown, activated by Mos (Verlhac et al., 1996; Verlhac et al., 2000; Halet and
Carroll, 2007). Wild-type oocytes undergo a decrease in cortical tension at 6 h after
germinal vesicle breakdown, whereas mos-/- oocytes do not show this decrease
(Chaigne et al., 2013). These cortical tension changes in meiosis I are associated with
phosphorylation of the MAPK3/1 substrate WAVE2, which in turn could lead to activation
of the Arp2/3 complex and changes in cortical actomyosin (i.e., thickening of cortical
actin and loss of cortical myosin-II heavy chain MYH9) (Chaigne et al., 2013).
Two effects were observed here in eggs with reduced MAPK3/1 or MLCK
activity. The first was a loss of cortical anchoring of the metaphase II spindle. This had
been reported for U0126-treated eggs (Petrunewich et al., 2009), and we extend those
findings by showing that this loss of spindle anchoring also occurs in ML-7 treated eggs.
There are other reports of loss of normal spindle localization. Expression a dominantnegative version of the GTPase Rac1 in metaphase II eggs induces either a loss of
cortical anchoring of one spindle pole, or a gradual loss of cortical spindle localization
(Halet and Carroll, 2007). Treatment of metaphase II eggs with the actin-related protein2/3 (ARP2/3) complex inhibitor CK-666 induces a rapid loss of cortical spindle
localization, evident within a few minutes of exposing eggs to CK-666 (Yi et al., 2011),
whereas this rapid loss of spindle localization was not detected in these studies when
eggs were treated with blebbistatin, an inhibitor of the myosin-II ATPase (Yi et al., 2011).
As noted above and previously, our attempts to disrupt myosin-II with blebbistatin
89
unfortunately have not been successful (Larson et al., 2010). U0126-induced and ML-7induced spindle drift is not detected in the time frame used in the studies of CK-666 and
blebbistatin, and instead occurs substantially later, in a small number of eggs at 1.5 h
and more at 3 h. These data suggest that CK-666-induced spindle drift is a different
phenomenon, presumably with an underlying cause involving loss of actin nucleation
mediated by the ARP2/3 complex, from what was observed here with U0126 and ML-7.
The loss of cortical spindle anchoring induced by U0126 or ML-7 appears to be calciumindependent, as the extents of spindle drift from the cortex were comparable in eggs
preloaded with BAPTA-AM, eggs in Ca2+-deficient medium, and eggs with no BAPTAAM or in Ca2+-containing medium.
The second effect observed in eggs with reduced MAPK3/1 or MLCK activity is
parthenogenetic exit from metaphase II arrest. We show here that U0126- and ML-7induced exit from metaphase II is dependent on intracellular calcium, as the extent of
parthenogenetic activation induced by U0126 or ML-7 treatment is dramatically reduced
in eggs loaded with the calcium chelator BAPTA-AM. Our data further suggest that
extracellular calcium is important for this U0126- or ML-7-induced parthenogenesis.
This agrees with studies showing that external calcium is required for egg activation in
Drosophila and for completion of meiosis II in mouse (Miao et al., 2010; Horner and
Wolfner, 2008). Excitingly, we find that parthenogenetic exit from metaphase II arrest
induced by U0126 or ML-7 treatment is rescued by treating eggs with a zinc ionophore,
further demonstrating the importance of zinc in the maintenance of metaphase II arrest
(Suzuki et al., 2010; Kim et al, 2011; Bernhardt et al., 2012; Suzuki et al., 2010).
The data here are consistent with the model that an influx of Ca2+ and an efflux of
Zn2+ are important for egg activation (Kim et al., 2011; Miao and Williams, 2012; Miao et
al., 2012; Horner and Wolfner, 2008; Kaneuchi et al., 2015). Although mechanisms of
post-fertilization Zn2+ loss and Ca2+ entry are not fully understood, there are several
90
possible ways by which Ca2+ influx and/or Zn2+ efflux could be affected in U0126-treated
or ML-7-treated eggs, particularly with cytoskeletal disruptions being downstream effects
of MAPK3/1 and MLCK inhibition. Zinc loss from fertilized eggs has been speculated to
occur by exocytosis (Kim et al., 2011; Que et al., 2015), which could be affected by
disruptions of the actomyosin cytoskeleton (Matson et al., 2006; Tahara et al., 1996;
DiMaggio et al., 1997; Terada et al., 2000). An additional contribution to zinc loss could
be via zinc transporters (Lichten and Cousins, 2009; Kambe 2012; Dempski, 2012), and
calcium influx in eggs is likely channel-mediated. There are two possible, not mutually
exclusive ways by which cytoskeletal function could affect channel/transporter activity:
(a) actomyosin-facilitated trafficking that localizes ion channels/transporters in the
plasma membrane (e.g., Yao et al., 1999; Bezzerides et al., 2004; Meyer et al., 2006;
Monet et al., 2012), and (b) actomyosin-based effects on mechanosensitive channels
(Gu and Gu, 2014; Martinac, 2014; Plant, 2014). With decreased cortical tension
associated with MAPK3/1 or MLCK inhibition, it is tempting to speculate that a
mechanosensitive channel(s) underlies U0126- or ML-7-induced parthenogenesis. The
non-selective, Ca2+-permeant transient receptor potential (TRP) channels are intriguing
candidates (Kaneuchi et al., 2015; Meyer et al., 2006; Gu and Gu, 2014, Plant, 2014).
TRPV3 was recently characterized in mouse eggs, revealing that TRPV3 has a role in
Sr2+ influx in SrCl2-induced artificial egg activation (Carvacho et al., 2013). However, the
role of TRPV3 in calcium influx in eggs is unclear, and female fertility in Trpv3-/- mice
appears similar to wild-type (Carvacho et al., 2013). Thus, the regulation of ion
homeostasis in normal eggs remains to be fully elucidated, but future studies in this
areas should aid understanding of normal egg activation as well as parthenogenesis.
The effects observed with MAPK3/1 pathway inhibition or MLCK inhibition are
pertinent to egg health and reproductive success. Loss of maintenance of metaphase II
arrest and loss of cortical spindle localization occur with extended time after ovulation,
91
as egg quality deteriorates during a process known as post-ovulatory aging (Marston
and Chang, 1964; Lord and Aiken 2013; Tarin et al., 2000; Fissore et al., 2002). Postovulatory aging is associated with unsuccessful fertilization, and, in instances when aged
eggs are fertilized, with poor reproductive outcomes, including pregnancy loss, smaller
litter sizes, or in offspring with abnormalities Marston and Chang, 1964; Lord and Aiken
2013; Tarin et al., 2000; Fissore et al., 2002). Relevant to the data here, post-ovulatory
aged eggs have reduced MAPK3/1 activity and reduced cortical tension, associated with
a range of membrane and cortical abnormalities and the above-mentioned propensity to
undergo parthenogenetic activation (Szollosi, 1971; Longo, 1974; Webb et al., 1986;
Eichenlaub-Ritter et al., 1986; Goud et al., 2005; Xu et al., 1997; Mailhes et al., 1998;
Dalo et al., 2008; Wortzman and Evans, 2005; Mackenzie et al., 2016). Similar to
MAPK3/1-inhibited and MLCK-inhibited eggs, raising concentration of intracellular zinc
rescue the propensity to exit metaphase II arrest in post-ovulatory aged eggs. Thus,
what we observe here with MAPK3/1 pathway inhibition and the associated reduction in
myosin-II function is consistent with changes that occur with post-ovulatory aging,
suggestive of a tie between reduced MAPK3/1 activity and several of the changes
observed in aged eggs. In conclusion, a functional MAPK3/1 pathway is important for a
variety of events in the temporal and spatial regulation of meiosis in mammalian oocytes.
The data here provide new insights into the molecular foundations of certain cases of
spontaneous egg activation, and more broadly, into the range of functions of MAPK3/1 in
mammalian oocytes, consistent with other observations suggestive of coordination of
cell cycle progression, CSF activity, and cytoskeletal regulation (Masui and Markert,
1971; Shoji et al., 2006).
92
VI. REFERENCES
Ajduk A, Ilozue T, Windsor S, Yu Y, Seres KB, Bomphrey RJ, Tom BD, Swann K,
Thomas A, Graham CF, and Zernicka-Goetz M. “Rhythmic actomyosin-driven
contractions induced by sperm entry predict mammalian embryo viability” Nature
Communications 2 (2011): 417.
Azoury J, Lee KW, Georget V, Hikal P, and Verlhac MH. “Symmetry breaking in mouse
oocytes requires transient F-actin meshwork destabilization.” Development 138
(2011): 2903-2908
Backs J, Stein P, Backs T, Duncan F, Grueter CE, McAnally J, Qi X, Schultz RM, and
Olson EN. “The gamma isoform of CaM kinase II controls mouse egg activation
by regulating cell cycle resumption.” Proceedings of the Naitonal Academy of
Sciences 107 (2010): 81-86.
Bernhardt ML, Kong BY, Kim AM, O'Halloran TV, and Woodruff TK. “A zinc-dependent
mechanism regulates meiotic progression in mammalian oocytes.” Biology of
Reproduction 86 (2012): 114.
Bezzerides VJ, Ramsey IS, Kotecha S, Greka A,and Clapham DE. “Rapid vesicular
translocation and insertion of TRP channels.” Nature Cell Biology 6 (2004): 709720.
Carvacho I, Lee HC, Fissore RA, and Clapham DE. “TRPV3 channels mediate
strontium-induced mouse-egg activation.” Cell Reports 5 (2013):1375-1386.
Chaigne A, Campillo C, Gov NS, Voituriez R, Azoury J, Umaña-Diaz C, Almonacid M,
Queguiner I, Nassoy P, Sykes C, Verlhac MH, and Terret ME. “A soft cortex is
essential for asymmetric spindle positioning in mouse oocytes. Nature Cell
Biology 15 (2013): 958-966.
93
Chang HY, Minahan K, Merriman JA, and Jones KT. “Calmodulin-dependent protein
kinase gamma3 (CamKIIg3) mediates the cell cycle resumption of metaphase II
eggs in mouse.” Development 136 (2009): 4077-4081.
Choi TS, Fukasawa K, Zhou RP, Tessarollo L, Borror K, Resau J, and Vande Woude
GF. “The Mos/mitogen-activated protein kinase (MAPK) pathway regulates the
size and degradation of the first polar body in maturing mouse oocytes.”
Proceedings of the Naitonal Academy of Sciences 93 (1996): 7032-7035.
Chung HY, Jennings PC, Stewart JL, Verrills NM, and Jones KT. “Essential role of
protein phosphatase 2A in metaphase II arrest and activation of mouse eggs
shows by okadaic acid, dominant negative protein phosphatase 2A, and
FTY720.” Journal of Biological Chemistry 286 (2011): 14705-14712.
Colledge WH, Carlton MBL, Udy GB, and Evans MJ. “Disruption of c-mos cause
parthenogenetic development of unfertilized mouse eggs.” Nature 370 (1994):
65-68.
Dalo DT, McCaffery JM, and Evans JP. “Ultrastructural analysis of egg membrane
abnormalities in post-ovulatory aged eggs.” International Journal of
Developmental Biology 52 (2008)::535 - 544.
Davis FM, Tsao TY, Fowler SK, and Rao PN. “Monoclonal antibodies to mitotic cels.”
Proceedings of the Naitonal Academy of Sciences 80 (1983): 2926-2930.
De Santis L, Cino I, Rabellotti E, Calzi F, Persico P, Boroni A, and Coticchio G. “Polar
body morphology and spindle imaging as predictors of oocyte quality.”
Reproductive Biomedicine Online 11 (2005): 36-42.
Dempski RE. “The cation selectivity of the ZIP transporters.” Current Topics in
Membranes 69 (2012):221-245.
94
Deng M, Williams CJ, and Schultz RM. “Role of MAP kinase and myosin light chain
kinase in chromosome-induced development of mouse egg polarity.”
Developmental Biology 278 (2005): 358-366.
Deng M, Suraneni P, Schultz RM, and Li R. “The Ran GTPase mediates chromatin
signaling to control cortical polarity during polar body extrusion in mouse
oocytes.” Developmental Cell 12 (2007): 301-308.
Derganc J, Božic B, Sventina S, and Žekš B. “Stability analysis of micropipette aspriation
of neutrophils.” Biophsyical Journal 79 (2000): 153-162.
DiMaggio AJ, Jr., Lonergan TA, and Stewart-Savage J. “Cortical granule exocytosis in
hamster eggs requires microfilaments.” Molecular Reproduction and
Development 47 (1997): 334-340.
Ducibella T, and Fissore R. “The roles of Ca2+, downstream protein kinases, and
oscillatory signaling in regulating fertilization and the activation of development.”
Developmental Biology 315 (2008): 257-279.
Eichenlaub-Ritter U, Chandley AC, and Gosden RG. “Alterations to the microtubular
cytoskeleton and increased disorder of chromosome alignment in spontaneously
ovulated mouse oocytes aged in vivo: an immunofluorescence study.”
Chromosoma 94 (1986): 337-345.
Evans JP, Schultz RM, and Kopf GS. “Mouse sperm-egg membrane interactions:
analysis of roles of egg integrins and the mouse sperm homologue of PH-30
(fertilin) β.” Journal of Cell Science 108 (1995): 3267-3278.
Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, Van Dyk DE,
Pitts WJ, Earl RA, Hobbs F, Copeland RA, Magolda RL, Scherle PA, and
Trzaskos JM. “Identification of a Novel Inhibitor of Mitogen-activated Protein
Kinase Kinase.” Journal of Biological Chemistry 273 (1998):18623-18632.
95
Fissore RA, Kurokawa M, Knott J, Zhang M, and Smyth J. “Mechanisms underlying
oocyte activation and postovulatory aging.” Reproduction 124 (2002): 745-754.
Gardner AJ, Williams CJ, and Evans JP. “Establishment of the mammalian membrane
block to polyspermy: Evidence for calcium-dependent and -independent
regulation.” Reproduction 133 (2007): 383-393.
Gonzalez-Garcia JR, Bradley J, Nomikos M, Paul L, Machaty Z, Lai FA, and Swann K.
“The dynamics of MAPK inactivation at fertilization in mouse eggs.” Journal of
Cell Science 127 (2014): 2749-2760.
Goud AP, Goud PT, Diamond MP, Van Oostveldt P, and Hughes MR. “Microtubule
turnover in ooplasm biopsy reflects ageing phenomena in the parent oocyte.”
Reproduction Biomedicine Online 11 (2005): 43-52.
Gu Y, and Gu C. “Physiological and pathological functions of mechanosensitive ion
channels.” Molecular Neurobiology 50 (2014): 339-347.
Halet G, and Carroll J. “Rac activity is polarized and regulates meiotic spindle stability
and anchoring in mammalian oocytes.” Developmental Cell 12 (2007): 309-317.
Hashimoto N, Watanabe N, Furuta Y, Tamemoto H, Sagata N, Yokoyama M, Okazaki K,
Nagayoshi M, Takeda N, Ikawa Y, and Aizawa S. “Parthenogenetic activation of
oocytes in c-mos-deficient mice.” Nature 370 (1994): 68-71.
Hirao Y, and Eppig JJ. “Parthenogenetic development of Mos-deficient mouse oocytes.”
Molecular Reproduction and Development 48 (1997): 391-396.
Homer H. “The APC/C in female mammalian meiosis I.” Reproduction 146 (2013): R6171.
Horner VL, and Wolfner MF. “Mechanical stimulation by osmotic and hydrostatic
pressure activates Drosophila oocytes in vitro in a calcium-dependent manner.”
Developmental Biology 316 (2008): 100-109.
96
Jones KT. “Anaphase-promoting complex control in female mouse meiosis.” Results and
Problems in Cell Differentiation 53 (2011): 343-363.
Kambe T. “Molecular architecture and function of ZnT transporters.” Current Topics in
Membranes 69 (2012): 199-220.
Kaneuchi T, Sartain CV, Takeo S, Horner VL, Buehner NA, Aigaki T, and Wolfner MF.
“Calcium waves occur as Drosophila oocytes activate.” Proceedings of the
Naitonal Academy of Sciences 112 ( 2015): 791-796.
Kim AM, Bernhardt ML, Kong BY, Ahn RW, Vogt S, Woodruff TK, and O'Halloran TV.
“Zinc sparks are triggered by fertilization and facilitate cell cycle resumption in
mammalian eggs.” ACS Chemical Biology 6 (2011): 716-723.
Klemke RL, Cai S, Giannini AL, Gallagher PJ, de Lanerolle P, and Cheresh DA.
“Regulation of cell motility by mitogen-activated protein kinase.” Journal of Cell
Biology 137 (1997): 481-492.
Kline D, and Kline JT. “Repetitive calcium transients and the role of calcium in
exocytosis and cell cycle activation in the mouse egg.” Developmental Biology
149 (1992): 80-89.
Kryzak CA, Moraine MM, Kyle DD, Lee HJ, Cubeñas-Potts C, Robinson DN, and Evans
JP. “Prophase I mouse oocytes are deficient in the ability to respond to
fertilization by decreasing membrane receptivity to sperm and establishing a
membrane block to polyspermy.” Biology of Reproduction 89 (2013): 44.
Kolega J. “Phototoxicity and photoinactivation of blebbistatin in UV and visible light.”
Biochemical and Biophsyical Research Communications 320 (2004): 1020-1025.
Larson SM, Lee HJ, Hung PH, Matthews LM, Robinson DN, and Evans JP. “Cortical
mechanics and meiosis II completion in mammalian oocytes are mediated by
myosin-II and Ezrin-Radixin-Moesin (ERM) proteins.” Molecular Biology of the
Cell 21 (2010): 3182-3192.
97
Levi M, Maro B, and Shalgi R. “The involvement of Fyn kinase in resumption of the first
meiotic division in mouse oocytes.” Cell Cycle 9 (2010): 1577-1589.
Li H, Guo F, Rubinstein B, and Li R. “Actin-driven chromosomal motility leads to
symmetry breaking in mammalian meiotic oocytes.” Nature Cell Biology 10
(2008): 1301-1308.
Lichten LA, and Cousins RJ. “Mammalian zinc transporters: nutritional and physiologic
regulation.” Annual Review of Nutrition 29 (2009):153-176.
Longo FJ. “Ultrastructural changes in rabbit eggs aged in vivo.” Biology of Reproduction
11 (1974): 22-39.
Lord T, and Aitken RJ. “Oxidative stress and ageing of the post-ovulatory oocyte.”
Reproduction 146 (2013): R217-R227.
Luo J, McGinnis LK, and Kinsey WH. “Role of Fyn kinase in oocyte developmental
potential.” Reproduction Fertility and Development 22 (2010: 966-976.
Mackenzie, AM, Kyle DD, McGinnis LA, Lee HJ, Aldana N, Robinson DN, Evans JP.
“Cortical mechanics and myosin-II abnormalities assocaited with post-ovualtory
aging: Implications for functional defects in aged eggs.” Molecular Human
Reproduction (2016).
Mailhes JB, Young D, and London SN. “Postovulatory aging of mouse oocytes in vivo
and premature centromere separation and aneuploidy.” Biology of Reproduction
58 (1998): 1206-1210.
Markoulaki S, Matson S, and Ducibella T. “Fertilization stimulates long-lasting
oscillations of CaMKII activity in mouse eggs.” Developmental Biology 272
(2004): 15-25.
Marston JH, and Chang MC. "The fertilizable life of ova and their morphology following
delayed insemination in mature and immature mice." Journal of Experimental
Zoology 1555 (1964):237-252.
98
Martinac B. "The ion channels to cytoskeleton connection as potential mechanism of
mechanosensitivity." Biochimica et Biophysica Acta 1838 (2014): 682-691.
Masui Y, and Markert CL. "Cytoplasmic control of nuclear behavior during meiotic
maturation of frog oocytes. Journal of Experimental Zoology 177 (1971): 129146.
Matson S, Markoulaki S, and Ducibella T. "Antagonists of myosin light chain kinase and
of myosin II inhibit specific events of egg activation in fertilized mouse eggs."
Biology of Reproduction 74 (2006): 169-176.
McGinnis LK, and Albertini DF. "Dynamics of protein phosphorylation during meiotic
maturation." Journal of Assited Reproduction and Genetics 27 (2010): 169-182.
Medvedev S, Stein P, and Schultz RM. "Specificity of calcium/calmodulin-dependent
protein kinases in mouse egg activation." Cell Cycle 13 (2014): 1482-1488.
Meyer NE, Joel-Almagor T, Frechter S, Minke B, and Huber A. "Subcellular translocation
of the eGFP-tagged TRPL channel in Drosophila photoreceptors requires
activation of the phototransduction cascade." Journal of Cell Science 119 (2006):
2592-2603.
Miao Y-L, and Williams CJ. "Calcium signaling in mammalian egg activation and embryo
development: The influence of subcellular localization." Molecular Reproduction
and Development 79 (2012): 742-756.
Miao Y-L, Stein P, Jefferson WN, Padilla-Banks E, and Williams CJ. "Calcium influxmediated signaling is required for complete mouse egg activation." Proceedings
of the National Academy of Sciences 109 (2012): 4169-4174.
Miyagaki Y, Kanemori Y, Tanaka F, and Baba T. "Possible Role of p38 MAPK-MNK1EMI2 Cascade in Metaphase-II Arrest of Mouse Oocytes." Biology of
Reproduction (2014).
99
Monet M, Francoeur N, and Boulay G. "Involvement of phosphoinositide 3-kinase and
PTEN protein in mechanism of activation of TRPC6 protein in vascular smooth
muscle cells." Journal of Biological Chemistry 287 (2012): 17672-17681.
Moos J, Visconti PE, Moore GD, Schultz RM, and Kopf GS. "Potential role of mitogenactivated protein kinase in pronuclear envelope assembly and disassembly
following fertilization of mouse eggs." Biology of Reproduction 53 (1995): 692699.
Nabti I, Marangos P, Bormann J, Kudo NR, and Carroll J. "Dual-mode regulation of the
APC/C by CDK1 and MAPK controls meiosis I progression and fidelity." Journal
of Cell Biology 204 (2014): 891-900.
Nguyen DH, Catling AD, Webb DJ, Sankovic M, Walker LA, Somlyo AV, Weber MJ, and
Gonias SL. "Myosin light chain kinase functions downstream of Ras/ERK to
promote migration of urokinase-type plasminogen activator-stimulated cells in an
integrin-selective manner." Journal of Cell Biology 146 (1999): 149-164.
Oh JS, Susor A, and Conti M. "Protein tyrosine kinse Wee1B is essential for metaphase
II exit in mouse oocytes." Science 332 (2011): 462-465.
Oh JS, Susor A, Schindler K, Schultz RM, and Conti M. "Cdc25A activity is required for
the metaphase II arrest in mouse oocytes." Journal of Cell Science 126 (2013):
1081-1085.
Petrunewich MA, Trimarchi JR, Hanlan AK, Hammer MA, and Baltz JM. "Second meiotic
spindle integrity requires MEK/MAP kinase activity in mouse eggs." Journal of
Reproduction and Development 55 (2009): 30-38.
Phillips KP, Petrunewich MA, Collins JL, Booth RA, Liu XJ, and Baltz JM. "Inhibition of
MEK or cdc2 kinase parthenogenetically activates mouse eggs and yields the
same phenotypes as Mos(-/-) parthenogenotes." Developmental Biology 247
(2002): 210-223.
100
Pines J. "Mitosis: a matter of getting rid of the right protein at the right time." Trends in
Cell Biology 16 (2006): 55-63.
Plant TD. "TRPs in mechanosensing and volume regulation." Handbook of Experimental
Pharmacology 223 (2014): 743-766.
Que EL, Bleher R, Duncan FE, Kong BY, Gleber SC, Vogt S, Chen S, Garwin SA, Bayer
AR, Dravid VP, Woodruff TK, and O'Halloran TV. "Quantitative mapping of zinc
fluxes in the mammalian egg reveals the origin of fertilization-induced zinc
sparks." Nature Chemistry 7 (2015): 130-139.
Rauh NR, Schmidt A, Bormann J, Nigg EA, and Mayer TU. "Calcium triggers exit from
meiosis II by targeting the APC/C inhibitor XErp1 for degradation." Nature 437
(2005): 1048-1052.
Reichl EM, Ren Y, Morphew MK, Delannoy M, Effler JC, Girard KD, Divi S, Iglesias PA,
Kuo SC, and Robinson DN. "Interactions between myosin and actin crosslinkers
control cytokinesis contractility dynamics and mechanics." Current Biology 18
(2008): 471-480.
Schuh M, and Ellenberg J. "A new model for asymmetric spindle positioning in mouse
oocytes." Current Biology 18 (2008): 1986-1992.
Sharan SK, Pyle A, Coppola V, Babus J, Swaminathan S, Bendict J, Swing D, Martin
BK, Tessarollo L, Evans JP, Flaws JA, and Handel MA. "BRCA2 deficiency in
mice leads to meiotic impairment and infertility." Development 131 (2004): 131142.
Shoji S, Yoshida N, Amanai M, Ohgishi M, Fukui T, Fujimoto S, Nakano Y, Kajikawa E,
and Perry AC. "Mammalian Emi2 mediates cytostatic arrest and transduces the
signal for meiotic exit via Cdc20." The EMBO Journal 25 (2006): 834-845.
Simerly C, Nowak G, de Lanerolle P, and Schatten G. "Differential expression and
functions of cortical myosin IIA and IIB isotypes during meiotic maturation,
101
fertilization, and mitosis in mouse oocytes and embryos." Molecular Biology of
the Cell 9 (1998): 2509-2525.
Suzuki T, Yoshida N, Suzuki E, Okuda E, and Perry ACF. "Full-term mouse
development by abolishing Zn2+-dependent metaphase II arrest without Ca2+
release." Development 137 (2010): 2659-2669.
Suzuki T, Suzuki E, Yoshida N, Kubo A, Li H, Okuda E, Amanai M, and Perry ACF.
"Mouse Emi2 as a distinctive regulatory hub in second meiotic metaphase."
Development 137 (2010): 3281-3291.
Szollosi D. "Morphological changes in mouse eggs due to aging in the fallopian tube."
American Journal of Anatomy 130 (1971): 209-225.
Tahara M, Tasaka K, Masumoto N, Mammoto A, Ikebuchi Y, and Miyake A. "Dynamics
of cortical granule exocytosis at fertilization in living mouse eggs." American
Journal of Physiology 270 (1996): C1354-C1361.
Taki M, Wolford JL, and O'Halloran TV. "Emission ratiometric imaging of intracellular
zinc: design of a benzoxazole fluorescent sensor and its application in twophoton microscopy." Journal of the American Chemical Society 126 (2004): 712713.
Tarin JJ, Perez-Albala S, and Cano A. "Consequences on offspring of abnormal function
in ageing gametes." Human Reproduction Update 6 (2000): 532-549.
Terada Y, Simerly C, and Schatten G. "Microfilament stabilization by jasplakinolide
arrests oocyte maturation, cortical granule exocytosis, sperm incorporation cone
resorption, and cell-cycle progression, but not DNA replication, during fertilization
in mice." Molecular Reproduction and Development 56 (2000): 89-98.
Tong C, Fan HY, Chen DY, Song XF, Schatten H, and Sun QY. "Effects of MEK inhibitor
U0126 on meiotic progression in mouse oocytes: microtuble organization,
asymmetric division and metaphase II arrest." Cell Research 13 (2003): 375.
102
Tung JJ, Hansen DV, Ban KH, Loktev AV, Summers MK, Adler JR, 3rd, and Jackson
PK. "A role for the anaphase-promoting complex inhibitor Emi2/XErp1, a
homolog of early mitotic inhibitor 1, in cytostatic factor arrest of Xenopus eggs."
Proceedings of the Natioanl Academy of Sciences 102 (2005): 4318-4323
Ubaldi FM, and Rienzi L. "Morphological selection of gametes." Placenta 29 (2008): 115120.
Verlhac M-H, De Pennett H, Maro B, Cobb M, and Clarke HJ. "MAP kinase becomes
stably activated at metaphase and is associated with microtubule-organizing
centers during meiotic maturation of mouse oocytes." Developmental Biology 158
(1993): 330-340.
Verlhac MH, Kubiak JZ, Clarke HJ, and Maro B. "Microtubule and chromatin behavior
follow MAP kinase activity but not MPF activity during meiosis in mouse oocytes."
Development 120 (1994): 1017-1025.
Verlhac MH, Kubiak JZ, Weber M, Geraud G, Colledge WH, Evans MJ, and Maro B.
"Mos is required for MAP kinase activation and is involved in microtuble
organization during meiotic maturation in the mouse." Development 122 (1996):
815-822.
Verlhac MH, Lefebvre C, Kubiak JZ, Umbhauer M, Rassinier P, Colledge W, and Maro
B. "Mos activates MAP kinase in mouse oocytes through two opposite
pathways." The EMBO Journal 19 (2000): 6065-6074.
Vicente-Manzanares M, Ma X, Adelstein RS, and Horwitz AF. "Non-muscle myosin II
take centre stage in cell adhesion and migration." Nature Reviews Molecular Cell
Biology 10 (2009): 778-790.
Webb M, Howlett SK, and Maro B. "Parthenogenesis and cytoskeletal organization in
ageing mouse eggs." Journal of Embryology and Experimental Morphology 95
(1986): 131-145.
103
Whitten WK. "Nutrient requirements for the culture of preimplantation embryos in vitro."
Advances in Bioscience and Biotechnology 6 (1971): 129-139.
Wortzman GB, and Evans JP. "Membrane and cortical abnormalities in post-ovulatory
aged eggs: analysis of fertilizability and establishment of the membrane block to
polyspermy." Molecular Human Reproduction 11 (2005): 1-9.
Xu Z, Abbott A, Kopf GS, Schultz RM, and Ducibella T. "Spontaneous activation of
ovulated mouse eggs: Time-dependent effects on M-phase exit, cortical granule
exocytosis, maternal messenger ribonucleic acid recruitment, and inositol 1,4,5trisphosphate sensitivity." Biology of Reproduction 57 (1997): 743-750.
Yao Y, Ferrer-Montiel AV, Montal M, and Tsien RY. "Activation of store-operated Ca2+
current in Xenopus oocytes requires SNAP-25 but not a diffusible messenger."
Cell 98 (1999): 475-485
Yesilaltay A, Dokshin GA, Busso D, Wang L, Galiani D, Chavarria T, Vasile E, Quilaqueo
L, Orellana JA, Walzer D, Shalgi R, Dekel N, Albertini DF, Rigotti A, Page DC,
Krieger M. "Excess cholesterol induces mouse egg activation and may cause
female infertility." Proceedings of the National Academy of Sciences 2014.
Yi K, Unruh JR, Deng M, Slaughter BD, Rubinstein B, and Li R. "Dynamic maintenance
of asymmetric meiotic spindle position through ARP2/3-complex-driven
cytoplasmic streaming in mouse oocytes." Nature Cell Biology 13 (2011): 12521258.
Yu LZ, Xiong B, Gao WX, Wang CM, Zhong ZS, Huo LJ, Wang Q, Hou Y, Liu K, Liu XJ,
Schatten H, Chen DY, Sun QY. "MEK1/2 regulates microtubule organization,
spindle pole tethering and asymmetric division during mouse oocyte meiotic
maturation." Cell Cycle 6 (2007): 330-338.
104
Figure 2.1
MAPK3/1 and MLCK inhibition reduces levels of active, phosphorylated myosin
regulatory light chain, affects localization of phosphorylated myosin regulatory
light chain and decreases cortical tension in metaphase II eggs
Panel A shows representative blots of egg lysates (90 cells per lane; treated with 0.5%
DMSO (lane 1), 15 μM ML-7 (lane 2), or 50 μM U0126 (lane 3) for 90 min), probed with
anti-pMRLC and anti-MRLC. Panels B and C show quantification of band intensities of
anti-pMRLC levels and anti-MRLC levels, respectively. Values were normalized to
DMSO-treated eggs. Error bars represent standard errors of the mean. The antipMRLC blots were performed 13 times for DMSO-treated eggs, 11 times for ML-7treated eggs and 8 times for U0126-treated eggs. The difference between levels of
pMRLC in ML-7-treated eggs and U0126-treated eggs is statistically significant as
compared to DMSO-treated eggs (indicated by an asterisk; Kruskal-Wallis test with
Bonferroni-Dunn post-hoc testing, p < 0.05). The MRLC blots were repeated four times
for all treatment groups. Panels D-I: Immunofluorescence shows the localization of antipMRLC staining (green, with complementary black-and-white image of this channel in
Panels E, G, and I) and DNA (stained with DAPI, in blue) in metaphase II eggs exposed
to 0.5% DMSO (Panels D,E), eggs treated with 15 µM ML-7 (Panels F,G), or with 50 µM
U0216 (Panels H,I). Scale bar in Panel D = 10 μm. Panel J: Line-scan analysis around
the circumference of the cortical region to assess relative intensities of the pMRLC
cortical signal in DMSO-, ML-7-and U0126 treated eggs. This graph shows pooled data
from 23 DMSO-treated metaphase II eggs [blue line], 12 ML-7-treated eggs (red line;
four metaphase II, six metaphase II drifted spindle, two anaphase II), and 18 U0126treated eggs (green line; eight metaphase II, six metaphase II drifted spindle, and four
anaphase II); see also Figure 2 for data on individual eggs of each phenotype. In
DMSO-treated eggs, the two peaks in these scans coincide with pMRLC at the two
105
shoulders of the amicrovillar domain. The line scans of ML-7- and U0126- treated eggs
do not show these peaks. Panel K: Effective tension (Teff, in NnN/µm) on the microvillar
and amicrovillar domains of DMSO-treated eggs (dark gray) and U0126-treated eggs
(light gray) as measured by micropipette aspiration. Error bars represent standard
errors of the mean. This decrease in effective tension is statistically significant (MannWhitney U-test, p < 0.05). Numbers of eggs analyzed: DMSO-treated microvillar
domain, 36; U0126-treated microvillar domain, 79; DMSO-treated amicrovillar domain,
18; U0126-treated amicrovillar domain, 7.
106
U0126
ML-7
DMSO
A
- 20
pMRLC
- 20
MRLC
2
1
B
3
Fold Change
1.2
1.0
0.8
*
0.6
*
0.4
0.2
0.0
C
DMSO
ML-7
U0126
DMSO
ML-7
U0126
Fold Change
1.2
1.0
0.8
0.6
0.4
0.2
0.0
DMSO
ML-7
D
U0126
F
H
G
I
pMRLC
DNA
E
pMRLC
Intensity (A.U.)
J 100
DMSO
ML-7
75
U0126
50
25
0
0
Teff (nN/µM)
K
50
100 150 200 250
Distance (μm)
3.0
2.0
DMSO
U0126
*
1.0
*
0.0
Microvillar
107
Amicrovillar
Figure 2.2
MLCK inhibition does not affect MAPK levels, and MAPK3/1 and MLCK inhibition
reduce pMRLC immunofluorescence
Panel A-C: Eggs were treated with 0.5% DMSO (lane 1) and 15 μM ML-7 (lane 2) for 90
min. Panel A shows a representative blot of egg lysates (35 cells per lane), probed with
anti-pMAPK3/1 and anti-MAPK3/1, with Panel B showing quantification of band
intensities of anti-pMAPK3/1 levels, and Panel C showing quantification of band
intensities of anti-MAPK3/1 levels. The pMAPK3/1 blots and MAPK3/1 blots were
performed three times each. Values were normalized to DMSO-treated eggs. Error
bars represent standard error of the mean. Panel D-I: Line-scan analysis around the
circumference of the cortical region to assess relative intensities of the pMRLC cortical
signal in DMSO-, ML-7-and U0126 treated eggs. This graph shows data from individual
eggs, complementing the pooled data from multiple eggs shown in Figure 2.1J. Panels
D, F, and H are line scans of representative ML-7-treated eggs; D is normal metaphase
II egg, F is a metaphase II with a drifted spindle, and H is an egg that exited from
metaphase II arrest. Panels E, G, and I are line scans of representative U0126-treated
eggs, where E is normal metaphase II egg, G is a metaphase II with a drifted spindle,
and I is an egg that exited from metaphase II arrest.
108
1.2
A
1.0
Fold
FoldChange
Change
ML-7
DMSO
B
0.8
0.6
0.4
0.2
0.0
- 50
pMAPK
1
2
C
Fold Change
- 50
MAPK
DMSO
ML-7
DMSO
ML-7
1.2
1.0
0.8
0.6
0.4
0.2
0.0
E
100
Intensity (A.U.)
Intensity (A.U.)
D
50
0
0
G
100
50
0
0
100
50 100 150 200 250
Distance (μm)
I
Intensity (A.U.)
Intensity (A.U.)
H
50
0
0
50
0
50 100 150 200 250
Distance (μm)
Intensity (A.U.)
Intensity (A.U.)
F
100
50 100 150 200 250
Distance (μm)
109
0
50 100 150 200 250
Distance (μm)
0
50 100 150 200 250
Distance (μm)
0
50 100 150 200 250
Distance (μm)
100
50
0
100
50
0
Figure 2.3
Spindle localization in U0126-treated and ML-7-treated metaphase II eggs
Panels A-C: Immunofluorescence shows the localization of the meiotic spindle in
metaphase II eggs, stained with anti-β-tubulin (red) and DAPI to stain the maternal DNA
(blue). Dotted lines in these images show the perimeter of the egg. Panel A is a control
egg with normal spindle localization; Panels B and C show representative U0126- and
ML-7-treated eggs in which the metaphase II spindle has drifted away from the cortex.
The dotted line indicates how spindle distance was measured from the egg cortex to the
nearest edge of the maternal DNA. Scale bar in Panel C = 10 μm. Panels D-F: Timelapse microscopy of DAPI-loaded eggs over time, with eggs treated with DMSO (Panel
D), 50 μM U0126 (Panel E), or 15 μM ML-7 (Panel F). White arrowheads indicate the
localization of the DAPI-stained maternal DNA. There was no meiotic spindle drift
observed in DMSO-treated control eggs, whereas the DNA in a subset of U0126-treated
or ML-7-treated eggs loses its normal localization adjacent to the cortex over time.
Scale bar in Panel D = 17 μm. Panel G: Average distances (in µm) of the egg cortex to
the closest point of the maternal DNA in DMSO-treated, U0126-treated, and ML-7treated eggs. The U0126-treated and ML-7-treated eggs are further separated into the
subgroup of eggs with drifted spindles (i.e., cortex-to-DNA distance of 12.5 μm or
greater), and the subgroup of eggs with no drifted spindle (i.e., cortex-to-DNA distance
<12.5 µm). See also text for further details.
110
111
Figure 2.4
Effects of U0126 or ML-7 treatment in metaphase II eggs
Metaphase II eggs were treated with 0.5% DMSO, 50 µM U0126, or 15 µM ML-7 for 3 h,
then fixed and stained with DAPI to label DNA, anti-β-tubulin to label the meiotic spindle,
and the monoclonal antibody MPM-2 to label mitotic phosphoproteins (analysis shown in
Figure 2.8). Eggs were classified as metaphase II (Met II; normal metaphase II spindle
morphology and cortical localization), Met II drifted spindle (i.e., metaphase II spindle
that had moved into the cytoplasm from its normal cortical localization; shown in Figure
2.3), anaphase II, or telophase II (Ana II and Telo II, respectively; i.e., progressing out of
metaphase II arrest). Numbers in or above bars indicates numbers of eggs analyzed.
The extent of progression out of metaphase II arrest (combined numbers of eggs in
anaphase II and telophase II states) in U0126-treated eggs and ML-7-treated eggs is
statistically significant as compared to DMSO-treated eggs (χ2 analysis, p < 0.0001,
indicated with one asterisk). The extent of drifted spindle incidences in U0126-treated
eggs and ML-7-treated eggs is statistically significant as compared to DMSO-treated
eggs (χ2 analysis, p < 0.0001, indicated with two asterisks).
112
113
Figure 2.5
Calcium dependence of U0126-induced and ML-7-induced parthenogenetic exit
from metaphase II arrest
Panel A (Fertilized) shows control eggs, not loaded with BAPTA-AM and inseminated.
For Panels B-D, eggs were pre-loaded with 5 µM of the calcium chelator BAPTA-AM and
then inseminated (Panel B, Fertilized + BAPTA-AM), or treated with 15 μM ML-7 (Panel
C), or 50 μM U0126 (Panel D) for 3 h. For Panels E-G, eggs were cultured in Ca2+deficient medium and treated with 0.5% DMSO (Panel E), 15 µM ML-7 (Panel F), or 50
µM U0126 (Panel G) for 3 h. After the 3 h treatment or insemination, eggs were fixed
and stained with DAPI to label DNA, anti-β-tubulin to label the meiotic spindle, and
MPM-2 to label mitotic phosphoproteins (analysis shown in Figure 5). Eggs were
classified as in Figure 3: metaphase II (Met II; normal metaphase II spindle morphology
and cortical localization), Met II drifted spindle (i.e., metaphase II spindle that had moved
into the cytoplasm from its normal cortical localization; shown in Figure 2.3), anaphase
II, or telophase II (Ana II and Telo II, respectively; i.e., progressing out of metaphase II
arrest). Numbers in or above the bar indicates numbers of eggs analyzed. Panel H
summarizes the results, and provides values for control eggs ("Drug alone" refers to no
BAPTA-AM treatment or culture in Ca2+-containing medium, as compared to "Drug +
Ca2+ manipulation"). Panel H summarizes the effects on metaphase II exit, including
values for ML-7-treated or U0126-treated eggs in the "Drug alone" column. These data
are part of what is shown in Figure 2.4, with the data here from the specific experiments
using U0126 or ML-7 treatment cultured in parallel in experiments with the indicated
Ca2+ manipulation (i.e., either BAPTA-AM treatment prior to drug treatment, or durg
treatment in Ca2+-deficient medium). The extent of progression out of metaphase II
arrest (combined numbers of eggs in anaphase II and telophase II states) in ML-7treated eggs preloaded with BAPTA-AM or cultured in Ca2+-deficient medium is
114
statistically significant as compared to ML-7-treated eggs without the indicated Ca2+
manipulation (χ2 analysis, p < 0.0001, indicated with an asterisk in Panel H). The extent
of progression out of metaphase II arrest (combined numbers of eggs in anaphase II and
telophase II states) in U0126 treated-eggs preloaded with BAPTA-AM is statistically
significant as compared to controls, U0126-treated eggs without the indicated Ca2+
manipulation (χ2 analysis, p < 0.0001, indicated with an asterisk in Panel H).
115
116
Figure 2.6
U0126-induced and ML-7-induced parthenogenetic exit from metaphase II arrest
(1.5 h)
Metaphase II eggs were treated with 0.5% DMSO (Panel A), 15 µM ML-7 (Panel B), or
50 µM U0126 (Panel C) for 1.5 h, then fixed and stained with DAPI to label DNA, anti-βtubulin to label the meiotic spindle. Eggs were classified as metaphase II (Met II; normal
metaphase II spindle morphology and cortical localization), Met II drifted spindle (i.e.,
metaphase II spindle that had moved into the cytoplasm from its normal cortical
localization; shown in Figure 2.4), anaphase II, or telophase II (Ana II and Telo II,
respectively; i.e., progressing out of metaphase II arrest). For Panels D-F eggs were
cultured in calcium-deficient medium and treated with 0.5% DMSO (Panel D), 15 µM ML7 (Panel E), 50 µM U0126 (Panel F) for 1.5 h. The numbers in or above bars indicates
numbers of eggs analyzed. The extent of progression out of metaphase II arrest
(combined numbers of eggs in anaphase II and telophase II states) in U0126-treated
eggs and ML-7-treated eggs is statistically significant as compared to DMSO-treated
eggs (χ2 analysis, p < 0.0001, indicated with one asterisk). The extent of drifted spindle
incidences in U0126-treated eggs and ML-7-treated eggs is statistically significant as
compared to DMSO-treated eggs (χ2 analysis, p < 0.0001, indicated with two asterisks).
The extent of drifted spindle incidences in ML-7-treated eggs in calcium-deficient
medium is statistically significant as compared to DMSO-treated eggs in calciumdeficient medium (χ2 analysis, p < 0.0001, indicated with two asterisks).
117
DMSO
90 Minutes
60
40
80
20
40
20
0
Telo II
100
3/52
2/52
20
**
18/52
29/52
60
Ana II
Telo II
60
Telo II
E
40
**
20
0
0
100
Telo II
100
F
U0126
90 Minutes
80
U0126, Ca2+ -def
90 Minutes
4/28
4/28
Met II
drifted
spindle
Ana II
Telo II
60
**
40
20
0
*
3/30
*
4/28
16/28
20
Ana II
C
60
**
Met II
drifted
spindle
3/30
80
Met II
24/30
Met II
drifted
spindle
Percent of eggs
Met II
Percent of eggs
Ana II
ML-7, Ca2+-def
90 Minutes
80
Percent of eggs
ML-7
90 Minutes
Met II
drifted
spindle
100
B
80
Percent of eggs
Met II
1/57
Ana II
12/57
Met II
drifted
spindle
44/57
Met II
40
DMSO, Ca2+-def
90 Minutes
60
0
40
D
83/83
A
Percent of eggs
Percent of eggs
80
100
43/43
100
Met II
drifted
spindle
Ana II
0
Met II
Met II
118
Telo II
Figure 2.7
U0126-induced and ML-7-induced parthenogenetic exit from metaphase II arrest (8
h)
Metaphase II eggs were treated with 0.5% DMSO (Panel A), 15 µM ML-7 (Panel B), or
50 µM U0126 (Panel C) for 8 h, then fixed and stained with DAPI to label DNA, anti-βtubulin to label the meiotic spindle. Eggs were classified as metaphase II (Met II; normal
metaphase II spindle morphology and cortical localization), Met II drifted spindle (i.e.,
metaphase II spindle that had moved into the cytoplasm from its normal cortical
localization; shown in Figure 2.4), anaphase II, telophase II, or pronuclear (Ana II, Telo
II, PN, respectively; i.e., progressing out of metaphase II arrest). For Panels D-F, eggs
were cultured in calcium-deficient medium and treated with 0.5% DMSO (Panel D), 15
µM ML-7 (Panel E) and 50 µM U0126 (Panel F) for 8 h. Panel G (Fertilized) shows
control eggs, not loaded with BAPTA-AM and inseminated for 8 h. For Panels H-J, eggs
were pre-loaded with 5 µM of the calcium chelator BAPTA-AM and then inseminated
(Panel H, Fertilized + BAPTA-AM), or treated with 15 μM ML-7 (Panel I), or 50 μM
U0126 (Panel J) for 8 h. The numbers in or above bars indicates numbers of eggs
analyzed. The extent of progression out of metaphase II arrest (combined numbers of
eggs in anaphase II and telophase II states) in U0126-treated eggs and ML-7-treated
eggs is statistically significant as compared to DMSO-treated eggs in calcium-containing
medium, calcium-deficient medium, and BAPTA-AM-loaded eggs (χ2 analysis, p <
0.0001, indicated with one asterisk). The extent of drifted spindle incidences in U0126treated eggs and ML-7-treated eggs is statistically significant as compared to DMSOtreated eggs (χ2 analysis, p < 0.0001, indicated with two asterisks).
119
0
40
20
80
60
0
120
ift
F
*
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
*
Percent of eggs
U0126, Ca2+- def
8 Hours
dr
ift
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
30/30
Percent of eggs
60
100
80
60
40
0
20
100
80
60
40
20
2/13
II
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
0
6/13
et
ift
Percent of eggs
20
4/4
80
5/13
M
dr
56/56
100
28/40
dr
II
40
M
et
II
dr
ift
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
Percent of eggs
60
10/40
II
60
20/34
et
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
D
80
1/40
et
2/34
1/34
M
ift
Percent of eggs
DMSO, Ca2+- def
8 Hours
1/40
100
6/34
5/34
80
M
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
E
ML-7, Ca2+- def
8 Hours
Percent of eggs
ift
Percent of eggs
20
24/43
dr
100
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
60
40
9/43
II
*
60
1/43
et
dr
0
3/43
C
M
II
20
ift
U0126
8 Hours
Percent of eggs
et
40
dr
*
19/45
1/45
6/45
12/45
7/45
M
80
II
40
DMSO
8 Hours
et
80
100
6/43
100
90/120
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
0
A
M
20
**
10/120
ift
20
12/120
dr
Percent of eggs
60
5/120
II
40
3/120
et
80
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
ed Me
sp t II
in
dl
An e
a
Te II
lo
II
PN
M
B
ML-7
8 Hours
ift
ift
Percent of eggs
100
dr
dr
60
II
II
80
et
et
100
M
M
Supplementary Figure 3
Fertilized
8 Hours
G
*
0
42/42
100
40
20
0
Fertilized
+ BAPTA
8 Hours
H
40
20
0
ML-7 + BAPTA
8 Hours
I
*
0
U0126 + BAPTA
8 Hours
J
Figure 2.8
Analysis of M-phase phospho-protein levels detected by MPM-2 staining
The monoclonal antibody MPM-2, which reacts with M-phase specific phospho-epitopes,
was used to assess M-phase status in individual eggs. Panels A-F show representative
eggs that were stained with MPM-2 (green), anti-β-tubulin (red), and DAPI (blue).
Panels A-C show controls cells at prophase I, metaphase II, and embryonic interphase
(embryos fixed at 3 h post-insemination). Prophase I oocytes have low CDK1 activity
and thus a low MPM-2 signal. Metaphase II arrested eggs have high CDK1 activity, and
thus a high MPM-2 signal. Early embryos have low CDK1 activity, and low MPM-2
signal. Panels D-F show representative eggs treated with 15 μM ML-7 or 50 μM U0126.
Panel D shows a representative egg with a metaphase II spindle that has drifted away
from the cortex. Panels E and F show representative eggs that have progressed to
anaphase II and telophase II following inhibitor treatment. Scale bar = 10 μM. Panel G
shows quantification of the intensity of MPM-2 signals in eggs in the different
experimental treatment groups. Numbers in bars indicate the numbers of eggs analyzed
in each experimental group. Error bars represent standard error of the mean.
Metaphase II DMSO-treated eggs are shown in the black bar. Prophase I oocytes,
fertilized eggs, and ML-7-treated and U0126-treated eggs are shown in blue. The
average MPM-2 signal intensities in ML-7-treated eggs and U0126-treated eggs were
statistically significant different (p < 0.05; ANOVA with Fisher's Protected Least
Significant Different post-hoc testing) compared to DMSO-treated eggs (black bar).
Eggs in which intracellular Ca2+ was chelated by pretreating with BAPTA-AM are shown
in in green, combined with either fertilization (labeled "fertilized;" these eggs do not exit
from metaphase II arrest and thus have high MPM-2 signals), or with ML-7 or U0126
treatment. Eggs that were treated with either DMSO, ML-7, or U0126 in Ca2+-deficient
medium are shown in in red. The average MPM-2 signal intensities for ML-7-treated
121
eggs and U0126-treated eggs without BAPTA-AM and in Ca2+-containing medium (blue
bars) were statistically significant different as compared to the comparable drug
treatment group with either BAPTA-AM loading (green bars) or when drug treatment
occurred in Ca2+-deficient medium (red bars) (p < 0.05; ANOVA with Fisher's PLSD posthoc testing).
122
123
Figure 2.9
Effects of U0126 or ML-7 treatment, ± zinc ionophore, on actin and pMRLC
Panels A-C and J-L show representative fluorescence images of pMRLC (green), actin
(red), and DNA (blue), in eggs treated for 3 h with DMSO (Panel A), ML-7 (Panel B), or
U0126 (Panel C), or in eggs that were treated with 10 µM zinc pyrithione (ZnPT) for 5
min, then with DMSO (Panel J), ML-7 (Panel K), or U0126 (Panel L) for 3 h. Panels D-F
and M-O are data from line scans around the circumference of the egg (starting at the
point opposite the DNA) of cortical actin signals in Panels A-C. The peaks in Panels D
and M correspond to the cortical actin cap overlying the DNA in Panels A and J
respectively. The line scans in Panels E, F, N and O have no distinct peak, coinciding
with the loss of the actin cap overlying the DNA following inhibitor treatment in Panels B,
C, K and L. Panels G-I and P-R are line scans of the cortical pMRLC fluorescence in
Panels A-C and J-L respectively. The data in Panels G and P show two distinct peaks,
associated with pMRLC localization at the boundary of the amicrovillar domain in Panels
A and J. The line scans in Panels H, I, Q and R do not show these distinct peaks. Scale
bar (in Panel L, applicable to all images) = 10 μm.
124
125
Figure 2.10
Effects of zinc ionophore treatment on U0126-induced and ML-7-induced
parthenogenetic exit from metaphase II arrest
For Panels D-F, metaphase II eggs were hyperloaded with zinc through treatment with
10 µM zinc pyrithione (ZnPT) for 5 min, then treated with 0.5% DMSO, 50 µM U0126 or
15 µM ML-7 for 3 h. Panels A-C show data from control eggs not treated with ZnPT and
simply treated with 0.5% DMSO, 50 µM U0126 or 15 µM ML-7 for 3 h. In Panels A-F,
eggs were analyzed and classified as in Figures 3 and 4: metaphase II, MII drifted
spindle, anaphase II, or telophase II (progression out of metaphase II arrest). Numbers
in or above the bar indicates numbers of eggs analyzed. The number of eggs that exited
from metaphase II arrest following treatment with U0126 is statistically significant
compared to U0126-treated eggs that were pre-treated with the ZnPT (χ2 analysis,
p<0.0001, illustrated with three asterisks). Other statistical comparisons: The extent of
progression out of metaphase II arrest in U0126-treated eggs and ML-7-treated eggs is
statistically significant as compared to DMSO-treated eggs (χ2 analysis, p < 0.0001,
indicated with one asterisk). The extent of drifted spindle occurrence in U0126-treated
eggs and ML-7-treated eggs is statistically significant as compared to DMSO-treated
eggs (χ2 analysis, p < 0.0001, indicated with two asterisks). Panel G shows
quantification of MPM-2 signals in eggs in the different experimental treatment groups,
either not treated with ZnPT (control, dark bars) or treated with ZnPT (light bars). Values
were normalized to DMSO-treated control metaphase II eggs. Numbers in bars indicate
number of eggs analyzed, and error bars represent standard error of the mean.
Asterisks over the bars indicate distinct statistically significant differences (determined by
ANOVA with Fisher's Protected Least Significant Different post-hoc testing); one asterisk
indicates statistically significantly different as compared to the group in DMSO and Ca2+-
126
containing medium, and two asterisks indicate statistically significantly different as
compared to the group in ZnPT-loaded eggs.
127
3/
N
C
N
128
N
N
S
S
Figure 2.11
Post-ovulatory aged eggs have reduced pMRLC, but similar MRLC, compared to
young eggs, and the extent of spontaneous parthenogenetic activation is rescued
by treatment with a zinc ionophore
Panel A shows representative blots of egg lysates (90 cells per lane; young eggs
collected 13 hours post hcG-injection (lane 1), or post-ovulatory aged eggs collected
from the oviduct 22 hours post hcG-injection), probed with anti-pMRLC and anti-MRLC.
Panels B and C show quantification of band intensities of anti-pMRLC levels and antiMRLC levels, respectively. Values were normalized to young eggs. Error bars
represent standard errors of the mean. The anti-pMRLC blots were performed 4 times.
The difference between levels of pMRLC in post-ovulatory aged eggs and young eggs is
statistically significant as compared to young eggs (Panels A and B; indicated by an
asterisks; Kruskal-Wallis test with Bonferroni-Dunn post-hoc testing, p = 0.0062). The
anti-MRLC blots were repeated 3 times. MRLC levels were similar in young and postovulatory aged eggs (Panels A and C). Panel D show analysis of spontaneous
parthenogenetic egg activation between post-ovulatory aged eggs that were left
untreated and cultured for 2 h, or were treated with zinc pyrithione (ZnPT) for 10 min
prior to culture for 2 h. The extent of parthenogenetic activation in the ZnPT-treated
group compared to the untreated group is statistically significant (χ2 analysis, p = 0.003).
This experiment was repeated 4 times.
129
Aged
Young
A
- 20
pMRLC
- 20
MRLC
1
B
2
Fold Change
1.2
1.0
0.8
0.6
*
0.4
0.2
0.0
Fold Change
C
Young
Aged
1.2
1.0
0.8
0.6
0.4
0.2
0.0
Young
Aged
D
% of eggs activated
100
80
49/69
60
32/78
40
20
0
Aged,
Untreated
130
Aged, ZnPTtreated
CHAPTER 3
IQGAP3 mediates metaphase I spindle positioning in mammalian oocytes by
regulating the localization of MAPK3/1 to the spindle
I. ABSTRACT
The position of the spindle dictates the site of cytokinesis, and it is important that
the oocyte’s metaphase I spindle is positioned asymmetrically prior to division to ensure
unequal division of cytoplasmic nutrients to the egg and polar body. Spindle movement
is generated by the myosin-II motor, and spindle positioning is mediated by cytoplasmic
actin and dynamic cortical actin (Schuh and Ellenberg, 2008; Li et al., 2008; Chaigne et
al., 2012; Chaigne et al., 2015). IQ motif-containing GTPase activating protein 3
(IQGAP3) is a candidate for spindle positioning because it is implicated in cytokinesis
and contractile ring organization in other cell types and organisms (Eng et al., 1998; Epp
and Chant, 1997; Lippincott and Li, 1998). IQGAP3 is associated with the spindle in
metaphase I oocytes and metaphase II eggs. Following RNAi-mediated knockdown, the
majority of IQGAP3-deficient oocytes fail to recruit the metaphase I spindle to the cortex.
In HeLa cells, IQGAP3 recruitment to the contractile ring requires interaction with anillin
(Adachi et al., 2014), and myosin recruitment to the cytokinetic ring in yeast requires
binding to anillin-like Mid1 (Padmanabhan et al., 2011). Building upon this, we show that
IQGAP3 is required for normal localization of anillin, pMRLC, and actin. MAPK3/1 and
MLCK are necessary for asymmetric spindle positioning (Verlhac et al., 1996; Verlhac et
al., 2000, Schuh and Ellenberg, 2008; Chaigne et al., 2013), and we show that (1)
IQGAP3 is required for MAPK3/1 localization to the spindle, and (2) IQGAP3 and/or
anillin localization requires MAPK3/1 and MLCK. We propose that IQGAP3 mediates
metaphase I spindle positioning through the regulation of MAPK3/1 localization to the
spindle.
131
II. INTRODUCTION
It is critical that there is accurate coordination between the meiotic spindle and
actin-rich cortex because the position of the meiotic spindle dictates the site of
cytokinesis, ensuring unequal distribution of the nutrient-rich cytoplasm stockpiled during
oogenesis to daughter cells. This work addresses the novel candidate protein, IQ-motif
containing GTPase activating protein 3 (IQGAP3), and its role in spindle positioning in
mammalian oocytes. The spindle translocates to the cortex with the assistance of a
cytoplasmic actin meshwork and dynamic cortical actin network (Li et al., 2008; Schuh
and Ellenberg, 2008; Chaigne et al., 2013; Chaigne et al., 2015). Around the time of
germinal vesicle breakdown (GVBD), cytoplasmic actin filaments are arranged as a
symmetric cloud surrounding the condensing chromosomes (Li et al., 2008). A
symmetry-breaking event occurs at the start of spindle translocation that results in an
asymmetric cloud that lags behind the migrating chromosomes (Li et al., 2008) as
illustrated in Figure 1.4.
Spindle translocation to the cortex is achieved by a pushing force from behind
the spindle that is generated by actin filament polymerization, and by a pulling force from
the leading spindle pole that is generated by the myosin-II motor (Schuh and Ellenberg
2008; Li et al., 2008; Chaigne et al., 2013; Chaigne et al., 2015). Myosin-II-driven
spindle positioning was found when the rate of spindle movement slowed in oocytes
treated with the myosin light chain kinase (MLCK) inhibitor, ML-7 and in oocytes treated
with antibodies that cross-react with MYH9 (Schuh and Ellenberg, 2008; Simerly et al.,
1998). As the spindle reaches the cortex, the cytoplasmic actin filaments overlap with
the cortical actin network (Chaigne et al., 2013). Several changes to the cortical actin
network are necessary to finale the recruitment of the spindle to the cortex. MosMAPK3/1 triggers the cortical actin to undergo a thickening process that is mediated by
the Arp2/3 complex, and a simultaneous exclusion of myosin-II from the cortex (Chaigne
132
et al., 2013; Chaigne et al., 2015). The removal of myosin-II from the cortex coincides
with a decrease in cortical tension at the region of the cortex overlying the spindle
(Chaigne et al., 2013; Chaigne et al., 2015). Cortical actin thickening does not occur in
oocytes that lack MAPK3/1 activity, such as mos-/- oocytes or MEK1/2-inhibited oocytes
(Chaigne et al., 2013; Chaigne et al., 2015).
IQGAPs became of interest due to their roles in other cell types, particularly their
involvement in contractile ring organization and cytokinesis (Eng et al., 1998; Epp and
Chant, 1997; Lippincott and Li, 1998). The IQGAP family of proteins is found in a wide
variety of species, and is evolutionarily conserved, suggesting an important fundamental
function in the cell. Some characteristics of IQGAP make it a good candidate for spindle
positioning, an actin- and myosin-II-dependent process. IQGAPs localize to the
actomyosin ring and spindle pole body in budding and fission yeast (Eng et al., 1998;
Epp and Chant, 1997; Lippincott and Li, 1998). There are defects in actin-mediated
processes following the loss of IQGAP. Both rng2-null fission yeast and iqg1-null
budding yeast have defects in cytokinesis, altered actin organization, and fail to form
actomyosin rings (Eng et al., 1998; Epp and Chant, 1997).
In mouse oocytes, IQGAP3 possibly regulates exclusion of myosin-II from the
cortex, because Dictyostelium IQGAPs influence myosin localization and are critical for
regulating cortical tension and cellular mechanosensing through association with specific
actin cross-linkers (Dickinson et al., 2012; Faix et al., 1998; Mondal et al., 2010; Lee et
al., 1997). Certain IQGAPs, such as Saccharomyces cerevisiae Iqg1,
Schizosaccharomyces pombe Rng2, human IQGAP1 and human IQGAP3 interact with
the myosin essential light chain (Pathmanathan et al., 2008; Boyne et al., 2000;
Weissbach et al., 1998; Pathmanathan et al., 2008; D’souza et al., 2001; Atcheson et al.,
2011), thus making IQGAP3 a good candidate to interact with myosin-II, since myosin-II
generates the force for spindle movement.
133
There are three mammalian IQGAPs (IQGAP1, IQGAP2, and IQGAP3), but little
is known about their expression or function in mouse oocytes, except for one study
showing the localization of IQGAP1 (Bielak-Zmijewska et al., 2008). IQGAP3, in
particular, is a promising candidate because IQGAP3, but neither IQGAP1 nor IQGAP2,
is required for cytokinesis in murine epithelial cells and HeLa cells (Nojima et al., 2008;
Adachi et al., 2014). Transcriptome databases suggest that Iqgap3 mRNA is enriched in
mouse oocytes relative to other tissues, prompting us to examine IQGAP3 function in
oocytes (GeneAtlas, biogps.gnf.org).
Similar to IQGAPs, anillin interacts with actin, myosin-II and RhoA (Piekny and
Glotzer, 2008), molecules that are implicated in spindle positioning in oocytes as
discussed in Chapter 1 (Sections III C, III.D, and IV.A). Anillin was identified for its ability
to bind and bundle F-actin filaments in Drosophila (Field and Alberts, 1995; Kinoshita et
al., 2002; Oegema et al., 2000), making anillin a good candidate to participate in actinmediated spindle positioning. In HeLa cells, anillin is required for maintenance of
myosin-II at the equatorial plane during cytokinesis (Piekny and Glotzer, 2008). The
binding of anillin to the myosin-II hexamer is enabled by the phosphorylation of the
regulatory light chain (pMRLC) by MLCK in Xenopus egg extracts, the same kinase that
enables myosin-II driven spindle movement (Straight et al., 2005). An interaction
between IQGAP and anillin was discovered in fission yeast, where the IQGAP protein
Rng2 recruits myosin-II to the contractile ring through a physical interaction with the
anillin-related protein, Mid1 (Takaine et al., 2014; Padmanabhan et al., 2011; Almonacid
et al., 2011). Anillin interacts specifically with IQGAP3, but neither IQGAP1 or IQGAP2,
and this interaction is required for the recruitment of anillin to the contractile ring in HeLa
cells (Adachi et al., 2014), prompting us to test the hypothesis that IQGAP3 is required
for anillin localization in mouse oocytes.
134
The domain structure of IQGAPs enables these proteins to serve as a scaffold
for actin cross-linkers and small GTPases, especially Rac1 and Cdc42 (Bashour et al.,
1997; Brandt and Gross, 2007). The IQGAP domain structure contains four IQ motifs
that bind calmodulin, a GAP-related domain that mediates binding of Rac1 and Cdc42,
and a calponin homology domain (CHD) that binds actin (Wang et al., 2007). IQGAP1
localization is controlled by Rac1 and Cdc42 activity in fibroblasts (Watanabe et al.,
2004). Interestingly, Rac1 and Cdc42 play a role in spindle morphology and positioning
in mouse oocytes (Halet and Carroll, 2007; Na and Zernicka-Goetz, 2006). A dominantnegative or a constitutively active mutant of Cdc42 prevents spindle translocation to the
cortex in meiosis I, a similar phenotype observed in oocytes expressing a dominant
negative form of Rac1 (Na and Zernicka-Goetz, 2006; Halet and Carroll, 2007).
In addition to the small GTPases Rac1 and Cdc42, IQGAPs interact with
mitogen-activated protein kinase 1 (MAPK1, Erk2, or p42MAPK) and mitogen-activated
protein kinase 3 (also known as MAPK3, Erk1, or p44MAPK), a component of the MosMAPK3/1 signaling pathway that regulates various cellular processes in mammalian
oocytes (Roy et al., 2005; Ren et al., 2007; Chaigne et al., 2013; Simerly et al., 1998;
Schuh and Ellenberg, 2008; Chaigne et al., 2015). MAPK3/1 is phosphorylated and
activated by the upstream MAPK kinase 1 and 2 (MEK1/2), which is activated by the
accumulation of Mos, a MAPK kinase kinase (MAPK3K)(Shibuya and Ruderman, 1993;
Posada et al., 1993). MAPK3/1 is required for spindle positioning, since the spindle fails
to translocate to the cortex in mos-/- oocytes that lack MAPK3/1 activity (Verlhac et al.,
1996; Verlhac et al., 2000). IQGAP3 expression is regulated by MEK1/2, because
IQGAP3 expression is suppressed in epithelial cells treated with the MEK1/2-inhbitior,
U0126 (Nojima et al., 2008). Additionally, IQGAP3 mediates ERK2 (MAPK1) activation
because MAPK1 activity is inhibited in IQGAP3-deficient epithelial cells (Nojima et al.,
2008). In mammalian cells, IQGAP3 specifically interacts with ERK1 (Yang et al., 2014),
135
leading us to investigate MAPK3/1 localization in IQGAP3-deficient oocytes. Building
upon these previously established interactions between MAPK3/1 and IQGAP3 in
mammalian cells, we hypothesize that IQGAP3 mediates MAPK3/1 localization, and/or
MAPK3/1 affects IQGAP3 localization.
The study here tests the hypothesis that IQGAP3 functions in spindle positioning
through anillin and/or MAPK3/1. Since there is currently no IQGAP3 knockout mouse,
IQGAP3-deficient oocytes were created using RNAi-mediated knockdown, and the
meiotic spindle was examined at various time points throughout meiosis I. The
localizations of actin and pMRLC (both required for spindle positioning), as well as anillin
and MAPK3/1 (known proteins to interact with IQGAP3) were examined in IQGAP3deficient oocytes. Finally, IQGAP3 and anillin localizations were observed in MAPK3/1and MLCK-inhibited oocytes, proteins previously implicated in spindle positioning during
meiosis I (Verlhac et al., 1996; Verlhac et al., 2000; Schuh and Ellenberg, 2008).
III. MATERIALS AND METHODS
Collection, culture, and maturation of prophase I oocytes
Animals were used in accordance with the guidelines of the Johns Hopkins
University Animal Care and Use Committee. Prophase I-arrested oocytes were
collected from 6-8-week old female CF-1 mice (Harlan, Indianapolis, IN). Oocytes were
collected in Whitten's medium (109.5 mM NaCl, 4.7 mM KCl, 1.2 mM KH2PO4, 1.2 mM
MgSO4, 5.5 mM glucose, 0.23 mM pyruvic acid, 4.8 mM lactic acid hemicalcium salt
(referred to hereafter as WH medium (Whitten, 1971) supplemented with 7 mM NaHCO3,
15 mM HEPES and 0.05% polyvinyl alcohol (PVA; catalog #P8136; Sigma-Aldrich; St.
Louis, MO), referred to hereafter as WH/PVA medium. Dibutryryl cAMP (dbcAMP; 0.25
mM; catalog #D0627; Sigma-Aldrich) was added to the culture medium to maintain
prophase I arrest (Cho et al., 1974). Ovarian tissue was sheared with syringe needles in
order to release oocyte-cumulus complexes. Oocyte-cumulus complexes were denuded
136
by pipetting through a thin-bore glass pipette. Oocytes were transferred to Whitten’s
medium supplemented with 22 mM bicarbonate NaHCO3 and 0.05% polyvinyl alcohol
(referred to hereafter as WB/PVA) covered with mineral oil and placed in a humidified
atmosphere of 37oC, 5% CO2 for culture. For microinjection and culture time following
microinjection, oocytes were cultured in EmbryoMax® KSOM + amino acids with DGlucose (catalog #MR-106-D, Millipore; Billerica, MA), hereafter referred to as KSOM,
supplemented with 0.25 mM dbcAMP. For in vitro maturation, prophase I oocytes were
washed through several drops of WB/PVA or KSOM to remove dbcAMP.
Removal of zona pellucida and recovery
The zonae pellucidae (ZP) of cumulus-free oocytes and eggs were removed with
a brief incubation (~10-15 sec) in acidic culture medium compatible buffer (116.4 mM
NaCl, 5.4 mM KCl, 10 mM HEPES, 1 mM NaH2PO4, 0.8 mM MgSO4, pH 1.5). ZP-free
oocytes and eggs were washed through several drops of WB/PVA and cultured in
WB/PVA at 37oC in a humidified atmosphere of 5% CO2 in air. ZP-free prophase I
oocytes were washed and cultured in WB/PVA supplemented with 0.25 mM dbcAMP to
maintain prophase I arrest.
Immunofluorescence and fluorescence microscopy
General method
ZP-free oocytes and eggs were fixed in freshly prepared 4.0% paraformaldehyde
(catalog #P6148; Sigma-Aldrich) in phosphate-buffered saline (PBS, 137 mM NaCl, 3
mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4) for 60 min at room temperature or in
4.0% paraformaldehyde (prepared in 130 mM KCl, 25 mM HEPES, 3 mM MgCl2, 0.06%
Triton-X, pH 7.4) for 30 min at 37oC. Oocytes and eggs labeled with anti-anillin antibody
were fixed in cold methanol at -20oC for 5 min. Following fixation, oocytes were briefly
washed in 1x PBS, permeabilized for 15 min in PBS containing 0.1% Triton X-100
(catalog # BP-151-500; Fisher Scientific), and incubated in blocking solution (PBS
137
containing 0.1% BSA (catalog #A9647; Sigma-Aldrich), 0.01% Tween-20 (catalog
#P7949; Sigma-Aldrich), and 10% normal goat serum (NGS, catalog #5425; Cell
Signaling Technologies; Danvers, MA)). Oocytes and eggs were incubated in primary
antibody diluted in blocking solution for a minimum of 2 h. Eggs were washed, and then
incubated in secondary antibody for 2 h. Eggs were mounted in Vectashield mounting
medium (catalog #H-1200; Vector Laboratories; Burlingame, CA) supplemented with 1.5
μg/ml 4’6’-diamidino-2-phnylindole (DAPI; catalog #D9542; Sigma-Aldrich).
Imaging was performed on Zeiss Axio Observer Z1 Fluorescence microscope
with a Zeiss Axiocam MRm camera, Apotome optical sectioning and AxioVision software
(Carl Zeiss, Inc.). Analysis of the fluorescent intensity of IQGAP3 signals in the egg
cortex was performed using plot profile line scan analysis in ImageJ software
(http://rsb.info.nih/gov/ij/), using a line of sufficient width to capture the cortical staining
with anti-IQGAP3 antibody. Analysis of spindle localization in siRNA-injected oocytes
and pharmacological inhibitor-treated oocytes was performed measuring the distance
between DNA and cortex using AxioVision software, specifically using the point of the
maternal DNA closest to the egg periphery as the start point, and the egg perimeter as
the end point. An oocyte or egg was classified as having “DNA at the cortex” if DNA and
spindle was 10 μm or less from the cortex, or classified as “DNA not at the cortex” if the
DNA and the spindle was greater than 10 μm from the cortex. Phalloidin images in
Figure 3.2 G-J were captured using a Zeiss CellObserver Z1 linked to an ORCA-Flash
4.0 CMOS camera (Hamamatsu) and analyzed with the Zeiss ZEN 2012 blue edition
image software.
IQGAP3 labeling
ZP-free oocytes and eggs were fixed in 4% paraformaldehyde in PBS for 60 min
at room temperature, briefly washed in 1x PBS, and permeablized for 15 min in PBS
containing 0.1% Triton X-100 (Sigma-Aldrich). Prophase I oocytes and metaphase II
138
eggs were incubated in blocking solution for 60 min at room temperature and metaphase
I oocytes were incubated in blocking solution overnight at 4oC due to timing of
experiment. Oocytes and eggs were incubated in anti-IQGAP3 antibody (catalog #sc134688, Santa Cruz Biotech; Dallas, TX) at 2 μg/ml diluted in blocking solution for 2 h.
Eggs were washed, and then incubated in secondary antibody (7.5 μg/ml goat-anti-rabbit
IgG-FITC; or 7.5 μg/ml donkey-anti-rabbit IgG-Texas Red; Jackson Immunoresearch;
West Grove, PA) for 2 h. Eggs were mounted in Vectashield mounting medium
supplemented with 1.5 μg/ml DAPI.
α-tubulin and Filamentous-Actin labeling
ZP-free oocytes and eggs were fixed in 4% paraformaldehyde buffered with
HEPES for 30 min at 37°C, then briefly washed in 1x PBS, and permeablized for 15 min
in PBS containing 0.1% Triton X-100 (Sigma-Aldrich). Metaphase II eggs were
incubated in blocking solution for 60 min at room temperature and metaphase I oocytes
were incubated in blocking solution overnight at 4oC. Oocytes and eggs were incubated
for 2 h in anti-α-tubulin monoclonal supernatant diluted 1:5 (clone 12G10; developed by
Joseph Frankel and E. Marlo Nelson, obtained from the Developmental Studies
Hybridoma Bank developed under the auspices of the NICHD and maintained by The
University of Iowa, Department of Biology, Iowa City, IA). Eggs were washed, and then
incubated in secondary antibody (7.5 μg/ml goat-anti-mouse IgG-FITC; Jackson
Immunoresearch) and Acti-stain phalloidin-555 (200 ng/μl; catalog #PHDH1-A;
Cytoskeleton; Denver, CO) for 2 h. Eggs were mounted in Vectashield mounting
medium supplemented with 1.5 μg/ml DAPI.
Phosphorylated myosin regulatory light chain (pMRLC) labeling
ZP-free oocytes were fixed in 4.0% paraformaldehyde buffered with HEPES for
30 min at 37°C, washed quickly in 1x PBS, permeabilized for 15 min in PBS containing
0.1% Triton X-100 (Sigma-Aldrich). Oocytes were incubated in blocking solution
139
supplemented with 100 μM sodium orthovandate (Na3VO4; Sigma-Aldrich) for 60 min,
and then incubated in anti-pMRLC (also known as MYL9, catalog #3675, produced
against syntheticphosphopeptide corresponding to residues surrounding Ser19 of
human myosin light chain 2; Cell Signaling Technologies) at 100 ng/ml diluted in
blocking solution overnight at 4°C. Eggs were washed, then incubated in secondary
antibody (7.5 μg/ml donkey-anti-rabbit IgG-Texas Red; Jackson Immunoresearch) for 2
h. Eggs were mounted in Vectashield mounting medium supplemented with 1.5 μg/ml
DAPI.
Filamentous-Actin labeling
ZP-free oocytes were fixed in 4% paraformaldehyde buffered with HEPES for 30
min at 37°C, then briefly washed in 1x PBS, and permeablized for 15 min in PBS
containing 0.1% Triton X-100 (Sigma-Aldrich). Oocytes were incubated in IIF-block
overnight at 4oC. Oocytes were incubated in Acti-stain phalloidin-555 (200 ng/μl;
Cytoskeleton) for 2 h and washed. Eggs were mounted in Vectashield mounting
medium supplemented with 1.5 μg/ml DAPI.
MAPK3/1 labeling
ZP-free oocytes were fixed in 4% paraformaldehyde in PBS for 60 min at room
temperature, then briefly washed in 1x PBS, permeablized for 15 min in PBS containing
0.1% Triton X-100 (Sigma-Aldrich), and incubated in blocking solution overnight at 4oC.
Oocytes were incubated in anti-MAPK3/1 (800 ng/ml; catalog # 4695, Cell Signaling
Technologies) for 2 h. Oocytes were washed, and then incubated in secondary antibody
(7.5 μg/ml goat-anti-rabbit IgG-FITC; Jackson Immunoresearch) for 2 h. Eggs were
washed and mounted in Vectashield mounting medium supplemented with 1.5 μg/ml
DAPI.
140
Anillin labeling
ZP-free oocytes and eggs were fixed in cold methanol at -20oC for 5 min and
washed through several drops of 1x PBS. Prophase I oocytes and metaphase II eggs
were incubated in blocking solution for 60 min at room temperature and metaphase I
oocytes were incubated in blocking solution overnight at 4oC. Oocytes and eggs were
incubated with anti-anillin (10 μg/ml; catalog #GTX107742, GeneTex; Irvine, CA) for 2 h.
Eggs were washed and incubated with secondary antibody (7.5 μg/ml goat-anti-rabbit
IgG-FITC; Jackson Immunoresearch) for 2 h. Eggs were washed and mounted in
Vectashield mounting medium supplemented with 1.5 μg/ml DAPI.
Immunoblotting
General method
Samples were prepared by lysing oocytes in 10 μl SDS-PAGE sample buffer (65
mM Tris-HCl, 10% glycerol, 3.0% SDS, 0.02% bromophenol blue, 2% βmercaptoethanol pH 6.8) and heating at 100°C for 10 min. Proteins were separated on
8% SDS-polyacrylamide gels, then transferred to Immobilon-P PVDF membrane
(catalog # IPVH00010; Millipore). Membranes were blocked for 2 h in 5% dry milk
(Safeway) diluted in Tris-buffered saline with 0.1% Tween-20 (TBS-T), then incubated
overnight at 4°C in primary antibody diluted in TBS-T with 3% BSA and 0.02% NaN3
(catalog #GTX107742, GeneTex). After washing, membranes were incubated for 2 h at
room temperature in goat anti-rabbit immunoglobulin G (IgG) horseradish peroxidaseconjugated secondary antibody (GAR-HRP, 400 ng/ml; Jackson Immunoresearch)
diluted in TBS-T with 5% BSA. Immune conjugates were detected using SuperSignal
West Pico Chemiluminescent Substrate (catalog # 248300; Pierce Chemical
Company/Thermo Scientific, Rockford, IL) and X-ray film (catalog #248300; Research
Products International Corporation, Mount Prospect, IL).
141
Anti-IQGAP3 immunoblot
Samples of 185 prophase I oocytes (12 µg protein) were prepared by lysing in 10
μl SDS-PAGE sample buffer. Oocyte samples and positive tissue control (160 µg brain
lysate) were loaded and proteins were separated on 8% SDS-polyacrylamide gels, then
transferred at a constant current of 85 mAmps to Immobilon-P PVDF membrane
overnight at 4°C. Membranes were blocked for 2 h in 5% dry milk diluted in TBS-T, then
incubated overnight at 4°C in 100 μg/ml anti-IQGAP3 antibody diluted in TBS-T with 3%
BSA and 0.02% NaN3 (catalog #GTX123684, GeneTex). After washing, membranes
were incubated for 2 h at room temperature in GAR-HRP (400 ng/ml) diluted in TBS-T
with 5% BSA. Immune conjugates were detected using SuperSignal West Pico
Chemiluminescent Substrate and X-ray film.
Anti-anillin immunoblot
Samples of 100 control siRNA-injected prophase I oocytes and 100 Anlntargeting siRNA-injected prophase I oocytes cultured for 48 h following microinjection
were prepared by lysing oocytes in 10 μl SDS-PAGE sample buffer. Proteins were
separated on 8% SDS-polyacrylamide gels, then transferred to Immobilon-P PVDF
membrane. Membranes were blocked for 2 h in 5% dry milk diluted in TBS-T, then
incubated overnight at 4°C in 0.5 μg/ml anti-anillin antibody diluted in TBS-T with 3%
BSA and 0.02% NaN3 (catalog #GTX107742, GeneTex). After washing, membranes
were incubated for 2 h at room temperature in GAR-HRP (400 ng/ml) diluted in TBS-T
with 5% BSA. Immune conjugates were detected using SuperSignal West Pico
Chemiluminescent Substrate and X-ray film.
Band intensity was analyzed using ImageJ software (http://rsb.info.nih/gov/ij/),
selecting an appropriate exposure time for each blot such that no signals were
saturated. The rectangular selection tool was used to select each band and peak
intensity was determined. The area under each peak was calculated as a measure of
142
band intensity. Band intensities were reported as mean value in arbitrary units (A.U) ±
SEM for each group.
siRNA-mediated knockdown
ZP-intact prophase I oocytes were collected as described above and
microinjected in groups of 50 oocytes per 12 μl KSOM supplemented with 0.25 mM
dbcAMP under mineral oil in ambient air at room temperature. Oocytes were
microinjected using a Nikon Eclipse TE 2000–5 microscope with a 10x objective
(Melville, NY) equipped with an Eppendorf FemtoJet®(Hamburg, Germany), using
injection pressure of 200 hPa, injection time of 0.2 s, and compensation pressure of 0
hPa. Thinwall glass capillaries (catalog #TW100F-4; World Precision Instruments;
Sarastoa, FL) were used for microinjection needles pulled on micropipette puller (Model
P-87 Brown-Flaming; Sutter Instrument Co.) set to Heat 620, Pull 83-85, Velocity 70,
Time 150, Pressure 200. The medium for siRNA-injected oocytes was changed daily
and culture times are described in figure legends.
Oocytes were injected with Iqgap3-targeting siRNA or Anln-targeting siRNA (ONTARGET-plus SMARTpool, catalog #L-067152-00-0005 or catalog #L-056109-01-0005;
Dharmacon; Waltham, MA). siRNA was resuspended according to manufacturer’s
instructions, to a concentration of 100 μM in 1 volume of 5x siRNA Buffer (B-002000-UB100; Dharmacon) and 4 volumes of RNase-free water. Control siRNA (catalog # D001810-10-20, ON-TARGETplus control pool; Dharmacon) was used as a negative
control. Stocks of 100 μM Iqgap3-targeting siRNA were diluted to a concentration of 40
μM in 1x siRNA buffer for microinjection and stored in aliquots of 2.5 μl at -80oC. Stocks
of 100 μM anln-targeting siRNA were diluted to 50 μM, 75 μM and 100 μM in 1x siRNA
buffer for microinjection and stored in aliquots of 2.5 μl at -80oC.
143
Isolation of RNA, synthesis of cDNA, and Polymerase Chain Reaction (PCR)
Forty-eight hours following microinjection, RNA was isolated from siRNA-injected
oocytes by lysing at least 25 prophase I oocytes in 200 μl Trizol (catalog #15596-026;
Invitrogen; Carlsbad, CA) and inverting for 5 min at room temperature. The mixture was
treated with 1/10th of a volume of chloroform (20 μl), inverted several times and
incubated on ice for 5 min. The tubes were centrifuged at 4oC for 20 min at 14,000 rpm.
The upper, aqueous layer was transferred to a fresh 1.5 ml RNase-free tube, 1 μl of
glycogen (20 mg/ml stock; Invitrogen) was added and the tube was inverted. An equal
volume of isopropanol was added and the RNA was precipitated overnight at -20oC. The
RNA was pelleted by centrifuging for 20 min at 14,000 rpm. The RNA pellet was
washed with 70% ethanol, re-centrifuged for 5 min at 14,000 rpm and air-dried. The
RNA was re-suspended in 8 μl RNase-free water and RNA concentration was
determined by measuring the OD260.
First-strand cDNA synthesis was performed following manufacturer’s instructions
using 2 μg total RNA added to 50 ng random hexamer primers (50 ng, Promega;
Madison, WI), 1 μl dNTP mix (New England Biolabs; Ipswich, MA), and sterile RNasefree water up to a 13 μl reaction. The mixture was heated for 65oC for 5 min and
incubated on ice for one min. Following a brief centrifugation, to the contents of the tube
were added 4 μl 5x First-Strand Buffer (Invitrogen), 1 μl 0.1 M DTT, 1 μl RNaseOUTTM
Recombinant RNase Inhibitor (40 units/ μl, catalog # 10777-019, Invitrogen), 1 μl
SuperScriptTM III RT (200 units/μl; Invitrogen). The mixture was incubated at room
temperature for 5 min, 50oC for 60 min, and 70oC for 15 min. 1μl (2 units) of E. coli
RNase H (New England Biolabs; Ipswich, MA) was added to remove RNA
complementary to the cDNA, the reaction was incubated at 37oC for 20 min and cDNA
was stored at -20oC.
144
RNA knockdown was assessed using RT-PCR with gene-specific primers to
Iqgap3 and Anln. The forward and reverse primers for Iqgap3 was 5’GAGCTCGGACAGCCTATGAG-3’ and 3’-GTTGATGTTGTCCGTGTGCC-5’,
respectively. The forward and reverse primers for Anln were 5’ACACCGTAACATTTGGGCCT-3’ and 5’-GATGGCCTAGTGTCAGCACA-3’,
respectively (Invitrogen custom primers). Tissue plasminogen activator (Plat) was used
as a positive control as previously described in mouse oocytes (Svoboda et al., 2000).
PCR reactions were performed in 25 μl volumes with 2.5 μl 10x Buffer (with MgCl2),
0.375 μl 10 mM dNTP, 0.25 μl 40 μM forward primer, 0.25 μl 40 μM reverse primer, 1 μl
template cDNA, 20.375 μl sterile ddH2O and 0.25 μl Taq polymerase. The amount of
PCR product was evaluated over a range of cycle numbers to prevent saturation at an
annealing temperature of 56oC for TPA primers, 52oC for Iqgap3 primers, and 59.1oC for
Anln primers using the T100 Thermal Cycler (Bio-Rad Laboratories; Hercules, CA). The
cycle numbers selected for Plat, Iqgap3, and Anln primers were 29, 30 and 31 cycles.
PCR products were separated on 1.5% agarose gels, which were made from
0.75 g agarose (catalog #A6013-500G; Sigma-Aldrich) and 8 μl Ethidium bromide in 50
ml 0.5x Tris-borate-EDTA at a constant voltage of 100 volts for 60 min. The agarose gel
was scanned using the FujiFilm FLA-7000 imaging system (FujiFilm; Valhalla, NY). FLA7000 image files were exported to the MultiGauge program (FujiFilm). Band intensity
was analyzed using ImageJ software (http://rsb.info.nih/gov/ij/), selecting an appropriate
exposure time for each blot such that no signals were saturated. The rectangular
selection tool was used to select each band and peak intensity was determined. The
area under each peak was calculated as a measure of band intensity. Band intensities
were reported as mean value in arbitrary units (A.U) ± SEM for each group.
145
Treatment of oocytes with pharmacological inhibitors
The MEK inhibitor U0126 (Cell Signaling Technologies; which inhibits MEK1/2,
also known as mitogen-activated protein kinase kinase 1 and 2, or MAP2K1/2 (Favata et
al., 1998) was used to treat metaphase II eggs as previously described (Phillips et al.,
2002; Petrunewich et al., 2009; Yu et al., 2007; Nabti et al., 2014; McGinnis et al., 2015).
U0126 was prepared as a 10 mM stock in DMSO, and used to treat eggs at a
concentration 50 μM, based on previous work showing that parthenogenetic activation of
eggs by U0126 was dose-dependent through 8 h of treatment, whereas 100 μM U0126
was cytotoxic to eggs (Philips et al., 2002). The myosin light chain kinase (MLCK)
inhibitor ML-7 (Sigma-Aldrich; ML-7 inhibits MYLK and the skeletal muscle form,
MYLK2) was used as previously described (Larson et al., 2010; Matson et al., 2006;
McGinnis et al., 2015). ML-7 was prepared as a 10 mM stock in DMSO, and used to
treat eggs at a concentration 15 μM based on studies of the dose-dependence of ML-7
effects on metaphase II eggs (Matson et al., 2006). DMSO at a concentration of 0.5%
was used as a solvent control. DMSO, U0126, and ML-7 were diluted in WB/PVA for
treatment of eggs; treatment times are specified in text and figure legends. ML-7
treatment was done in four-well Nunclon Δ-treated plates (Fisher Scientific; Pittsburgh,
PA) without mineral oil overlay, as done previously (Larson et al., 2010; Matson et al.,
2006; Markoulaki et al., 2004).
Statistical analyses
Analyses were performed using StatView 5.0 (SAS Institute, Cary, NC). A pvalue less than 0.05 was considered significant. Chi-squared (χ2) tests were used to
compare distribution of frequencies observed following microinjection or pharmacological
inhibitor treatment.
146
IV. RESULTS
IQGAP3 localization throughout meiotic maturation, and RNAi-mediated
knockdown of IQGAP3 protein
Immunofluorescence was used to localize IQGAP3 at various stages of meiotic
maturation. At prophase I and metaphase I, IQGAP3 localized to the cortex and to the
spindle, respectively (Figure 3.1A, B). IQGAP3 had a variety of localizations at
metaphase II, including primarily to the spindle, to the astral-like microtubules around the
spindle, and to the spindle and subcortical region of the egg (Figure 3.1C-E). To
investigate the function of IQGAP3 in oocytes, RNAi-mediated knockdown was used to
generate IQGAP3-deficient oocytes. The sequences in the Iqgap3-targeting pool were
subjected to analysis by BLAST and verified to be specific for Iqgap3, and not to have
sequence homology to Iqgap1 or Iqgap2. Prophase I oocytes were injected with 40 μM
control siRNA or 40 μM Iqgap3-targeting siRNA, and cultured for 48 h in conditions that
maintained prophase I arrest. Prophase I oocytes injected with Iqgap3-targeting siRNA
had 81.5 ± 7% knockdown at the transcript level compared to oocytes injected with
control siRNA (Figure 3.1F, G). An anti-IQGAP3 immunoblot required over 180 oocytes
per lane for the appropriate band to be detected; in one experimental run of this, 34%
knockdown was detected at the protein level in Iqgap3-targeting siRNA injected oocytes
compared to control siRNA-injected oocytes (Figure 3.1H). Due to the large number of
oocytes required for anti-IQGAP3 immunoblotting, immunofluorescence was a practical
and informative approach to assess IQGAP3 knockdown. Control siRNA-injected
oocytes had a strong IQGAP3 signal at the cortex (Figure 3.1I), whereas oocytes
injected with Iqgap3-targeting siRNA had a much fainter IQGAP3 signal (Figure 3.1J, K).
The fluorescent IQGAP3 signal was quantified with a line-scan analysis along the
circumference of the cortex (Figure 3.1L), confirming that IQGAP3 protein was knocked
down in these siRNA-injected oocytes.
147
Meiotic maturation in IQGAP3-deficient oocytes
In mammalian oocytes, meiotic resumption out of prophase I arrest is analogous
to the G2-to-M transition in mitotic cells. IQGAP3-deficient oocytes were assessed for
their ability to exit prophase I and undergo meiotic maturation. Prophase I oocytes were
cultured dbcAMP-containing media to maintain prophase I arrest (Cho et al., 1974)
during the 48 h culture time following microinjection to allow for protein knockdown.
Oocytes could begin meiotic maturation when dbcAMP was washed away, and were
scored on the ability to exit from prophase I arrest and undergo GVBD. Progression out
of GVBD appeared normal, with 61% (102/166) of IQGAP3-deficient oocytes and 67%
(121/181) of control oocytes undergoing GVBD by 5 h post-dbCAMP removal. We then
investigated whether IQGAP3-deficient oocytes could reach metaphase I by culturing
control and IQGAP3-deficient oocytes for 8 h following exit from prophase I arrest.
Control siRNA-injected oocytes fixed at 8 h following exit from prophase I arrest were at
metaphase I. Next, we examined the localization of the spindle to determine if IQGAP3
plays a role in spindle positioning. A metaphase I spindle formed and translocated to the
cortex in 46% (62/159) of control oocytes (Figure 3.2B). IQGAP3-deficient oocytes
displayed a range of phenotypes at 8 h following exit from prophase I arrest. The
majority of IQGAP3-deficient oocytes formed a normal spindle (91%, 146/161 oocytes),
however, only 14% (22/161) of oocytes had a spindle positioned adjacent to the cortex,
whereas the majority of oocytes had a spindle that did not reach the cortex (Figure 3.2CE). The distance between the DNA and cortex was measured, and an oocyte was
scored as “DNA at cortex” if DNA measured 10 μm or less from the cortex, or scored as
“DNA not at cortex” if DNA was greater than 10 μm from the cortex. 57% of control
oocytes (91/159) had DNA that had not yet reached the cortex, compared to 77% of
IQGAP3-deficient oocytes (124/161). A small number (6/159) of control oocytes and 8%
(13/161) of IQGAP3-deficient oocytes had condensed DNA that was not clustered or
148
aligned as seen by individual chromosomes in the cytoplasm (Figure 3.2E). A small
subset (2/161) of IQGAP3-deficient oocytes underwent what appeared to be abnormal
cytokinesis in which DNA appeared to be in anaphase or telophase and moving to
opposite poles of the spindle (Figure 3.2F). Varying extents of IQGAP3 protein
knockdown could be attributed to the different phenotypes observed in IQGAP3-deficient
oocytes. Analysis of the frequency distributions of the phenotypes revealed there was a
statistically significant difference between control oocytes and IQGAP3-deficient oocytes
(Figure 3.2K).
As described in the introduction, cytoplasmic actin and cortical actin mediate
positioning of the metaphase I spindle, so the localization of actin was next examined in
control and IQGAP3-deficient oocytes (Schuh and Ellenberg, 2008; Li et al., 2008;
Chaigne et al., 2013; Chaigne et al., 2015). Control oocytes fixed at 8 h after initiation of
maturation revealed actin localized to the region of the cortex overlying the DNA when
the DNA was less than 10 µm from the cortex (Figure 3.2B, G, H), or actin localized
uniformly around the cortex when the DNA was greater than 10 µm from the cortex
(Figure 3.2A). IQGAP3-deficient oocytes were time-matched to control oocytes for all
experiments. IQGAP3-deficient oocytes fixed at this 8 h time point after initiation of
maturation did not have the patch of cortical actin overlying the meiotic spindle, but
rather actin localized uniformly around the oocyte cortex or as an actin cloud
surrounding the DNA (Figure 3.2C-E, I, J). Of the IQGAP3-deficient oocytes that had an
actin cloud around the DNA, 74% (17/23) of oocytes had a symmetric actin cloud around
the DNA, and 26% (6/23) of oocytes had an asymmetric cloud around the DNA. In
IQGAP3-deficent oocytes with an asymmetric actin cloud, the majority of the cloud
trailed behind the DNA that had translocated away from the center of the oocyte,
suggesting that the symmetry-breaking event previously described in Li et al., 2008 had
occurred.
149
As noted above, the metaphase I spindle did not reach the cortex in the majority
of IQGAP3-deficient oocytes (Figure 3.2K). We examined whether this effect was timedependent, testing the hypothesis that DNA translocation occurred more slowly in
IQGAP3-deficient oocytes as compared to control oocytes. Control and IQGAP3deficient oocytes were analyzed at 16 h after the initiation of meiotic maturation,
because control oocytes would be arrested at metaphase II when the spindle was
adjacent to the cortex, actin localized in a cap to the cortical region overlying the spindle,
and first polar body emission occurred (Figure 3.2L). The DNA measurements were
defined by the same distance parametric as at metaphase I, an oocyte was classified as
“DNA at cortex” if DNA measured 10 μm or less from the cortex, or classified as “DNA
not at cortex” if DNA was greater than 10 μm from the cortex. After 16 h following exit
from prophase I arrest, 73% of control siRNA-injected oocytes (19/26) were at
metaphase II, compared to only 24% of IQGAP3-deficient oocytes (8/33). The majority
(55%, 8/33) of IQGAP3-deficient oocytes had a spindle that did not reach the cortex,
compared to 8% (2/26) of control siRNA-injected oocytes. In some of the IQGAP3deficient oocytes, actin localized as a cloud around the DNA and uniformly around the
cortex (Figure 3.2O), as seen in the oocytes fixed at 8 h after exit from prophase I arrest.
19% (5/26) of control oocytes and 9% (3/33) of IQGAP3-deficient oocytes had DNA in
the process of condensing as seen by discrete chromosomes in the cytoplasm (Figure
3.2M). The remaining 12% (4/33) of IQGAP3-deficient oocytes had condensed and
clustered DNA (Figure 3.2N). There was a statistically significant difference calculated
from the frequency distributions of these different phenotypes at 16 h between the
control and IQGAP3-deficient oocytes at 16 h (Figure 3.2Q).
Anillin and myosin-II are mislocalized in IQGAP3-deficient oocytes.
In fission yeast, IQGAP Rng2 is recruited to the cytokinetic ring through its
interaction with anillin-like Mid1 (Takaine et al., 2014; Padmanabhan et al., 2011;
150
Almonacid et al., 2011). Similarly, IQGAP3 localization to the cytokinetic ring is
dependent upon an interaction with anillin in HeLa cells (Adachi et al., 2014). Based on
the previously established interaction between IQGAPs and anillin, anillin localization
was examined in IQGAP3-deficient oocytes. At metaphase I, the localization of anillin
varied based on where the aligned chromosomes were positioned relative to the cortex.
If the chromosomes were greater than 10 μm from the cortex, anillin localized as a
cluster around the chromosomes (Figure 3.3A). If the oocyte chromosomes were less
than 10 μm from the cortex, anillin localized to the region of the cortex overlying the
chromosomes, as well as around the chromosomes (Figure 3.3B). However, in a subset
of control and IQGAP3-deficient oocytes, anillin had cytoplasmic localization despite the
position of the chromosomes (Figure 3.3D). Anillin localized to the cortex in 61% of
control oocytes, around the chromosomes in 28% of oocytes, and to the cytoplasm in
13% of oocytes (n = 54). In 62% of IQGAP3-deficient oocytes, anillin localized primarily
as a cluster around the chromosomes (Figure 3.3C) (n = 39). Anillin localized to the
cortex overlying the chromosomes in 28% of IQGAP3-deficient oocytes, and to the
cytoplasm in 10% of IQGAP3-deficient oocytes (Figure 3.3D). There was a statistically
significant difference between control metaphase I oocytes and time-matched IQGAP3deficient oocytes based on the frequency distributions of anillin localization patterns,
leading to the conclusion that anillin localization requires IQGAP3 at metaphase I.
Spindle positioning is dependent on myosin-II (Schuh and Ellenberg, 2008;
Simerly et al., 1998), and myosin is recruited to the cytokinetic ring through its interaction
with IQGAP member Rng2 and anillin-like Mid1 in yeast (Padmanabhan et al., 2011).
Based on the mislocalization of anillin and inability of the spindle to move to the cortex in
IQGAP3-deficient oocytes, the localization of the active form of myosin-II
(phosphorylated myosin regulatory light chain, pMRLC) was examined. pMRLC
localized to the poles of the spindle in control metaphase I oocytes (Figure 3.3E, F).
151
However, this pole-localized pMRLC was not observed IQGAP3-deficient oocytes, and
the overall pMRLC signal was very faint to undetectable (Figure 3.3G, H). It can be
concluded that normal pMRLC localization to the poles of the metaphase I spindle
requires IQGAP3.
MAPK3/1 localization is altered in IQGAP3-deficient oocytes
Based on the known interaction between IQGAP3 and MAPK3 in HeLa cells and
MAPK1 in murine epithelial cells (Yang et al., 2014; Nojima et al., 2008), as well as the
requirement of MAPK3/1 for asymmetric spindle positioning mouse oocytes (Verlhac et
al., 1996; Verlhac et al., 2000; Chaigne et al., 2013), MAPK3/1 localization in IQGAP3deficient oocytes was examined next. MAPK3/1 localized to the spindle in control
metaphase I oocytes (Figure 3.4A). In contrast, MAPK3/1 had a variety of localizations
depending on the appearance and localization of the DNA in IQGAP3-deficient oocytes.
MAPK3/1 localized to the subcortical region in oocytes that had condensed, but
unaligned chromosomes (Figure 3.4B). When DNA measured greater than 10 μm from
the cortex, MAPK3/1 had faint, patchy cortical localization (Figure 3.4C). MAPK3/1
localized faintly to the spindle (Figure 3.4D), or to both the spindle and subcortical region
when the DNA was less than 10 μm from the cortex (Figure 3.4E). It can be concluded
that IQGAP3 is required for normal MAPK3/1 localization at metaphase I.
Normal localization of IQGAP3 is dependent on MEK1/2 and MLCK at metaphase I
and metaphase II.
IQGAP3 localization was hypothesized to be dependent on a functional MosMEK1/2-MAPK3/1 pathway, since IQGAP3 expression is lost following MEK1/2 inhibition
in epithelial cells (Nojima et al., 2008). In addition to MAPK3/1, MLCK is required to
activate pMRLC to generate the force required for spindle translocation across the
cytoplasm, as spindle movement is slowed in MLCK-inhibited oocytes (Schuh and
Ellenberg, 2008). MAPK3/1 can phosphorylate and activate MLCK in other cell types,
152
which can then can phosphorylate the myosin regulatory light chain, enabling the
organization of myosin-II into thick filaments (Klemke et al., 1997; Nguyen et al., 1999;
Vicente-Manzanares et al., 2009), and this appears to be the case in mouse oocytes as
well (McGinnis et al., 2015; Deng et al., 2005). To test our hypothesis that IQGAP3
localization is dependent upon the Mos-MEK1/2-MAPK3/1 pathway and/or MLCK,
IQGAP3 localization was examined in MEK1/2-inhibited oocytes treated with U0126 and
in MLCK-inhibited oocytes treated with ML-7.
IQGAP3 had normal localization to the spindle in 80% of DMSO-treated oocytes,
but only 19% of ML-7-treated oocytes, and 0% of U0126-treated oocytes (Figure 3.4F,
G; sample sizes: 20 DMSO-treated, 21 ML-7-treated, 24 U0126-treated). IQGAP3 was
mislocalized to the cortex in 10% of control oocytes, 43% of ML-7-treated oocytes, and
54% of U0126-treated oocytes (Figure 3.4I, J) and to the cytoplasm in 10% of DMSOtreated oocytes, 33% of ML-7-treated oocytes, and 17% of U0126-treated oocytes
(Figure 3.4H). There was an undetectable IQGAP3 signal in 5% of MLCK-inhibited
oocytes and 49% of MEK-inhibited oocytes (Figure 3.4K). Based on the frequency
distributions for different IQGAP3 localization patterns, there was a statistically
significant difference between DMSO-treated and ML-7-treated metaphase I oocytes,
between DMSO-treated and U0126-treated metaphase I oocytes, and between ML-7treated and U0126-treated metaphase I oocytes (Figure 3.4L). More MEK-inhibited
oocytes lost normal IQGAP3 localization compared to MLCK-inhibited oocytes, probably
due to more downstream signaling molecules are affected following inhibition of MEK1/2.
We conclude that IQGAP3 localization at metaphase I requires MEK1/2 and MLCK.
The distance between the DNA and cortex was measured and scored as
described above and in Figure 3.2K. At metaphase I, 75% of control oocytes had DNA
at the cortex (defined as DNA within 10 µm from the cortex), and 25% of oocytes had
DNA that was not at the cortex (defined as DNA greater than 10 µm from the cortex).
153
Only 10% of ML-7-treated oocytes and 42% of U0126-treated oocytes had DNA at the
cortex, compared to 81% of ML-7-treated and 50% of U0126-treated oocytes with DNA
that did not reach the cortex. In 10% of ML-7-treated oocytes and 8% of U0126-treated
oocytes, homologous chromosomes appeared to be separating and the oocyte was
classified as “anaphase-like” (Figure 3.4K). A statistically significant difference was
identified between DMSO-treated and ML-7-treated metaphase I oocytes and between
ML-7-treated and U0126-treated oocytes by χ2-analysis of frequency distributions
observed for different DNA localizations and appearances (Figure 3.4M).
To complement the studies above of metaphase I oocytes, IQGAP3 localization
was assessed in metaphase II eggs treated with U0126 or ML-7. In 81% of metaphase
II eggs, IQGAP3 localized to the spindle and cortex, or just to the spindle (Figure 3.5A,
B). IQGAP3 localized to the cytoplasm in 13% of ML-7-treated eggs and in 52% of
U0126-treated eggs, and around the DNA in 29% of ML-7-treated eggs and 4% of
U0126-treated eggs, (Figure 3.5D, E). The IQGAP3 signal was undetectable in 19% of
DMSO-treated eggs, 58% of ML-7-treated eggs, and 44% of U0126-treated eggs (Figure
3.5C, F; sample sizes: 53 DMSO-treated, 31 ML-7-treated, 48 U0126-treated). Based
on the frequency distributions of the pattern of IQGAP3 localization, there was a
statistically significant difference between DMSO-treated and ML-7-treated metaphase II
eggs, between DMSO-treated and U0126-treated metaphase II eggs, and between ML7-treated and U0126-treated metaphase II eggs (Figure 3.5G). Similar to metaphase I, it
can be concluded that IQGAP3 localization requires MEK1/2 and MLCK at metaphase II.
At metaphase II, MAPK3/1 activity is required for the maintenance of the spindle
adjacent to the cortex, and inhibition of MEK1/2 or of MLCK resulted in loss of spindle
localization adjacent to the cortex in a subset of drug-treated metaphase II eggs (Phillips
et al., 2002; Petrunewich et al., 2009; McGinnis et al., 2015). Following DMSOtreatment, 94% of metaphase II eggs had DNA within 10 µm of the cortex, and 6% of
154
eggs had DNA greater than 10 µm from the cortex. Following treatment with ML-7 and
U0126, 38% and 58% of metaphase II eggs had DNA at the cortex, respectively. DNA
was not at the cortex in 62% of ML-7-treated eggs and 33% of U0126-treated eggs, and
DNA was “anaphase-like” in 8% of U0126-treated eggs (Figure 3.5E). χ 2-analysis
revealed that there was a statistically significantly difference between DMSO-treated and
ML-7-treated eggs, between DMSO- and U0126-treated eggs, and between ML-7treated and U0126-treated eggs (Figure 3.5H), supporting previous studies (Phillips et
al., 2002; Petrunewich et al., 2009; McGinnis et al., 2015).
Anillin localization is dependent on MEK1/2 and MLCK at metaphase I and
metaphase II.
Thus far we have shown that anillin requires IQGAP3 for normal localization at
metaphase I, and normal IQGAP3 localization is dependent on MEK1/2 and MLCK. Due
to the interaction between IQGAP3 and anillin, anillin localization was examined in
U0126-treated and ML-7 treated metaphase I oocytes and metaphase II eggs. Anillin
had normal localization around the DNA in 50% of DMSO-treated oocytes, 26% of ML-7treated oocytes, and 10% of U0126-treated oocytes (Figure 3.6A; sample size: 20
DMSO-treated, 27 ML-7-treated, 31 U0126-treated). Anillin localized to the cortex in
15% of control oocytes, 11% of ML-7- treated oocytes, and 16% of U0126-treated
oocytes, and had cytoplasmic localization in 35% of DMSO-treated oocytes, 59% of ML7-treated oocytes, and 23% of U0126-treated oocytes (Figure 3.6B). Anillin was nearly
undetectable in 4% of oocytes treated with ML-7, and in 52% of oocytes treated with
U0126 (Figure 3.6C). Based on an analysis of frequency distributions of anillin
localization patterns, there was a statistically significant difference between DMSOtreated and U0126-treated oocytes, and between ML-7-treated and U0126-treated
oocytes (Figure 3.6D). This suggests that normal anillin localization is dependent on
MEK1/2, but not MLCK at metaphase I. The distance between the DNA and cortex was
155
measured and scored as described above and in Figure 3.4M. There was a statistically
significant difference based on DNA appearance and localization between DMSOtreated and ML-7-treated oocytes, and between ML-7 and U0126-treated oocytes
(Figure 3.6E), supporting what we saw in Figure 3.4M and previous report that MLCKinhibition slows spindle migration to the cortex (Schuh and Ellenberg, 2008).
To complement the studies above at metaphase I, anillin localization was
examined at metaphase II. Anillin localized to the spindle or around the DNA in 69% of
control eggs, 12% of ML-7-treated eggs, and 8% of U0126-treated eggs (Figure 3.6F;
sample size: 52 DMSO-treated, 49 ML-7-treated, 39 U0126-treated). Anillin localized to
the cortex overlying the DNA in 19% of DMSO-treated eggs, 22% of ML-7-treated eggs,
and 13% of U0126-treated eggs (Figure 3.6G). In 12% of DMSO-treated control eggs,
27% of ML-7-treated eggs, and 45% of U0126-treated eggs, anillin localized to the
cytoplasm (Figure 3.6H, J). There was a nearly undetectable anillin signal in 39% of ML7-treated eggs, and 36% of U0126-treated eggs (Figure 3.6I, K). From frequency
distributions of anillin localization patterns, there was a statistically significant difference
between DMSO-treated and ML-7-treated metaphase II eggs, and between DMSOtreated and U0126-treated metaphase II eggs (Figure 3.6L). Normal anillin localization
requires MEK1/2 and MLCK activity at metaphase II, which is different from metaphase I
where anillin localization is dependent on just MEK1/2.
All of the DMSO-treated metaphase II eggs had DNA within 10 µm from the
cortex. DNA was at the cortex of 53% of ML-7-treated eggs and 67% of U0126-treated
eggs. Following treatment with ML-7 and U0126, 37% and 28% of eggs had DNA
greater than 10 µm from the cortex, respectively. There was anaphase-like DNA in 10%
of ML-7-treated eggs and 5% of MEK-inhibited eggs, similar to what we have previously
shown in a subset of drug treated eggs (Petrunewich et al., 2009; McGinnis et al., 2015).
There was a statistically significant difference between DMSO-treated and ML-7-treated
156
metaphase II eggs, and between DMSO-treated and U0126-treated metaphase II eggs
based on the frequency distributions of DNA localization and appearance (Figure 3.6M),
similar to Figure 3.5H.
Attempts were made to generate anillin-deficient oocytes, so that the question of
whether IQGAP3 localization is dependent on anillin could be addressed. However,
RNAi-mediated knockdown of anillin in oocytes was successful at the transcript level, but
unsuccessful at the protein level. Prophase I oocytes injected with Anln-targeting siRNA
had 78.4% ± 1.8% less transcript than control siRNA-injected oocytes (Figure 3.7A).
However, there was no change in anillin protein, despite increasing concentrations of
Anln-targeting siRNA, as well as extending culture time from 48 h to 72 h (Figure 3.7C).
Anti-anillin immunoblots (n = 2) revealed that less than 10 % protein knockdown was
achieved in Anln-targeting siRNA-injected oocytes. On the chance that knockdown was
underestimated due to the large number of oocytes required per lane,
immunofluorescence was used to analyze anillin knockdown at the single-cell level.
Anillin localized to the cortex in control siRNA-injected oocytes 72 h following
microinjection (Figure 3.7D). The anillin signal was confirmed by performing a nonimmune control on control siRNA-injected oocytes (Figure 3.7F). There was a similar
cortical anillin signal observed in prophase I oocytes 72 h after being injected with Anlntargeting siRNA (Figure 3.7E). The minimal knockdown was likely due to slow anillin
protein turnover.
V. DISCUSSION
This work presents evidence that IQGAP3 functions in spindle positioning during
meiosis I in mouse oocytes (summarized in Figure 3.8). The localization of IQGAP3 to
the spindle at metaphase I and II suggests a spindle-associated function. The majority
of IQGAP3-deficient oocytes have a spindle that does not reach the cortex at 8 h
following the initiation of meiotic maturation, a time when control oocytes have a spindle
157
adjacent to the cortex and are at metaphase I. Spindle migration is not delayed in
IQGAP3-deficient oocytes, based on data showing that the majority of IQGAP3-deficient
oocytes have a spindle that still does not reach the cortex at 16 h following exit from
prophase I arrest. At this same time point, control oocytes are at metaphase II and have
undergone first polar body emission.
Prior to this study, little was known about the function of IQGAPs in mouse
oocytes, other than data showing that IQGAP1, like IQGAP3, is localized in the oocyte
cytoplasm and in the oocyte cortex at prophase I (Bielak-Zmijewska et al., 2008).
IQGAP1 then localizes to the neck of the polar body during first polar body emission
(Bielak-Zmijewska et al., 2008), suggesting a possible involvement in the regulation of
cytokinesis, as has been characterized for IQGAPs in other cell types (Eng et al., 1998;
Epp and Chant, 1997; Lippincott and Li, 1998). On the other hand, at metaphase II,
IQGAP1 has cytoplasmic localization, which is different from IQGAP3 localization to the
spindle (Bielak-Zmijewska et al., 2008). No studies have been performed of IQGAP1
deficiency in oocytes, so we do not know if there is a spindle-positioning defect in
IQGAP1-deficient oocytes. In addition, neither Iqgap1-/- or Iqgap2-/- mice display any
fertility defects (Li et al., 2000; Schmidt et al., 2008), which may be a result of the
redundancy of other IQGAP family members (IQGAP1, IQGAP2 or IQGAP3), or may
imply that IQGAP3 has an oocyte-specific function that IQGAP1 and IQGAP2 do not.
Spindle positioning in meiosis I is initially dependent upon a cytoplasmic actin
meshwork that is nucleated by the straight actin nucleator Formin-2 (Fmn2) and its
interacting protein Spire1/2 and a dynamic cortical actin network nucleated by the
branched actin nucleator Arp2/3 and its interacting protein Wave2 (Li et al., 2008;
Azoury et al., 2008; Leader et al., 2002; Dumont et al., 2007; Pfender et al., 2011; Schuh
and Ellenberg, 2008; Holubcova et al., 2013; Chaigne et al., 2013; Chaigne et al., 2015).
IQGAP3 has an actin-binding CHD domain (Wang et al., 2007), and this actin binding
158
function of IQGAP3 is presumably lost in an IQGAP3-deficient oocyte. Hypothetically,
an IQGAP3-deficient oocyte could lose the ability to bind to the cytoplasmic or cortical
actin that regulates spindle positioning, thus resulting in a metaphase I spindle that fails
to be recruited to the cortex.
Whereas normal metaphase I oocytes have actin enriched at the region of the
cortex overlying the DNA, IQGAP3-deficient oocytes have uniform cortical actin and a
subset of IQGAP3-deficient oocytes have a symmetric actin cloud surrounding DNA
localized greater than 10 µm from cortex. During meiotic maturation, cortical
reorganization resulting in an enrichment of actin is induced by a distance-dependent,
Ran-GTP signal from the chromosomes (Deng et al., 2007). DNA beads injected into
oocytes could induce cortical remodeling and cortical actomyosin assembly if placed
within 20 µm of the cortex (Deng et al., 2007). It is likely that the majority of IQGAP3deficient oocytes have chromatin localized at a distance too great from the cortex to
generate cortical reorganization required for spindle positioning, thus resulting in the
differences in actin localization between IQGAP3-deficient oocytes compared to control
metaphase I oocytes. Since Fmn2 is required for formation of the actin cloud, as Fmn2-/oocytes do not form an actin cloud (Li et al., 2008), we can presume that IQGAP3deficient oocytes have Fmn2, and that IQGAP3 acts downstream of Fmn2.
As the metaphase I spindle translocates to the cortex, the cytoplasmic actin
filaments overlap with the cortical actin filaments, and allowing myosin-II contractility to
produce tension and generate a pulling force (Chaigne et al., 2013; Chaigne et al.,
2015). The thickening of cortical actin is mediated by MAPK3/1 signaling, based on the
fact that thickening of cortical actin thickening is not observed in mos-/- oocytes or in
oocytes treated with the MEK1/2-inhibitor U0126 (Chaigne et al., 2013). MAPK3/1
regulates the cortical actin network through phosphorylation of Wave2, then activated
Wave2 activates the Arp2/3 complex to induce cortical actin thickening, myosin-II
159
exclusion from the cortex, and the associated decrease in cortical tension; these events
culminate in in the recruitment of the spindle to the cortex (Verlhac et al., 1996; Chaigne
et al., 2013; Chaigne et al., 2015). Based on the requirement of IQGAP3 for normal
MAPK3/1 localization to the metaphase I spindle, we propose that IQGAP3 mediates the
spatial regulation of MAPK3/1 activity at metaphase I required for spindle positioning.
MAPK3/1 localization to the spindle requires IQGAP3 (Figure 3.4). This implies that with
MAPK3/1 mislocalization in an IQGAP3-deficient oocyte, the activation of Wave2 and
Arp2/3 may be affected so that necessary changes in the cortical actin network (cortical
actin thickening, myosin-II exclusion from the cortex, decreased cortical tension) do not
occur and spindle migration is inhibited.
Movement of the metaphase I spindle is generated by pole-localized myosin-II
pulling on the cytoplasmic and cortical actin filaments (Schuh and Ellenberg, 2008;
Chaigne et al., 2013; Chaigne et al., 2015). pMRLC is not localized to the poles of the
metaphase I spindle in IQGAP3-deficient oocytes. A similar mislocalization of pMRLC is
observed in Fmn2+/- oocytes that have a defect in positioning of the spindle (Dumont et
al., 2007). pMRLC mislocalization raises the possibility that the failure to position the
spindle adjacent to the cortex in IQGAP3-deficient oocytes is a result from the loss of the
driving-force provided by myosin-II. It is also possible that myosin-II facilitates the actin
turnover that drives cytoplasmic streaming towards the cortex (Yi et al., 2011), and the
dynamic nature of the cytoplasmic actin meshwork could be compromised in IQGAP3deficient oocytes lacking myosin-II activity, as seen with the symmetric actin cloud
surrounding the chromosomes.
In other cell types, myosin localization to the cytokinetic ring is mediated by
IQGAP3 and its interacting protein anillin (Almonacid et al., 2011; Padmanabhan et al.,
2011). Anillin localizes to the cleavage furrow in HeLa cells, and recruits IQGAP3
through direct binding of the myosin-II-binding and actin-binding domains of anillin to the
160
actin-binding domain of IQGAP3 (Adachi et al., 2014). Our work shows that IQGAP3 is
required for anillin localization at metaphase I in mouse oocytes. Anillin also interacts
with myosin-II (Piekny and Glotzer, 2008). We propose that IQGAP3 regulates the
localization of anillin, which recruits myosin-II to the poles of the spindle. Mislocalized
anillin in IQGAP3-deficient oocytes would not be able to recruit myosin-II to the right
place, explaining the mislocalization of pMRLC. Knockdown of anillin in the oocyte could
determine if IQGAP3 localization is dependent on anillin, and if anillin also mediates
spindle positioning. There is not currently an anillin knockout mouse available, however
due to the requirement of anillin in cytokinesis in mitotic cells, it is likely that if anillin was
knocked out in every cell, then the mouse would be embryonic lethal. Rather, the
possibility of an oocyte-specific conditional knockout of anillin would prove more
beneficial to determine the function of anillin within the oocyte. Additionally, it may be
worthwhile to examine IQGAP3 in C. elegans following anillin depletion, as the worm
model has provided important insight into the role of anillin in actomyosin-dependent
cytokinesis processes (Dorn et. al 2010).
As noted above, Mos accumulation activates MEK1/2, and MEK1/2
phosphorylates and activates MAPK3/1 (MAPK3K) (Shibuya and Ruderman, 1993;
Posada et al., 1993). A signaling cascade such as this requires precise spatial and
temporal regulation within the oocyte, which we propose is mediated by IQGAP3 serving
as a scaffolding molecule for MAPK3/1 activity at metaphase I. Perturbations to the
Mos-MEK1/2-MAPK3/1 pathway result in inhibition of spindle translocation (Verlhac et
al., 2000; Chaigne et al., 2013; Xiong et al., 2008; Shen et al., 2010; Xiong et al., 2007;
Schuh and Ellenberg, 2008), similar to what is observed in IQGAP3-deficient oocytes.
MAPK3/1 and IQGAP3 are associated with the metaphase I spindle (Verlhac et al.,
1993, Brunet and Maro et al., 2005), and are both required for the normal localization of
the other such that MAPK3/1 is mislocalized in an IQGAP3-deficient oocyte, and
161
IQGAP3 loses normal localization in a U0126-treated oocyte. IQGAP3 and MAPK3/1 are
hypothesized to interact in the oocyte based on previously established interactions
between IQGAP3 and MAPK3 or MAPK1 in other cell types (Nojima et al., 2008; Yang et
al., 2014). In addition to the regulation of the cortical actin network, we hypothesize that
MAPK3/1 activates MLCK at metaphase I, which is observed in in other cell types and in
mouse oocytes at metaphase II (Klemke et al., 1997; Nguyen et al., 1999; VicenteManzanares et al., 2009; McGinnis et al., 2015; Deng et al., 2005). IQGAP3-mediated
MAPK3/1 localization to the spindle can activate MLCK, which can phosphorylate and
activate myosin-II at the spindle poles (recruited by anillin) to generate spindle
movement (Schuh and Ellenberg, 2008). The localization of IQGAP3 to the spindle is
maintained by MAPK3/1 and MLCK activity since IQGAP3 localization is lost in MEKinhibited or MLCK-inhibited oocytes. A significant number of MEK-inhibited, but not in
MLCK-inhibited, oocytes lose normal anillin localization. This difference could perhaps
be due to the inhibition of MEK1/2 affecting downstream effector molecules, whereas
MLCK inhibition affects only MRLC phosphorylation.
In addition to positioning of the metaphase I spindle, MAPK3/1 and MLCK activity
are also required for anchoring the spindle adjacent to the cortex as well as maintenance
of metaphase II arrest (Colledge et al., 1994; Hashimoto et al., 1994; Verlhac et al.,
1996; Petrunewich et al., 2009; Phillips et al., 2002; Hirao and Eppig, 1997; Hirao and
Eppig, 2007; Tong et al., 2003; McGinnis et al., 2015; Chapter 2, Figure 2.3). Normal
IQGAP3 and anillin localizations are dependent on MEK1/2 and MLCK activity at
metaphase II (Figure 3.5, 3.6). At metaphase II, a subset of MLCK-inhibited and MEKinhibited eggs had undergone parthenogenetic activation and loss of normal DNA
localization adjacent to the cortex (Petrunewich et al., 2009; McGinnis et al., 2015;
Chapter 2, Figure 2.3 and 2.4). The parthenogenetic activation observed in oocytes
after an hour of inhibitor treatment is supported by the time-dependent exit observed in
162
MLCK-inhibited and MEK1/2-inhibited oocytes (McGinnis et al., 2015; Chapter 2, Figure
2.5). To complement the pharmacological inhibitor studies performed here that analyze
oocytes following an acute depletion of MAPK3/1 activity, future studies could
investigate IQGAP3 and anillin in Mapk3/1-/- oocytes to determine if there is a difference
in IQGAP3 and anillin localization following a chronic depletion of MAPK3/1. Different
from mos-/- oocytes that fail to position the spindle near the cortex or undergo polar body
emission, Mapk3/1-/- oocytes surprisingly progress through meiosis I normally (Zhang et
al., 2015). However, ovulated metaphase II Mapk3/1-/- eggs had poorly assembled
metaphase II spindles and were defective in the maintenance of metaphase II arrest
(Zhang et al., 2015), highlighting the importance of the spatial and temporal activation of
MAPK3/1.
We propose that IQGAP3 may be serving as a scaffolding molecule for the
spatial regulation of key proteins implicated in spindle positioning (illustrated in Figure
3.9). In a metaphase I oocyte, IQGAP3 localizes to the spindle and hypothetically binds
to cytoplasmic or cortical actin filaments through the CHD domain to assist in spindle
positioning. IQGAP3 regulates anillin localization, possibly through an interaction
between the CHD domain of IQGAP3 and the actin-binding and myosin-binding domains
of anillin, based on data from HeLa cells (Adachi et al., 2014). Once localized
appropriately, anillin can bind and recruit myosin-II to the spindle poles (Schuh and
Ellenberg, 2008). Based on the direct interaction between IQGAP3 with MAPK3 and
MAPK1 in other cell types (Yang et al., 2014; Nojima et al., 2008), we propose that
IQGAP3 recruits MAPK3/1 to the spindle, enabling MAPK3/1 to (1) activate MLCK so
that pole-localized MRLC can be phosphorylated to enable spindle movement, and (2)
induce changes to the cortical actin network required for the recruitment of the spindle to
the cortex (induce thickening of cortical actin, myosin-II exclusion from the cortex)
(Chaigne et al., 2013; Chaigne et al., 2015), and (3) maintain normal IQGAP3 and anillin
163
localization. The MAPK3/1 signaling pathway is critical for many important cellular
processes in the mouse oocyte throughout meiotic maturation and egg activation, and
MAPK3/1 activity likely must be regulated in space and time to ensure the correct
activation of downstream effector molecules. This work is the first to characterize
IQGAP3 as having a role in spindle positioning in mouse oocytes, and these data
indicate that IQGAP3 mediates spindle positioning through the localization of MAPK3/1
to the spindle.
164
VI. REFERENCES
Adachi M, Kawasaki A, Nojima H, Nishida E, and Tsukita S. “Involvement of IQGAP
family proteins in the regulation of mammalian cell cytokinesis.” Genes to Cells
19 (2014): 803-820.
Almonacid M, Celton-Morizur Z, Kjakubowski JL, Dingli F, Loew D, Mayeux A, Chen JS,
Gould KL Clifford DM, and Paoletti A. “Temporal control of contractile ring
assembly by Plo1 regulation of myosin II recruitment by Mid1/anillin.” Current
Biology 21 (2011): 473-479.
Atcheson E, Hamilton E, Pathmanathan S, Greer B, Harriott P, and Timson DJ. “IQ-motif
selectivity in human IQGAP2 and IQGAP3: binding of calmodulin and myosin
essential light chain.” Bioscience Reports 31 (2011): 371-379.
Azoury J, Lee KW, Georget V, Hikal P, and Verlhac MH. “Symmetry breaking in mouse
oocytes requires transient F-actin meshwork destabilization.” Development 138
(2011): 2903-2908.
Bashour, AM, Fullterton AT, Hart MJ, and Bloom GS. “IQGAP1, a Rac and Cdc42binding protein, directly binds and cross-links microfilaments.” Journal of Cell
Biology 137 (1997): 1555-1566.
Bielak-Zmijewska A, Kolano A, Szczepanka K, Malezewski M, and Borsuk E. “Cdc42
protein acts upstream of IQGAP1 and regulates cytokinesis in mouse oocytes
and embryos.” Developmental Biology 322 (2008): 21-32.
Boyne JR, Yosuf HM, Bieganowski P, Brenner C, and Price C. “Yeast myosin light chain,
Mlc1p, interacts with both IQGAP and class II myosin to effect cytokinesis.” The
Journal of Cell Science 113 (2000): 4533-4543.
Brandt DT, and Gross R. “Get to grips: steering local actin dynamics with IQGAPs.” The
EMBO Reports 8 (2007): 1019-1023.
165
Brunet S, and Maro B. “Cytoskeleton and cell cycle control during meiotic maturation of
the mouse oocyte: integrating time and space.” Reproduction 130 (2005): 301811.
Chaigne A, Verlhac MH, and Terret ME. “Spindle positioning in mammalian oocytes.”
Experimental Cell Research 318 (2012): 1442-1447.
Chaigne A, Campillo C, Gov NS, Voituriez R, Azoury J, Umaña-Diaz C, Almonacid M,
Queguiner I, Nassoy P, Sykes C, Verlhac MH, and Terret ME. “A soft cortex is
essential for asymmetric spindle positioning in mouse oocytes.” Nature Cell
Biology 15 (2013): 958-966.
Chaigne A, Campillo C, Gov NS, Voituriez R, Sykes C, Verlhac MH, Terret ME. A narrow
window of cortical tension guides asymmetric spindle positioning in the mouse
oocyte.” Nature Communications 6 (2015): 6027.
Cho WK, Stern S, and Biggers JD. “Inhibitory effect of dibutyryl cAMP on mouse oocyte
maturation in vitro.” Journal of Experimental Zoology 187 (1974): 383-386.
Colledge WH, Carlton MBI, Udy GB, and Evans MJ. “Disruption of c-mos cause
parthenogenetic development of unfertilized mouse eggs.” Nature 370 (1994):
65-68.
D'souza VM, Naqvi NI, Wang H, and Balasubramanian MK. “Interactions of Cdc4p, a
myosin light chain, with IQ-domain containing proteins in Schizosaccharomyces
pombe.” Cell Structure and Function 26 (2001): 555-565.
Deng M, Williams CJ, and Schultz RM. “Role of MAP kinase and myosin light chain
kinase in chromosome-induced development of mouse egg polarity.”
Developmental Biology 278 (2005): 358-366.
Dickinson DJ, Robinson DN, Nelson WJ, and Weis WI. “α-catenin and IQGAP regulate
myosin localization to control epithelial tube morphogenesis in Dictyostelium.”
Developmental Cell 23 (2012): 533-546.
166
Dorn JF, Zhang L, Paradis V, Edoh-Bedi D, Jusu S, Maddox PS, and Maddox AS.
“Actomyosin tube formation in polar body cytokinesis requires Anillin in C.
elegans.” Current Biology 20 (2010): 2046-2051.
Dumont J, Million K, Sunderland K, Rassinier P, Lim H, Leader B, and Verlhac MH.
“Formin-2 is required for spindle migration and for the late steps of cytokinesis in
mouse oocytes.” Developmental Biology 30 (2007): 254-265.
Eng JA, Naqvi NI, Wong KC, and Balasubramanian MK. “Rng2p, a protein required for
cytokinesis in fission yeast, is a component of the actomyosin ring and the
spindle pole body.” Current Biology 8 (1998): 611-621.
Epp JA, and Chant J. “An IQGAP-related protein controls actin-ring formation and
cytokinesis in yeast.” Current Biology 7 (1997): 921-929.
Faix J, Cloughery C, Konzok A, Mintert U, Murphy J, Albrecht R, Mulbauer B, Kuhlmann
J. “The IQGAP-related protein DGAP1 interacts with Rac and is involved in the
modulation of the F- actin cytoskeleton and control of cell motility.” Journal of Cell
Science 111 (1998): 3059-3071.
Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, Van Dyk DE,
Pitts WJ, Earl RA, Hobbs F, Copeland RA, Magolda RL, Scherle PA, and
Trzaskos JM. “Identification of a novel inhibitor of mitogen-activated protein
kinase kinase.” Journal of Biological Chemistry 273 (1998): 18623-18632.
Field CM, and Alberts BM. “Anillin, a contractile ring protein that cycles from the nucleus
to the cell cortex.” Journal of Cell Biology 131 (1995): 165-178.
Halet G, and Carroll J. “Rac activity is polarized and regulates meiotic spindle stability
and anchoring in mammalian oocytes.” Developmental Cell 12 (2007): 309-317.
Hashimoto N, and Kishimoto T. “Regulation of meiotic metaphase by a cytoplasmic
maturation-promoting factor during mouse oocyte maturation.” Developmental
Biology 126 (1988): 242-252.
167
Hirao Y, and Eppig JJ. “Parthenogenetic development of Mos-deficient mouse oocytes.
Molecular Reproduction and Development 48 (1997): 391-396.
Holubcová Z, Blayney M, Elder K, and Schuh M. “Human oocytes. Error-prone
chromosome-mediated spindle assembly favors chromosome segregation
defects in human oocytes.” Science 348 (2015): 1143-1147.
Kinoshita M, Field CM, Coughlin ML, Straight AF, and Mitchison TJ. “Self- and actintemplated assembly of Mammalian septins.” Developmental Cell 3 (2002): 791802.
Klemke RL, Cai S, Giannini AL, Gallagher PJ, de Lanerolle P, and Cheresh DA.
“Regulation of cell motility by mitogen-activated protein kinase.” Journal of Cell
Biology 137 (1997): 481-492.
Larson SM, Lee HJ, Hung PH, Matthews LM, Robinson DN, and Evans JP. “Cortical
mechanics and meiosis II completion in mammalian oocytes are mediated by
myosin-II and Ezrin-Radixin-Moesin (ERM) proteins.” Molecular Biology of the
Cell 21 (2010): 3182-3192.
Leader B, Lim H, Carabatsos MJ, Harrington A, Ecsedy J, Pellman D, Maas R, and
Leder P. “Formin-2, polyploidy, hypofertility and positioning of the meiotic spindle
in mouse oocytes.” Nature Cell Biology 4 (2002): 921-928.
Lee S, Escalante R, and Firtel RA. “A RasGAP is essential for cytokinesis and spatial
patterning in Dictyostelium.” Development 124 (1997): 983-996.
Li S, Wang Q, Chakladar A, Bronson RT, Bernards A. “Gastric hyperplasia in mice
lacking the putative Cdc42 effector IQGAP1.” Molecular and Cellular Biology 20
(2000): 697-701.
Li H, Guo F, Rubinstein B, and Li R. “Actin-driven chromosomal motility leads to
symmetry breaking in mammalian meiotic oocytes.” Nature Cell Biology 10
(2008): 1301-1308.
168
Lippincott J, and Li R. “Sequential assembly of myosin II, an IQGAP-like protein, and
filamentous actin to a ring structure involved in budding yeast cytokinesis.”
Journal of Cell Biology 140 (1998): 355-366.
Markoulaki S, Matson S, and Ducibella T. “Fertilization stimulates long- lasting
oscillations of CaMKII activity in mouse eggs.” Developmental Biology 272
(2004): 15-25.
Matson S, Markoulaki S, and Ducibella T. “Antagonists of myosin light chain kinase and
of myosin II inhibit specific events of egg activation in fertilized mouse eggs.”
Biology of Reproduction 74 (2006): 169-176.
McGinnis LA, Lee HJ, Robinson DN, and Evans JP. “MAPK3/1 (ERK1/2) and Myosin
Light Chain Kinase in Mammalian Eggs Affect Myosin-II Function and Regulate
the Metaphase II State in a Calcium- and Zinc-Dependent Manner.“ Biology of
Reproduction 92 (2015): 146.
Mondal S, Burgute B, Rieger D, Muller R, Rivero F, Faix J, Schleicher M, and Noegel A.
“Regulation of the actin cytoskeleton by an interaction of IQGAP related protein
GAPA with filamin and cortexillin I.” PLOS One 11 (2010): e15440.
Na J, and Zernicka-Goetz M. “Asymmetric position and organization of the meiotic
spindle of mouse oocytes requires CDC42 function.” Current Biology 16 (2006):
1249-1254.
Nabti I, Marangos P, Bormann J, Kudo NR, and Carroll J. “Dual-mode regulation of the
APC/C by CDK1 and MAPK controls meiosis I progression and fidelity.” Journal
of Cell Biology 204 (2014): 891-900.
Nguyen DH, Catling AD, Webb DJ, Sankovic M, Walker LA, Somlyo AV, Weber MJ, and
Gonias SL. “Myosin light chain kinase functions downstream of Ras/ERK to
169
promote migration of urokinase-type plasminogen activator-stimulated cells in an
integrin-selective manner.” Journal of Cell Biology 146 (1999): 149-164.
Nojima H, Adachi M, Matsui T, Okawa K, Tsukita S, and Tsukita S. “IQGAP3 regulates
cell proliferation through the Ras/ERK signaling cascade.” Nature Cell Biology 10
(2008): 971-978.
Oegema K, Savoian MS, Mitchison TJ, and Field CM. “Functional analysis of a human
homologue of the Drosophila actin binding protein anillin suggests a role in
cytokinesis.” Journal of Cell Biology 150 (2000): 539-552.
Padmanabhan A, Bakka K, Sevugan M, Naqvi NI, D'souza V, Tang X, Mishra M, and
Balasubramanian MK. “IQGAP-related Rng2p organizes cortical nodes and
ensures position of cell division in fission yeast.” Current Biology 21 (2011): 467472.
Pathmanathan S, Elliott SF, McSwiggen S, Greer B, Harriott P, Irvine GB, and Timson
DJ. “IQ motif selectivity in human IQGAP1: binding of myosin essential light chain
and S100B.” Molecular and Cellular Biochemistry 318 (2008): 43-51.
Petrunewich MA, Trimarchi JR, Hanlan AK, Hammer MA, and Baltz JM. “Second meiotic
spindle integrity requires MEK/MAP kinase activity in mouse eggs.” Journal of
Reproduction and Development 55 (2009): 30-38.
Pfender S, Kuznetsov V, Pleiser S, Kerkhoff E, and Schuh M. “Spire-type actin
nucleators cooperate with Formin-2 to drive asymmetric oocyte division.” Current
Biology 21 (2011): 955-960.
Phillips KP, Petrunewich MA, Collins JL, Booth RA, Liu XJ, and Baltz JM. “Inhibition of
MEK or cdc2 kinase parthenogenetically activates mouse eggs and yields the
same phenotypes as Mos-/- parthenogenotes.” Developmental Biology 247
(2002): 210-223.
170
Piekny AJ, and Glotzer M. “Anillin is a scaffold protein that links RhoA, actin, and myosin
during cytokinesis.” Current Biology 18 (2008): 30-36.
Posada J, Yew N, Ahn NG, Vande Woude GF, and Cooper JA. “Mos stimulates MAP
kinase in Xenopus oocytes and activates a MAP kinase kinase in vitro.”
Molecular and Cellular Biology 13 (1993): 2546-2553.
Ren Y, Effler JC, Norstrome M, Luo T, Firtel RA, Iglesia PA, Rock RS, and Robinson
DN. “Mechanosensing through cooperative interactions between myosin II and
the actin crosslinker cortexillin.” Current Biology 19 (2009): 1421-1428.
Roy M, Li Z, and Sacks DB. “IQGAP1 is a scaffold for mitogen-activated protein kinase
signaling.” Molecular and Cellular Biology 25 (2005): 7940-7952.
Schmidt V, Chiariello C, Capilla E, Miller F, Bahou W. “Development of hepatocellular
carcinoma in Iqgap2-deficient mice is IQGAP1 dependent.” Molecular and
Cellular Biology 28 (2008): 1489-1502.
Schuh M, and Ellenberg J. “A new model for asymmetric spindle positioning in mouse
oocytes.” Current Biology 18 (2008): 1986-1992.
Shen W, Ahmad F, Hockman S, Ma J, Omi H, Raghavachari N, and Manganiello V.
“Female infertility in PDE3A-/- mice: polo-like kinase 1 (Plk1) may be a tar- get of
protein kinase A (PKA) and involved in meiotic arrest of oocytes from PDE3A-/mice.” Cell Cycle 9 (2010): 4720-4734.
Shibuya EK, and Ruderman JV. “Mos induces the in vitro activation of mitogen-activated
protein kinases in lysates of frog oocytes and mammalian somatic cells.”
Molecular and Cellular Biology 4 (1993): 781-790.
Simerly C, Nowak G, de Lanerolle P, and Schatten G. “Differential expression and
functions of cortical myosin IIA and IIB isotypes during meiotic maturation,
fertilization, and mitosis in mouse oocytes and embryos.” Molecular Biology of
the Cell 9 (1998): 2509-2525.
171
Straight AF, Field CM, and Mitchison TJ. “Anillin binds nonmuscle myosin II and
regulates the contractile ring.” Molecular Biology of the Cell 16 (2005): 193-201.
Svoboda P, Stein P, Hayashi H, AND Schultz RM. “Selective reduction of dormant
maternal mRNAs in mouse oocytes by RNA interference.” Development 127
(2000): 4147-41566.
Takaine M, Numata O, and Nakano K. “Fission yeast IQGAP maintains F-actinindependent localization of myosin-II in the contractile ring.” Genes Cells. 19
(2014): 161-176
Tong C, Fan HY, Chen DY, Song XF, Schatten H, and Sun QY. “Effects of MEK inhibitor
U0126 on meiotic progression in mouse oocytes: microtubule organization,
asymmetric division and metaphase II arrest.” Cellular Response 13 (2003): 75383.
Verlhac MH, De Pennett H, Maro B, Cobb M, and Clarke HJ. “MAP kinase becomes
stably activated at metaphase and is associated with microtubule-organizing
centers during meiotic maturation of mouse oocytes.” Developmental Biology 158
(1993): 330-340.
Verlhac MH, Kubiak JZ, Weber M, Géraud G, Colledge WH, Evans MJ, and Maro B.
Mos is required for MAP kinase activation and is involved in microtubule
organization during meiotic maturation in the mouse. Development 122 (1996);
815-822.
Verlhac MH, Lefebvre C, Kubiak JZ, Umbhauer M, Rassinier P, Colledge W, Maro B.
“Mos activates MAP kinase in mouse oocytes through two opposite pathways.”
The EMBO Journal 19 (2000): 6065-6074.
Vicente-Manzanares M, Ma X, Adelstein RS, and Horwitz AF. “Non-muscle myosin II
take centre stage in cell adhesion and migration.” Nature Reviews Molecular
Cellular Biology 10 (2009): 778-790.
172
Wang S, Watanabe T, Noritake J, Fuakta M, Yoshimura T, Itoh N, Harada T, Nakagaw
M, Matsuura Y, Arimua N, and Kaibuchi K. “IQGAP3, a novel effector of Rac1
and Cdc42, regulates neurite outgrowth.” Journal of Cell Science 120 (2007):
567-577.
Watanabe N, Wang S, Noritake J, Sato K, Fukata M, Takefuji M, Nakagawa M, Izumi N,
Akiyama T, and Kaibuchi K. “Interaction with IQGAP1 links APC to Rac1, Cdc42,
and actin filaments during cell polarization and migration.” Developmental Cell 7
(2004): 871-883.
Weissbach L, Bernards A, and Herion DW. “Binding of myosin essential light chain to the
cytoskeleton-associated protein IQGAP1.” Biochemical and Biophysical
Research Communications 251 (1998): 269-276.
Whitten WK. “Nutrient requirements for the culture of preimplantation embryos in vitro.”
Advances in the Biosciences 6 (1971): 129-129.
Xiong B, Yu L-Z, Wang Q, Ai J-S, Yin S, Liu J-H, OuYang Y-C, Hou Y, Chen D-Y, and
Zou H. “Regulation of intracellular MEK1/2 translocation in mouse oocytes:
cytoplasmic dynein/dynactin-mediated pole- ward transport and cyclin B
degradation-dependent release from spindle poles.” Cell Cycle 6 (2007): 15211527.
Xiong B, Sun SC, Lin SL, Li M, Xu BZ, OuYang YC, Hou Y, Chen DY, and Sun QY.
“Involvement of Polo-like kinase 1 in MEK1/2-regulated spindle formation during
mouse oocyte meiosis.” Cell Cycle 7 (2008): 1804-1809.
Yang Y, Zhao W, Xu QW, Wang XS, Zhang Y, and Zhang J. “IQGAP3 promotes EGFRERK signaling and the growth and metastasis of lung cancer cells.” PLoS One 9
(2014): e97578.
Yi K, Unruh JR, Deng M, Slaughter BD, Rubinstein B, and Li R. “Dynamic maintenance
of asymmetric meiotic spindle position through Arp2/3-complex-driven
173
cytoplasmic streaming in mouse oocytes.” Nature Cell Biology 13 (2011): 12521258.
Yu L, Xiong B, Gao W, Wang C, Zhong Z, Huo L, Wang Q, Hou Y, Liu K, and Liu XJ.
“MEK1/2 regulates microtubule organization, spindle pole tethering and
asymmetric division during mouse oocyte meiotic maturation.” Cell Cycle 6
(2007): 1522-1527.
Zhang YL, Liu XM, Ji SY, Sha QQ, Zhang J, and Fan HY. “ERK1/2 activities are
dispensable for oocyte growth but are required for meiotic maturation and
pronuclear formation in mouse.” Journal of Genetics and Genomics 42 (2015):
477-485.
174
Figure 3.1
IQGAP3 localization through meiotic maturation in wild-type oocytes, and
assessment of IQGAP3 knockdown following siRNA injection.
(A-B) IQGAP3 (red) localizes to the cortex in prophase I oocytes and to the spindle in
metaphase I oocytes. (C-E) IQGAP3 had various localizations at metaphase II,
including to astral-like microtubules around the spindle, to the spindle, and to both the
spindle and cortex. DNA is labeled in blue. Scale bar in Panel A = 10 μm. (F) Oocytes
injected with 40 μM Iqgap3-targeting siRNA have 81.5 ± 7% knockdown at the transcript
level (lane 2) at 48 h following injection compared to oocytes injected with 40 μM control
siRNA (lane 1). (G) Primers directed to tissue plasminogen activator (Plat) were used as
a loading control for Iqgap3-targeting siRNA-injected oocytes (lane 2) and control
siRNA-injected oocytes (lane 1). (H) Immunoblot with 185 prophase I oocytes per lane
injected with control siRNA (lane 1) and Iqgap3-targeting siRNA (lane 2) probed with
anti-IQGAP3. (I-K) Immunofluorescence was used to assess IQGAP3 protein
knockdown at the single-cell level at 48 h post-siRNA injection. Control siRNA-injected
prophase I oocytes show a strong cortical IQGAP3 signal (green in Panel I). DNA is
labeled in blue. Iqgap3-targeting siRNA-injected oocytes (Panels J and K) have a fainter
cortical IQGAP3 signal. Scale bar in Panel H = 10 μm. (L) Line-scan analysis around
the circumference of the cortical region to assess relative intensities of the IQGAP3
cortical signal in control siRNA-injected and Iqgap3-targeting siRNA-injected prophase I
oocytes.
175
Metaphase I Prophase I
Merge
IQGAP3
DNA
A
B
Metaphase II
C
F
D
E
Control
siRNA
Iqgap3Control targeting
siRNA siRNA
Iqgap3-targeting
siRNA
J
I
K
IQGAP3
primers
G
2
IQGAP3 DNA
Iqgap3Control targeting
siRNA siRNA
L
Control
(Plat)
primers
1
H
2
Iqgap3Control targeting
siRNA siRNA
α-IQGAP3
1
100
Intensity (A.U.)
1
Fig. 1I
Fig. 1J
Fig. 1K
75
50
25
0
0
2
50
100
150
Distance (µm)
176
200
250
Figure 3.2
Phenotypes observed in IQGAP3-deficient oocytes at eight- or 16 h following exit
from prophase I arrest.
(A-F) Fluorescence microscopy showed the localization of DNA (blue), spindle (green)
and actin (red) in control siRNA-injected oocytes and Iqgap3-targeting siRNA-injected
oocytes at 8 h following exit from prophase I arrest. Scale bar in Panel A = 10 μm. (GJ) Fluorescence microscopy showed the localization of DNA (blue) and actin (gray) in
control siRNA-injected oocytes and Iqgap3-targeting siRNA-injected oocytes at 8 h
following exit from prophase I arrest. Scale bar in Panel G = 10 μm. Actin was
concentrated to the region of the cortex overlying the DNA in control siRNA-injected
metaphase I oocytes (e.g. Panels G, H). Actin localizes primarily as a cloud surrounding
the DNA greater than 10 μm from the cortex in a subset of Iqgap3-targeting siRNAinjected metaphase I oocytes (e.g. Panels I, J). Each oocyte was scored for phenotype
and DNA/spindle localization based on the proximity of the DNA to the cortex. A
measurement of 10 μm or less was scored as “DNA at cortex”. A measurement greater
than 10 μm was scored as “DNA not at cortex”. DNA that was condensing but not yet
clustered or aligned was scored as “DNA condensing”. An oocyte that underwent
abnormal cytokinesis was scored as such. (K) Frequency distributions of the different
phenotypes observed in control siRNA-injected oocytes and Iqgap3-targeting siRNAinjected oocytes at 8 h following exit from prophase I arrest. There was a statistically
significant difference between the two groups (χ2 analysis, p < 0.0001). (L-P)
Immunofluorescence shows the localization of DNA (blue), spindle (green) and actin
(red) in control siRNA-injected and Iqgap3-targeting siRNA-injected oocytes at 16 h
following exit from prophase I arrest. Each oocyte was scored for phenotype and
DNA/spindle localization based on the proximity of the DNA to the cortex. An oocyte
was scored as metaphase II (MII) if the DNA was 10 μm or less from the cortex and if
177
first polar body emission occurred. An oocyte was scored as “Spindle not at cortex” if
DNA was 10 μm or greater from the cortex; these oocytes did not have first polar bodies.
Oocytes with condensed DNA that was not yet clustered or aligned as seen by distinct
chromosomes in the cytoplasm were scored as ”DNA condensing/no spindle” as shown
in Panel M. Oocytes with clustered DNA that did not form a spindle were scored as
“Clustered DNA/no spindle” as shown in Panel N. (Q) Frequency distributions of the
different phenotypes observed in control siRNA-injected oocytes and Iqgap3-targeting
siRNA-injected oocytes at 16 h following exit from prophase I arrest. There was a
statistically significant difference between the two groups (χ2 analysis, p = 0.0010).
178
C
D
E
F
Control
siRNA
16 hours
following start of maturation
L
Iqgap3-targeting siRNA
Iqgap3-targeting siRNA
Control
siRNA
8 hours
following start of maturation
A
B
Control
siRNA
N
O
P
Spindle
not at cortex
Actin α-tubulin
DNA
Actin α-tubulin DNA
H
G
M
Q
100%
2/35
7/32
80%
Iqgap3targeting
siRNA
J
5/32
60%
20/35
40%
Actin DNA
K
5/35
100%
6/159
13/161
20%
2/161
8/35
0%
80%
60%
20/32
91/159
124/161
Control
C
siRNA
Iqgap3I
targeting
siRNA
Clustered
DNA/No spindle
DNA
not condensed/No
spindle
40%
DNA condensing/No
Condensed
DNA/No spindle
20%
0%
62/159
Spindle not at cortex
22/161
Iqgap3Control
C
I
siRNA targeting
siRNA
Metaphase II
Abnormal cytokinesis
DNA
not aligned/No spindle
No
spindle
DNA not at cortex
DNA at cortex
179
Figure 3.3
Localizations of anillin and pMRLC in IQGAP3-deficient oocytes.
(A-B) Immunofluorescence shows anillin localization changes depending on the position
of the DNA relative to the cortex in control siRNA-injected metaphase I oocytes. Anillin
localizes around the DNA if the DNA is greater than 10 μm from the cortex (e.g. Panel
A). Anillin localizes to the region of the cortex overlying the DNA if the DNA is 10 μm or
less from the cortex (e.g. Panel B). (C-D) Anillin localizes as a cluster around the DNA in
Iqgap3-targeting siRNA-injected metaphase I oocytes (e.g. Panel C). Anillin localization
is cytoplasmic in a subset of Iqgap3-targeting siRNA-injected metaphase I oocytes (e.g.
Panel D). Scale bar in Panel A = 10 μm. (E-F) Immunofluorescence shows that pMRLC
(green) localizes to spindle poles on either side of the aligned chromosomes in control
siRNA-injected metaphase I oocytes. (G-H) In Iqgap3-targeting siRNA-injected
metaphase I oocytes, pole-localized pMRLC is not detected. Scale bar in Panel E = 10
μm.
180
Iqgap3-targeting
siRNA
Control
siRNA
Iqgap3-targeting
siRNA
Control
siRNA
A
B
C
D
Anillin DNA
E
F
G
H
pMRLC DNA
181
Figure 3.4
MAPK3/1 localization in IQGAP3-deficient metaphase I oocytes, and IQGAP3
localization in U0126- or ML-7-treated metaphase I oocytes.
(A-E) Immunofluorescence was used to show the localization of MAPK (green) in
control siRNA-injected and Iqgap3-targeting siRNA-injected metaphase I oocytes. Scale
bar in Panel A = 10 μm. (F-K) Immunofluorescence shows the localization of IQGAP3 in
control oocytes (treated with DMSO, n = 20), oocytes treated with ML-7 (to inhibit MLCK,
n = 21), and oocytes treated with U0126 (to inhibit MEK1/2, n = 24). Metaphase I
oocytes were treated for 60 minutes with 0.5% DMSO, 15 μM ML-7 or 50 μM U0126.
Scale bar in Panel F = 10 μm. Each DMSO, ML-7-, and U0126- treated oocyte was
scored based on the characteristics of the IQGAP3 immunofluorescence signal. (L)
Frequency distributions of different IQGAP3 patterns observed in metaphase I oocytes
treated with DMSO, ML-7 and U0126. There was a statistically significant difference
between DMSO and ML-7-treated oocytes (χ2 analysis, p = 0.0015), between DMSO
and U0126-treated oocytes (χ2 analysis, p < 0.0001), and between ML-7- and U0126treated oocytes (χ2 analysis, p = 0.0195). Each oocyte was scored for DNA appearance
or localization based on the proximity of the DNA to the cortex. A measurement of 10
μm or less was scored as “DNA at cortex” (e.g. Panel G). A measurement greater than
10 μm was scored as “DNA not at cortex” (e.g Panel F). DNA that appears to be
fragmenting was scored as “anaphase-like” (e.g. Panel K). (M) Frequencies of different
DNA appearances observed in metaphase I oocytes treated with DMSO, ML-7 and
U0126. There was a statistically significant difference between DMSO- and ML-7
treated oocytes (χ2 analysis, p < 0.0001), and between ML-7- and U0126-treated
oocytes (χ2 analysis, p = 0.0492).
182
Control siRNA
Iqgap3-targeting siRNA
A
MAPK3/1 DNA
B
C
D
E
ML-7
DMSO
U0126
F
H
J
G
I
K
IQGAP3 DNA
p = 0.0015 p = 0.0195
L
100%
60%
M
p < 0.0001
2/20
2/20
80%
7/24
4/24
40%
9/21
80%
5/20
15/20
10/24
ML-7
U0126
DMSO
ML-7
U0126
Undetectable signal
Anaphase-like
Cytoplasm
DNA not at cortex
Cortex
DNA at cortex
Around DNA/Spindle
2/21
0%
DMSO
17/21
20%
4/21
0%
2/24
2/21
12/24
60%
40%
13/24
20%
p = 0.0619
100%
1/21
7/21
16/20
p < 0.0001 p = 0.0492
183
Figure 3.5
IQGAP3 localization in in U0126- or ML-7-treated metaphase II eggs.
(A-B) Immunofluorescence shows the localization of IQGAP3 in control metaphase II
eggs (treated with DMSO), eggs treated with ML-7 (to inhibit MLCK), and eggs treated
with U0126 (to inhibit MEK1/2). Metaphase II eggs were treated for 60 min with 0.5%
DMSO, 15 μM ML-7 or 50 μM U0126. Scale bar in Panel A = 10 μm. Each DMSO, ML7-, and U0126- treated egg was scored based on the characteristics of the IQGAP3
immunofluorescence signal. (G) Frequency distributions of different IQGAP3 patterns
observed in metaphase II eggs treated with DMSO, ML-7 and U0126. There was a
statistically significant difference between DMSO and ML-7-treated eggs (χ2 analysis, p =
0.0002), between DMSO and U0126-treated eggs (χ2 analysis, p < 0.0001), and
between ML-7- and U0126-treated eggs (χ2 analysis, p = 0.0002). Each egg was scored
for DNA appearance or localization based on the proximity of the DNA to the cortex. A
measurement of 10 μm or less was scored as “DNA at cortex”. A measurement greater
than 10 μm was scored as “DNA not at cortex”. DNA that appears fragmented was
scored as “anaphase-like” (e.g. Panel E). (H) Frequency distributions observed in
metaphase II eggs treated with DMSO, ML-7 and U0126. There was a statistically
significant difference between DMSO- and ML-7 treated oocytes (χ2 analysis, p <
0.0001), between DMSO- and U0126-treated oocytes (χ2 analysis, p < 0.0001), and
between ML-7- and U0126-treated oocytes (χ2 analysis, p = 0.0255).
184
B
C
D
E
F
U0126
ML-7
DMSO
A
IQGAP3 DNA
p = 0.0002 p = 0.0002
G
p < 0.0001 p = 0.0255
H
p < 0.0001
100%
100%
10/53
80%
21/48
3/53
60%
60%
40/53
20%
4/31
2/48
28/48
12/31
0%
DMSO
U0126
16/48
50/53
20%
ML-7
ML7
U0126
Undetectable signal
Anaphase-like
Cytoplasm
DNA not at cortex
Cortex
DNA at cortex
Around DNA
19/31
25/48
0%
ML7
ML-7
4/48
40%
9/31
DMSO
3/53
80%
18/31
40%
p < 0.0001
185
Figure 3.6
Anillin localization in U0126-treated or ML-7-treated metaphase I oocytes and
metaphase II eggs.
(A-C) Immunofluorescence shows anillin localization in DMSO-, ML-7-, and U0126treated metaphase I oocytes. Scale bar in Panel A = 10 μm. Metaphase I oocytes were
scored for anillin localization following treatment with 0.5 % DMSO, 15 µM ML-7, and 50
µM U0126. (D) Frequency distributions of different anillin patterns observed in
metaphase I oocytes treated with DMSO, ML-7, and U0126. There was a statistically
significant difference between DMSO-treated and U0126-treated metaphase I oocytes
(χ2 analysis, p = 0.0003), and between ML-7-treated and U0126-treated metaphase I
oocytes (χ2 analysis, p = 0.0003). Each oocyte was scored for DNA localization and
appearance based on the proximity of the DNA to the cortex. A measurement of 10 μm
or less was scored as “DNA at cortex”, and greater than 10 μm was scored as “DNA not
at cortex”. DNA that appeared to be fragmenting was scored as “anaphase-like”. (E)
Frequencies of different DNA appearances observed in metaphase I oocytes treated
with DMSO, ML-7, and U0126 (treated as described in Figure 3.4). There was a
statistically significant difference between DMSO-treated and ML-7-treated metaphase I
oocytes (χ2 analysis, p = 0.0147), and between DMSO-treated and U0126-treated
metaphase I oocytes (χ2 analysis, p = 0.0255). (F-K) Immunofluorescence was used to
show anillin localization (green) in DMSO-, ML-7-, and U0126-treated metaphase II
eggs. Scale bar in Panel F = 10 μm. Metaphase II eggs were scored for anillin
localization following treatment with DMSO, ML-7, and U0126. (L) Frequency
distributions of different anillin patterns observed in metaphase II eggs treated with
DMSO, ML-7, and U0126. There was a statistically significant difference between
DMSO-treated and ML-7-treated metaphase II eggs (χ2 analysis, p < 0.0001) and
DMSO-treated and U0126-treated metaphase II eggs (χ2 analysis, p < 0.0001). Each
186
egg was scored for DNA localization and appearance based on the proximity of the DNA
to the cortex. A measurement of 10 μm or less was scored as DNA at cortex, greater
than 10 μm was scored as DNA not at cortex. DNA that appeared to be pulling apart
was scored as anaphase-like. (M) Frequencies of different DNA appearances observed
in metaphase II eggs treated with DMSO, ML-7 and U0126 (treated as described in
Figure 3.5). There was a statistically significant difference between DMSO-treated and
ML-7-treated metaphase II eggs (χ2 analysis, p < 0.0001) and DMSO-treated and
U0126-treated metaphase II eggs (χ2 analysis, p < 0.0001).
187
Metaphase I
DMSO
C
Anillin DNA
p = 0.0147 p = 0.0255
p =0.2509 p = 0.0003
D
60%
40%
E
p = 0.0003
1/27
100%
80%
7/20
16/27
3/20
7/27
0%
DMSO
ML-7
p = 0.7891
1/27
100%
80%
16/31
60%
7/31
40%
5/31
3/31
20%
3/27
10/20
20%
13/20
1/27
ML-7
U0126
Anaphase-like
DNA not at cortex
DNA at cortex
ML-7
DMSO
12/31
7/20
DMSO
U0126
19/31
25/27
0%
Undetectable signal
Cytoplasm
Cortex
Around DNA
Metaphase II
U0126
ML-7
B
A
U0126
F
H
J
G
I
K
Anillin DNA
p < 0.0001 p = 0.3274
L
100%
80%
6/52
10/52
60%
40%
20%
0%
p < 0.0001 p = 0.3939
M
p < 0.0001
19/49
13/49
36/52
14/39
60%
17/39
11/49
6/49
5/39
3/39
40%
2/39
5/49
80%
11/39
18/49
52/52
26/49
26/39
20%
DMSO ML-7
ML7 U0126
Undetectable signal
Cytoplasm
Cortex
Around DNA
p < 0.0001
100%
188
0%
DMSO ML-7
ML7 U0126
Anaphase-like
DNA not at cortex
DNA at cortex
Figure 3.7
Assessment of anillin mRNA and protein knockdown in oocytes injected with
Anln-targeting siRNA.
(A-B) RT-PCR with anillin primers and control tissue plasminogen activator (Plat)
primers, respectively. Prophase I oocytes injected with 50 μM Anln-targeting siRNA and
cultured for 48 h have 78.4 ± 1.8% knockdown at the transcript level (lane 2) compared
to oocytes injected with 50 μM control siRNA (lane 1). Primers directed to tissue
plasminogen activator (Plat) were used as a loading control for control siRNA-injected
oocytes (lane 1) and Anln-targeting siRNA-injected oocytes (lane 2). This experiment
was repeated three times. (C) Representative anti-anillin immunoblot (repeated two
times) with 100 prophase I oocytes per lane injected with 100 μM control-siRNA and 100
μM anillin-targeting siRNA cultured for 72 h. There is no detectable knockdown in anillin
protein between control-injected oocytes (lane 1) and Anln-targeting siRNA injected
oocytes (lane 2) following 72 h of culture. (D-E) Anillin immunofluorescence of prophase
I oocytes injected with 100 μM control siRNA and 100 μM Anln-targeting siRNA cultured
for 72 h. (F) A non-immune control image shown here to represent what no signal looks
like in comparison. Scale bar in Panel D= 10 μm.
189
AnlnControl targeting
siRNA siRNA
A
Anillin primers
1
2
AnlnControl targeting
siRNA siRNA
B
Control (Plat)
primers
1
2
AnlnControl targeting
siRNA siRNA
C
α-Anillin
1
Control
siRNA
D
2
Anln-targeting
siRNA
E
F
Anillin DNA
Non-immune
control
190
Figure 3.8
Illustration of key findings of IQGAP3 in mouse oocytes.
Schematic diagrams at top illustrate spindle position in normal oocyte at metaphase I
and metaphase II. (A) Summary of effects observed in IQGAP3-deficient oocytes at
metaphase I. (B) IQGAP3 and anillin localization following MEK1/2-inhibition in
metaphase I oocytes treated with 50 µM U0126 for 60 min with drug treatment starting at
7 h following initiation of meiotic maturation, and metaphase II eggs treated with 50 µM
U0126 for 60 min. (C) IQGAP3 and anillin localizations following MLCK-inhibition in
metaphase I oocytes treated with 15 µM ML-7 for 60 min with drug treatment starting at
7 h following initiation of meiotic maturation, and metaphase II eggs treated for 60 min
with 15 µM ML-7.
191
Metaphase I
1. 
A
IQGAP3-deficient
oocytes
2. 
3. 
4. 
5. 
B MEK1/2-inhibited
oocytes
C MLCK-inhibited
1. 
2. 
1. 
Metaphase II
N/A
Spindle not positioned near
cortex
Uniform cortical actin, subset of
oocytes have cytoplasmic actin
cloud
Mislocalization of anillin
Mislocalization of pMRLC
Mislocalization of MAPK3/1
Mislocalization/loss of IQGAP3
signal
Mislocalization/loss of anillin
signal
1. 
Mislocalization/loss of IQGAP3
signal
1. 
2. 
2. 
oocytes
192
Mislocalization/loss of
IQGAP3 signal
Mislocalization/loss of
anillin signal
Mislocalization/loss of
IQGAP3 signal
Mislocalization/loss of
anillin signal
Figure 3.9
Proposed model of IQGAP3 function in mouse oocytes.
In a metaphase I oocyte, we propose that IQGAP3 mediates spindle positioning by (1)
binding to cytoplasmic or cortical actin through the CHD actin-binding domain, (2)
regulating the localization of anillin, so that anillin can bind and recruit myosin to the
spindle poles, (3) recruiting MAPK3/1 to the spindle. MAPK3/1 recruitment to the
spindle by IQGAP3 enables MAPK3/1 to (a) maintain IQGAP3 localization at the spindle
(b) activate MLCK, so that MLCK can phosphorylate and activate MRLC to generate
spindle movement, and (c) trigger Arp2/3 to induce changes to cortical actin (thickening
of cortical actin, myosin-II exclusion from the cortex). IQGAP3 and anillin localization
requires MAPK3/1, thus the blue arrows in the diagram indicate that U0126 treatment
resulted in mislocalized or undetectable IQGAP3 and anillin signal in a significant
number of MEK-inhibited oocytes. IQGAP3 localization requires MLCK, thus the purple
arrows indicate that ML-7 treatment resulted in mislocalization of IQGAP3 in a significant
number of MLCK-inhibited oocytes. Superscripted numerals refer to data published by
other groups (1, Schuh and Ellenberg, 2008; 2,Verlhac et al., 2000; 3, Chaigne et al,
2013).
193
MAPK3/1
Mediates spindle migration2
Cortical actin thickening3
Myosin-II exclusion from cortex3
Decreased cortical tension3
MAPK3/1
Anillin
IQGAP3
Binds to cytoplasmic or
cortical
actin network
Myosin recruitment
to spindle pole
MLCK
Regulates IQGAP3 and
anillin localization
Mediates spindle
migration1
194
CHAPTER 4
The actin-binding protein nexilin mediates metaphase I spindle organization and
positioning in mammalian oocytes and affects the phosphorylation of LIMK1/2
I. ABSTRACT
The first asymmetric meiotic division of the mammalian oocyte requires
organization of the spindle, as well as positioning of the spindle relative to the cortex.
Spindle translocation to the cortex is mediated by two actin-based networks and the
cytoskeleton-associated protein, myosin-II (Li et al., 2008; Schuh and Ellenberg, 2008).
Nexilin, an actin-binding protein, is associated with the spindle and region of the cortex
overlying the spindle in metaphase I oocytes and metaphase II eggs. Following RNAimediated knockdown, the majority of nexilin-deficient oocytes fail to recruit the
metaphase I spindle to the cortex, with a subset of these nexilin-deficient oocytes failing
to form a spindle. γ-tubulin, a marker of spindle organization and protein known to
interact with nexilin (Hutchins et al., 2010), is mislocalized in nexilin-deficient oocytes
that fail to form a spindle. Actin and the active form of the myosin regulatory light chain
are mislocalized in nexilin-deficient oocytes compared to control metaphase I oocytes.
Nexilin-deficient oocytes have reduced levels of pLIMK1/2 and of LIMK’s substrate
phosphorylated cofilin. Other studies have associated reduced pLIMK1/2 and pCofilin in
oocytes with metaphase I spindle translocation failure (Duan et al., 2014; Lee et al.,
2015; Zhang et al., 2014). Expression of a phospho-mimic form of cofilin did not rescue
the spindle migration defect in nexilin-deficient oocytes, but did induce a spindle defect
on its own, highlighting the importance of the phosphorylation status of cofilin during
meiotic maturation.
195
II. INTRODUCTION
Progression of the mammalian oocyte through meiosis I and II is characterized
by the organization and orientation of the meiotic spindle relative to the cortex to ensure
that two asymmetric cell divisions occur (Brunet et al., 1999; Sardet et al., 2002). The
position of the meiotic spindle dictates the site of cytokinesis, and is key for unequal
distribution of the nutrient-rich cytoplasm stockpiled during oogenesis to the egg and
polar body. This work focuses on the novel candidate protein nexilin, and its role in
positioning of the meiotic spindle in mammalian oocytes.
There are two actin-based mechanisms required for spindle positioning: a
cytoplasmic actin meshwork and dynamic cortical actin network (Li et al., 2008; Schuh
and Ellenberg, 2008; Chaigne et al., 2013; Chaigne et al., 2015). The cytoplasmic
network is dense at prophase I, and undergoes a drop in density upon the exit from G2,
I, as determined following fluorescence recovery after photobleaching of actin tagged
with YFP (Azoury et al., 2011). At the time of GVBD, a symmetric actin cloud surrounds
the chromatin (Li et al., 2008). When the spindle begins to move away from the center
of the oocyte, the symmetric nature of the actin cloud is disrupted, termed symmetrybreaking, and actin becomes enriched in the region of the cytoplasm opposite the
direction of chromosomes (Figure 1.4) (Li et al., 2008). Dynamic changes to the cortical
actin network include a thickening of cortical actin and exclusion of myosin-II from the
region of the cortex overlying the spindle, which coincides with a reduction in cortical
tension (Chaigne et al., 2015). There is a narrow range of cortical tension that allows
positioning of the metaphase I spindle, and it was shown that the spindle remains
centrally localized if the cortical tension is too high or too low in experimentally
manipulated oocytes (Chaigne et al., 2015).
Several properties of nexilin make it a good candidate to mediate actin and
myosin-II dependent spindle positioning. Nexilin was first isolated as an actin-filament
196
binding protein at cell-matrix adherens junctions (Ohtsuka et al., 1998). Nexilin is highly
abundant in cardiac and skeletal muscle, having an essential role in the maintenance of
Z-disks in zebrafish and rat (Hassel et al., 2009). The Z-disks are the anchoring
structures that sense and respond to mechanical stress during muscle contraction, a
myosin-based process. Following the loss of nexilin, there is a destabilization of Z-disks,
disturbed mechanosensing, and altered mechano-transduction (Hassel et al., 2009).
Zebrafish embryos injected with Nexn-targeting morpholinos have ruptured myofilaments
and die from heart failure (Hassel et al., 2009). While heart contraction is a myosinbased process, both actin and myosin have normal protein expression in nexilin-deficient
cardiomyocytes, showing that the loss of nexilin does not alter expression of these other
contractile elements (Hassel et al., 2009). Building upon the work in zebrafish, a NEXN
G650del mutation was found to be a common mutation in human dilated cardiomyopathy
patients (Hassel et al., 2009). A nexilin knockout mouse was recently developed, and
these mice exhibit very early postnatal lethality, with all mice dying by day 8, due to
progressive left ventricular dilation and wall thinning (Aherrahrou et al., 2016).
Surprisingly, the sarcomere myofilaments and Z-disks of the hearts of these Nexn-KO
mice are not affected (Aherrahrou et al., 2016), contrasting with what was observed in
the zebrafish model (Hassel et al., 2009).
A transcriptome database suggests that oocytes have a comparable amount of
nexilin mRNA compared to cardiac and skeletal muscle, tissues where nexilin has a
known function (GeneAtlas, biogps.gnf.org), prompting our interest in the role of nexilin
in mouse oocytes. The studies here generated nexilin-deficient oocytes using RNAimediated knockdown, with the purpose of identifying the functions of nexilin in oocytes,
and testing the hypothesis that this actin-binding protein could be involved in spindle
positioning during meiosis. As discussed in Chapter 1, Sections IV.A-IV.C, multiple
molecules and signaling pathways have been implicated in spindle positioning in
197
mammalian oocytes including the Mos-MAPK3/1 pathway, ROCK-LIMK1/2-cofilin
pathway, Formin-2, Spire 1/2, Wave2, and Arp2/3 (Verlhac et al., 1996; Kalab et al.,
1996; Duan et al. 2014; Lee et al., 2015; Zhang et al., 2014; Chaigne et al., 2013;
Chaigne et al., 2015; Azoury et al., 2008; Leader et al., 2002; Dumont et al., 2007;
Pfender et al., 2011; Schuh and Ellenberg, 2008; Holubcova et al., 2013; Verlhac et al.,
2000; Yi et al., 2011). Work here focused on the Rho-kinase (ROCK)- LIM kinases 1/2
(LIMK1/2)-cofilin pathway, based on the interaction between nexilin and the Lin11, Isl-1,
Mec-3 (LIM) domain and actin-binding protein 1 (LIMA1) (Hein et al., 2015). Based on
the binding between nexilin and LIMA1, nexilin may hypothetically be binding to the LIM
domain in LIMK1/2. Mammalian oocytes with disrupted ROCK activity, either by RNAi or
pharmacological inhibition, have decreased levels of phosphorylated cofilin, and do not
emit first polar bodies due to failure of the spindle to translocate to the cortex (Lee et al.,
2015; Duan et al., 2014; Zhang et al., 2014), similar to what we observe here in nexilindeficient oocytes. ROCK, an effector of the small GTPase Rho, is an important regulator
of actin dynamics by promoting actin organization through phosphorylation of
downstream effectors, two of them being LIMK1/2 (Schamnke et al., 2007; Maekawa et
al. 1999). LIMK1/2 directly phosphorylates and inactivates the actin-severing protein
cofilin (Arber et al., 1998; Katoh et al., 2001). In mitotic cells, LIMK1/2-mediated
phosphorylation of cofilin is critical to ensure the positioning of the spindle (Kaji et al.,
2008). Work here thus also tested the hypothesis that nexilin-deficiency would impact
the ROCK-LIMK1/2-Cofilin pathway, a pathway that is involved in spindle positioning in
mouse oocytes (Duan et al., 2014).
III. MATERIALS AND METHODS
Collection, culture, and maturation of prophase I oocytes
Animals were used in accordance with the guidelines of the Johns Hopkins
University Animal Care and Use Committee. Prophase I-arrested oocytes were
198
collected from 6-8-week old female CF-1 mice (Harlan, Indianapolis, IN). Oocytes were
collected in Whitten's medium (109.5 mM NaCl, 4.7 mM KCl, 1.2 mM KH2PO4, 1.2 mM
MgSO4, 5.5 mM glucose, 0.23 mM pyruvic acid, 4.8 mM lactic acid hemicalcium salt
(referred to hereafter as WH medium (Whitten, 1971) supplemented with 7 mM NaHCO3,
15 mM HEPES and 0.05% polyvinyl alcohol (PVA; catalog #P8136; Sigma-Aldrich; St.
Louis MO), referred to hereafter as WH/PVA medium. Dibutryryl cAMP (dbcAMP; 0.25
mM; catalog #D0627; Sigma-Aldrich) was added to the culture medium to maintain
prophase I arrest (Cho et al., 1974). Ovarian tissue was sheared with syringe needles in
order to release oocyte-cumulus complexes. Oocyte-cumulus complexes were denuded
following pipetting through a thin-bore glass pipette. Oocytes were transferred to
Whitten’s medium supplemented with 22 mM bicarbonate NaHCO3 and 0.05% polyvinyl
alcohol (referred to hereafter as WB/PVA) covered with mineral oil and placed in a
humidified atmosphere of 37oC, 5% CO2 for culture. For microinjection and culture
following microinjection, oocytes were cultured in EmbryoMax® KSOM + amino acids
with D-Glucose (catalog #MR-106-D, Millipore; Billerica, MA), hereafter referred to as
KSOM, supplemented with 0.25 mM dbcAMP. For in vitro meiotic maturation, prophase
I oocytes were washed through several drops of WB/PVA or KSOM to remove dbcAMP.
Removal of zona pellucida and recovery
The zonae pellucidae (ZP) of cumulus-free oocytes and eggs were removed with
a brief incubation (~10-15 sec) in acidic culture medium compatible buffer (116.4 mM
NaCl, 5.4 mM KCl, 10 mM HEPES, 1 mM NaH2PO4, 0.8 mM MgSO4, pH 1.5). ZP-free
oocytes and eggs were washed through several drops of WB/PVA and cultured in
WB/PVA at 37oC in a humidified atmosphere of 5% CO2 in air. ZP-free prophase I
oocytes were washed and cultured in WB/PVA supplemented with 0.25 mM dbcAMP to
maintain prophase I arrest.
199
Immunofluorescence and fluorescence microscopy
General method
ZP-free oocytes and eggs were fixed in freshly prepared 4.0% paraformaldehyde
(catalog #P6148 Sigma-Aldrich) in phosphate-buffered saline (PBS, 137 mM NaCl, 3
mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4) for 60 min at room temperature (RT)
or in 4.0% paraformaldehyde (prepared in 130 mM KCl, 25 mM HEPES, 3 mM MgCl ,
2
0.06% Triton-X, pH 7.4) for 30 min at 37oC. Following fixation, oocytes were briefly
washed in 1x PBS, permeabilized for 15 min in PBS containing 0.1% Triton X-100
(catalog # BP-151-500; Fisher Scientific), and incubated in blocking solution (PBS
containing 0.1% BSA (catalog #A9647; Sigma-Aldrich), 0.01% Tween-20 (catalog
#P7949; Sigma-Aldrich), and 10% normal goat serum (NGS, catalog #5425; Cell
Signaling Technologies; Danvers, MA). Oocytes and eggs were incubated in primary
antibody diluted in blocking solution for a minimum of 2 h. Eggs were washed, and then
incubated in secondary antibody for 2 h. Eggs were mounted in Vectashield mounting
medium (catalog #H-1200; Vector Laboratories; Burlingame, CA) supplemented with 1.5
μg/ml 4’6’-diamidino-2-phenylindole (DAPI; catalog #D9542; Sigma-Aldrich).
Imaging was performed on Zeiss Axio Observer Z1 Fluorescence microscope
with a Zeiss Axiocam MRm camera, Apotome optical sectioning and AxioVision software
(Carl Zeiss, Inc.). Analysis of the fluorescent intensity of the nexilin signal in the egg
cortex was performed using plot profile line scan analysis in ImageJ software
(http://rsb.info.nih/gov/ij/), using a line of sufficient width to capture the cortical staining
with anti-nexilin antibody. Analysis of spindle localization in siRNA-injected oocytes and
pharmacological inhibitor-treated oocytes was performed measuring the distance
between DNA and cortex using AxioVision software, specifically using the point of the
maternal DNA closest to the egg periphery as the start point, and the egg perimeter as
200
the end point. An oocyte or egg was classified as having “DNA at the cortex” if DNA and
spindle was 10 μm or less from the cortex, or classified as “DNA not at the cortex” if the
DNA and the spindle was greater than 10 μm from the cortex. Phalloidin images in
Figure 4.2 G-J were captured using a Zeiss CellObserver Z1 linked to an ORCA-Flash
4.0 CMOS camera (Hamamatsu) and analyzed with the Zeiss ZEN 2012 blue edition
image software.
Nexilin labeling
ZP-free oocytes and eggs were fixed in 4% paraformaldehyde in PBS for 60 min
at RT, briefly washed in 1x PBS, and permeablized for 15 min in PBS containing 0.1%
Triton X-100 (Sigma-Aldrich). Prophase I oocytes and metaphase II eggs were
incubated in blocking solution for 60 min at room temperature and metaphase I oocytes
were incubated in blocking solution overnight at 4oC due to timing of experiment.
Oocytes and eggs were incubated in anti-Nexilin antibody (catalog #SAB4200124,
Sigma-Aldrich) at 5 μg/ml diluted in blocking solution for 2 h. Eggs were washed, and
then incubated in secondary antibody (7.5 μg/ml goat-anti-mouse IgG-FITC; or 7.5 μg/ml
donkey-anti-mouse IgG-Texas Red; Jackson Immunoresearch; West Grove, PA) for 2 h.
Eggs were mounted in Vectashield mounting medium supplemented with 1.5 μg/ml
DAPI.
α-tubulin and Filamentous-actin double labeling
ZP-free oocytes and eggs were fixed in 4% paraformaldehyde buffered with
HEPES for 30 min at 37°C, then briefly washed in 1x PBS, and permeablized for 15 min
in PBS containing 0.1% Triton X-100 (Sigma-Aldrich). Metaphase II eggs were
incubated in blocking solution for 60 min at room temperature and metaphase I oocytes
were incubated in blocking solution overnight at 4oC. Oocytes and eggs were incubated
for 2 h in anti-α-tubulin monoclonal supernatant diluted 1:5 (clone 12G10; developed by
Joseph Frankel and E. Marlo Nelson, obtained from the Developmental Studies
201
Hybridoma Bank developed under the auspices of the NICHD and maintained by The
University of Iowa, Department of Biology, Iowa City, IA). Eggs were washed, and then
incubated in secondary antibody (7.5 μg/ml goat-anti-mouse IgG-FITC; Jackson
Immunoresearch) and Acti-stain phalloidin-555 (200 ng/μl; catalog #PHDH1-A;
Cytoskeleton; Denver, CO) for 2 h. Eggs were mounted in Vectashield mounting
medium supplemented with 1.5 μg/ml DAPI.
ROCK labeling
ZP-free oocytes were fixed in 4% paraformaldehyde buffered with PBS for 60
min at RT, then briefly washed in 1x PBS, and permeablized for 15 min in PBS
containing 0.1% Triton X-100. Metaphase I oocytes were incubated in blocking solution
overnight at 4oC. Oocytes were incubated for 2 h in anti-ROCK (catalog # GTX113266,
Genetex, Irvine, CA) at 179 μg/ml diluted in blocking solution. Eggs were washed, and
then incubated in secondary antibody (7.5 μg/ml donkey-anti-rabbit IgG-Texas Red;
Jackson Immunoresearch) for 2 h. Eggs were mounted in Vectashield mounting
medium supplemented with 1.5 μg/ml DAPI.
pLIMK1/2 labeling
ZP-free oocytes were fixed in 4% paraformaldehyde buffered with PBS and
supplemented with 100 µM Na3VO4 for 60 min at RT, then briefly washed in 1x PBS, and
permeablized for 15 min in PBS containing 0.1% Triton X-100. Metaphase I oocytes
were incubated in blocking solution supplemented with 100 µM Na3VO4 for 60 min at RT.
Oocytes were incubated overnight at 4oC in anti-phospho-LIMK1 (Thr508)/ LIMK2
(Thr505) (pLIMK1/2; Catalog #3841, Cell Signaling Technologies; Danvers, MA) at 1.02
μg/ml diluted in blocking solution supplemented with 100 µM Na3VO4. Eggs were
washed, and then incubated in secondary antibody (7.5 μg/ml donkey-anti-rabbit IgGFITC; Jackson Immunoresearch) for 2 h. Eggs were mounted in Vectashield mounting
medium supplemented with 1.5 μg/ml DAPI.
202
pCofilin labeling
ZP-free oocytes were fixed in 4% paraformaldehyde buffered with PBS and
supplemented with 100 µM Na3VO4 for 60 min at RT, then briefly washed in 1x PBS, and
permeablized for 15 min in PBS containing 0.1% Triton X-100. Metaphase I oocytes
were incubated in blocking solution supplemented with 100 µM Na3VO4 for 60 min at RT.
Oocytes were incubated overnight at 4oC in anti-phospho-cofilin (Ser3)(77G2) (Catalog
#3313, Cell Signaling Technologies; Danvers, MA) at 420 ng/ml diluted in blocking
solution supplemented with 100 µM Na3VO4. Eggs were washed, and then incubated in
secondary antibody (7.5 μg/ml donkey-anti-rabbit IgG-FITC; Jackson Immunoresearch)
for 2 h. Eggs were mounted in Vectashield mounting medium supplemented with 1.5
μg/ml DAPI.
Cofilin labeling
ZP-free oocytes were fixed in 4% paraformaldehyde buffered with PBS for 60
min at RT, then briefly washed in 1x PBS, and permeablized for 15 min in PBS
containing 0.1% Triton X-100. Metaphase I oocytes were incubated in blocking solution
overnight at 4oC. Oocytes were incubated for 2 h at RT in anti-cofilin 1 (Catalog
#GTX628804, Genetex) at 5 μg/ml diluted in blocking solution. Eggs were washed, and
then incubated in secondary antibody (7.5 μg/ml donkey-anti-mouse IgG-FITC; Jackson
Immunoresearch) for 2 h. Eggs were mounted in Vectashield mounting medium
supplemented with 1.5 μg/ml DAPI.
Phosphorylated myosin regulatory light chain (pMRLC) labeling
ZP-free oocytes were fixed in 4.0% paraformaldehyde buffered with HEPES for
30 min at 37°C, washed quickly in 1x PBS, permeabilized for 15 min in PBS containing
0.1% Triton X-100 (Sigma-Aldrich). Oocytes were incubated in blocking solution
supplemented with 100 μM sodium orthovanadate (Na3VO4; Sigma-Aldrich) for 60 min,
and then incubated in anti-pMRLC (also known as MYL9; catalog #3675, produced
203
against syntheticphosphopeptide corresponding to residues surrounding Ser19 of
human myosin light chain 2; Cell Signaling Technologies) at 100 ng/ml diluted in
blocking solution overnight at 4°C. Eggs were washed, then incubated in secondary
antibody (7.5 μg/ml donkey-anti-rabbit IgG-Texas Red; Jackson Immunoresearch) for 2
h. Eggs were mounted in Vectashield mounting medium supplemented with 1.5 μg/ml
DAPI.
Filamentous-actin labeling
ZP-free oocytes were fixed in 4% paraformaldehyde buffered with HEPES for 30
min at 37°C, then briefly washed in 1x PBS, and permeablized for 15 min in PBS
containing 0.1% Triton X-100 (Sigma-Aldrich). Oocytes were incubated in IIF-block
overnight at 4oC. Oocytes were incubated in Acti-stain phalloidin-555 (200 ng/μl;
Cytoskeleton) for 2 h and washed. Eggs were mounted in Vectashield mounting
medium supplemented with 1.5 μg/ml DAPI.
γ-tubulin labeling
ZP-free oocytes were fixed in 2% paraformaldehyde buffered with 2.5 mM EGTA,
5mM MgCl2, 0.1mM PIPES, and 2.5 mM Triton X-100) for 30 min at RT. Oocytes were
washed in 0.1% Fetal Bovine Serum (FBS) in PBS, and incubated in 50 mM NH4Cl for
15 min at RT. Oocytes were incubated overnight at 4oC in Jordan lab blocking solution
(10% FBS, 0.1% Triton X-100 in PBS). The following morning, oocytes were incubated
in anti-γ–tubulin (catalog #T6557, Sigma-Aldrich) at 1:1000 for 50 min at 37oC. Oocytes
were washed in 10% FBS in PBS for 50 min at 37oC, and then incubated in secondary
antibody (7.5 μg/ml goat-anti-mouse IgG-FITC; Jackson Immunoresearch) for 50 min at
37oC. Eggs were washed three times with 10% FBS in PBS for 20 min at 37oC, and
mounted in Vectashield mounting medium supplemented with 1.5 μg/ml DAPI.
204
Anillin labeling
ZP-free oocytes and eggs were fixed in cold methanol at -20oC for 5 min and
washed through several drops of 1x PBS. Prophase I oocytes and metaphase II eggs
were incubated in blocking solution for 60 min at room temperature and metaphase I
oocytes were incubated in blocking solution overnight at 4oC. Oocytes and eggs were
incubated with anti-anillin (10 μg/ml; catalog #GTX107742, GeneTex) for 2 h. Eggs
were washed and incubated with secondary antibody (7.5 μg/ml goat-anti-rabbit IgGFITC; Jackson Immunoresearch) for 2 h. Eggs were washed and mounted in
Vectashield mounting medium supplemented with 1.5 μg/ml DAPI
PAK4 labeling
ZP-free oocytes were fixed in 4% paraformaldehyde buffered with PBS for 60
min at RT, then briefly washed in 1x PBS, and permeablized for 15 min in PBS
containing 0.1% Triton X-100. Metaphase I oocytes were incubated in blocking solution
overnight at 4oC. Oocytes were incubated for 2 h in anti-PAK4 (catalog #K2890; SigmaAldrich) at 83 μg/ml diluted in blocking solution. Eggs were washed, and then incubated
in secondary antibody (7.5 μg/ml donkey-anti-rabbit IgG-Texas Red; Jackson
Immunoresearch) for 2 h. Eggs were mounted in Vectashield mounting medium
supplemented with 1.5 μg/ml DAPI.
Immunoblotting
General method
Samples were prepared by lysing oocytes in 10 μl SDS-PAGE sample buffer (65
mM Tris-HCl, 10% glycerol, 3.0% SDS, 0.02% bromophenol blue, 2% βmercaptoethanol pH 6.8) and heating at 100°C for 10 min. Proteins were separated on
SDS-polyacrylamide gels, then transferred to Immobilon-P PVDF membrane (catalog #
IPVH00010; Millipore). Membranes were blocked for 2 h in 5% dry milk (Safeway) or
10% fish gelatin (catalog #G7765; Sigma-Aldrich) diluted in Tris-buffered saline with
205
0.1% Tween-20 (TBS-T) or phosphate-buffered saline with 0.1% Tween-20 (PBS-T) ,
then incubated overnight at 4°C in primary antibody diluted in TBS-T or PBS-T with 3%
BSA and 0.02% NaN3 (catalog #GTX107742, GeneTex). After washing, membranes
were incubated for 2 h at room temperature in goat anti-rabbit immunoglobulin G (IgG)
horseradish peroxidase-conjugated secondary antibody (GAR-HRP, 400 ng/ml; Jackson
Immunoresearch) diluted in TBS-T or PBS-T with 5% BSA. Immune conjugates were
detected using SuperSignal West Pico Chemiluminescent Substrate (catalog # 248300;
Pierce Chemical Company/Thermo Scientific, Rockford, IL) and X-ray film (catalog
#248300; Research Products International Corporation, Mount Prospect, IL).
Anti-nexilin immunoblot
Samples of 12 prophase I oocytes injected with 40 µM control siRNA and 12
prophase I oocytes injected with 40 µM Nexn-targeting siRNA cultured for 48 h following
microinjection were prepared by lysing oocytes in 10 μl SDS-PAGE sample buffer.
Oocyte samples and positive tissue control (16 µg uterus lysate) were loaded and
proteins were separated on 10% SDS-polyacrylamide gels, then transferred at a
constant voltage of 100 volts to Immobilon-P PVDF membrane for 60 min. Membranes
were blocked for 2 h in 5% dry milk diluted in PBS-T, then incubated overnight at 4°C in
0.5 μg/ml anti-nexilin antibody diluted in PBS-T with 3% BSA and 0.02% NaN 3 (catalog
#SAB4200124, Sigma-Aldrich). After washing, membranes were incubated for 2 h at
room temperature in GAM-HRP (400 ng/ml) diluted in PBS-T with 5% BSA. Immune
conjugates were detected using SuperSignal West Pico Chemiluminescent Substrate
and X-ray film.
Anti-pLIMK1/2 immunoblot
Oocytes injected with siRNA were cultured for 48 h following microinjection.
Samples of 29 control siRNA-injected oocytes and 29 Nexn-targeting siRNA-injected
oocytes were lysed at 8 h following exit from prophase I arrest in 10 μl SDS-PAGE
206
sample buffer supplemented with 100 µM Na3VO4. Proteins were separated on 10%
SDS-polyacrylamide gels, then transferred to Immobilon-P PVDF membrane at a
constant voltage of 100 volts for 75 min. Membranes were blocked for 2 h in 10% fish
gelatin (catalog #G7765; Sigma-Aldrich) diluted in TBS-T, then incubated overnight at
4°C in 200 ng/ml anti-pLIMK1/2 antibody diluted in TBS-T with 3% BSA and 0.02% NaN3
(catalog #3841, Cell Signaling Technologies; Danvers, MA). After washing, membranes
were incubated for 2 h at room temperature in GAR-HRP (400 ng/ml) diluted in TBS-T
with 5% BSA. Immune conjugates were detected using SuperSignal West Pico
Chemiluminescent Substrate and X-ray film.
Anti-LIMK2 immunoblot
Oocytes injected with siRNA were cultured for 48 h following microinjection.
Samples of 20 control siRNA-injected oocytes and 20 Nexn-targeting siRNA-injected
oocytes were lysed at 8 h following exit from prophase I arrest in 10 μl SDS-PAGE
sample buffer. Proteins were separated on 10% SDS-polyacrylamide gels, then
transferred to Immobilon-P PVDF membrane at a constant voltage of 100 volts for 70
min. Membranes were blocked for 2 h in 10% fish gelatin (catalog #G7765; SigmaAldrich) diluted in TBS-T, then incubated overnight at 4°C in 438 ng/ml anti-LIMK2
antibody diluted in TBS-T with 3% BSA and 0.02% NaN3 (catalog #3845, Cell Signaling
Technologies; Danvers, MA). After washing, membranes were incubated for 2 h at room
temperature in GAR-HRP (400 ng/ml) diluted in TBS-T with 5% BSA. Immune
conjugates were detected using SuperSignal West Pico Chemiluminescent Substrate
and X-ray film.
Anti-pCofilin immunoblot
Oocytes injected with siRNA were cultured for 48 h following microinjection.
Samples of 20 wild-type prophase I oocytes, 20 wild-type metaphase I oocytes, 20
control siRNA-injected prophase I oocytes, 20 Nexn-targeting siRNA-injected prophase I
207
oocytes, 20 control siRNA-injected oocytes at 8 h following exit from prophase I arrest,
and 20 Nexn-targeting siRNA-injected oocytes at 8 h following exit from prophase I
arrest were prepared by lysing oocytes in 10 μl SDS-PAGE sample buffer supplemented
with 100 µM Na3VO4. Proteins were separated on 12.5% SDS-polyacrylamide gels, then
transferred to Immobilon-P PVDF membrane at a constant voltage of 100 volts for 75
min. Membranes were blocked for 2 h in 10% fish gelatin diluted in TBS-T, then
incubated overnight at 4°C in 40 ng/ml anti-pCofilin (Ser3) antibody diluted in TBS-T with
3% BSA and 0.02% NaN3 (catalog #3313, Cell Signaling Technologies). After washing,
membranes were incubated for 2 h at room temperature in GAR-HRP (400 ng/ml)
diluted in TBS-T with 5% BSA. Immune conjugates were detected using SuperSignal
West Pico Chemiluminescent Substrate and X-ray film.
Anti-MAPK3/1 immunoblot
An immunoblot previously probed with anti-pCofilin was washed in TBS-T for 30
min to wash off the SuperSignal West Pico Chemiluminescent Substrate, and incubated
in 10 ml of Restore Western Blot Stripping Buffer (catalog #21059; Thermo Scientific) for
15 min at RT. To ensure complete removal of pCofilin signal, the blot was incubated
with SuperSignal West Pico Chemiluminescent Substrate, and exposed to X-ray film to
confirm no signal. The blot was then washed for 30 min in TBS-T, re-blocked in 10%
fish gelatin in TBS-T for 2 h at RT, and incubated in anti-MAPK3/1 (catalog # 4695; Cell
Signaling Technologies) at 98 ng/ml diluted in TBS-T with 3% BSA and 0.02% NaN3
overnight at 4oC. After washing, membranes were incubated for 2 h at room
temperature in GAR-HRP (400 ng/ml) diluted in TBS-T with 5% BSA. Immune
conjugates were detected using SuperSignal West Pico Chemiluminescent Substrate
and X-ray film.
Band intensity was analyzed using ImageJ software (http://rsb.info.nih/gov/ij/),
selecting an appropriate exposure time for each blot such that no signals were
208
saturated. The rectangular selection tool was used to select each band and peak
intensity was determined. The area under each peak was calculated as a measure of
band intensity. Band intensities were reported as mean value in arbitrary units (A.U) ±
SEM for each group.
siRNA-mediated knockdown
ZP-intact prophase I oocytes were collected as described above and
microinjected in groups of 50 oocytes per 12 μl KSOM supplemented with 0.25 mM
dbcAMP under mineral oil in ambient air at room temperature. Oocytes were
microinjected using a Nikon Eclipse TE 2000–5 microscope with a 10x objective
(Melville, NY) equipped with an Eppendorf FemtoJet®(Hamburg, Germany), using
injection pressure of 200 hPa, injection time of 0.2 s, and compensation pressure of 0
hPa. Thinwall glass capillaries (catalog #TW100F-4; World Precision Instruments;
Sarastoa, FL) were used for microinjection needles pulled on micropipette puller (Model
P-87 Brown-Flaming; Sutter Instrument Co.) set to Heat 620, Pull 83-85, Velocity 70,
Time 150, and Pressure 200. The medium for siRNA-injected oocytes was changed
daily and culture times are described in figure legends.
Oocytes were injected with Nexn-targeting siRNA (ON-TARGET-plus
SMARTpool, catalog # L-051624-01-0005; Dharmacon; Waltham, MA). siRNA was
resuspended according to manufacturer’s instructions, to a concentration of 100 μM in 1
volume of 5x siRNA Buffer (B-002000-UB-100; Dharmacon,) and 4 volumes of RNasefree water. Control siRNA (catalog # D-001810-10-20, ON-TARGETplus control pool;
Dharmacon) was used as a negative control. Stocks of 100 μM Nexn-targeting siRNA
were diluted to a concentration of 40 μM in 1x siRNA buffer for microinjection and stored
in aliquots of 2.5 μl at -80oC.
209
Construction of pIVT-EGFP-HsCfl1-S3E
A plasmid containing the cDNA encoding human cofilin 1 S3E was obtained from
Addgene (#50861, Cambridge, MA) and was verified by DNA sequencing. The cDNA
insert encoding pEGFP-N1 human cofilin 1 S3E was amplified by polymerase chain
reaction (PCR) using PhusionTM-High Fidelity DNA polymerase (New England Biolabs;
Ipswich, MA). There is 85% identity in the amino acid sequence between human and
mouse, justifying the use of human cofilin. Cloning primer sequences are shown in
Table 4.1. The PCR product was gel-purified (QIAquick Gel Extraction kit; Qiagen;
Valencia, CA), digested with Pst1 and Kpn1 (New England Biolabs, Ipsich, MA), and
cloned into digested pIVT vector (gift of Dr. Carmen Williams, Igarshi et al., 2007)
according to standard protocols. The resulting plasmid pIVT-EGFP-HsCfl1-S3E was
transformed into E. coli DH-5-α cells and verified by DNA sequencing.
Synthesis of single stranded RNA
mRNA was synthesized from pIVT.pEGFP-N1 human cofilin S3E and pGEMHE3mEGFP-UtrCH using the mMessage Machine kit (Ambion, Austin, TX.) The
pIVT.pEGFP-N1 human cofilin S3E plasmid DNA was digested with ScaI and the
pGEMHE-3mEGFP-UTRCH plasmid DNA was digested with NotI, to linearize the DNA.
For the in vitro transcription reaction, the following components were mixed from the
mMessage Machine kit: 4 µl of nuclease-free water, 10µl 2x NTP/CAP, 2 µl 10x
Reaction Buffer, 1 µg linear template DNA, 2 µl enzyme mix. The reaction was gently
mixed and incubated at 37oC for 2 h. After 2 h, 1 µl TURBO DNase was added and
gently mixed, and incubated at 37oC for 15 min. For RNA extraction, 115 µl nucleasefree water and 15 µl Ammonium Acetate Stop Solution (5M ammonium acetate, 100 mM
EDTA) were added, followed by 150 µl of 1:1 phenol:chloroform. The reaction was
inverted gently several times and centrifuged at 16,000xg for 5 min at 4oC. An additional
150 µl of 1:1 phenol: chloroform was added and re-spun at 16,000xg for 5 min at 4oC.
210
The aqueous layer was transferred to a clean 1.5 ml Eppendorf tube, 150 µl of 100%
isopropanol was added, and RNA was precipitated overnight at -80oC. The following
morning, the RNA was pelleted by centrifugation at 16,000xg for 15 min at 4oC. The
pellet was washed with cold 70% ethanol, and re-spun at 16,000xg for 15 min at 4oC.
The pellet was air dried for 10 minutes, and resuspended in 10 µl of RNAse-free water.
The OD260/280 of the mRNA was determined using a spectrophotometer. The
concentration of pIVT.pEGFP-N1 human cofilin S3E was adjusted to 2 µg/µl, and the
concentration of pGEMHE-3mEGFP-UtrCH was adjusted to 1 µg/µl. mRNA stocks were
stored at -80oC.
Treatment of oocytes with pharmacological inhibitors
The ROCK inhibitor, Y-27632 (catalog #10005583, registry #129830-38-2;
Cayman Chemical; Ann Arbor, MI) was used to specifically inhibit ROCK activity in
mouse oocytes. Prophase I oocytes were cultured in 50 µM Y-27632 for 8 h in a
humidified atmosphere of 37oC, 5% CO2 prior to ZP removal and indirect
immunofluorescence labeling nexilin. This dose was selected based on previous studies
in mouse oocytes (Duan et al., 2014; Hyo Lee, unpublished data).
Prophase I oocytes were treated with 0.25 µM of the p21-activated kinase
inhibitor, PF-3758309, (catalog #CAS 898044-15-0; Millipore; Billerica, MA) for 8 h in a
humidified atmosphere of 37oC, 5% CO2 prior to ZP removal and indirect
immunofluorescence labeling nexilin. This dose was selected based on previous reports
in other cell types (Jiang et al., 2014; Hyo Lee, unpublished).
Statistical analyses
Analyses were performed using StatView 5.0 (SAS Institute, Cary, NC). A pvalue less than 0.05 was considered significant. Chi-squared (χ2) tests were used to
compare distribution of frequencies observed following microinjection or pharmacological
inhibitor treatment.
211
IV. RESULTS
Nexilin localization throughout meiotic maturation and RNAi-mediated knockdown
of nexilin protein
The localization of nexilin at various stages of meiotic maturation was
characterized using immunofluorescence. At prophase I, nexilin localized to the cortex
(Figure 4.1A), and to the spindle as well as the region of the cortex overlying the spindle
at metaphase I (Figure 4.1B). At metaphase II, nexilin localized primarily to the
amicrovillar domain, the region overlying the metaphase II spindle, and faintly to the
spindle (Figure 4.1C). To investigate the function of nexilin in oocytes, RNAi-mediated
knockdown was used to generate nexilin-deficient oocytes. Prophase I oocytes were
injected with 40 μM control siRNA or 40 μM Nexn-targeting siRNA, and cultured for 48 h
in conditions that maintained prophase I arrest. Prophase I oocytes injected with Nexntargeting siRNA had 67 ± 1.5% knockdown at the transcript level compared to control
siRNA-injected oocytes (Figure 4.1D, E). Nexilin-deficient oocytes had 72 ± 3.4%
knockdown at the protein level compared to control oocytes (Figure 4.1F). In addition to
an immunoblot, immunofluorescence was used to assess nexilin knockdown at the
single-cell level. Control oocytes had a strong nexilin signal at the cortex (Figure 4.1G,
H), whereas nexilin-deficient had a much fainter nexilin signal (Figure 4.1I, J). The
fluorescent nexilin signal was quantified with a line-scan analysis along the
circumference of the cortex (Figure 4.1 K), confirming that nexilin protein was knocked
down in these nexilin-deficient oocytes.
Meiotic maturation in nexilin-deficient oocytes
In mammalian oocytes, meiotic resumption from prophase I arrest is analogous
to the G2-to-M transition in mitotic cells. In vitro meiotic maturation experiments were
performed to assess the ability of nexilin-deficient oocytes to exit prophase I and
undergo meiotic maturation. During the 48 h culture time following microinjection to
212
allow for protein knockdown, prophase I oocytes were cultured in media containing
dbcAMP, a cell permeable analog to maintain prophase I arrest (Cho et al., 1974).
When dbcAMP was washed away, oocytes could begin meiotic maturation, and were
scored on the ability to exit from prophase I arrest and undergo germinal vesicle
breakdown (GVBD). The loss of nexilin did not affect the ability of the oocyte to undergo
GVBD, as seen in 72% (63/88) of nexilin-deficient oocytes and 73% (75/103) of control
oocytes having completed GVBD by 5 h. Given that progression through GVBD
appeared normal, we then investigated whether nexilin-deficient oocytes could reach
metaphase I by culturing control siRNA-injected oocytes and Nexn-targeting siRNAinjected oocytes for 8 h following exit from prophase I arrest. Control siRNA-injected
oocytes fixed 8 h following exit from prophase I arrest were at metaphase I. To
determine if nexilin plays a role in spindle positioning, the localization of the spindle was
first examined. A metaphase I spindle formed and translocated to the cortex in 31%
(61/195) of control oocytes (Figure 4.2B). Nexilin-deficient oocytes displayed a range of
phenotypes at 8 h following exit from prophase I arrest. The majority (79%; 125/159) of
nexilin-deficient oocytes formed a normal spindle, however, only 13% (21/159) of nexilindeficient oocytes had a spindle that reached the cortex, and 65% (104/159) of nexilindeficient oocytes had a spindle that did not reach the cortex (Figure 4.2A, C-E).
The distance between the DNA and cortex was measured, and an oocyte was
scored as “DNA at cortex” if DNA measured 10 μm or less from the cortex, or scored as
“DNA not at cortex” if DNA was greater than 10 μm from the cortex. Nearly 62%
(120/195) of control oocytes had DNA that did not reach the cortex, compared to 65%
(104/159) of nexilin-deficient oocytes. A small portion (7%; 14/195) of control oocytes
had condensed DNA that had not clustered or aligned and did not form a spindle as
seen by distinct chromosomes in the cytoplasm, this was observed in 20% (32/159) of
nexilin-deficient oocytes (Figure 4.2C). 1% (2/159) of nexilin-deficient oocytes
213
underwent abnormal cytokinesis in which DNA appeared anaphase-like and moved to
opposite poles of the spindle (Figure 4.2F). The different phenotypes observed in
nexilin-deficient oocytes possibly could be attributed to varying extents of nexilin protein
knockdown in each oocyte. Analysis of the frequency distributions of the phenotypes
revealed there was a statistically significant difference between control oocytes and
nexilin-deficient oocytes (Figure 4.2K).
Since nexilin is an actin-binding protein, and spindle positioning is dependent on
cytoplasmic and cortical actin, the localization of actin in control and nexilin-deficient
oocytes was next investigated. In control oocytes at metaphase I, actin localized
uniformly around the cortex when the DNA was not at the cortex (Figure 4.2A), and
localized to the region of the cortex overlying the DNA when the DNA was at the cortex
(Figure 4.2B, G, H). Control oocytes at metaphase I did not have a cytoplasmic actin
cloud, consistent with what was found in another study of oocytes at this stage (Li et al.,
2008). In contrast, nexilin-deficient oocytes had uniform cortical localization, with no
enrichment of actin to the region of the cortex overlying the DNA (Figure 4.2C, D, I, J).
A subset of nexilin-deficient oocytes had DNA surrounded by an actin cloud, with a
symmetric actin cloud observed in 88% (14/18) of oocytes (Figure 2C, J), and an
asymmetric cloud in 22% (4/18) of oocytes (Figure 4.2D). In oocytes with an asymmetric
actin cloud, the majority of the cloud trailed behind the DNA as the DNA left the center of
the oocyte (illustrated in Figure 1.4).
As noted above, the metaphase I spindle did not reach the cortex in the majority
of nexilin-deficient oocytes by 8 h after the initiation of meiotic maturation (Figure 4.2K).
We examined whether this effect was time-dependent, testing the hypothesis that DNA
translocation occurred more slowly in nexilin-deficient oocytes as compared to control
oocytes. Control and nexilin-deficient oocytes were analyzed at 16 h after the initiation
of meiotic maturation, because control oocytes would be arrested at metaphase II when
214
the spindle was adjacent to the cortex, actin localized in a cap to the cortical region
overlying the spindle, and first polar body emission occurred (Figure 4.2L). The DNA
measurements were defined by the same distance parametric as at metaphase I, an
oocyte was classified as “DNA at cortex” if DNA measured 10 μm or less from the
cortex, or classified as “DNA not at cortex” if DNA was greater than 10 μm from the
cortex. At 16 h following exit from prophase I arrest, 76% (35/46) of control siRNAinjected oocytes were at metaphase II, compared to only 26% (12/46) of nexilin-deficient
oocytes (Figure 4.2L). The majority (46%; 21/46) of nexilin-deficient oocytes had a
spindle that did not reach the cortex, compared to 7% (3/46) of control oocytes. In some
of the nexilin-deficient oocytes, actin localized as a cloud around the DNA and uniformly
around the cortex (Figure 4.2N), as seen in oocytes fixed at 8 h after exit from prophase
I arrest. 17% (8/46) of control oocytes had condensed DNA that did align, and did not
form a spindle (as in Figure 4.2C). Of the remaining nexilin-deficient oocytes, 9% (4/46)
of oocytes had clustered DNA but did not form a spindle (Figure 4.2I), and 12% (9/46)
had condensed DNA that did not yet cluster or align as seen by distinct chromosomes in
the cytoplasm (Figure 4.2M). There was a statistically significant difference calculated
from the frequency distributions of these different phenotypes between control and
nexilin-deficient oocytes at 16 h (Figure 4.2O).
ROCK appears unaffected, but phosphorylation of LIMK1/2 is reduced in nexilindeficient oocytes.
Similar to nexilin-deficient oocytes, mammalian oocytes with disrupted ROCK
activity do not undergo first polar body emission due to spindle migration failure (Duan et
al., 2014; Zhang 2014; Lee et al., 2015). The localization of ROCK was next examined
to determine if changes in ROCK were causing the spindle migration failure in nexilindeficient oocytes. ROCK localized to the cortex in control oocytes at metaphase I
(Figure 4.3A, B), and nexilin-deficient oocytes at 8 h following exit from prophase I arrest
215
(Figure 4.3C, D). Next, nexilin localization was observed in oocytes fixed 8 h following
exit from prophase I arrest where ROCK activity was inhibited with the pharmacological
inhibitor Y-27632 for the duration of meiotic maturation. Inhibition of ROCK did not
appear to affect nexilin localization. Nexilin localized to the spindle in control metaphase
I oocytes (Figure 4.3E, F) as well as in ROCK-inhibited oocytes (Figure 4.3 G, H).
Nearly half of ROCK-inhibited oocytes (5/12) had DNA that did not translocate to the
cortex, similar to what has been previously reported in mouse oocytes (Duan et al.,
2014). It can be concluded that nexilin localization was unaffected by inhibition of ROCK
activity and ROCK localization was unaffected in nexilin-deficient oocytes. Next, a
downstream effector of ROCK was pursued to determine if nexilin functions to foster an
interaction between ROCK and other molecules.
During mitosis, ROCK promotes actin assembly through phosphorylation of LIM
kinase 1/2 (LIMK1/2; Watanabe et al., 1999), so the levels of active, phosphorylated
LIMK1/2 in control and nexilin-deficient oocytes were assessed. Nexilin-deficient
oocytes had 57.4 ± 3% less active, phosphorylated LIMK1/2 (pLIMK1/2) compared to
control oocytes at metaphase I (Figure 4.3I). There was no difference in total LIMK2
between control and nexilin-deficient oocytes at the same time point (Figure 4.3J). The
decrease in pLIMK1/2 observed in an anti-pLIMK1/2 immunoblot is consistent with
pLIMK1/2 immunofluorescence, suggesting that pLIMK1/2 activity is altered in nexilindeficient oocytes. In metaphase I oocytes, pLIMK1/2 localized to the poles on either
side of the spindle (Figure 4.3K, L, [arrowheads]). This pole-localized pLIMK1/2 was not
observed in a subset of nexilin-deficient oocytes at the same time-point (Figure 4.3N).
The localization of pLIMK1/2 was not dependent on spindle position because some
nexilin-deficient oocytes with centrally located spindles had spindle-localized pLIMK1/2
(Figure 4.3M). Despite no difference in ROCK localization, nexilin-deficient oocytes had
reduced phosphorylation of LIMK1/2 compared to control oocytes at 8 h following exit
216
from prophase I arrest, suggesting that nexilin may assist in the interaction between
ROCK and LIMK1/2.
Nexilin-deficient oocytes have less pCofilin compared to control oocytes
As noted in the introduction, mammalian oocytes with disrupted ROCK activity
reduced levels of inactive, phosphorylated cofilin (pCofilin; Duan et al., 2014; Zhang et
al., 2014; Lee et al., 2015), suggesting that the phosphorylation status of cofilin is
important for the actin dynamics required for metaphase I spindle positioning.
Phosphorylation and subsequent activation of LIMK1/2 enables LIMK1/2 to
phosphorylate cofilin (Arber et al., 1998; Yang et al., 1998). In contrast to LIMK1/2,
phosphorylation results in the inactivation of cofilin (Arber et al., 1998; Yang et al., 1998).
We tested the hypothesis that pCofilin levels were altered in nexilin-deficient oocytes,
which we showed have reduced pLIMK1/2 activity (Figure 4.3I). In mitotic cells, the level
of pCofilin gradually increases in the early stages of mitosis, peaking at metaphase, and
decreases in telophase and cytokinesis (Amano et al., 2002). In contrast, we show that
metaphase I mouse oocytes have 40.3 ± 12% less pCofilin compared to prophase I
oocytes (Figure 4.4A). At prophase I, there was no difference in levels of pCofilin
between control and nexilin-deficient oocytes as detected by immunoblot (Figure 4.4B).
However, at 8 h following initiation of meiotic maturation, nexilin-deficient oocytes had
61± 13% less pCofilin compared to control metaphase I oocytes (Figure 4.4C).
Cofilin and pCofilin also were examined by immunofluorescence. pCofilin
localized to the cytoplasm and faintly to the spindle in control metaphase I oocytes
(Figure 4.4E, F [asterisks]). However, this localization of pCofilin to the spindle was lost
in the subset of nexilin-deficient oocytes that did form a spindle at 8 h following exit from
prophase I arrest (Figure 4.4H). In control siRNA-injected metaphase I oocytes, cofilin
localized to the cortex and faintly to the spindle (Figure 4.4I, J). A similar localization
was observed in nexilin-deficient oocytes at 8 h after exit from prophase I arrest (Figure
217
4.4K, L). Attempts to determine the expression levels of total cofilin between control and
nexilin-deficient oocytes using an immunoblot were not successful, due to this anti-cofilin
antibody not working well for immunoblots.
A phospho-mimetic form of cofilin affects the ability of the spindle to translocate
to the cortex at metaphase I.
As shown above (Figure 4.4), nexilin-deficient oocytes had reduced levels of
pCofilin. This finding, combined with the results of others showing that reduced pCofilin
correlated with defects in metaphase I spindle migration (Duan et al. 2014; Lee et al.,
2015; Zhang et al., 2014), prompted us to investigate the functions of cofilin in oocytes
during meiosis I. Experiments were undertaken expressing a phospho-mimic form of
cofilin, cofilin-S3E, in both wild-type oocytes and in nexilin-deficient oocytes. Cofilin-S3E
was previously used to determine if cofilin enhances axonal cell growth in hippocampal
neurons (Garvalov et al., 2007), and found that wild-type cofilin and a nonphosphorylatable mutant of cofilin, but not cofilin-S3E, increased axon growth (Garvalov
et al., 2007). Thus, our experiment with nexilin-deficient oocytes was done to ascertain
if cofilin-S3E would rescue the spindle migration defect observed with nexilin-deficiency.
Control and nexilin-deficient oocytes were microinjected with cRNA encoding cofilin-S3E
(Garvalov et al., 2007), and allowed to exit from prophase I arrest. After 8 h, 77% of
control oocytes (24/31) had chromatin at the cortex (Figure 4.5A). In contrast, 87% of
control oocytes (40/46) injected with cofilin-S3E cRNA did not have chromatin at the
cortex (Figure 4.5B). Additionally, 85% of nexilin-deficient oocytes (11/13) and nearly
90% of nexilin-deficient oocytes (38/42) injected with cofilin-S3E cRNA had chromatin
that did not reach the cortex (Figure 4.5C, D). Next, control oocytes and nexilin-deficient
oocytes were injected with water as a control experiment to show that a second round of
microinjection did not affect the ability of the chromatin to translocate to the cortex.
Nearly 78% (14/18) of control oocytes injected with water had chromatin that reached
218
the cortex at 8 h following exit from prophase I arrest, confirming that a second injection
did not affect the ability of the chromatin to move to the cortex. An additional control
experiment examined oocytes injected with a different cRNA encoding the actin probe
GFP-UtrCH, previously used in mouse oocytes (Mori et al., 2011). This experiment
demonstrated that injection with a different translatable cRNA did not affect the ability of
the chromatin to translocate to the cortex, as observed in oocytes injected with cofilinS3E. There was no difference in chromatin localization in oocytes injected with control
siRNA viruses control siRNA injected with GFP-UtrCH. Similarly, there was no
difference in chromatin localization between nexilin-deficient oocytes versus nexilindeficient oocytes injected with GFP-UtrCH (Figure 4.5F). χ2 analysis showed that there
was a statistically significant difference between control oocytes versus control oocytes
injected + cofilin-S3E based on chromatin localization (Figure 4.5E). There was a
statistically significant difference in chromatin localization between control oocytes
versus nexilin-deficient oocytes, and control oocytes injected with water and nexilindeficient oocytes injected with water. Whereas the introduction of cofilin-S3E did not
rescue the spindle defect phenotype in nexilin-deficient oocytes, cofilin-S3E hindered
spindle positioning in control oocytes.
Proteins known to interact with nexilin are mislocalized in nexilin-deficient
oocytes
Using high-affinity capture mass spectrometry, nexilin was discovered to interact
with γ-tubulin, a marker of spindle organization, thus making nexilin a good candidate to
have a spindle-related function (Hutchins et al., 2010). In addition to the majority of
nexilin-deficient oocytes that did not have spindle recruitment to the cortex at 8 h
following exit from prophase I arrest, there was a substantial number (36/139) of nexilindeficient oocytes that did not form a spindle (Figure 4.2K). Therefore, we tested the
hypothesis that γ-tubulin localization was altered in nexilin-deficient oocytes using
219
immunofluorescence. In control metaphase I oocytes, γ-tubulin localized precisely to the
spindle poles (Figure 4.6A). However at 8 h following exit from prophase I arrest,
nexilin-deficient oocytes had a variety of γ-tubulin localizations depending upon the
appearance of the DNA. In nexilin-deficient oocytes where the DNA was not completely
condensed or aligned along the metaphase plate, γ-tubulin had scattered localization
around the DNA (Figure 4.6B, C). In nexilin-deficient oocytes that appeared to have
normal DNA aligned along the metaphase plate, and a spindle that began to translocate
away from the center of the oocyte, γ-tubulin was not localized tightly to the spindle
poles, but rather dispersed around the poles (Figure 4.6D). The subtle difference in γtubulin localization would have not been detected if the meiotic spindle was labeled with
only α- or β-tubulin. We concluded nexilin is required for the localization of γ-tubulin.
Nexilin was discovered to interact with anillin through high affinity mass
spectrometry capture (Hein et al., 2015). Anillin interacts with several known cytokinesis
regulatory molecules at the contractile ring including RhoA, actin, and myosin-II, all
molecules implicated in spindle positioning in mouse oocytes (Piekny and Glotzer,
2008). In control metaphase I oocytes, anillin had a variety of localizations, 37% (14/38)
of oocytes had anillin localized to the cortex overlying the chromatin adjacent to the
cortex (Figure 4.6E), 29% (11/38) of oocytes had anillin localized to the chromatin, 18%
(7/38) of oocytes had anillin localized uniformly around the cortex (Figure 4.6F), and
16% (6/38) of oocytes had anillin localized as speckles around the DNA. In nexilindeficient oocytes, anillin localized as speckles around the chromatin in 66% (19/29) of
oocytes (Figure 4.6G), to the chromatin in 24% (7/29) of oocytes (Figure 4.6H), and to
the region of the cortex overlying the chromatin in 10% (3/29) of oocytes. χ 2 analysis
determined that there was a statistically significant difference between control
metaphase I oocytes and time-matched nexilin-deficient oocytes based on the frequency
distributions of anillin localization patterns.
220
Localization of myosin-II is altered in nexilin-deficient oocytes
Spindle positioning is dependent on the non-muscle myosin-II motor protein
acting as a pulling force on the actin filaments during meiosis I in mouse oocytes
(Schuh and Ellenberg, 2008; Li et al., 2008). Inhibition of myosin light chain kinase
(MLCK) and other perturbations to myosin-II resulted in impaired spindle migration and
failed first polar body emission (Chaigne et al., 2013; Simerly et al., 1998; Schuh and
Ellenberg, 2008). Since the failure to position the spindle at the cortex and emit the first
polar body were phenotypes observed in nexilin-deficient oocytes, the localization of the
active form of myosin-II (as identified by phosphorylated myosin regulatory light chain,
pMRLC) was investigated. In control metaphase I oocytes, pMRLC localized to the
poles on either side of the spindle (Figure 4.6I, J, in agreement with Dumont et al.,
2007). However, this pole-localized pMRLC was not observed in the subset of nexilindeficient oocytes that had chromosomes aligned along the metaphase plate, and the
overall pMRLC signal was very faint to undetectable (Figure 4.6K, L).
Nexilin and PAKs
Due to similarities observed in nexilin-deficient oocytes and in oocytes treated
with the p21-activated kinase (PAK) inhibitor PF-3758309 (specifically reduced
pLIMK1/2 and pCofilin levels; Hyo Lee, unpublished data), we investigated if (a) PAK
localization would be affected by nexilin deficiency, and (b) if nexilin localization would
be affected by PF-3758309 treatment. PAK4 localized uniformly around the cortex in
control metaphase I oocytes (Figure 4.7A, B) and in nexilin-deficient oocytes at 8 h
following the initiation of meiotic maturation (Figure 4.7C, D). PAK4 localization at
metaphase I does not appear to be dependent on nexilin.
Next, immunofluorescence was used to investigate the localization of nexilin in
PAK-inhibited oocytes. Similar to treatment with Y-27632, oocytes were treated with PF3758309 for the duration of meiotic maturation and fixed after 8 h. In control-treated
221
oocytes, nexilin localized to the spindle and to the region of the cortex overlying the DNA
(Figure 4.7E), or uniformly around the cortex if the DNA was not near the cortex (Figure
4.7F). PAK-inhibited oocytes had similar nexilin localization to the spindle and the
region of the cortex overlying the DNA (Figure 4.7G), or uniformly around the cortex
(Figure 4.7H). Since the localization of nexilin was unaffected following PAK inhibition,
nexilin localization does not require PAK activity.
V. DISCUSSION
This work presents evidence that nexilin plays a role in spindle organization and
spindle positioning in mouse oocytes during meiosis I. The localization of nexilin to the
meiotic spindle and to the region overlying the spindle at metaphase I and metaphase II
suggest a spindle-associated function. The majority of nexilin-deficient oocytes have a
spindle that does not reach the cortex at 8 h following exit from prophase I arrest, a time
when control oocytes have a spindle adjacent to the cortex and are at metaphase I.
Spindle migration is not delayed in nexilin-deficient oocytes, based on data showing that
the majority of nexilin-deficient oocytes have a spindle that still does not reach the cortex
at 16 h following exit from prophase I arrest. Time-matched control oocytes are at
metaphase II and have undergone first polar body emission.
Metaphase I spindle positioning is accomplished by the polymerization of
cytoplasmic actin filaments pushing the spindle, and pole-localized myosin-II pulling on
the overlapping actin filaments that make up the cytoplasmic and cortical actin networks
(Schuh and Ellenberg 2008; Li et al., 2008; Chaigne et al., 2013; Chaigne et al., 2015).
Actin and myosin-II are both mislocalized in nexilin-deficient oocytes that fail to position
the spindle near the cortex. A subset of nexilin-deficient oocytes has a symmetric actin
cloud surrounding the DNA. Since the formation of the actin cloud requires Fmn2, as
Fmn2-/- oocytes do not form an actin cloud (Li et al., 2008), we can conclude that nexilindeficient oocytes have Fmn2, and that nexilin acts downstream of Fmn2. Whereas
222
control metaphase I oocytes have an enrichment of actin to the region of the cortex
overlying the spindle, nexilin-deficient oocytes have actin localized uniformly around the
cortex. A distance-dependent, Ran-GTP signal induces cortical reorganization during
meiotic maturation, and oocytes injected with DNA beads localized within 20 µm of the
cortex were able to induce cortical remodeling and cortical actomyosin (Deng et al.,
2007). The uniform cortical actin localization observed in nexilin-deficient oocytes is
likely due the distance between the chromatin and cortex being too great to relay the
cortical reorganization signal.
As mentioned above, spindle movement is generated by pole-localized myosin-II
pulling on the cytoplasmic and cortical actin filaments (Schuh and Ellenberg, 2008;
Simerly et al. 1998). Control metaphase I oocytes had pMRLC localized to the spindle
poles, however this pole-localized pMRLC was not detectable in the subset of nexilindeficient oocytes that had chromosomes aligned along the metaphase plate (and
presumably formed a spindle). Normal pMRLC localization at metaphase I likely
requires an organized spindle, and it is possible that there are a range of spindle defects
in nexilin-deficient oocytes that hinder pMRLC localization. Whereas some spindles in
nexilin-deficient oocytes appeared normal based on α/β-tubulin labeling of central
microtubules, further experiments revealed that γ-tubulin was mislocalized at the poles.
Thus these range of spindle defects observed in nexilin-deficient oocytes could be
impacting pMRLC localization. Therefore, nexilin-deficient oocytes are likely unable to
generate the myosin-II mediated pulling force required for metaphase I spindle
positioning due to mislocalized or undetectable pMRLC. Additionally, we speculate that
anillin is required for the normal localization of myosin-II at metaphase I. Myosin-II
recruitment to the cytokinetic ring is mediated by anillin (Piekny and Glotzer, 2008), a
protein known to interact with nexilin (Hein et al., 2015). Since anillin is mislocalized in
nexilin-deficient oocytes, as a result from either the loss of nexilin or the inability of the
223
spindle to translocate to the cortex, then presumably myosin-II is also mislocalized within
the oocyte. This proposed mislocalization of myosin-II might be affecting the pulling
force generated by the spindle, or the function of myosin-II in the cortical actin network.
The ROCK-LIMK1/2-Cofilin pathway has been previously implicated in spindle
positioning in mammalian oocytes (Duan et al., 2014; Zhang et al., 2014; Lee et al.,
2015; Li et al, 2016). Some mammalian oocytes that are unable to position the
metaphase I spindle adjacent to the cortex have reduced pCofilin (Duan et al., 2014;
Zhang et al., 2014; Lee et al., 2015), which is similar to what we show in nexilin-deficient
oocytes. Whereas oocytes with reduced pCofilin are a result from ROCK inhibition
(Duan et al., 2014; Zhang et al., 2014; Lee et al., 2015), nexilin-deficient oocytes
appeared to have normal ROCK localization. Despite having normal ROCK localization,
nexilin-deficient oocytes have reduced levels of pLIMK1/2, a downstream effector
molecule of ROCK. Mouse oocytes treated with a LIMK inhibitor have reduced pCofilin
(Li et al., 2016), which is similar to the reduced pLIMK1/2 and resulting reduced pCofilin
observed in nexilin-deficient oocytes (Figure 4.3; Figure 4.4). In contrast to other studies
that assessed pCofilin levels in ROCK-inhibited oocytes (Duan et al., 2014; Zhang et al.,
2014; Lee et al., 2015), this group is the first to show that inhibition of LIMK results in
reduced pCofilin in mouse oocytes (Li et al., 2016). This suggests that nexilin functions
to bring ROCK and LIMK1/2 together within the oocyte, enabling the phosphorylation
and activation of LIMK1/2.
Based on the fact that the knockdown of LIMK1 destabilizes cortical actin
organization in mitotic cells (Kaji et al., 2008), the changes in actin localization observed
in nexilin-deficient oocytes may be a result of the reduced pLIMK1/2 levels compared to
control metaphase I oocytes. LIMK’s substrate is cofilin, which when phosphorylated is
inactive. Since there is less pCofilin, then hypothetically there is more active cofilin, in
nexilin-deficient oocytes compared to control metaphase I oocytes. An increased
224
amount of actin-severing by cofilin may explain the actin cloud aggregate surrounding
the DNA in nexilin-deficient oocytes (Figure 4.2C, D, I, J), such that increased actin
depolymerization by cofilin results in a disrupted cytoplasmic actin meshwork. Based on
a previous study (Jang et al., 2014), the difference in pCofilin observed in nexilindeficient oocytes is likely also affecting the cortical actin. Mouse oocytes overexpressing
a constitutively active form of cofilin resulted in a significant decrease in cortical actin
compared to control oocytes (Jang et al., 2014). Therefore, there cortical actin may be
decreased in nexilin-deficient oocytes, thus hindering the ability of the spindle to be
recruited by the cortical actin network, which requires a thickening of cortical actin
(Chaigne et al., 2013; Chaigne et al., 2015).
We hypothesized that the phosphorylation status of cofilin is important for
metaphase I spindle positioning, based on our result showing that nexilin-deficient
oocytes that fail to position the spindle adjacent to the cortex have reduced pCofilin
compared to metaphase I oocytes. We proposed that the injection of cRNA encoding a
phospho-mimetic form of cofilin (cofilin-S3E) would counteract the reduced pCofilin
levels in nexilin-deficient oocytes, and thus rescue the spindle-positioning defect.
Surprisingly, control oocytes injected with cofilin S3E cRNA had an interesting
phenotype of its own. Cofilin-S3E interferes with the ability of the spindle to reach the
cortex, whereas control oocytes injected with water or a different cRNA have a spindle
positioned at the cortex at metaphase I. While cofilin-S3E was insufficient to rescue the
spindle-positioning defect in nexilin-deficient oocyte, this exciting result that the
expression of cofilin-S3E hinders normal translocation of the spindle to the cortex
highlights the significance of the regulation of phosphorylated cofilin throughout meiotic
maturation. This experiment suggests that actin depolymerization mediated by cofilin is
required for normal spindle positioning, and thus the introduction of excess inactive
cofilin hinders normal meiotic progression.
225
In addition to spindle positioning defects, a subset of nexilin-deficient oocytes
does not form a spindle as seen by the mis-localization of γ-tubulin, a protein known to
interact with nexilin (Hutchins et al. 2010). Co-immunoprecipitation experiments also
show that γ-tubulin interacts with pLIMK1 in mouse oocytes (Li et al., 2016). Following
LIMK1 inhibition, γ-tubulin localization was lost and spindle organization was disrupted
(Li et al., 2016), which is similar to what we observe in nexilin-deficient oocytes with
reduced pLIMK1/2. Putting this together with our data, we propose that spindle
organization defects observed in nexilin-deficient oocytes are a result of (1) the inability
of γ-tubulin to bind to nexilin, and (2) less pLIMK1 for γ-tubulin to bind in nexilin-deficient
oocytes. It is already known that nexilin interacts with γ-tubulin (Hutchins et al., 2010),
but future studies could determine in if there is an interaction between nexilin and
LIMK1/2.
The work presented here is the first to characterize nexilin in mouse oocytes, and
identified nexilin as a new candidate that functions in spindle organization and spindle
positioning at metaphase I. Proteins implicated in spindle organization and positioning
are mislocalized in in nexilin-deficient oocytes, including γ-tubulin, actin, and pMRLC.
Spindle positioning is mediated by pLIMK1/2 and pCofilin in mammalian oocytes (Duan
et al., 2014; Zhang et al., 2014; Lee et al., 2015), and both proteins are reduced in
nexilin-deficient oocytes. Furthermore, we show evidence that the expression of a
phospho-mimetic form of cofilin prevents spindle translocation in control oocytes at
metaphase I. It has been estimated that 8.6% to 15.2% of all infertility patients produce
at least one meiotically incompetent oocyte, classified as unable to progress to
metaphase II arrest, such as observed in nexilin-deficient oocytes (Bar-Ami et al., 1994;
Avrech et al., 1997). The identification of nexilin as a protein that mediates spindle
positioning during metaphase I provides insight into the regulation of the asymmetric
meiotic divisions that could prove beneficial to reproductive health.
226
VI. REFERENCES
Aherrahrou Z, Schlossarek S, Stoelting S, Klinger M, Geertz B, Weinberger F, Kessler T,
Aherrahrou R, Moreth K, Bekeredjian R, Hrabě de Angelis M, Just S, Rottbauer
W, Eschenhagen T, Schunkert H, Carrier L, and Erdmann J. “Knock-out of
nexilin in mice leads to dilated cardiomyopathy and endomyocardial
fibroelastosis.” Basic Research in Cardiology 111 (2016): 6.
Amano T, Kaji N, Ohashi K, and Mizuno K. “Mitosis-specific activation of LIM motifcontaining protein kinase and roles of cofilin phosphorylation and
dephosphorylation in mitosis.” Journal of Biological Chemistry 277 (2002):
22093-22102.
Arber S, Barbayannis FA, Hanser H, Schneider C, Stanyon CA, Bernard O, and Caroni
P. “Regulation of actin dynamics through phosphorylation of cofilin by LIMkinase.” Nature 393 (1998): 805-809.
Avrech OM, Goldman GA, Rufas O, Stein A, Amit S, Yoles I, Pinkas H, and Fisch B.
“Treatment variables in relation to oocyte maturation: lessons from a clinical
micromanipulation-assisted in vitro fertilization program.” Journal of Assisted
Reproduction and Genetics 14 (1997): 337-342.
Azoury J, Lee KW, Georget V, Rassinier P, Leader B, and Verlhac MH. “Spindle
positioning in mouse oocytes relies on a dynamic meshwork of actin filaments.”
Current Biology 18 (2008): 1514-1519.
Azoury J, Lee KW, Georget V, Hikal P, and Verlhac MH. “Symmetry breaking in mouse
oocytes requires transient F-actin meshwork destabilization.” Development 138
(2011): 2903-2908.
Bar-Ami S, Zlotkin E, Brandes JM, and Itskovitz-Eldor J. “Failure of meiotic competence
in human oocytes.” Biology of Reproduction 50 (1994): 1100-1107.
227
Brunet S, Maria AS, Guillaud P, Dujardin D, Kubiak JZ, and Maro B. “Kinetochore fibers
are not involved in the formation of the first meiotic spindle in mouse oocytes, but
control the exit from the first meiotic M phase.” Journal of Cell Biology 146
(1999): 1-12.
Brunet S, and Verlhac MH. “Positioning to get out of meiosis: the asymmetry of division.”
Human Reproduction Update 17 (2011): 68-75.
Chaigne A, Campillo C, Gov NS, Voituriez R, Azoury J, Umaña-Diaz C, Almonacid M,
Queguiner I, Nassoy P, Sykes C, Verlhac MH, and Terret ME. “A soft cortex is
essential for asymmetric spindle positioning in mouse oocytes.” Nature Cell
Biology 15 (2013): 958-966.
Chaigne A, Campillo C, Gov NS, Voituriez R, Sykes C, Verlhac MH, and Terret ME. “A
narrow window of cortical tension guides asymmetric spindle positioning in the
mouse oocyte.” Nature Communications 6 (2015): 6027.
Cho WK, Stern S, and Biggers JD. “Inhibitory effect of dibutyryl cAMP on mouse oocyte
maturation in vitro.” Journal of Experimental Zoology 187 (1974): 383-386.
Deng M, Suraneni P, Schultz RM, Li R. “The Ran GTPase mediates chromatin signaling
to control cortical polarity during polar body extrusion in mouse oocytes.”
Developmental Cell 12 (2007): 301-308.
Duan X, Liu J, Dai XX, Liu HL, Cui XS, Kim NH, Wang ZB, Wang Q, and Sun SC. “RhoGTPase effector ROCK phosphorylates cofilin in actin-meditated cytokinesis
during mouse oocyte meiosis.” Biology of Reproduction 90 (2014): 3.
Dumont J, Million K, Sunderland K, Rassinier P, Lim H, Leader B, and Verlhac MH.
“Formin-2 is required for spindle migration and for the late steps of cytokinesis in
mouse oocytes.” Developmental Biology 301 (2007): 254-265.
228
Garvalov BK, Flynn KC, Neukirchen D, Meyn L, Teusch N, Wu X, Brakebusch C,
Bamburg JR, and Bradke F. “Cdc42 regulates cofilin during the establishment of
neuronal polarity.” Journal of Neuroscience 27 (2007): 13117-131129.
Hassel D, Dahme T, Erdmann J, Meder B, Huge A, Stoll M, Just S, Hess A, Ehlermann
P, Weichenhan D, Grimmler M, Liptau H, Hetzer R, Regitz-Zagrosek V, Fischer
C, Nürnberg P, Schunkert H, Katus HA, and Rottbauer W. “Nexilin mutations
destabilize cardiac Z-disks and lead to dilated cardiomyopathy.” Nature Medicine
15 (2009): 1281-1288.
Hein MY, Hubner NC, Poser I, Cox J, Nagaraj N, Toyoda Y, Gak IA, Weisswange I,
Mansfeld J, Buchholz F, Hyman AA, and Mann M. “A human interactome in three
quantitative dimensions organized by stoichiometries and abundances.” Cell 163
(2015): 712-723.
Holubcová Z, Blayney M, Elder K, and Schuh M. “Human oocytes. Error-prone
chromosome-mediated spindle assembly favors chromosome segregation
defects in human oocytes.” Science 348 (2015): 1143-1147.
Hutchins JR, Toyoda Y, Hegemann B, Poser I, Hériché JK, Sykora MM, Augsburg M,
Hudecz O, Buschhorn BA, Bulkescher J, Conrad C, Comartin D, Schleiffer A,
Sarov M, Pozniakovsky A, Slabicki MM, Schloissnig S, Steinmacher I, Leuschner
M, Ssykor A, Lawo S, Pelletier L, Stark H, Nasmyth K, Ellenberg J, Durbin R,
Buchholz F, Mechtler K, Hyman AA, and Peters JM. “Systematic analysis of
human protein complexes identifies chromosome segregation proteins.” Science
328 (2010): 593-599.
Igarashi H, Knott JG, Schultz RM, Williams CJ. “Alterations of PLCbeta1 in mouse eggs
change calcium oscillatory behavior following fertilization.” Developmental
Biology 312 (2007): 321-330.
229
Jang W, Jo YJ, Kim HC, Jia JL, Namgoong S, Kim NH. “Non-muscle tropomyosin
(Tpm3) is crucial for asymmetric cell division and maintenance of cortical integrity
in mouse oocytes.” Cell Cycle 13 (2014): 2359-2369.
Jiang N, Jenson-Hjorth K, Hekmat O, Iglesias-Gato D, Kruse T, Wang C, Wei W, Ke B,
Yan B, Niu Y, Olsen JV, and Flores-Morales A. “In vivo quantitative
phosphoproteomic profiling identifies novel regulators of castration-resistant
prostate cancer growth.” Oncogene 2014: 1-13.
Kaji N, Muramoto A, and Mizuno K. “LIM Kinase-mediated Cofilin Phosphorylation during
Mitosis Is Required for Precise Spindle Positioning.” Journal of Biological
Chemistry 283 (2008): 4983-4992.
Kalab P, Kubiak JZ, Verlhac MH, Colledge WH, and Maro B. “Activation of p90rsk during
meiotic maturation and first mitosis in mouse oocytes and eggs: MAP kinaseindependent and -dependent activation.” Development 122 (1996): 1957-1964.
Katoh K, Kano Y, Amano M, Onishi H, Kaibuchi K, and Fujiwara K. “Rho- kinase–
mediated contraction of isolated stress fibers.” Journal of Cell Biology 153
(2001): 569-584.
Leader B, Lim H, Carabatsos MJ, Harrington A, Ecsedy J, Pellman D, Maas R, and
Leder P. “Formin-2, polyploidy, hypofertility and positioning of the meiotic spindle
in mouse oocytes.” Nature Cell Biology 4 (2002): 921-928.
Lee A, Hakuno F, Northcott P, Pessin JE, and Rozakis Adcock M. “Nexilin, a
cardiomyopathy-associated F-actin binding protein, binds and regulates IRS1
signaling in skeletal muscle cells.” PLoS One 8 (2013): e55634.
Lee SR, Xu YN, Jo YJ, Namgoong S, and Kim NH. “The Rho-GTPase effector ROCK
regulates meiotic maturation of the bovine oocyte via myosin light chain
phosphorylation and cofilin phosphorylation.” Molecular Reproduction and
Development 82 (2015): 849-58.
230
Li H, Guo F, Rubinstein B, and Li R. “Actin-driven chromosomal motility leads to
symmetry breaking in mammalian meiotic oocytes.” Nature Cell Biology 10
(2008): 1301-1308.
Li X, Zhu Y, Cao Y, Wang Q, Du J, Tian J, Liang Y, and Ma W. “LIM kinase activity is
required for microtubule organising centre positioning in mouse oocyte meiosis.”
Reproduction, Fertility, and Development (2016).
Maekawa M, Ishizaki T, Boku S, Watanabe N, Fujita A, Iwamatsu A, Obinata T, Ohashi
K, Mizuno K, and Narumiya S. “Signaling from Rho to the actin cytoskeleton
through protein kinases ROCK and LIM-kinase.” Science 284 (1999): 895-898.
Mori M, Monnier N, Daigle N, Bathe M, Ellenberg J, and Lénárt P. “Intracellular transport
by an anchored homogeneously contracting F-actin meshwork.” Current Biology
21 (2011): 606-611.
Mouse Gene Atlas Nexilin. Available from http://biogps.gnf.org
Ohtsuka T, Nakanishi H, Ikeda W, Satoh A, Momose Y, Nishioka H, and Takai Y.
“Nexilin: a novel actin filament-binding protein localized at cell-matrix adherens
junction.” Journal of Cell Biology 143 (1998): 1227-1238.
Pfender S, Kuznetsov V, Pleiser S, Kerkhoff E, and Schuh M. “Spire-type actin
nucleators cooperate with Formin-2 to drive asymmetric oocyte division.” Current
Biology 21 (2011): 955-960.
Piekny AJ, and Glotzer M. “Anillin is a scaffold protein that links RhoA, actin, and myosin
during cytokinesis.” Current Biology 18 (2008): 30-36.
Sardet C, Prodon F, Dumollard R, Chang P, and Chênevert J. “Structure and function of
the egg cortex from oogenesis through fertilization.” Developmental Biology 241
(2002): 1-23.
231
Schmandke A, Schmandke A, and Strittmatter SM. “ROCK and Rho: biochemistry and
neuronal functions of Rho-associated protein kinases.” Neuroscientist 13 (2007):
454-469.
Schuh M, and Ellenberg J.” A new model for asymmetric spindle positioning in mouse
oocytes.” Current Biology 18 (2008): 1986-1992.
Simerly C, Nowak G, de Lanerolle P, and Schatten G. “Differential expression and
functions of cortical myosin IIA and IIB isotypes during meiotic maturation,
fertilization, and mitosis in mouse oocytes and embryos.” Molecular Biology of
the Cell 9 (1998): 2509-2525.
Verlhac MH, Kubiak JZ, Weber M, Géraud G, Colledge WH, Evans MJ, and Maro B.
“Mos is required for MAP kinase activation and is involved in microtubule
organization during meiotic maturation in the mouse.” Development 122 (1996):
815-822.
Verlhac MH, Lefebvre C, Guillaud P, Rassinier P, and Maro B. “Asymmetric division in
mouse oocytes: with or without Mos.” Current Biology 10 (2000): 1303-1306.
Watanabe N, Kato T, Fujita A, Ishizaki T, and Narumiya S. “Cooperation between mDia1
and ROCK in Rho-induced actin reorganization.” Nature Cell Biology 1 (1999):
136-143.
Whitten WK. “Nutrient requirements for the culture of preimplantation embryos in vitro.”
Advances in the Biosciences 6 (1971): 129-129.
Yang N, Higuchi O, Ohashi K, Nagata K, Wada A, Kangawa K, Nishida E, and Mizuno K.
“Cofilin phosphorylation by LIM-kinase 1 and its role in Rac-mediated actin
reorganization.” Nature 393 (1998): 809-812.
Yi K, Unruh JR, Deng M, Slaughter BD, Rubinstein B, and Li R. “Dynamic maintenance
of asymmetric meiotic spindle position through ARP2/3- complex-driven
232
cytoplasmic streaming in mouse oocytes.” Nature Cell Biology 13 (2011): 12511258.
Zhang Y, Duan X, Xiong B, Cui XS, Kim NH, Rui R, and SC Sun. “ROCK inhibitor Y27632 prevents porcine oocyte maturation.” Theriogenology 82 (2014): 49-56.
233
Table 4.1
Primer sequences for cloning pEGFP-N1 human cofilin S3E into pIVT vector
Description
Forward primer for cloning
pEGFP-N1 human cofilin
S3E; includes Pst1 site
Reverse primer for cloning
pEGFP-N1 human cofilin
S3E; includes Kpn1 site
Sequence (5’ 3’)
5’TAAGCACTGCAGATGGCCGAAGGTGTGGCTGTCTCTG3’
5’TGCTTAGGTACCCGCGGCCGCTTTACTTGTACAGCTC 3’
234
Figure 4.1
Nexilin localization throughout meiotic maturation in wild-type oocytes and
assessment of nexilin following siRNA-mediated knockdown.
(A-C) Nexilin localization was detected by immunofluorescence in oocytes at prophase I,
metaphase I, and metaphase II, with nexilin labeled in green, and DNA labeled in blue.
Scale bar in Panel A= 10 μm. (D) Oocytes injected with 40 μM Nexn-targeting siRNA
have 67 ± 1.5% knockdown at the transcript level (lane 2) at 48 h following injection
compared to oocytes injected with 40 μM control siRNA (lane 1). (E) Primers directed to
tissue plasminogen activator (Plat) were used as a loading control for Nexn-targeting
siRNA-injected oocytes (lane 2) and control siRNA-injected oocytes (lane 1). (F) Nexilin
protein knockdown was assessed by immunoblotting of oocyte lysates (14 oocytes per
lane = 875 ng) prepared 48 h after injection with either 40 μM negative control siRNA
(lane 1) or 40 µM Nexn-targeting siRNA (lane 2). Uterus lysate (33.3 μg) used as a
positive control (lane 3). One representative blot was shown; this experiment was
repeated 5 times. Nexn-targeting siRNA-injected oocytes had 72 ± 3.4% knockdown as
compared to control oocytes. (G-H) Nexilin protein knockdown was assessed at the
single-cell level by immunofluorescence. Control siRNA-injected oocytes had a strong
nexilin signal (green) around the cortex. DNA was labeled in blue; (I-J) Oocytes injected
with Nexn-targeting siRNA had undetectable fluorescent nexilin signal around cortex.
Scale bar in Panel E = 10 μm. (K) Line-scan analysis around the circumference of the
cortical region to assess relative intensities of the Nexilin cortical signal in control siRNAinjected and Nexn-targeting siRNA-injected prophase I oocytes.
235
Merge
NexnControl targeting
siRNA siRNA
Nexilin
primers
1
E
Nexilin
G
H
I
J
2
NexnControl targeting
siRNA siRNA
1
DNA
Control
siRNA
Prophase I
Metaphase I
C
Nexilin
2
Control
(Plat)
primers
Nexntargeting
siRNA
D
B
Metaphase II
Merge
A
Nexilin DNA
1
2
α-nexilin
Uterus
lysate
33.3 μg
3
Intensity (A.U.)
F
NexnControl targeting
siRNA siRNA
K 100
75
50
25
0
0
50
100 150 200
Distance (µm)
Control siRNA
Nexn-targeting siRNA
Nexn-targeting
siRNA
236
250
Figure 4.2
Phenotypes observed in nexilin-deficient oocytes at 8- or 16 h following exit from
prophase I arrest.
(A-F) Fluorescence microscopy showed the localization of DNA (blue), α-tubulin
(green), and actin (red) in control siRNA-injected oocytes and Nexn-targeting siRNAinjected oocytes at 8 h following exit from prophase I arrest. Scale bar in Panel A = 10
μm. (G-J) Fluorescence microscopy showed the localization of DNA (blue), and actin
(gray) in control siRNA-injected oocytes and Nexn-targeting siRNA-injected oocytes at 8
h following exit from prophase I arrest. Scale bar in Panel G = 10 μm. Actin was
concentrated to the region of the cortex overlying the DNA in control siRNA-injected
metaphase I oocytes (e.g. Panels G, H). Actin localizes primarily in a cloud-like cluster
around the DNA that was greater than 10 μm from the cortex in Nexn-targeting siRNAinjected metaphase I oocytes (e.g. Panels I, J). Each oocyte was scored for DNA
localization based on the proximity of the DNA to the cortex. A measurement of 10 μm
or less was scored as DNA at cortex (e.g., Panels B, G, H), and greater than 10 μm was
scored as DNA not at cortex (e.g., Panels A, D, E). DNA that localized to the center of
the oocyte and underwent condensation but was not yet clustered or aligned was scored
as condensing DNA/not aligned (e.g., Panel C). An oocyte that underwent abnormal
cytokinesis was scored as such (e.g., Panel F). (K) Frequency distributions of the
different phenotypes observed in control siRNA-injected oocytes and Nexn-targeting
siRNA-injected oocytes at 8 h following exit from prophase I arrest. There was a
statistically significant difference between the two groups (χ 2 analysis, p < 0.0001). (LN) Immunofluorescence was used to show the localization of DNA (blue), nexilin (green),
and actin (red) in control siRNA-injected and Nexn-targeting siRNA-injected oocytes at
16 h following exit from prophase I arrest. Each oocyte was scored for DNA and spindle
localization based on the proximity of the DNA to the cortex. An oocyte was scored as
237
MII if the DNA was 10 μm or less from the cortex and polar body emission occurred
(e.g., Panel L). An oocyte was scored as spindle not at cortex if DNA is greater than 10
μm from the cortex (e.g., Panel N). DNA that localized to the center of the oocyte and
underwent condensation but was not yet clustered or aligned was scored as Condensing
DNA/No spindle. Condensed DNA that clustered but did not align and did not form a
spindle was scored as Clustered DNA/No spindle (e.g. Panel M). (O) Frequency
distributions of the different phenotypes observed in control siRNA-injected oocytes and
Nexn-targeting siRNA-injected oocytes at 16 h following exit from prophase I arrest.
There was a statistically significant difference between the two groups (χ 2 analysis, p <
0.0001).
238
16 hours
following start of maturation
8 hours
following start of maturation
B
C
D
E
F
Nexntargeting
siRNA
Control
siRNA
Actin α-tubulin DNA
G
O
100%
60%
J
I
35/46
21/51
40%
20%
0%
3/46
8/46
Control
c
siRNA
Metaphase II
61/195
60%
120/195
20%
14/195
Control
C
siRNA
21/159
9/51
4/51
Nexnn
targeting
siRNA
Spindle not at cortex
Clustered DNA/No spindle
Spindle
Condensing DNA/No spindle
104/159
32/159 2/159
NexnN
targeting
siRNA
DNA at cortex
DNA not at cortex
Condensing
DNA/notspindle
aligned
DNA not aligned/No
Abnormal Cytokinesis
17/51
80%
100%
0%
N
H
Actin DNA
40%
PB
Actin Nexilin DNA
K
80%
L
M
Nexn-targeting siRNA
Nexn-targeting siRNA
Control
siRNA
Control
siRNA
A
239
Figure 4.3
ROCK localization appears unaffected, but pLIMK1/2 is reduced in nexilindeficient oocytes at 8 h following exit from prophase I arrest.
(A-D) Immunofluorescence was used to show ROCK localization in control siRNAinjected and Nexn-targeting siRNA-injected oocytes cultured for 8 h into in vitro
maturation, when control oocytes reached metaphase I. Scale bar in Panel A = 10 μm.
(E-H) Immunofluorescence was used to show nexilin localization in oocytes treated with
0.5% DMSO or 50 µm Y-27632 for 8 h, when solvent control-treated oocytes reached
metaphase I. Scale bar in Panel A = 10 μm. (I) Representative anti-pLIMK1/2
immunoblot, with oocytes injected with negative control siRNA (lane 1) or Nexn-targeting
siRNA (lane 2), cultured for 8 h into in vitro maturation, when control oocytes reached
metaphase I (22 oocytes per lane). This immunoblot was repeated three times. (J)
Representative anti-LIMK2 immunoblot, with oocytes injected with negative control
siRNA (lane 1) or Nexn-targeting siRNA (lane 2), cultured for 8 h into in vitro maturation,
when control oocytes reached metaphase I (20 oocytes per lane). This immunoblot was
repeated twice. (K-N) Immunofluorescence was used to show pLIMK1/2 localization
(green) in control siRNA-injected and Nexn-targeting siRNA-injected oocytes cultured for
8 h into in vitro maturation, when control oocytes reached metaphase I. Arrowheads
denote pLIMK1/2 localization at the spindle poles. Scale bar in Panel G = 10 μm.
240
B
C
D
Nexntargeting
siRNA
Control
siRNA
A
ROCK DNA
F
G
H
Y-27632
DMSO
E
Nexilin DNA
α-pLIMK1/2
1
J
L
M
N
2
NexnControl targeting
siRNA siRNA
α-LIMK2
1
K
Nexntargeting
siRNA
I
Control
siRNA
NexnControl targeting
siRNA siRNA
2
pLIMK1/2 DNA
241
Figure 4.4
Nexilin-deficient oocytes have less pCofilin at 8 h following exit from prophase I
arrest.
(A) Representative anti-pCofilin immunoblot, with prophase I oocytes (lane 1) or
metaphase I oocytes (lane 2) (18 oocytes per lane). Quantification of band intensities of
anti-pCofilin levels. Values were normalized to prophase I oocytes. (B) Representative
anti-pCofilin immunoblot (repeated two times), with prophase I oocytes injected with
negative control siRNA (lane 1) or Nexn-targeting siRNA (lane 2) (18 oocytes per lane).
Quantification of band intensities of anti-pCofilin levels. Values were normalized to
prophase I oocytes injected with negative control siRNA. (C) Representative antipCofilin immunoblot, with oocytes injected with negative control siRNA (lane 1) or Nexntargeting siRNA (lane 2), cultured for 8 h into in vitro maturation, when control oocytes
reached metaphase I (22 oocytes per lane). Quantification of band intensities of antipCofilin levels. Values were normalized to oocytes injected with negative control siRNA.
(D) Representative anti-MAPK3/1 immunoblot, with oocytes injected with negative
control siRNA (lane 1) or Nexn-targeting siRNA (lane 2), cultured for 8 h into in vitro
maturation, when control oocytes reached metaphase I (22 oocytes per lane). Each
immunoblot experimental series was repeated 3-5 times. (E-H) Immunofluorescence
was used to show pCofilin localization (green) in control siRNA-injected and Nexntargeting siRNA-injected oocytes cultured for 8 h into in vitro maturation, when control
oocytes reached metaphase I. Asterisks denote pCofilin localization to the spindle.
Scale bar in Panel E = 10 μm. (I-L) Immunofluorescence was used to cofilin localization
in control siRNA-injected and Nexn-targeting siRNA-injected oocytes cultured for 8 h into
in vitro maturation, when control oocytes reached metaphase I. Scale bar in Panel I =
10 μm.
242
1.0
0.8
WT WT
Pro I Met I
0.6
0.4
α-pCofilin
A
0.2
1
2
0.0
Pro I
1.2
1.0
0.8
0.6
0.4
0.2
0.0
NexnControl targeting
siRNA siRNA
Pro I
Pro I
B
α-pCofilin
1
2
NexnControl targeting
siRNA siRNA
1.0
Control
Nexn-
Control
siRNA
Nexntargeting
siRNA
Control Pro Nexn Pro I
siRNA
targeting
I
siRNA
0.8
0.6
α-pCofilin
C
Met I
0.4
D
0.0
2
F
E
*
*
G
H
Nexn-targeting
Control siRNA
siRNA
1
Nexn-targeting
Control siRNA
siRNA
0.2
α-MAPK
pCofilin DNA
I
J
K
L
Cofilin DNA
243
Figure 4.5
Injection of cRNA encoding human cofilin-S3E disrupts spindle translocation to
the cortex.
(A and C) Immunofluorescence was used to show the localization of cofilin in control
siRNA-injected and Nexn-targeting siRNA-injected oocytes at 8 h following exit from
prophase I arrest. Scale bar in Panel A = 10 μm. (B and D) A subset of control siRNAinjected oocytes and Nexn-targeting siRNA-injected oocytes were injected with 2µg/µl
cRNA encoding cofilin-S3E prior to the start of meiotic maturation. Each oocyte was
scored for DNA localization based on the proximity of the DNA to the cortex. A
measurement of 10 μm or less was scored as DNA at cortex (e.g., Panel A), and greater
than 10 μm was scored as DNA not at cortex (e.g., Panel B, C, D). An oocyte that
underwent abnormal cytokinesis was scored as such. (E) Frequency distributions of the
different phenotypes observed in oocytes injected with: control siRNA, control siRNA +
water, control siRNA + cofilin-S3E cRNA, Nexn-targeting siRNA, Nexn-targeting siRNA +
water, Nexn-targeting siRNA + cofilin-S3E cRNA. There was a statistically significant
difference between oocytes injected with (1) control siRNA versus control siRNA +
cofilin-S3E cRNA, (2) control siRNA + water versus control siRNA + cofilin-S3E cRNA,
(3) control siRNA + Nexn-targeting siRNA, (4) control siRNA + water versus Nexntargeting siRNA + water (χ 2 analysis, p < 0.0001). (F) A subset of control siRNA-injected
and Nexn-targeting siRNA-injected were injected with RNA encoding GFP-UtrCH (an
actin probe), to observe the effects that a different transcription product had on DNA
localization. The injection of a different RNA did not affect ability of the spindle to
translocate to the cortex in control oocytes.
244
Control siRNA
+ Cofilin S3E
cRNA
Control
siRNA
B
A
Nexn-targeting
siRNA + Cofilin
S3E cRNA
Nexntargeting
siRNA
D
C
Cofilin DNA
E
100%
1/13
7/31
4/18
Abnormal cytokinesis
80%
40/46
60%
24/31
40%
17/18
38/42
DNA not at cortex
11/13
14/18
DNA at cortex
20%
0%
F
6/46
Control
Neg
siRNA
100%
1/18
4/42
3/16
80%
60%
1/13
Control Control Nexn- NexnNexnNeg
+ targeting
Nexn Nexn
+ Nexn
+
siRNA+ Neg
targeting
targeting
siRNA
water
cofilin
+
siRNA Cofilin
siRNA
siRNA water
+
Water Cofilin S3E
+
+
Water Cofilin S3E
cRNA
cRNA
16/21
6/8
5/5
40%
DNA at cortex
13/16
20%
2/8
5/21
0%
Control
Neg
siRNA
Nexn-+
Neg + NexnNexn Nexn
Control
targeting targeting
siRNA
UtrCH siRNA
UtrCH
siRNA
+
+
GFP-UtrCH
GFP-UtrCH
RNA
RNA
245
DNA not at cortex
Figure 4.6
Localizations of γ-tubulin, anillin, and phosphorylated myosin regulatory light
chain (pMRLC) in nexilin-deficient oocytes.
A) Immunofluorescence was used to show localization of γ-tubulin (green) at the spindle
poles in control siRNA-injected metaphase I oocytes. Oocyte DNA was labeled in blue.
(B-D) Nexn-targeting siRNA-injected metaphase I oocytes had various γ-tubulin
localizations (see text for more details). Scale bar in Panel A = 10 μm. (E-F)
Immunofluorescence shows anillin (green) localization in control siRNA-injected oocytes.
Anillin localizes to the region of the cortex overlying the chromatin if the chromatin is 10
μm or less from the cortex (e.g. Panel E), or localizes uniformly around the cortex when
the chromatin is greater than 10 μm from the cortex (e.g. Panel F). Scale bar in Panel E
= 10 μm. (G-H) Immunofluorescence shows anillin localization in Nexn-targeting siRNAinjected oocytes at 8 h following exit from prophase I arrest. The majority of oocytes
have anillin localized around the chromatin, or to the chromatin (e.g. Panels G and H).
(I-J) Immunofluorescence showed pMRLC (green) localized to spindle poles on either
side of the aligned chromosomes in control siRNA-injected metaphase I oocytes. Scale
bar in Panel I = 10 μm. (K-L) In Nexn-targeting siRNA-injected metaphase I oocytes,
pMRLC was not detected at the spindle poles.
246
Nexn-targeting siRNA
Control siRNA
A
B
C
D
Control siRNA
E
F
Nexn- targeting
siRNA
γ-tubulin DNA
G
H
Nexn- targeting
siRNA
Control siRNA
Anillin DNA
I
J
K
L
pMRLC DNA
247
C
Figure 4.7
PAK4 localization is unaffected in nexilin-deficient oocytes, and PAK inhibition
does not affect nexilin-localization.
(A-B) Immunofluorescence showed PAK4 (green) localized to the cortex in control
siRNA-injected metaphase I oocytes. Scale bar in Panel A = 10 μm. (C-D) In Nexntargeting siRNA-injected metaphase I oocytes, PAK4 localized to the cortex, similar to
control siRNA-injected oocytes. (E-F) In metaphase I oocytes treated with 0.005%
DMSO for 8 h following exit from prophase I arrest, immunofluorescence showed nexilin
(green) localized to the spindle and to the region of the cortex overlying the DNA (blue)
(Panel E), or uniformly around the cortex (Panel F). Scale bar in Panel E = 10 μm. (GH) Oocytes treated with 0.25 µm PF-3758309 for 8 h following exit from prophase I
arrest had nexilin localized to the spindle and to the region of the cortex overlying the
DNA (Panel G) or uniformly around the cortex (Panel H).
248
PF-3758309
DMSO
Nexntargeting
siRNA
Control
siRNA
A
B
C
D
PAK4 DNA
E
F
G
H
Nexilin DNA
249
CHAPTER 5
Discussion
The work presented in this thesis extends the current understanding of proteins
required for the successful progression through meiosis I and II. Until now, neither
IQGAP3 nor nexilin has been characterized in mouse oocytes. This work identified the
function of nexilin (Chapter 4) in spindle organization and the function of nexilin and
IQGAP3 (Chapter 3) in the molecular coordination of spindle positioning at metaphase I.
The site of cytokinesis is dictated by the position of the spindle, thus it is crucial that the
spindle is positioned asymmetrically prior to division. Oocytes that fail to undergo
asymmetric division have reduced reproductive success (Leader et al., 2002; Chaigne et
al., 2013; Colledge et al., 1994; Verlhac et al., 2000; Hashimoto et al., 1994). At
metaphase II, MAPK3/1 and MLCK function to anchor the metaphase II spindle near the
cortex and maintain metaphase II arrest (Chapter 2). Metaphase II eggs with inhibited
MAPK3/1and MLCK activity mimic the phenotypes observed in eggs that remain in the
oviduct for an extended period of time without being fertilized, known as post-ovulatory
aged eggs. The broader implications of Chapters 3 and 4 are discussed in section IV.B,
and the broader implications of Chapter 2 are discussed in section IV.D.
IV.A Meiosis I
Female meiosis requires unique temporal and spatial regulation compared to
mitosis. Due to the large size of the oocyte, smaller domains within the cell likely
coordinate the recruitment of signaling proteins to the correct localization at the
appropriate time to ensure cell cycle progression. Data presented here suggest that
IQGAP3 and nexilin regulate the localization of key signaling molecules at metaphase I.
Following GVBD, proteins required for spindle assembly must be spatially regulated.
Microtubule-organizing centers (MTOCs) are activated and recruited near the
250
chromosomes, and randomly growing MTOCs organize into a bipolar spindle in a
RanGTP-dependent manner (Brunet and Maro, 2005; Carazo-Salas et al., 1999; Kalab
et al., 1999; Dumont 2007). γ-tubulin localizes around the chromatin around the time of
GVBD, and eventually translocates to the poles of the metaphase I spindle, thus aiding
in spindle formation (Lee et al., 2000; Sanfins et al., 2004). Preliminary data suggests
an interaction between γ-tubulin and nexilin (Hutchins et al, 2010), and we propose that
this interaction mediates spindle assembly in oocytes. Nexilin-deficient oocytes exhibit a
range of spindle defects that are identified by γ-tubulin mislocalization (Figure 4.6).
Surprisingly, some nexilin-deficient oocytes appear to have healthy spindles based on
α/β-tubulin labeling, however upon further inspection γ-tubulin is mislocalized at the
spindle poles. Normal γ-tubulin localization is lost and spindle organization is disrupted
in mouse oocytes with inhibited LIMK1 activity (Li et al., 2016). Both of these
phenotypes are observed in nexilin-deficient oocytes that also have reduced pLIMK1/2
(Figure 4.3; Figure 4.6). Putting this in context with our data, spindle formation may be
disrupted in nexilin-deficient oocytes as a result of (1) the inability of γ-tubulin to bind to
nexilin, and (2) reduced pLIMK1 for γ-tubulin to bind.
Following spindle assembly, the oocyte requires accurate spatial and temporal
regulation for the positioning of the spindle near the cortex. Spindle movement is
generated by two forces: (1) the polymerization of cytoplasmic actin filaments pushing
the spindle from behind, and (2) the pulling on cytoplasmic and cortical actin filaments by
pole-localized myosin-II (Schuh and Ellenberg, 2008; Simerly et al., 1998; Li et al., 2008;
Chaigne et al., 2013; Chaigne et al., 2015). Both actin and myosin-II are mislocalized in
nexilin- and IQGAP3-deficient oocytes that fail to position the metaphase I spindle near
the cortex (Figure 3.2; Figure 4.2). The spindle initially translocates across a
cytoplasmic actin network that is regulated by the straight actin nucleator Formin-2
(Fmn2), and its interacting protein Spire1/2 (Azoury et al., 2008; Azoury et al., 2011;
251
Dumont et al., 2007; Holubcova et al., 2013; Leader et al., 2002; Li et al., 2008; Pfender
et al., 2011; Schuh and Ellenberg, 2008). A symmetric actin cloud surrounds the central
spindle shortly after GVBD, and the distribution of the actin cloud becomes asymmetric
as the spindle begins to translocate towards the cortex (Figure 1.4). This is termed a
symmetry-breaking event (Li et al., 2008). A subset of nexilin- and IQGAP3-deficient
oocytes has a symmetric actin cloud (Figure 3.2; Figure 4.2), suggesting that nexilin and
IQGAP3 contain Fmn2, since Fmn2-/- oocytes fail to form an actin cloud (Li et al., 2008),
and nexilin and IQGAP3 act downstream of Fmn2.
Eventually, the spindle translocates close enough to the cortex to so that the
actin filaments surrounding the spindle overlap with cortical actin filaments. Changes to
the cortical actin network at metaphase I include thickening of cortical actin and
exclusion of myosin-II from the cortex, coinciding with a softening of the cortex that is
necessary to finalize spindle recruitment (Chaigne et al., 2013; Chaigne et al., 2015).
The dynamic changes to the cortical network are regulated by Mos-MAPK3/1 activation
of Wave2 and the Arp2/3 complex (Chaigne et al., 2013; Chaigne et al., 2015). Our
work shows that IQGAP3 functions to localize MAPK3/1 to the spindle, thus mediating
the spatial regulation of the Mos-MAPK3/1 signaling cascade required for cortical actin
changes. Cortical actin thickening does not occur in mos-/- oocytes or in MEK1/2inhibited oocytes treated with U0126 (Chaigne et al., 2013; Chaigne et al., 2015), likely
explaining why mos-/- oocytes fail to position the spindle near the cortex (Verlhac et al.,
1996; Verlhac et al., 2000).
Cortical changes do not appear to occur in nexilin- and IQGAP3-deficient
oocytes, since the spindle of an IQGAP3- and nexilin-deficient oocyte is likely too far
from the cortex to generate a cortical remodeling signal (Deng et al., 2007). Metaphase
I oocytes have an enrichment of actin in the region of the cortex overlying the spindle,
however IQGAP3-deficient and nexilin-deficient oocytes have uniform cortical actin
252
localization (Figure 3.2; Figure 4.2). There is distance-dependent RanGTP-mediated
signal that emanates from the chromatin (Deng et al., 2007). If the chromatin is
localized within 20 µM of the cortex, then cortical remodeling is induced (Deng et al.,
2007). Since the spindle is positioned at a distance from the cortex in the majority of
IQGAP3- and nexilin-deficient oocytes, the distance between the chromatin and cortex is
likely too great to transmit the signal to induce cortical remodeling.
Cortical reorganization is mediated by small GTPase proteins such as Cdc42 and
Rac1, which localize to the metaphase I spindle and is required for cytokinesis in female
meiosis (Bielak-Zmijewska et al., 2008; Zhang et al., 2008; Leblanc et al., 2011; Wang et
al., 2013; Halet and Carroll, 2007). The regulation of Cdc42 and Rac1 activity is critical
for spindle and cortex coordination. IQGAP3- and nexilin-deficient oocytes resemble
oocytes with inhibited Cdc42 or Rac1 activity. Formation of the actin cap and polar body
emission is disrupted when Cdc42 activity is perturbed (Na and Zernicka-Goetz, 2006),
and oocytes arrest at prometaphase I when Rac1 activity is inhibited (Halet and Caroll,
2007). Based on the interactions between Cdc42 and Rac1 with IQGAP in other cell
types (Bashour et al., 1997; Brandt and Gross, 2007), the spatial regulation of Cdc42
and/or Rac1 may be interrupted in an IQGAP3-deficient oocyte.
The metaphase I spindle moves in a biphasic manner (Yi et al., 2013), and
distinguishing spindle translocation across the cytoplasmic actin or cortical actin network
can be determined by time-lapse microscopy. The first phase of spindle migration is
defined as a “confined random walk” that covers 5-10 µm at a lower rate of speed and is
mediated by Fmn2-dependent pushing of the spindle (the cytoplasmic actin network) (Yi
et al., 2013). Following an abrupt transition, the spindle travels with a straighter
trajectory and increased rate of speed in an Arp2/3-dependent second phase (the
cortical actin network) (Yi et al., 2013). Future studies could utilize this method to
253
determine what phase of the biphasic spindle movement a spindle of an IQGAP3- or
nexilin-deficient oocyte becomes arrested.
The active form of myosin-II (pMRLC), in addition to actin, is also mislocalized in
nexilin- and IQGAP3-deficient oocytes (Figure 3.3; Figure 4.6). We hypothesize that
normal pMRLC localization to the spindle is mediated by anillin, a protein known to
interact with molecules required for cytokinesis such as actin and myosin-II (Piekny and
Glotzer, 2008). The interaction between IQGAP and anillin is conserved across various
organisms and suggests a fundamental function in the cell (Eng et al., 1998; Epp et al.,
1997; Padmanabhan et al., 2011; Adachi et al., 2014). Anillin also was recently
discovered to interact with nexilin (Hein et al., 2015). IQGAP3- and nexilin-deficient
oocytes have mislocalized anillin (Figure 3.3, Figure 4.6), supporting our model that
normal anillin localization is required for pMRLC recruitment to the spindle. A similar
mislocalization of pMRLC and anillin is observed in IQGAP3-deficient HeLa cells (Adachi
et al., 2014). When pMRLC is not localized to the spindle poles, then spindle movement
is prevented (Schuh and Ellenberg, 2008; Simerly et al., 1998). This explains the failure
of the spindle to translocate to the cortex in IQGAP3- and nexilin-deficient oocytes.
IQGAP3 and nexilin both mediate positioning of the metaphase I spindle, however
appear to do so through the spatial regulation of different signaling proteins, and anillin is
a common protein between IQGAP3 and nexilin.
Myosin light chain kinase (MLCK)-dependent phosphorylation of the myosin
regulatory light chain (MRLC) is required for spindle movement, as the rate of spindle
movement was slowed in oocytes treated with the MLCK inhibitor ML-7 (Schuh and
Ellenberg, 2008). Once MRLC is localized to the spindle poles, the phosphorylation of
MRLC by MLCK can enable the force generation to propel the spindle along the actin
networks. Based on our model, IQGAP3 regulates MAPK3/1 localization to the spindle.
Once MAPK3/1 is localized to the spindle, then MAPK3/1 can activate MLCK, which can
254
then phosphorylate and activate pole-localized MRLC, resulting in spindle movement
(Schuh and Ellenberg, 2008; Simerly et al., 1998).
The ROCK-LIMK1/2-cofilin pathway has been implicated in metaphase I spindle
positioning (Duan et al., 2015; Lee et al., 2015; Zhang et al., 2014; Li et al., 2016).
Mammalian oocytes with inhibited ROCK activity have reduced pCofilin and exhibit a
similar spindle positioning defect as seen in nexilin- and IQGAP3-deficient oocytes
(Duan et al., 2015; Lee et al., 2015; Zhang et al., 2014). As a reminder, ROCK
phosphorylates LIMK1/2 (Stanyon and Bernard, 1999), and then LIMK1/2
phosphorylates its only downstream effector, cofilin (Maekawa et al., 1999) (Figure 1.3).
Phosphorylation inactivates the actin depolymerization activity of cofilin (Agnew et al.,
1995; Moriyama et al., 1996; Arber et al., 1998; Yang et al., 1998; Sumi et al., 1999).
While ROCK localization appears unaffected, pLIMK1/2 levels are reduced in nexilindeficient oocytes (Figure 4.3), suggesting that nexilin functions to enable an interaction
between ROCK and LIMK1/2.
Nexilin-deficient oocytes also have reduced pCofilin (Figure 4.4). There was no
change in pCofilin observed in IQGAP3-deficient oocytes, which further supports nexilin
and IQGAP3 mediate spindle positioning through separate mechanisms. From our work
and other studies that report oocytes with less pCofilin can not position the spindle near
the cortex (Duan et al., 2014; Lee et al., 2015; Zhang et al., 2014), we tested the
hypothesis that introducing a phospho-mimetic form of cofilin would rescue the spindle
positioning defect in nexilin-deficient oocytes. Interestingly, the expression of phosphomimetic cofilin hinders normal spindle positioning in control oocytes, highlighting the
importance of the phosphorylation status of cofilin during meiotic maturation.
IV.B Public health relevance of meiotic maturation
In assisted reproductive technology (ART) clinics, oocytes retrieved following
hormone stimulation protocols are scored based on morphology and appearance.
255
Oocytes that are not arrested at metaphase II at the time of retrieval are scored as
immature. Oocyte maturation failure can be a result of unexplained infertility (Levran et
al., 2002; Eichelaub-Ritter et al., 1995; Hartshorne et al., 1999; Harrison et al. 200;
Bergere et al., 2001; Neal et al., 2001), and 8.6% to 15.2% of infertile women produce at
least one immature oocyte (Bar-Ami et al., 1994; Avrech et al., 1997). If more than 25%
of oocytes are immature at the time of egg retrieval, there is a decreased chance of
successful fertilization resulting a clinical pregnancy (Bar-Ami et al., 1994).
An oocyte is classified as arrested at metaphase I if there is no longer an intact
germinal vesicle and no polar body. This description is similar to the morphological
appearance of an IQGAP3- or nexilin-deficient oocyte under a dissecting scope. MI
arrested oocytes could be a result of a defect in a signal transduction pathway or spindle
abnormality that would activate the spindle assembly checkpoint. Infertility or reduced
reproductive success is reported in mouse models that have oocytes that fail to progress
to metaphase II arrest (Edelmann et al., 1996; Furuya et al., 2007; Libby et al., 2002;
Madgwick et al., 2006; Solc et al., 2008; Spruck et al. 2003; Wassmann et al., 2003;
Woods et al., 1999).
Polycystic ovarian syndrome (PCOS) is a metabolic dysfunction and endocrine
disorder that affects women of reproductive age (Franks, 1995; Franks, 2008;
Knochenhauer et al., 1998; Diamanti- Kandarakis et al., 2008; Asuncio ́n et al., 2000;
Azziz, 2004; Wood et al., 2007; Toulis et al., 2009). PCOS patients yield a higher
number of oocytes following hormone stimulation protocols. Unfortunately, the oocytes
are of lower quality, show reduced fertilization and implantation rates, and higher rates of
miscarriage (Sengoku et al., 1997; Ludwig et al., 1999; Mulders et al., 2003; Heijnen et
al., 2006; Weghofer et al., 2007; Sahu et al., 2008; Boomsma et al., 2008). These
subfertile phenotypes are suggestive of impaired meiotic maturation (reviewed in Qiao
and Feng, 2011).
256
IV.C Meiosis II
Thus far, the importance of the spatial and temporal regulation of signaling
molecules required for spindle organization, spindle positioning, and cortical
reorganization at metaphase I has been discussed. Maintenance of metaphase II
spindle position and maintenance of metaphase II arrest also require precise spatial and
temporal regulation. The spindle is positioned parallel to the cortex in the spindlesequestering domain of the metaphase II rodent egg following the first meiotic division,
and it is critical that the spindle remains anchored adjacent to the cortex for the duration
of metaphase II arrest and prior to the second meiotic division. The metaphase II egg
has a mechanical polarity, such that the amicrovillar domain that sequesters the spindle
is 2.5 times more rigid than the microvillar domain to which sperm bind (Larson et al.,
2010). The rigidity of amicrovillar domain suggests an important spindle-associated
function, and perturbations to molecules that mediate cortical tension result in spindle
defects (Larson et al., 2010).
The site of the second meiotic division is dictated by the position of the spindle,
thus it is important that the spindle remains anchored adjacent to the cortex during
metaphase II arrest. Prior to this thesis work, MAPK3/1 activity was known to maintain
spindle position (Petrunewich et al., 2009). In other cell types, MAPK3/1 activates
MLCK, and then MLCK can phosphorylate MRLC to enable myosin bipolar thick filament
assembly (Klemke et al., 1997; Nguyen et al., 1999; Vicente-Manzanares et al., 2009).
Our work has shown that this pathway also functions in metaphase II eggs (Deng et al.,
2005; McGinnis et al., 2015). Oocytes with inhibited MEK1/2 or MLCK activity have
reduced pMRLC, and therefore reduced myosin II-mediated contractility (Figure 2.1). A
reduction in myosin-II mediated contractility coincides with a decrease in cortical tension
in both domains of the metaphase II egg (Figure 2.1). This decreased cortical tension
257
disrupts the ability of the amicrovillar domain to sequester the spindle, and the spindle
drifts away from the cortex (Figure 2.3).
Another important cellular event that requires spatial and temporal regulation is
the maintenance of metaphase II arrest, which is regulated by MAPK3/1 and MLCK
activity (Phillips et al., 2002; Tong et al., 2003; Petrunewich et al., 2009; McGinnis et al.,
2015). There are reports of reduced female fertility in eggs that fail to maintain
metaphase II arrest (Colledge et al., 1994; Verlhac et al., 2000; Hashimoto et al., 1994).
Eggs with inhibited MAPK3/1 and MLCK activity undergo parthenogenetic activation
following 3 h of pharmacological inhibitor treatment (Figure 2.4), with nearly all inhibitor
treated eggs having exited from metaphase II arrest by 8 h (Figure 2.6; McGinnis et al.,
2015). Exit from metaphase II arrest was determined to be dependent upon increased
intracellular calcium (Figure 2.7), and was rescued by increasing the intracellular
concentration of zinc (Figure 2.10). Our result supports previous reports that raising the
intracellular zinc concentration reduced the extent of SrCl2-induced egg activation (Kim
et al., 2011; Bernhardt et al., 2012). This thesis work has added to what is known in the
field of oocyte biology about the spatial and temporal regulation by MAPK3/1 and MLCK
in the metaphase II egg.
IV.D Public health relevance of meiosis II
Post-ovulatory ageing occurs when an ovulated egg remains in the oviduct for an
extended period of time without being fertilized. Post-ovulatory ageing is an important
public health issue because there are reports of reduced reproductive success if
fertilization is delayed for an extended time following ovulation (Blandau and Jordan,
1941; Blandau and Young, 1939; Gray et al., 1995; Guerrero and Lanctot, 1970;
Guerrero and Rojas, 1975; Miao et al., 2009, Takahashi et al., 2013; Tarin et al., 2000;
Wilcox et al., 1998). Post-ovulatory aged eggs are an example of naturally occurring
eggs with reduced MAPK3/1 activity (Xu et al., 1997). Pharmacological inhibitors were
258
used to inhibit MAPK3/1 activity in metaphase II eggs, and these eggs have some
resemblance to post-ovulatory aged eggs. Similar cytoskeletal defects that are
observed in eggs with inhibited MEK1/2 or MLCK activity are also seen in post-ovulatory
aged eggs (Dalo et al., 2008; Webb et al., 1986; Wortzman and Evans, 2005; Brunet
and Verlhac, 2011; Longo, 1974; Longo, 1980; Szollosi, 1971; Webb et al., 1986). For
instance, post-ovulatory aged eggs have reduced pMRLC (Figure 2.11) and reduced
cortical tension (Mackenzie et al., 2016) compared to young eggs. This is similar to the
reduced pMRLC levels and reduced cortical tension in eggs with inhibited MAPK3/1
activity (Figure 2.1; McGinnis et al., 2015)
Post-ovulatory aged eggs have an increased propensity to spontaneously exit
from metaphase II arrest compared to young eggs (Chebotareva et al., 2011; Goud et
al., 2005; Mailhes et al., 1998; Szollosi, 1971; Webb et al., 1986; Xu et al., 1997;
Mackenzie et al., 2016). The extent of spontaneous parthenogenetic activation
observed in post-ovulatory aged eggs is rescued by increasing the intracellular zinc
concentration, similar to the rescue of parthenogenetic activation observed in eggs with
inhibited MEK1/2 or MLCK activity (Figure 2.10; Figure 2.11; Mackenzie et al., 2016;
McGinnis et al., 2015). This thesis work provides some insight into the molecular
dysfunction in post-ovulatory aged eggs.
In an ART lab, the selection of an embryo to implant into a woman’s uterus is a
process that is constantly being optimized. The first few stages of embryogenesis are
regulated by the maternal stores within the oocyte, so embryo potential is ultimately
determined by the quality and maturation of the oocyte prior to fertilization (Mtango et al.,
2008; Stitzel et al., 2007; Li et al., 2010). Until now, various morphological factors of
human oocytes have been previously used for the prediction of oocyte quality and
implantation potential. These morphological factors include zona pellucida thickness,
259
granularity, perivitelline space, and oocyte shape (Bertrand et al., 1995; Ebner et al.,
2008; Kahraman et al., 2000; Rienzi et al., 2011; Xia et al., 1997).
Recent advances have identified mechanical parameters, including cortical
tension, of a two-pronuclear embryo are indicative of embryo potential (Yanez et al.,
2016). This objective technique would eliminate any subjectivity of the embryologist
when analyzing morphological factors to determine oocyte quality. Embryo selection
can occur up to several days following fertilization, but the ability to determine embryo
quality several hours after fertilization means less culture time in the laboratory setting
which has been shown to negatively impact embryos (Fernandez-Gonzalez et al., 2007;
Fleming et al., 2004).
The work presented in this thesis has extended our understanding of proteins
implicated in the spatial and temporal regulation of signaling molecules during meiosis I
and II. The function of nexilin and IQGAP3 in spindle organization and positioning at
metaphase I can provide clarity into mechanisms of unexplained infertility. MAPK3/1
and MLCK activity in the metaphase II egg helps to elucidate the mechanism behind
spindle anchoring and maintenance of metaphase II arrest. Successful completion of
these meiotic events is indicative of oocyte quality and are factors affecting reproductive
success.
260
REFERENCES
Adachi M, Kawasaki A, Nojima H, Nishida E, and Tsukita S. “Involvement of IQGAP
family proteins in the regulation of mammalian cell cytokinesis.” Genes to Cells
19 (2014): 803-820.
Agnew BJ, Minamide LS, and Bamburg JR. “Reactivation of phosphorylated actin
depolymerizing factor and identification of the regulatory site.” Journal of
Biological Chemistry 270 (1995): 17582-17587.
Arber S, Barbayannis FA, Hanser H, Schneider C, Stanyon CA, Bernard O, and Caroni
P. “Regulation of actin dynamics through phosphorylation of cofilin by LIMkinase.” Nature 393 (1998): 805-809.
Asuncio ́n M, Calvo RM, San Milla ́n JL, Sancho J, Avila S, and Escobar-Morreale HF.
“A prospective study of the prevalence of the polycystic ovary syndrome in
unselected Caucasian women from Spain.” Journal of Clinical Endocrinology and
Metabolism 85 (2000): 2434-2438.
Avrech OM, Goldman GA, Rufas O, Stein A, Amit S, Yoles I, Pinkas H, and Fisch B.
“Treatment variables in relation to oocyte maturation: lessons from a clinical
micromanipulation-assisted in vitro fertilization program.” Journal of Assisted
Reproduction and Genetics 14 (1997): 337-342.
Azoury J, Lee KW, Georget V, Hikal P, and Verlhac MH. “Symmetry breaking in mouse
oocytes requires transient F-actin meshwork destabilization.” Development 138
(2011): 2903-2908.
Azoury J, Lee KW, Georget V, Rassinier P, Leader B, and Verlhac MH. “Spindle
positioning in mouse oocytes relies on a dynamic meshwork of actin filaments.”
Current Biology 18 (2008): 1514-1519.
Azziz R. “PCOS: a diagnostic challenge.” Reproductive Biomedicine Online 8 (2004):
644–648.
261
Bar-Ami S, Zlotkin E, Brandes JM, and Itskovitz-Eldor J. “Failure of meiotic competence
in human oocytes.” Biology of Reproduction 50 (1994): 1100-1107.
Bashour, AM, Fullterton AT, Hart MJ, and Bloom GS. “IQGAP1, a Rac and Cdc42binding protein, directly binds and cross-links microfilaments.” Journal of Cell
Biology 137 (1997): 1555-1566.
Bergere M, Lombroso R, Gombault M, Wainer R, and Selva J. “An idiopathic infertility
with oocytes meta- phase I maturation block: case report.” Human Reproduction
16 (2001): 2136-2138.
Bernhardt ML, Kong BY, Kim AM, O'Halloran TV, and Woodruff TK. “A zinc-dependent
mechanism regulates meiotic progression in mammalian oocytes.” Biology of
Reproduction 86 (2012): 114.
Bertrand E, Van Den Bergh M, and Englert Y. “Fertilization and early embryology: does
zona pellucida thickness influence the fertilization rate?” Human Reproduction 10
(1995): 1189-1193.
Bielak-Zmijewska A, Kolano A, Szczepanka K, Malezewski M, and Borsuk E. “Cdc42
protein acts upstream of IQGAP1 and regulates cytokinesis in mouse oocytes
and embryos.” Developmental Biology 322 (2008): 21-32.
Blandau RJ, and Jordan ES. “The effect of delayed fertilization on the development of
the rat ovum.” American Journal of Anatomy 68 (1941): 275-291.
Blandau RJ, and Young WC. “The effects of delayed fertilization on the development of
the guinea pig ovum.” American Journal of Anatomy 64 (1939): 303-329.
Boomsma CM, Fauser BCJM, and Macklon NS. “Pregnancy complications in women
with Polycystic ovary syndrome.” Seminars in Reproductive Medicine 26 (2008):
72-84.
Brandt DT, and Gross R. “Get to grips: steering local actin dynamics with IQGAPs.” The
EMBO Reports 8 (2007): 1019-1023.
262
Brunet S, and Maro B. ”Cytoskeleton and cell cycle control during meiotic maturation of
the mouse oocyte: integrating time and space.” Reproduction 130 (2005); 801811.
Brunet S, and Verlhac MH. “Positioning to get out of meiosis: the asymmetry of division.”
Human Reproduction Update 17 (2011): 68-75.
Carazo-Salas RE, Gruss OJ, Mattaj IW, and Karsenti E. “Ran-GTP coordinates
regulation of microtubule nucleation and dynamics during mitotic-spindle
assembly.” Nature Cell Biology 3 (2001): 228-234.
Chaigne A, Campillo C, Gov NS, Voituriez R, Azoury J, Umaña-Diaz C, Almonacid M,
Queguiner I, Nassoy P, Sykes C, Verlhac MH, and Terret ME. “A soft cortex is
essential for asymmetric spindle positioning in mouse oocytes.” Nature Cell
Biology 15 (2013): 958-966.
Chaigne A, Campillo C, Gov NS, Voituriez R, Sykes C, Verlhac MH, and Terret ME. “A
narrow window of cortical tension guides asymmetric spindle positioning in the
mouse oocyte.” Nature Communications 19 (2015): 6027.
Chebotareva T, Taylor J, Mullins JJ, and Wilmut I. “Rat eggs cannot wait: Spontaneous
exit from meiotic metaphase II-arrest.” Molecular Reproduction and Development
78 (2011): 795-807.
Colledge WH, Carlton MBL, Udy GB, and Evans MJ. “Disruption of c-mos cause
parthenogenetic development of unfertilized mouse eggs.” Nature 370 (1994):
65-68.
Dalo DT, McCaffery JM, and Evans JP. “Ultrastructural analysis of egg membrane
abnormalities in post-ovulatory aged eggs.” International Journal of Development
Biology 52 (2008): 535-544.
263
Deng M, Suraneni P, Schultz RM, Li R. “The Ran GTPase mediates chromatin signaling
to control cortical polarity during polar body extrusion in mouse oocytes.”
Developmental Cell 12 (2007): 301-308.
Deng M, Williams CJ, and Schultz RM. “Role of MAP kinase and myosin light chain
kinase in chromosome-induced development of mouse egg polarity.”
Developmental Biology 278 (2005): 358-366.
Diamanti-Kandarakis E. “Polycystic ovarian sysndrome: pathophysiology, molecular
aspects and clinical implications.” Expert Reviews in Molecular Medicine 10
(2008): e31–e21.
Duan X, Liu J, Dai XX, Liu HL, Cui XS, Kim NH, Wang ZB, Wang Q, and Sun SC. “RhoGTPase effector ROCK phosphorylates cofilin in actin-meditated cytokinesis
during mouse oocyte meiosis.” Biology of Reproduction 90 (2014): 3.
Dumont J, Million K, Sunderland K, Rassinier P, Lim H, Leader B, and Verlhac MH.
“Formin-2 is required for spindle migration and for the late steps of cytokinesis in
mouse oocytes.” Developmental Biology 301 (2007): 254-265.
Ebner T, Shebl O, and Moser M. “Developmental fate of ovoid oocytes.” Human
Reproduction 23 (2008): 62-66.
Edelmann W, Cohen PE, Kane M, Lau K, Morrow B, Bennett S, Umar A, Kunkel T,
Cattoretti G, Chaganti R, Pollard JW, Kolodner RD, and Kucherlapti R. “Meiotic
pachytene arrest in MLH1- deficient mice.” Cell 85 (1996): 1125-1134.
Eichenlaub-Ritter U, Schmiady H, Kentenich H, and Soewarto D. “Fertilization and early
embryology: Re- current failure in polar body formation and premature
chromosome condensation in oocytes from a human patient: indicators of
asynchrony in nuclear and cyto- plasmic maturation.” Human Reproduction (10)
1995: 2343-2349.
264
Eng JA, Naqvi NI, Wong KC, and Balasubramanian MK. “Rng2p, a protein required for
cytokinesis in fission yeast, is a component of the actomyosin ring and the
spindle pole body.” Current Biology 8 (1998): 611-621.
Epp JA, and Chant J. “An IQGAP-related protein controls actin-ring formation and
cytokinesis in yeast.” Current Biology 7 (1997): 921-929.
Ferna ́ndez-Gonzalez R, Ramirez MA, Bilbao A, De Fonseca FR, and Gutie ́rrez-Ada ́n
A. “Suboptimal in vitro culture conditions: an epigenetic origin of long-term health
effects.” Molecular Reproduction and Development 74 (2007): 1149-1156.
Fleming TP, Kwong WY, Porter R, Ursell E, Fesenko I, Wilkins A, Miller DJ, Watkins AJ,
and Eckert JJ. “The embryo and its future.” Biology of Reproduction 71 (2004):
1046-1054.
Franks S. “Polycystic ovary syndrome in adolescents.” International Journal of Obstetrics
32 (2008): 1035-1041.
Franks S. “Polycystic ovary syndrome.” New England Journal of Medicine 333 (1995):
853-861.
Furuya M, Tanaka M, Teranishi T, Matsumoto K, Hosoi Y, Saeki K, Ishimoto H,
Minegishi K, Iritani A, and Yoshimura Y. “H1foo is indispensable for meiotic
maturation of the mouse oocyte.” Journal of Reproduction and Development 53
(2007): 895-902.
Goud AP, Goud PT, Diamon MP, Van Oostveldt P, and Hughes MR. “Microtubule
turnover in ooplasm biopsy reflects ageing phenomena in the parent oocyte.”
Reproductive BioMedicine Online 11 (2005): 43-52.
Gray RH, Simpson JL, Kambic RT, Queenan JT, Mena P, Perez A, and Barbato M.
“Timing of conception and the risk of spontaneous abortion among pregnancies
occurring during the use of natural family planning.” American Journal of
Obstetrics and Gynecology Research 172 (1995): 1567-1572.
265
Guerrero R, and Lanctot CA. “Aging of fertilizing gametes and spontaneous abortion:
Effect of the day of ovulation and the time of insemination.” American Journal of
Obstetrics and Gynecology 104 (1970): 263-267.
Guerrero R, and Rojas OI. “Spontaneous abortion and aging of human ova and
spermatozoa.” New England Journal of Medicine 297 (1975): 573-575.
Halet G, and Carroll J. “Rac activity is polarized and regulates meiotic spindle stability
and anchoring in mammalian oocytes.” Developmental Cell 12 (2007): 309-317.
Harrison KL, Sherrin DA, and Keeping JD. “Repeated Oocyte Maturation Block.” Journal
of Assisted Reproduction and Genetics 17 (2000): 231-233.
Hartshorne G, Montgomery S, and Klentzeris L. “A case of failed oocyte maturation in
vivo and in vitro”. Fertility and Sterility 71 (1999): 567-570.
Hashimoto N, Watanabe N, Furuta Y, Tamemoto H, Sagata N, Yokoyama M, Okazaki K,
Nagayoshi M, Takeda N, Ikawa Y, and Aizawa S. “Parthenogenetic activation of
oocytes in c-mos-deficient mice.” Nature 370 (1994): 68-71.
Heijnen EM, Eijkemans MJ, Hughes EG, Laven JS, Macklon NS, and Fauser BC. “A
meta- analysis of outcomes of conventional IVF in women with polycystic ovary
syndrome.” Human Reproduction Update 12 (2006): 13-21.
Hein MY, Hubner NC, Poser I, Cox J, Nagaraj N, Toyoda Y, Gak IA, Weisswange I,
Mansfeld J, Buchholz F, Hyman AA, and Mann M. “A human interactome in three
quantitative dimensions organized by stoichiometries and abundances.” Cell 163
(2015): 712-723.
Holubcová Z, Blayney M, Elder K, and Schuh M. “Human oocytes. Error-prone
chromosome-mediated spindle assembly favors chromosome segregation
defects in human oocytes.” Science 348 (2015): 1143-1147.
266
Horner VL, and Wolfner MF. “Mechanical stimulation by osmotic and hydrostatic
pressure activates Drosophila oocytes in vitro in a calcium-dependent manner.”
Developmental Biology 316 (2008): 100-109.
Hutchins JR, Toyoda Y, Hegemann B, Poser I, Hériché JK, Sykora MM, Augsburg M,
Hudecz O, Buschhorn BA, Bulkescher J, Conrad C, Comartin D, Schleiffer A,
Sarov M, Pozniakovsky A, Slabicki MM, Schloissnig S, Steinmacher I, Leuschner
M, Ssykor A, Lawo S, Pelletier L, Stark H, Nasmyth K, Ellenberg J, Durbin R,
Buchholz F, Mechtler K, Hyman AA, and Peters JM. “Systematic analysis of
human protein complexes identifies chromosome segregation proteins.” Science
328 (2010): 593-599.
Kahraman S, Yakın K.,Donmez E, and Samli H. “Relationship between granular
cytoplasm of oocytes and pregnancy outcome following intracytoplasmic sperm
injection.” Human Reproduction 15 (2000): 2390-2393.
Kalab P, RT Pu, and Dasso M. “ The Ran GTPase regulates mitotic spindle assembly.”
Current Biology 9 (1999): 481-484.
Kaneuchi T, Sartain CV, Takeo S, Horner VL, Buehner NA, Aigaki T, and Wolfner MF.
“Calcium waves occur as Drosophila oocytes activate.” Proceedings of the
Naitonal Academy of Sciences 112 ( 2015): 791-796.
Kim AM, Bernhardt ML, Kong BY, Ahn RW, Vogt S, Woodruff TK, and O'Halloran TV.
“Zinc sparks are triggered by fertilization and facilitate cell cycle resumption in
mammalian eggs.” ACS Chemical Biology 6 (2011): 716-723.
Klemke RL, Cai S, Giannini AL, Gallagher PJ, de Lanerolle P, and Cheresh DA.
“Regulation of cell motility by mitogen-activated protein kinase.” Journal of Cell
Biology 137 (1997): 481-492.
Knochenhauer ES, Key TJ, Kahsar-Miller M, Waggoner W, Boots LR, and Azziz R.
“Prevalence of the polycystic ovary syndrome in unselected black and white
267
women of the southeastern United States: a prospective study.” Journal of
Clinical Endocrinology and Metabolism 83 (1998): 3078-3082.
Larson SM, Lee HJ, Hung PH, Matthews LM, Robinson DN, and Evans JP. “Cortical
mechanics and meiosis II completion in mammalian oocytes are mediated by
myosin-II and Ezrin-Radixin-Moesin (ERM) proteins.” Molecular Biology of the
Cell 21 (2010): 3182-3192.
Leader B, Lim H, Carabatsos MJ, Harrington A, Ecsedy J, Pellman D, Maas R, and
Leder P. “Formin-2, polyploidy, hypofertility and positioning of the meiotic spindle
in mouse oocytes.” Nature Cell Biology 4 (2002): 921-928.
Leblanc J, Zhang X, McKee D, Wang ZB, Li R, Ma C, Sun QY, and Liu XJ. “The small
GTPase Cdc42 promotes membrane protrusion during polar body emission via
ARP2-nucleated actin polymerization.” Molecular Human Reproduction 17
(2011): 305-316.
Lee J, Miyano T, and Moor RM. “Spindle formation and dynamics of g-tubulin and
nuclear mitotic apparatus protein distribution during meiosis in pig and mouse
oocytes.” Biology of Reproduction 62 (2000): 1184-1192.
Lee SR, Xu YN, Jo YJ, Namgoong S, and Kim NH. “The Rho-GTPase effector ROCK
regulates meiotic maturation of the bovine oocyte via myosin light chain
phosphorylation and cofilin phosphorylation.” Molecular Reproduction and
Development 82 (2015): 849-858.
Levran D, Farhi J, Nahum H, Glezerman M, and Weissman A. “Maturation arrest of
human oocytes as a cause of infertility: case report.” Human Reproduction 14
(2002): 1605-1609.
Li H, Guo F, Rubinstein B, and Li R. “Actin-driven chromosomal motility leads to
symmetry breaking in mammalian meiotic oocytes.” Nature Cell Biology 10
(2008): 1301-1308.
268
Li L, Zheng P, and Dean J. “Maternal control of early mouse development.”
Development 137 (2010): 859-870.
Li X, Zhu Y, Cao Y, Wang Q, Du J, Tian J, Liang Y, and Ma W. “LIM kinase activity is
required for microtubule organising centre positioning in mouse oocyte meiosis.”
Reproduction, Fertility, and Development (2016).
Libby BJ, De La Fuente R, O’Brien MJ, Wigglesworth K, Cobb J, Inselman A, Eaker S,
Handel MA, Eppig JJ, and Schimenti JC. “The mouse meiotic mutation mei1
disrupts chromosome synapsis with sexually dimorphic consequences for meiotic
progression.” Developmental Biology 242 (2002): 174-187.
Longo FJ. “Organization of microfilaments in sea urchin (Arbacia punctulata) eggs at
fertilization: effects of cytochalasin B.” Developmental Biology 74 (1980): 422433.
Longo FJ. “Ultrastructural changes in rabbit eggs aged in vivo.” Biology of Reproduction
11 (1974): 22-39.
Ludwig M, Finas DF, al-Hasani S, Diedrich K, and Ortmann O. “Oocyte quality and
treatment outcome in intracytoplasmic sperm injection cycles of polycystic
ovarian syndrome patients.” Human Reproduction 14 (1999): 354-358.
Mackenzie, AM, Kyle DD, McGinnis LA, Lee HJ, Aldana N, Robinson DN, Evans JP.
“Cortical mechanics and myosin-II abnormalities assocaited with post-ovulatory
aging: Implications for functional defects in aged eggs.” Molecular Human
Reproduction (2016).
Madgwick S, Hansen DV, Levasseur M, Jackson PK, and Jones KT. “Mouse Emi2 is
required to enter meiosis II by reestablishing cyclin B1 during interkinesis.”
Journal of Cell Biology 174 (2006): 791-801.
269
Maekawa M, Ishizaki T, Boku S, Watanabe N, Fujita A, Iwamatsu A, Obinata T, Ohashi
K, Mizuno K, and Narumiya S. “Signaling from Rho to the actin cytoskeleton
through protein kinases ROCK and LIM-kinase.” Science 285 (1999): 895-898.
Mailhes JB, Young D, and London SN. “Postovulatory ageing of mouse oocytes in vivo
and premature centromere separation and aneuploidy.” Biology of Reproduction
58 (1998): 1206-1210.
Maro B, and Verlhac MH. “Polar body formation: new rules for asymmetric divisions.”
Nature Cell Biology 4 (2002): E281-283.
McGinnis LA, Lee HJ, Robinson DN, and Evans JP. “MAPK3/1 (ERK1/2) and Myosin
Light Chain Kinase in Mammalian Eggs Affect Myosin-II Function and Regulate
the Metaphase II State in a Calcium- and Zinc-Dependent Manner.“ Biology of
Reproduction 92 (2015): 146.
Mehlmann LM. “Stops and starts in mammalian oocytes: recent advances in
understanding the regulation of meiotic arrest and oocyte maturation.”
Reproduction 130 (2005): 791-799.
Miao YL, and Williams CJ. “Calcium signaling in mammalian egg activation and embryo
development: the influence of subcellular localization.” Molecular Reproduction
and Development 79 (2012): 742-756.
Miao YL, Stein P, Jefferson WN, Padilla-Banks E, and Williams CJ. "Calcium influxmediated signaling is required for complete mouse egg activation." Proceedings
of the National Academy of Sciences 109 (2012): 4169-4174.
Miao YL, Kikuchi K, Sun QY, and Schatten H. “Oocyte aging: cellular and molecular
changes, developmental potential and reversal possibility.” Human Reproduction
Update 15 (2009): 573-585.
Moriyama K, Iida K, and Yahara I “Phosphorylation of Ser-3 of cofilin regulates its
essential function on actin.” Genes Cells 1 (1996): 73-86.
270
Mtango NR, Potireddy S, and Latham KE. “Oocyte quality and maternal control of
development.” International Review of Cell and Molecular Biology 268 (2008):
223-290.
Mulders AG, Laven JS, Imani B, Eijkemans MJ, and Fauser BC. “IVF outcome in
anovulatory infertility (WHO group 2)—including polycystic ovary syndrome
following previous unsuccessful ovulation induction.” Reproductive Biomedicine
Online 7 (2003): 50-58.
Na J, and Zernicka-Goetz M. “Asymmetric position and organization of the meiotic
spindle of mouse oocytes requires CDC42 function.” Current Biology 16 (2006):
1249-1254.
Neal MS, Cowan L, Louis JP, Hughes E, King WA, and Basrur PK. “Cytogenetic
evaluation of human oocytes that failed to complete meiotic maturation in vitro.”
Fertility and Sterility 77 (2002): 844-845.
Nguyen DH, Catling AD, Webb DJ, Sankovic M, Walker LA, Somlyo AV, Weber MJ, and
Gonias SL. “Myosin light chain kinase functions downstream of Ras/ERK to
promote migration of urokinase-type plasminogen activator-stimulated cells in an
integrin-selective manner.” Journal of Cell Biology 146 (1999): 149-164.
Nojima H, Adachi M, Matsui T, Okawa K, Tsukita S, and Tsukita S. “IQGAP3 regulates
cell proliferation through the Ras/ERK signaling cascade.” Nature Cell Biology 10
(2008): 971-978.
Padmanabhan A, Bakka K, Sevugan M, Naqvi NI, D'souza V, Tang X, Mishra M, and
Balasubramanian MK. “IQGAP-related Rng2p organizes cortical nodes and
ensures position of cell division in fission yeast.” Current Biology 21 (2011): 467472.
271
Petrunewich MA, Trimarchi JR, Hanlan AK, Hammer MA, and Baltz JM. “Second meiotic
spindle integrity requires MEK/MAP kinase activity in mouse eggs.” Journal of
Reproduction and Development 55 (2009): 30-38.
Pfender S, Kuznetsov V, Pleiser S, Kerkhoff E, and Schuh M. “Spire-type actin
nucleators cooperate with Formin-2 to drive asymmetric oocyte division.” Current
Biology 21 (2011): 955-960.
Phillips KP, Petrunewich MA, Collins JL, Booth RA, Liu XJ, and Baltz JM. “Inhibition of
MEK or cdc2 kinase parthenogenetically activates mouse eggs and yields the
same phenotypes as Mos(-/-) parthenogenotes.” Developmental Biology 247
(2002): 210-223.
Piekny AJ, and Glotzer M. “Anillin is a scaffold protein that links RhoA, actin, and myosin
during cytokinesis.” Current Biology 18 (2008): 30-36.
Qiao J, and Feng H. “Extra- and intra-ovarian factors in polycystic ovary syndrome:
impact on oocyte maturation and embryo developmental competence.” Human
Reproduction Update 17 (2011): 17-33.
Rienzi L, Vajta G, and Ubaldi F. “Predictive value of oocyte morphology in human IVF: a
systematic review of the literature.” Human Reproduction Update 17 (2011): 3445.
Sahu B, Ozturk O, Ranierri M, and Serhal P. “Comparison of oocyte quality and
intracytoplasmic sperm injection outcome in women with isolated polycystic
ovaries or polycystic ovarian syndrome.” Archives of Gynecology and Obstetrics
277 (2008): 239-244.
Sanfins A, Plancha CE, Overstrom EW, and Albertini DF. “Meiotic spindle
morphogenesis in in vivo and in vitro matured mouse oocytes: Insights into the
relationship between nuclear and cytoplasmic quality.” Human Reproduction 19
(2004): 2889-2899.
272
Schuh M, and Ellenberg J.” A new model for asymmetric spindle positioning in mouse
oocytes.” Current Biology 18 (2008): 1986-1992.
Sengoku K, Tamate K, Takuma N, Yoshida T, Goishi K, and Ishikawa M. “The
chromosomal normality of unfertilized oocytes from patients with polycystic
ovarian syndrome.” Human Reproduction 12 (1997): 474-477.
Simerly C, Nowak G, de Lanerolle P, and Schatten G. “Differential expression and
functions of cortical myosin IIA and IIB isotypes during meiotic maturation,
fertilization, and mitosis in mouse oocytes and embryos.” Molecular Biology of
the Cell 9 (1998): 2509-2525.
Solc P, Saskova A, Baran V, Kubelka M, Schultz RM, and Motlik J. “CDC25A
phosphatase controls meiosis I progression in mouse oocytes.” Developmental
Biology 317 (2008): 26-269.
Spruck CH, de Miguel MP, Smith AP, Ryan A, Stein P, Schultz RM, Lincoln AJ, Donovan
PJ, and Reed SI. “Requirement of Cks2 for the first metaphase/anaphase
transition of mammalian meiosis.” Science 300 (2003): 647–650.
Stanyon CA, and Bernard O. “LIM-kinase1.” International Journal of Biochemistry and
Cell Biology 31 (1999): 389-394.
Stitzel ML, and Seydoux G. “Regulation of the oocyte-to-zygote transition.” Science 316
(2007): 407-408.
Sumi T, Matsumoto K, and Nakamura T. “Cofilin phosphorylation and actin cytoskeletal
dynamics regulated by rho- and Cdc42-activated LIM-kinase 2.” Journal of Cell
Biology 147 (1999): 1519-1532.
Szollosi D. “Morphological changes in mouse eggs due to aging in the fallopian tube.”
American Journal of Anatomy 130 (1971): 209-225.
Takahashi T, Igarashi H, Amita M, Hara S, Matsuo K, and Kurachi H. “Molecular
mechanism of poor embryo development in postovulatory aged oocytes: mini
273
review.” The Journal of Obstetrics and Gynaecology Research 39 (2013):
143101439.
Tarin JJ, Perez-Albala S, and Cano A. “Consequences on offspring of abnormal function
in ageing gametes.” Human Reproduction Update 6 (2000): 532-549.
Tong C, Fan HY, Chen DY, Song XF, Schatten H, and Sun QY. “Effects of MEK inhibitor
U0126 on meiotic progression in mouse oocytes: microtubule organization,
asymmetric division and metaphase II arrest.” Cellular Response 13 (2003): 75383.
Toulis KA, Gouli DG, Farmakiotis D, Georgopoulos NA, Katsikis I, Tarlatzis BC,
Papadima I, and Panidis D. “Adiponectin levels in women with polycystic ovary
syndrome: a systematic review and a meta-analysis.” Human Reproduction
Update 15 (2009): 297-307.
Verlhac MH, Kubiak JZ, Weber M, Geraud G, Colledge WH, Evans MJ, and Maro B.
"Mos is required for MAP kinase activation and is involved in microtuble
organization during meiotic maturation in the mouse." Development 122 (1996):
815-822.
Verlhac MH, Kubiak JZ, Weber M, Géraud G, Colledge WH, Evans MJ, and Maro B.
“Mos is required for MAP kinase activation and is involved in microtubule
organization during meiotic maturation in the mouse.” Development 122 (1996):
815-822.
Verlhac MH, Lefebvre C, Kubiak JZ, Umbhauer M, Rassinier P, Colledge W, Maro B.
“Mos activates MAP kinase in mouse oocytes through two opposite pathways.”
The EMBO Journal 19 (2000): 6065-6074.
Vicente-Manzanares M, Ma X, Adelstein RS, and Horwitz AF. “Non-muscle myosin II
take centre stage in cell adhesion and migration.” Nature Reviews Molecular
Cellular Biology 10 (2009): 778-790.
274
Wang ZB, Jiang ZZ, Zhang QH, Hu MW, Huang L, Ou XH, Guo L, Ouyang YC, Hou Y,
Brakebusch C, Schatten H, and Sun QY. “Specific deletion of Cdc42 does not
affect meiotic spindle organization/migration and homologous chromosome
segregation but disrupts polarity establishment and cytokinesis in mouse
oocytes.” Molecular Biology of the Cell 24 (2013): 3832-3841.
Wassmann K, Niault T, and Maro B. “Metaphase I arrest upon activation of the Mad2dependent spindle checkpoint in mouse oocytes.” Current Biology 13 (2003):
1596-1608.
Webb M, Howlett SK, and Maro B. “Parthenogenesis and cytoskeletal organization in
ageing mouse eggs.” Journal of Embryology and Experimental Morphology 95
(1986): 131-145.
Weghofer A, Munne S, Chen S, Barad D, and Gleicher N. “Lack of association between
polycystic ovary syndrome and embryonic aneuploidy.” Fertility and Sterility 88
(2007): 900-905.
Wilcox AJ, Weinberg CR, and Baird DD. “Post-ovulatory ageing of the human oocyte
and embryo failure.” Human Reproduction 13 (1998): 394-397.
Wood JR, Dumesic DA, Abbott DH, and Strauss JF III. “Molecular abnormalities in
oocytes from women with polycystic ovary syndrome revealed by microarray
analysis.” Journal of Clinical Endocrinology and Metabolism 92 (2007): 705-713.
Woods LM, Hodges CA, Baart E, Baker SM, Liskay M, and Hunt PA. “Chromosomal
influence on meiotic spindle assembly: abnormal meiosis I in female Mlh1 mutant
mice.” Journal of Cell Biology 145 (1999): 1395-1406.
Wortzman GB, and Evans JP. “Membrane and cortical abnormalities in post-ovulatory
aged eggs: analysis of fertilizability and establishment of the membrane block to
polyspermy.” Molecular Human Reproduction 11 (2005): 1-9.
275
Xia P. “Intracytoplasmic sperm injection: correlation of oocyte grade based on polar
body, perivitelline space and cytoplasmic inclusions with fertilization rate and
embryo quality.” Human Reproduction 12 (1997): 1750-1755.
Xu, Z, Abbott A, Kopf GS, Schultz RM, and Ducibella T. “Spontaneous activation of
ovulated mouse eggs: time-dependent effects on M-phase exit, cortical granule
exocytosis, maternal messenger ribonucleic acid recruitment, and inositol 1,4,5trisphosphate sensitivity.” Biology of Reproduction 57 (1997): 743-750.
Yanez LZ, Han J, Behr BB, Pera RA, and Camarillo DB. “Human oocyte developmental
potential is predicted by mechanical properties within hours after fertilization.”
Nature Communications 7 (2016). 10809.
Yang N, Higuchi O, Ohashi K, Nagata K, Wada A, Kangawa K, Nishida E, and Mizuno K.
“Cofilin phosphorylation by LIM-kinase 1 and its role in Rac-mediated actin
reorganization.” Nature 393 (1998): 809-812.
Yang Y, Zhao W, Xu QW, Wang XS, Zhang Y, and Zhang J. “IQGAP3 promotes EGFRERK signaling and the growth and metastasis of lung cancer cells.” PLoS One 9
(2014): e97578.
Yi K, Rubinstein B, and Li R. “Symmetry breaking and polarity establishment during
mouse oocyte maturation.” Philosophical transactions of the royal society of
London 368 (2013): 20130002.
Zhang X, Ma C, Miller AL, Katbi HA, Bement WM, and Liu XJ. “Polar body emission
requires a RhoA contractile ring and Cdc42-mediated membrane protrusion.”
Developmental Cell 15 (2008): 386-400.
Zhang Y, Duan X, Cao R, Liu HL, Cui XS, Kim NH, Rui R, and Sun SC. “Small GTPase
RhoA regulates cytoskeleton dynamics during porcine oocyte maturation and
early embryo development.” Cell Cycle 13 (2014): 3390-3403.
276
Lauren A. McGinnis, M.S.
3900 North Charles St. #502
Baltimore, MD 21218
973-727-6770
[email protected]
Born May 4, 1986
Denville, NJ
EDUCATION
Doctor of Philosophy Candidate
Johns Hopkins Bloomberg School of Public Health, Department of Biochemistry and
Molecular Biology, Division of Reproductive Biology, August 2010 – Current.
Expected completion date: April 18, 2016
Thesis advisor: Janice P. Evans, Ph.D.
Master of Science, Molecular and Cellular Biology
Johns Hopkins University, Department of Biology, May 2008 – May 2009.
Thesis title: An Investigation into the Regulation of Vcx1 in the Calcium Signaling
Pathway of Saccharomyces cerevisiae.
Thesis Advisor: Kyle W. Cunningham, Ph.D.
Bachelor of Science, Molecular and Cellular Biology
Johns Hopkins University, August 2004-May 2008.
RESEARCH EXPERIENCE
Ph.D. candidate, Johns Hopkins Bloomberg School of Public Health, Department of
Biochemistry & Molecular Biology, Division of Reproductive Biology, August 2010 –
Current.
• Independently characterized protein in mouse oocyte that regulates metaphase II
arrest in an ion-dependent manner; identified two novel candidate proteins that
regulate correct positioning of meiotic spindle prior to cytokinesis.
• Research published in peer-reviewed journals and presented at international
scientific conferences.
• Developed and implemented protocol for time-lapse microscopy of living oocytes,
and provided technical expertise to fellow graduate students in the laboratory and
department.
• Optimized micropipette puller so that laboratory members can independently pull
micromanipulation tools for oocyte microinjection.
• Mentored and supervised one undergraduate, five rotation students, and two master
student’s research projects.
• Maintained a meticulous laboratory notebook daily.
Master of Science student, Johns Hopkins University, Department of Biology, May
2008 – May 2009.
• Studied a vacuolar protein/calcium exchanger in the calcium-signaling pathway in
Saccharomyces cerevisiae.
• Performed intensive literature review, drafted protocol, and implemented new
methodology for isolation of intact vacuoles from Saccharomyces cerevisiae.
• Skillset includes tetrad dissection, yeast transformation, protein extraction,
immunoblotting, radioactive calcium uptake and FACS array death assays.
277
Undergraduate Research Assistant, Johns Hopkins University, Department of Biology,
September 2007 – May 2008.
• Investigated protein kinase function in calcium-signaling pathway of Saccharomyces
cerevisiae.
• Learned laboratory techniques including PCR, cloning, gel electrophoresis and
plasmid mini-prep.
CERTIFICATION
Embryology Certificate Course. American Society for Reproductive Medicine. Completed
April 2015.
RELEVANT WORK EXPERIENCE
Research Technologist, Johns Hopkins University, Department of Biology, August
2009-May 2010.
• Assisted in design of undergraduate Genetics Laboratory and Developmental
Biology Laboratory curriculum with Dr. Carolyn Norris.
• Prepared laboratory materials weekly for 60 undergraduate students.
• Supervised teaching assistants and teaching laboratories three times a week.
Histology Laboratory Intern, Pathology Department, St. Clare’s Hospital Dover, NJ,
May-September 2007.
• Processed, chemically stained, mounted tissue specimens and shadowed organ
dissection.
• Observed clinical diagnoses on pathology reports.
PUBLICATIONS
Peer-reviewed research articles
Mackenzie AC, Kyle DD, McGinnis LA, Lee HJ, Aldana N, Robinson DN, Evans JP.
Cortical mechanics and myosin-II abnormalities associated with post-ovulatory aging:
Implications for functional defects in aged eggs. Molecular Human Reproduction. 2016
Feb 26.
McGinnis LA, Lee HJ, Robinson DN, Evans JP. MAPK3/1 (ERK1/2) and Myosin Light
Chain Kinase in Mammalian Eggs Affect Myosin-II Function and Regulate the
Metaphase II State in a Calcium- and Zinc-Dependent Manner. Biology of Reproduction.
92(6):0,1–14. 2015.
Gleason JE, Corrigan DJ, Cox JE, Reddi AR, McGinnis LA, Culotta VC.
Analysis of hypoxia and hypoxia-like states through metabolite profiling. PLoS One. 6(9)
2011.
Published Abstracts
McGinnis LA, Evans JP. (2015). IQGAP3 is a candidate protein for correct spindle
positioning during meiotic maturation in mammalian oocytes. Abstract No. P-274.
American Society for Reproductive Medicine, Baltimore, Maryland.
McGinnis LA, Lee HJ, Robinson DN, Evans JP. (2013) Myosin-II-based contractility in
the mouse egg cytoskeleton is affected by ERK1/2 MAP kinase activity and contributes
to maintaining metaphase II arrest by maintaining Ca2+ influx. Abstract No. 440. Society
278
for the Study of Reproduction, Montreal, Canada.
HONORS AND AWARDS
Travel Grant recipient, The Larry Ewing Memorial Trainee Travel Fund, Society for the
Study of Reproduction, July 2013.
Training Grant recipient, Johns Hopkins University Reproductive Biology Training
Grant, National Institute of Child Health & Development, 2011-2012.
Dean’s List, Johns Hopkins University, Fall 2004, Spring 2007.
PROFESSIONAL AFFILIATIONS
Society for the Study of Reproduction
CONFERENCES AND PRESENTATIONS
American Society for Reproduction Medicine Annual Conference, Baltimore, MD
October 2015 (poster)
Society for the Study of Reproduction 46th Annual Meeting, Montreal, Canada July 2226, 2013 (poster)
Gordon Research Bi-annual Conference: Fertilization & Activation of Development,
Holderness, New Hampshire, July 2011 (attendee)
LEADERSHIP EXPERIENCE
Social Committee Co-Founder, Johns Hopkins Bloomberg School of Public Health,
Department of Biochemistry and Molecular Biology
• Founded committee of students that organize several monthly events to encourage
camaraderie between department faculty, staff, and graduate students.
Manuscript reviewer, Molecular Human Reproduction and Development, 2013 –
current.
• Critically reviewed manuscripts and provided feedback to authors.
Grading Assistant, Fundamentals of Reproductive Biology, Johns Hopkins Bloomberg
School of Public Health, 2011 – 2014.
• Evaluated exams for class of approximately 100 graduate students.
Teaching Assistant, Johns Hopkins University, Department of Biology, 2008-2009.
• Independently conducted General Biology I and II laboratory weekly consisting of 30
undergraduates.
• Provided guidance regarding basic laboratory techniques.
• Graded laboratory reports for class of approximately 30 undergraduate students.
• Graded exams for class of approximately 300 undergraduate students.
279