Name: page 1 of 6 pages MOLECULAR BIOLOGY BIO372S January 31, 2013 First mid-term examination (one hour) Please read each question carefully and put your answers on the exam page only in the spaces indicated. Good luck! Name: Signature: Student Number: Name: page 2 of 6 pages well 10,000 bp 100 bp 1 (15 points). You are given a sample of double-stranded DNA containing the following fragment lengths: 100, 316, 1000, 3162, 10000, 15000, and 20000 bp. The 1% agarose gel is run so that the smallest fragment appears at 9 cm from the well and the 10000 base fragment 3 cm from the well. Show the approximate positions of the other fragments. Name: page 3 of 6 pages 2 (15 points). Put check marks below for the conditions that apply to transcript mapping. S1 mapping of 5’ end 5’ end of DNA probe is labeled 3’ end of DNA probe is labeled accurate to a single nucleotide Polynucleotide kinase Used Klenow fragment of DNApol used S1 nuclease used Electrophoretic mobility of DNA is measured Electrophoretic mobility of RNA is measured Measures transcript start site Measures transcript stop site S1 mapping of 3’ end Primer extension Name: page 4 of 6 pages 3 (20 marks). You make an equal mixture (by weight) of: i) E.coli DNA and ii) the unique fraction of Agaricus bisporus DNA. The two DNAs were previously sheared to a uniform size of 200 bp. The DNA mixture was thermally denatured and then placed in standard conditions allowing renaturation. Draw a plausible renaturation (Cot) curve. Name: page 5 of 6 pages 4 (30 points). The following question is in reference to the Meselson and Stahl experiment. Cells of E. coli are grown on a medium containing the heavy isotope of nitrogen (15N) which is incorporated into the DNA, which is of higher than normal density. The cells are then transferred to medium with the normal, lighter isotope of nitrogen (14N). After various periods of time, DNA is extracted and analysed with cesium density-gradient centrifugation. Show the banding positions, and their relative intensities, over four generations after the transfer to the medium with the lighter isotope of nitrogen. Name: page 6 of 6 pages 5 (10 points). Below is a melt curve of a sample of DNA. Show a plausible corresponding density trace from cesium-chloride density gradient centrifugation for the same DNA. Melt curve Density trace 6 (10 Points). Below is a nucleotide sequence of DNA. Write a plausible sequence after RIP in Neurospora crassa has acted upon it. 5’GTCTTTACTAGGCATTGGCAGTTATACAGGCATTTGGGCTATCATTT 3’ Sequence after RIP here:
© Copyright 2026 Paperzz