Journal of Cell Science 109, 429-435 (1996)
Printed in Great Britain © The Company of Biologists Limited 1996
JCS4091
429
Overexpression of occludin, a tight junction-associated integral membrane
protein, induces the formation of intracellular multilamellar bodies bearing
tight junction-like structures
Mikio Furuse1, Kazushi Fujimoto2, Naruki Sato1, Tetsuaki Hirase1,3, Sachiko Tsukita1,4
and Shoichiro Tsukita1,*
1Department of Cell Biology, Faculty of Medicine, Kyoto University, Konoe-Yoshida, Sakyo-ku, Kyoto 606, Japan
2Department of Anatomy, Faculty of Medicine, Kyoto University, Sakyo-ku, Kyoto 606, Japan
3First Department of Internal Medicine, Faculty of Medicine, Kobe University, Chuo-ku, Kobe, Hyogo 650, Japan
4College of Medical Technology, Kyoto University, Sakyo-ku, Kyoto 606, Japan
*Author for correspondence
SUMMARY
Occludin is an integral membrane protein localizing at
tight junctions with four transmembrane domains. When
chicken occludin was overexpressed in insect cells by
recombinant baculovirus infection, peculiar multilamellar
structures accumulated in the cytoplasm. Partial isolation
of these structures indicated that the introduced chicken
occludin was highly enriched in these structures. Thin
section electron microscopy revealed that each lamella was
transformed from intracellular membranous cisternae
whose luminal space was completely collapsed, and that in
each lamella, outer leaflets of opposing membranes
appeared to be fused with no gaps, like tight junctions. Furthermore, in the freeze-fracture replicas of these multilamellar structures, short tight junction-like intramembranous particle strands were occasionally observed, which
were specifically labeled by anti-occludin mAb. These
observations favor the idea that occludin plays a key role
in the formation of tight junctions.
INTRODUCTION
We identified a novel membrane protein named occludin,
which was exclusively localized at TJs at the immunofluorescence light and immunoelectron microscope levels (Furuse
et al., 1993). Sequence analyses of occludin cDNA suggested
that occludin consists of four transmembrane domains, a long
carboxyl-terminal, a short amino-terminal cytoplasmic domain
and two extracellular loops, and that the content of tyrosine
and glycine residues is unusually high in these extracellular
domains. Occludin is not extracted from plasma membranes
without using detergents, supporting the notion that it is an
integral membrane protein (Furuse et al., 1993). Of course,
further detailed analyses are required to conclusively prove this
notion and to determine its exact membrane folding topology.
We found that ZO-1 is directly associated with the carboxylterminal 150 amino acids, and that this association is required
for occludin to be correctly delivered to and incorporated in
TJs (Furuse et al., 1994).
Compared with adhesion molecules working at other intercellular junctions such as adherens junctions and desmosomes,
those at TJs should be structurally and functionally unique.
They must tightly obliterate the intercellular space for the
barrier function in epithelial and endothelial cell sheets
(Farquhar and Palade, 1963). They must form a continuous
strand within the membrane to work as a fence against mem-
In epithelial and endothelial cells, the tight junction (TJ) seals
cells to create a primary barrier to the diffusion of solutes across
the cell sheet, and it also works as a boundary between the apical
and basolateral membrane domains to create their polarization
(Schneeberger and Lynch, 1992; Gumbiner, 1987, 1993). The
occurrence of TJs is thus essential for epithelial and endothelial
cells to exert their various physiological functions. Some unique
peripheral membrane proteins are reportedly localized at TJs
(Anderson et al., 1993; Citi, 1993). ZO-1, with a molecular mass
of 220 kDa, was first identified and is localized in the immediate
vicinity of the plasma membrane of TJs in epithelial and endothelial cells, whereas it is occasionally colocalized with
cadherins in cells lacking TJs, such as fibroblasts and cardiac
muscle cells (Stevenson et al., 1986, 1989; Anderson et al.,
1988; Itoh et al., 1991, 1993; Howarth et al., 1992; Tsukita et
al., 1992). ZO-2 with a molecular mass of 160 kDa was identified as a ZO-1-binding protein by immunoprecipitation
(Gumbiner et al., 1991; Jesaitis and Goodenough, 1994). Furthermore, monoclonal antibodies identified two other TJ-specific
peripheral proteins named cingulin and 7H6 antigen (Citi et al.,
1988; Zhong et al., 1993). However, the integral membrane
protein localizing at TJs remained elusive for quite some time.
Key words: Occludin, Tight junction, Baculovirus, Cell adhesion,
Freeze fracture
430
M. Furuse and others
branous lipids and proteins (Staehelin, 1974). In this study,
chicken occludin was overexpressed in insect cells by recombinant baculovirus infection. Most of the overexpressed
occludin molecules did not appear on the cell surface, and
instead, they were concentrated in peculiar multilamellar structures in the cytoplasm to form TJ-like structures, that is, to fuse
the opposing membranes. Immuno-replicas showed that short
TJ-like intramembranous particle strands occur in the
membranes of multilamellar structures, and that these strands
contain chicken occludin molecules. These data support the
notion that occludin plays a key role in the formation of a TJ.
MATERIALS AND METHODS
Cells and antibodies
Sf9 cells were purchased from Invitrogen Corporation (San Diego,
CA), and were grown in TC-100 medium (Gibco BRL, Gaitherburg,MD) supplemented with Bacto tryptose phosphate broth (Gibco
BRL) and 10% of FCS at 27ºC. Rat anti-chicken occludin mAbs (Oc1 and Oc-2) were obtained and characterized as described (Furuse et
al., 1993).
Recombinant baculovirus infection
The recombinant baculovirus was isolated using a MAXBACTM kit
(Invitrogen, San Diego, CA). A vector containing full length cDNA
of chicken occludin (pX1RSP) with a SpeI site just upstream of the
first ATG was first constructed, using PCR with primers
5′GGGATCGATACTAGTATGTTCAGCAAGAAGTCC3′ (sense)
and 5′CGTAATCCCAGGCGAGCGTGG3′ (antisense). Then the
occludin cDNA derived from pX1RSP by SpeI-BamHI digestion was
cloned into the NheI and BamHI site of the pBlueBac2 to produce the
baculovirus transfer vector pBacOC. This vector was co-transfected
with the wild-type baculovirus, AcMNPV DNA, into Sf9 cells, and
the recombinant virus BacOCV, was isolated and condensed. The Sf9
cells were infected with BacOCV at an m.o.i. of 10, incubated for 50
hours, then processed for immunoblotting, immunofluorescence
microscopy, or electron microscopy.
Isolation of multilamellar structures
Infected Sf9 cells (2×107) were collected and homogenized in 1 mM
NaHCO3 (pH 7.5)/1 mM PMSF using a tight-fitting Dounce homogenizer. Sucrose was added to the homogenate at a final concentration of 48% (w/v), overlaid on 55% sucrose, then centrifuged at
10,000 g for 2 hours in a swing rotor. The 48/55% band was collected,
resuspended in 1 mM NaHCO3 (pH 7.5)/1 mM PMSF, then centrifuged to recover the fraction enriched in the multilamellar structures as a pellet.
Laser scanning microscopy
Infected cells cultured on coverslips were fixed with 1% formaldehyde/PBS for 10 minutes, permeabilized with 0.2% Triton X-100/PBS
for 10 minutes, then incubated with anti-occludin mAb, Oc-2, for 30
minutes. After being washed and incubated with FITC-conjugated
goat anti-rat IgG (TAGO, Inc., Burlingame, CA), the cells were
observed under a laser scan microscope, Zeiss LSM310 (Carl Zeiss,
Inc., Oberkochen, Germany).
Thin section electron microscopy
Infected Sf9 cells were fixed with 2% paraformaldehyde/2.5% glutaraldehyde/0.1 M cacodylate buffer (pH 7.3) for 2 hours at room
temperature. Isolated multilamellar structures were fixed with the
same fixative containing 0.1% tannic acid. After washing in 0.1 M
cacodylate buffer (pH 7.3), samples were postfixed with 1% OsO4 in
0.1 M cacodylate buffer (pH 7.3) for 1 hour on ice. Samples were then
stained en bloc with 1% uranyl acetate, dehydrated with a graded
series of ethanols, and embedded in Epon 812. Ultrathin sections were
cut with a diamond knife, doubly stained with lead citrate and uranyl
acetate, then examined under a JEOL 1200EX electron microscope at
an accelerating voltage of 80 kV.
For immunoelectron microscopy of isolated multilamellar structures, the pellets were resuspended in 1% BSA/PBS and incubated in
anti-occludin mAbs, Oc-1 and Oc-2, followed by goat anti-rat IgG
coupled to 10 nm gold (Amersham, Corp., Arlington Heights, IL).
Samples were then fixed and processed for thin-section electron
microscopy as described above.
Immunoelectron microscopy on freeze-fracture replicas
The immunoelectron microscopic technique for examining freezefracture replicas was described in detail previously (Fujimoto, 1995).
A small block of chicken liver or a pellet of infected Sf9 cells was
quickly frozen by being slammed against a pure copper block cooled
by liquid helium gas (Heuser et al., 1979). The frozen samples were
fractured at −110°C and platinum-shadowed unidirectionally at an
angle of 45° in Balzers Freeze Etching System (BAF 400T; Balzers
Corp., Hudson, NH). The samples were immersed in a sample lysis
buffer containing 2.5% SDS, 10 mM Tris-HCl and 0.6 M sucrose (pH
8.2) for 12 hours at room temperature, and replicas floating off the
samples were washed with PBS. Under these conditions, integral
membrane proteins were captured by replicas, and their cytoplasmic
domain was accessible to antibodies. The replicas were incubated with
anti-occludin mAb (Oc-1) for 60 minutes, then washed with PBS
several times. They were then incubated with the goat anti-rat IgG
coupled to 10 nm gold (Amersham). The samples were washed with
PBS, picked up on Formvar-coated grids, and examined in a JEOL
1200EX electron microscope at an accelerating voltage of 80 kV.
Gel electrophoresis and immunoblotting
One-dimensional SDS-PAGE (12.5% gel) was based on the method
of Laemmli (1970). Gels were stained with Coomassie Brilliant Blue
R-250. For immunoblotting, proteins separated by SDS-PAGE were
electrophoretically transferred to nitrocellulose sheets, which were
then incubated with the antibodies. The antibodies were detected
using a blotting detection kit (Amersham).
RESULTS
Expression and distribution of chicken occludin in
baculovirus-infected Sf9 cells
We overexpressed chicken occludin in insect Sf9 cells by means
of recombinant baculovirus infection, in the expectation that
some occludin would appear on the cell surface. The chicken
occludin cDNA was integrated into the baculovirus genome, and
the recombinant virus containing the occludin cDNA was
isolated and condensed. Cultured insect Sf9 cells were infected
with the recombinant virus. Immunoblots with anti-chicken
occludin mAb, Oc-2, revealed that the chicken occludin
expressed in Sf9 cells was detected as broad bands of around 65
kDa (Fig. 1, lanes 1 and 2), although it was not detected by silver
staining of the whole cell lysate (see Fig. 4, lane 1). This profile
was identical to that of occludin included in the junctional
fraction isolated from the chicken liver (Fig. 1, lane 3).
When the Sf9 cells overexpressing chicken occludin were
observed by means of confocal immunofluorescence
microscopy, most of the expressed occludin was distributed
inside the cell in a granular manner (Fig. 2a). Thin-section
electron microscopy of these cells identified unusual electrondense membrane structures inside the cytoplasm, which were
never seen in Sf9 cells infected with normal baculoviruses
Overexpression of occludin
kDa
200
116
97
66
45
31
Fig. 1. Anti-occludin mAb (Oc-2) immunoblots of the whole cell
lysate (1 µg/lane) from non-infected Sf9 cells (lane 1), from Sf9 cells
infected with recombinant baculovirus carrying chicken occludin
cDNA (lane 2), and isolated junctional fraction (20 µg/lane) from
chicken liver (lane 3). The banding pattern in lanes 2 and 3 are
identical.
(Fig. 2b). These structures appeared to consist of thin parallel
or concentric lamellae.
Partial isolation of occludin-enriched multilamellar
structures
Since we thought that these multilamellar structures would be
composed of chicken occludin, we enriched them by homogenization followed by sucrose density gradient centrifugation. Thin-section electron microscopy showed that the multilamellar structures were recovered at the 48/55% interface
Fig. 2. Overexpression of chicken
occludin in insect Sf9 cells by
recombinant baculovirus infections.
(a) Confocal immunofluorescence
microscopic image of Sf9 cells
overexpressing chicken occludin.
Cells were stained with anti-occludin
mAb, Oc-2. Chicken occludin was
distributed inside the cytoplasm as
granular structures. (b) Thin section
electron microscopic images of Sf9
cells overexpressing chicken
occludin. Multilamellar structures
(arrows) are accumulated in the
cytoplasm. N, nucleus. Bars: (a) 10
µm; (b) 1 µm.
431
(Fig. 3a). When this fraction was incubated with anti-chicken
occludin mAbs followed by secondary antibody-conjugated
colloidal gold, the multilamellar structures were heavily
labeled (Fig. 3b). Furthermore, in the 48/55% fraction,
occludin was directly recognized by silver staining as well as
by immunoblotting (Fig. 4). These findings suggest that
expressed chicken occludin is highly concentrated in the multilamellar structures.
Thin-section electron microscopic images of
multilamellar structures
Using the glutaraldehyde-fixed Sf9 cells expressing occludin
or the fraction rich in the multilamellar structures fixed with
glutaraldehyde containing tannic acid to contrast the proteinous structures, we analyzed the ultrastructure of the multilamellar structures by thin-section electron microscopy (Fig.
5). These structures consisted of many disc-like lamellae, each
of which had a loop of membrane at both ends. This indicated
that each disc (lamella) was transformed from the intracellular
membranous cisternae, of which the luminal space was completely collapsed. Any structural continuity was hardly
observed between these multilamellar structures and typical
rough endoplasmic reticulum membranes/Golgi apparatus
membranes, leaving the origin of these multilamellar structures
unknown. In tannic acid-fixed preparations of isolated structures, on the cytoplasmic surface of each collapsed cisterna,
electron dense protrusions about 12 nm in length were densely
and rather regularly arranged. These protrusions are not
ribosomes, because the former was significantly less contrasted
as compared to the latter in glutaraldehyde-fixed cells (see Fig.
5a). By contrast, the outer leaflets of the opposing membranes
432
M. Furuse and others
Fig. 3. Enrichment of multilamellar
structures from Sf9 cells
overexpressing chicken occludin by
means of sucrose density gradient
centrifugation. (a) Low power electron
microscopic image of 48/55%
interface. (b) Immunoelectron
microscopic localization of chicken
occludin in isolated multilamellar
structures. Since, prior to embedding,
samples were incubated with the
mixture of anti-occludin mAbs, Oc-1
and Oc-2, only the surface of
multilamellar structures were labeled
(for comparison see Fig. 6a). Bars: (a)
1 µm; (b) 200 nm.
appeared to be fused with no gaps, and the pairs of membranes
occasionally part leaving some luminal gaps which lacked the
cytoplasmic protrusions (Fig. 5, inset).
Freeze-fracture images of multilamellar structures
Infected Sf9 cells expressing chicken occludin were freezefractured and immunolabeled with anti-occludin mAb. As
shown in Fig. 6a, all layers of the multilamellar structures were
heavily labeled with immunogold particles, confirming that
these structures were mainly composed of introduced chicken
occludin. In addition to these structures, plasma membranes
and nuclear envelopes were occasionally labeled, though there
were few gold particles on these structures (data not shown).
The fracture planes of the multilamellar structures labeled
with mAb were characterized by densely-packed intramembranous particles of about 10 nm in diameter (Fig. 6b). Close
inspection revealed that several particles occasionally aligned
to form short strands (Fig. 6b,c), measuring about 10 nm in
thickness, which was compatible with that of TJ strands in situ
(see Fig. 7). The strands were up to 50 nm in length.
DISCUSSION
mic domains of occludin, and the extracellular loops may be
directly involved in the fusion of the outer leaflets of opposing
membranes. This interpretation is highly consistent with the
findings that the cytoplasmic domain of band 3 proteins in
tannic acid-fixed erythrocyte membranes is visualized as cytoplasmic protrusions about 10 nm in length (Tsukita et al., 1980,
1981), and that these fused opposing membranes occasionally
part leaving some luminal gaps where the protrusions on
membranes were hardly detected (Fig. 5b; inset). These observations suggest that occludin by itself fuses the outer leaflets
of opposing membranes in multilamellar structures.
Intercellular junctions such as adherens junctions, desmosomes, and gap junctions are characterized by their own
specific intercellular distances, 20, 25, and 2 nm, respectively
(Revel and Karnovsky, 1967). These distances are determined
by respective cell adhesion molecules, cadherins (Takeichi,
1991), desmogleins/desmocolins (Holton et al., 1990; Koch et
al., 1990; Buxton et al., 1993), and connexins (Bennett et al.,
1991; Stauffer et al., 1991; Kumar and Gilula, 1992). In this
sense, the adhesion molecule in a TJ must be very unusual, as
kDa
200
When chicken occludin was overexpressed in insect Sf9 cells,
most of it was not targeted to the plasma membranes, but was
retained inside cells to form unusual multilamellar structures.
Our interpretation of the formation of these multilamellar
structures is as follows. Expressed occludin accumulates in
membranous vesicles or cisternae for unknown reasons,
resulting in the collapse of these cisternae to form lamellae.
These lamellae were characterized in thin-section electron
microscopic images by the discontinuous fusion of the outer
leaflets of opposing membranes and densely-arranged cytoplasmic protrusions. Occludin molecules consist of four transmembrane domains, a long carboxyl-terminal domain and a
short amino-terminal cytoplasmic domain (255 and 57 amino
acids, respectively), and two extracellular loops (44 amino
acids each) (Furuse et al., 1993). Therefore, the electron dense
protrusions in the tannic acid-fixed samples on the cytoplasmic
surface may be the morphological counterpart of the cytoplas-
116
97
66
45
31
Fig. 4. Enrichment of multilamellar structures. Silver staining profile
of whole cell lysate (2 µg/lane) from Sf9 cells overexpressing
chicken occludin (lane 1) and the fraction enriched with the
multilamellar structures (lane 2; see Fig. 3), as well as their
accompanying immunoblots (0.2 µg/lane) with anti-occludin mAb,
Oc-2 (lanes 3, 4). Occludin was enriched so that it became detectable
by silver staining (lane 2).
Overexpression of occludin
Fig. 5. Ultrastructure of the
multilamellar structures.
Electron microscopic
image of glutaraldehydefixed multilamellar
structures inside Sf9 cells
(a) and the isolated
multilamellar structures
fixed with a mixture
containing 0.1% tannic
acid (b) on ultrathin
sections. Each lamella has
a membrane loop at both
ends (arrows). In each
lamella, the outerleaflets of
opposing membranes are
fused with no gaps. In the
tannic acid-fixed,
cytoplasmic surface of the
membranes, electron dense
protrusions about 12 nm in
length are closely arranged (arrowheads). Fused opposing membranes are occasionally taken apart with some luminal gaps where the
protrusions on membranes are hardly detected (inset). Bars: (a and b) 100 nm.
Fig. 6. Immunoelectron microscopic images of
freeze-fracture replicas of occludin-enriched
structures labeled with the anti-occludin mAb,
Oc-1. In transversely-fractured images (a), all
layers of multilamellar structures are heavily
labeled (arrowheads). The fracture planes are
characterized by densely-packed
intramembranous particles of about 10 nm in
diameter (b). At higher magnification (c), in
addition to solitary particles (arrowhead),
several particles occasionally aligned to form a
short strand (arrow). Bars: (a and b) 200 nm;
(c) 100 nm.
433
434
M. Furuse and others
it completely obliterates the intercellular space to form a TJ.
Our present observations are consistent with the idea that
occludin is an adhesion molecule working at TJs, i.e. that
occludin can obliterate the intercellular space, although TJ-like
structures in Sf9 cells overexpressing occludin were observed
only in the intracellular multilamellar structures (not on the cell
surface) under the unphysiological conditions.
To directly address the question of whether or not occludin
works as an adhesion molecule at a TJ, we should establish
fibroblast transfectants expressing chicken occludin on their
surface, and show that a TJ is formed between these transfectants. However, we found that most of the introduced occludin
was distributed in the cytoplasm of fibroblasts (Furuse et al.,
1994). Also in Sf9 cells, expressed occludin was mostly concentrated in multilamellar structures and not on the plasma
membrane. Occludin is first incorporated into membranes at
the rough endoplasmic reticulum, but from which types of
intracellular membranous structures these multilamellar structures are derived remains elusive. These observations imply the
existence of a specific molecular machinery for the targeting
of occludin molecules to plasma membranes.
Another property expected for the TJ adhesion molecules is
the ability to form a linear polymer inside membranes, since in
freeze-fractures, TJs consists of variable numbers of parallel
interweaving strands of intramembranous particles in the fracture
face of the membrane (Staehelin, 1974). Fujimoto (1995) showed
by freeze-fracture and immunolabeling that occludin is a
component of TJ strands in epithelial cells in situ. However, this
procedure did not lend itself to estimating the density of the
occludin molecules in TJ strands. The degree to which occludin
contributes to the formation of TJ strands remains elusive.
The question arose as to whether or not TJ strands are reconstituted in the multilamellar structures where chicken occludin
molecules were expressed and densely packed. Freeze-fracture
combined with immunolabeling allowed us to identify which
membranous structures accumulated occludin and to examine
the arrangements of intramembranous particles within them. The
fracture plane of these structures was characterized by a large
number of particles of about 10 nm in diameter. A connexon
consisting of 6 connexin molecules (gap junction channel
molecules), which also bear four transmembrane domains of a
Fig. 7. Localization of occludin on a freezefracture replica of chicken liver. Tight junction
strands are exclusively labeled with anti-occludin
mAb, Oc-1. Bar, 200 nm.
similar molecular size to those of occludin, is visualized as an
intramembranous particle about 9-11 nm in diameter in freezefracture images (Yancey et al., 1979). Therefore, it is likely that
the 10 nm particle we found in the multilamellar structures
consists of several occludin molecules. However, the possibility
cannot be excluded at present, that single occludin molecules are
visualized as 10 nm intramembranous particles, or that this
particle represents a complex of occludin, lipids and other
unidentified membrane proteins. Very interestingly, these
particles tended to align to give a short TJ strand-like appearance. The length of these strands (up to 50 nm) indicated that 25 particles ‘polymerize’ into short strands within lipid bilayers
of multilamellar structures. This again favors the idea that
occludin is at least one of the major constituents of TJ strands.
So far, in addition to integral membrane proteins, two other
factors are thought to be involved in the formation of TJ strands:
peripheral membrane proteins and lipids. Some peripheral
membrane proteins such as ZO-1, ZO-2, cingulin, 7H6 antigen
etc. are reportedly localized at TJs, and are thought to be
involved in TJ formation (Anderson et al., 1993; Citi, 1993).
Among them, ZO-1 directly binds to the cytoplasmic domain
of occludin, and this binding appears to be required for occludin
molecules to be localized at TJs (Furuse et al., 1994). Although
the amino-terminal half of ZO-1 shows sequence similarity to
the dlg gene product in Drosophila (Itoh et al., 1993; Tsukita
et al., 1993; Willott et al., 1993), it remains unclear whether or
not a ZO-1 homologue occurs in insect cells such as Sf9. As
shown in Fig. 4, in partially isolated multilamellar structures
occludin, but no other high molecular mass proteins, were
remarkably enriched. Therefore, if a ZO-1 homologue is not
expressed in Sf9 cells, the lack of ZO-1 expression may partly
explain the shortness of occludin strands in the multilamellar
structures. The co-introduction of occludin and ZO-1 cDNAs
into Sf9 cells will evaluate this notion in the near future. The
involvement of the other TJ peripheral proteins in the formation
of TJ strands can also be tested in the same way.
Whether or not the TJ strand is of a proteinous or lipidic nature
is of some controversy (Pinto de Silva and Kachar, 1982; Kachar
and Reese, 1982; Verkleiji, 1984). The resistance of TJ strands
to the detergent treatment favored the protein hypothesis
(Stevenson and Goodenough, 1984), but some histochemical
Overexpression of occludin
analyses have suggested that TJ strands are composed at least of
phospholipids (Kan, 1993). Therefore, the shortness of the
occludin strand in multilamellar structures may be partly attributed to the lack of a unique lipid in Sf9 cells. Now that high levels
of recombinant occludin can be purified from infected Sf9 cells,
the interaction between occludin and lipid should be examined in
various kinds of liposomes in vitro from the perspective of the
TJ strand formation. Along these lines, the relationship between
the TJ strand formation and occludin ‘polymerization’ within the
membrane is currently being analyzed in our laboratory.
We thank all the members of our laboratory, especially Drs A.
Nagafuchi, S. Yonemura, and M. Itoh, for their helpful discussions
throughout this study. T. Hirase thanks Prof. M. Yokoyama (Kobe
University) for providing him with the opportunity to work in the Laboratory of Cell Biology in National Institute for Physiological
Sciences. This work was supported in part by a Grant-in-Aid for
Cancer Research and a Grant-in-Aid for Scientific Research (A) from
the Ministry of Education, Science and Culture of Japan, and by
research grants from the Yamada Science Foundation, the Mitsubishi
Foundation, and the Toray Science Foundation (to Sh. Tsukita) and
in part by a Grant-in-Aid for Scientific Research (C) (to K. Fujimoto).
REFERENCES
Anderson, J. M., Stevenson, B. R., Jesaitis, L. A., Goodenough, D. A. and
Mooseker, M. S. (1988). Characterization of ZO-1, a protein component of
the tight junction from mouse liver and Madin-Darby canine kidney cells. J.
Cell Biol. 106, 1141-1149.
Anderson. J. M., Balda, M. S. and Fanning, A. S. (1993). The structure and
regulation of tight junctions. Curr. Opin. Cell Biol. 5, 772-778.
Bennett, M. W. L., Barrio, L. C., Bargiello, T. A., Spray, D. C., Hertzberg,
E. and Saez, J. C. (1991). Gap junctions: new tools, new answers, new
questions. Neuron 6, 305-320.
Buxton, R. S., Cowin, P., Franke, W. W., Garrod, D. R., Green, K. J., King, I.
A., Koch, P. J., Magee, A. I., Rees, D. A., Stanley, J. R. and Steinberg, M. S.
(1993). Nomenclature of the desmosomal cadherins. J. Cell Biol. 121, 481-483.
Citi, S., Sabanay, H., Jakes, R., Geiger, B. and Kendrick-Jones, J. (1988).
Cingulin, a new peripheral component of tight junctions. Nature 33, 272-276.
Citi, S. (1993). The molecular organization of tight junctions. J. Cell Biol. 121,
485-489.
Farquhar, M. G. and Palade, G. E. (1963). Junctional complexes in various
epithelia. J. Cell Biol. 17, 375-409.
Fujimoto, K. (1995). Freeze-fracture replica electron microscopy combined
with SDS digestion for cytochemical labeling of integral membrane proteins.
Application to the immunogold labeling of intercellular junctional
complexes. J. Cell Sci. 108, 3443-3449.
Furuse, M., Hirase, T., Itoh, M., Nagafuchi, A., Yonemura, S., Tsukita, Sa.
and Tsukita, Sh. (1993). Occludin: a novel integral membrane protein
localizing at tight junctions. J. Cell Biol. 123, 1777-1788.
Furuse, M., Itoh, M., Hirase, T., Nagafuchi, A., Yonemura, S., Tsukita, Sa.
and Tsukita, Sh. (1994). Direct association of occludin with ZO-1 and its
possible involvement in the localization of occludin at tight junctions. J. Cell
Biol. 127, 1617-1626.
Gumbiner, B. (1987). Structure, biochemistry, and assembly of epithelial tight
junctions. Am. J. Physiol. 253, C749-C758.
Gumbiner, B., Lowenkopf, T. and Apatira, D. (1991). Identification of a 160
kDa polypeptide that binds to the tight junction protein ZO-1. Proc. Nat.
Acad. Sci. USA 88, 3460-3464.
Gumbiner, B. (1993). Breaking through the tight junction barrier. J. Cell Biol.
123, 1631-1633.
Heuser, J. E., Reese, T. S., Dennis, M. J., Jan, Y., Jan, L. and Evans, L.
(1979). Synaptic vesicle exocytosis captured by quick freezing and
correlated with quantal transmitter release. J. Cell Biol. 81, 275-300.
Holton, J. L., Kenny, T. P., Legan, P. K., Collins, J. E., Keen, J. N., Sharma,
R. and Garrod, D. R. (1990). Desmosomal glycoproteins 2 and 3
(desmocollins) show N-terminal similarity to calcium-dependent cell-cell
adhesion molecules. J. Cell Sci. 97, 239-246.
435
Howarth, A. G., Hughes, M. R. and Stevenson, B. R. (1992). Detection of the
tight junction-associated protein ZO-1 in astrocytes and other nonepithelial
cell types. Am. J. Physiol. 262, C461-469.
Itoh, M., Yonemura, S., Nagafuchi, A., Tsukita, Sa. and Tsukita, Sh.
(1991). A 220-kD undercoat-constitutive protein: Its specific localization at
cadherin-based cell-cell adhesion sites. J. Cell Biol. 115, 1449-1462.
Itoh, M., Nagafuchi, A., Yonemura, S., Kitani-Yasuda, T., Tsukita, Sa. and
Tsukita, Sh. (1993). The 220-kD protein colocalizing with cadherins in nonepithelial cells is identical to ZO-1, a tight junction-associated protein in
epithelial cells: cDNA cloning and immunoelectron microscopy. J. Cell Biol.
121, 491-502.
Jesaitis, L. A. and Goodenough, D. A. (1994). Molecular characterization and
tissue distribution of ZO-2, a tight junction protein homologous to ZO-1 and
the Drosophila discs-large tumor suppresser protein. J. Cell Biol. 124, 949-961.
Kachar, B. and Reese, T. S. (1982). Evidence for the lipidic nature of tight
junction strands. Nature 296, 464-466.
Kan, F. W. K. (1993). Cytochemical evidence for the presence of
phospholipids in epithelial tight junction strands. J. Histochem. Cytochem.
41, 649-656.
Koch, P. J., Walsh, M. J., Schmelz, M., Goldschmidt, M. D., Zimbelmann,
R. and Franke, W. W. (1990). Identification of desmoglein, a constitutive
desmosomal glycoprotein, as a member of the cadherin family of cell
adhesion molecule. Eur. J. Cell Biol. 53, 1-12.
Kumar, N. M. and Gilula, N. B. (1992). Molecular biology and genetics of gap
junction channels. Semin. Cell Biol. 3, 3-16.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature 227, 680-685.
Pinto da Silva, P. and Kachar, B. (1982). On tight junction structure. Cell 28,
441-450.
Revel, J. P. and Karnovsky, M. J. (1967). Hexagonal array of subunits in
intercellular junctions of the mouse heart and liver. J. Cell Biol. 33, C7-C12.
Schneeberger, E. E. and Lynch, R. D. (1992). Structure, function, and
regulation of cellular tight junctions. Am. J. Physiol. 262, L647-L661.
Staehelin, L. A. (1974). Structure and function of intercellular junctions. Int.
Rev. Cytol. 39, 191-282.
Stauffer, K. A., Kumar, N. M., Gilula, N. M. and Unwin, N. (1991). Isolation
and purification of gap junction channels. J. Cell Biol. 115, 141-150.
Stevenson, B. R., Siliciano, J. D., Mooseker, M. S. and Goodenough, D. A.
(1986). Identification of ZO-1: a high molecular weight polypeptide
associated with the tight junction (zonula occludens) in a variety of epithelia.
J. Cell Biol. 103, 755-766.
Stevenson, B. R., Heintzelman, M. B., Anderson, J. M., Citi, S. and
Mooseker, M. S. (1989). ZO-1 and cingulin: tight junction proteins with
distinct identities and localizations. Am. J. Physiol. 257, C621-C628.
Takeichi, M. (1991). Cadherin cell adhesion receptors as a morphogenetic
regulator. Science 251, 1451-1455.
Tsukita, Sa., Tsukita, Sh. and Ishikawa, H. (1980). Cytoskeletal network
underlying the human erythrocyte membrane. Thin-section electron
microscopy. J. Cell Biol. 85, 567-576.
Tsukita, Sa., Tsukita, Sh., Ishikawa, H., Sato, S. and Nakao, M. (1981).
Electron microscopic study of reassociation of spectrin and actin with the
human erythrocyte membrane. J. Cell Biol. 90, 70-77.
Tsukita, Sh., Tsukita, Sa., Nagafuchi, A. and Yonemura, S. (1992).
Molecular linkage between cadherins and actin filaments in cell-to-cell
adherens junctions. Curr. Opin. Cell Biol. 4, 834-839.
Tsukita, Sh., Itoh, M., Nagafuchi, A., Yonemura, S. and Tsukita, Sa.
(1993). Submembranous junctional plaque proteins include potential tumor
suppresser molecules. J. Cell Biol. 123, 1049-1053.
Verkleiji, A. J. (1984). Lipidic intramembranous particles. Biochim. Biophys.
Acta A 779, 43-63.
Willott, E., Balda, M. S., Fanning, A. S., Jameson, B., Van Itallie, C. and
Anderson, J. M. (1993). The tight junction protein ZO-1 is homologous to
the Drosophila discs-large tumor suppresser protein of septate junctions.
Proc. Nat. Acad. Sci. USA 90, 7834-7838.
Yancey, S. B., Easter, D. and Revel, J.-P. (1979). Cytological changes in gap
junctions during liver regeneration. J. Ultrastruct. Res. 67, 229-242.
Zhong, Y., Saitoh, T., Minase, T., Sawada, N., Enomoto, K. and Mori, M.
(1993). Monoclonal antibody 7H6 reacts with a novel tight junctionassociated protein distinct from ZO-1, cingulin and ZO-2. J. Cell Biol. 120,
477-483.
(Received 19 September 1995 - Accepted 31 October 1995)