This information is current as
of June 18, 2017.
The Influences of Hinge Length and
Composition on the Susceptibility of Human
IgA to Cleavage by Diverse Bacterial IgA1
Proteases
Bernard W. Senior and Jenny M. Woof
J Immunol 2005; 174:7792-7799; ;
doi: 10.4049/jimmunol.174.12.7792
http://www.jimmunol.org/content/174/12/7792
Subscription
Permissions
Email Alerts
This article cites 36 articles, 21 of which you can access for free at:
http://www.jimmunol.org/content/174/12/7792.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2005 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
The Journal of Immunology
The Influences of Hinge Length and Composition on the
Susceptibility of Human IgA to Cleavage by Diverse Bacterial
IgA1 Proteases1
Bernard W. Senior and Jenny M. Woof2
S
ome important pathogenic bacteria like, for example, the
respiratory tract pathogens Streptococcus pneumoniae,
Haemophilus influenzae, and Neisseria meningitidis and
the genital tract pathogens Neisseria gonorrhoeae and Ureaplasma
urealyticum, have the ability to initiate infection at mucosal surfaces of the body. This process is thought to be facilitated by the
secretion of proteolytic enzymes, termed IgA1 proteases (see reviews Refs. 1–3), which specifically cleave the protective IgA1 in
the hinge of the ␣ H chain to generate Fab and Fc fragments. As
a consequence, these invading pathogens escape IgA1-mediated
agglutination and elimination mechanisms. Furthermore, epitopes
on the pathogens are masked by the Fabs formed, thereby masking
recognition of epitopes by other intact Igs (4, 5).
Additional evidence that IgA1 proteases are involved in virulence comes from observations that the amount of enzyme secreted
is directly related to the pathogenicity of the isolate (6); strains of
related species that do not produce IgA1 protease are nonpathogenic (7, 8); the products of IgA1 cleavage are detectable in the
CSF, vaginal washings, and other body fluids of patients infected
with an IgA1 protease-producing strain (9 –11); and Ab to the
IgA1 protease is found in convalescing patients recovering from
infection with an IgA1 protease-producing pathogen (12–14).
However, because the substrate for IgA1 proteases is restricted
almost exclusively (15–17) to IgA1 from human, gorilla, chimDivision of Pathology and Neuroscience, University of Dundee Medical School, Ninewells Hospital, Dundee, United Kingdom
Received for publication February 3, 2005. Accepted for publication March 30, 2005.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work is supported by funding from the Wellcome Trust (to J.M.W.).
2
Address correspondence and reprint requests to Dr. Jenny M. Woof, Division of
Pathology and Neuroscience, University of Dundee Medical School, Ninewells Hospital, DD1 9SY Dundee, U.K. E-mail address: [email protected]
Copyright © 2005 by The American Association of Immunologists, Inc.
panzee, and the IgA of the orangutan (18), it is difficult to prove
that IgA1 proteases are virulence factors in vivo. However, IgA1
protease has recently been shown to give in vivo and in vitro
protection against IgA-mediated killing of S. pneumoniae (19).
Moreover, IgA1 specific for S. pneumoniae has been shown to
loose its protective effects when cleaved by IgA1 protease, with
the resultant Fab actually enhancing adherence of pneumococci to
host cells (20).
Although the IgA1 proteases produced by different bacteria belong to widely different families, namely, serine-, metallo-, and
thiol-proteases, they all cleave human IgA1 only in the hinge. The
IgA1 hinge comprises a duplication of a sequence of eight amino
acids rich in proline, threonine, and serine (see Fig. 1). It is absent
from human IgA2, which is thereby resistant to cleavage by the
proteases. The IgA1 proteases are all postproline endopeptidases
and cleave at either a Pro-Ser (type 1 enzyme) or a Pro-Thr (type
2 enzyme) peptide bond. However, the enzymes are extremely
specific in that the enzyme of a given bacterium cleaves a specific
peptide bond in only one of the duplicated sequences of amino
acids and not at the equivalent site in the other duplicate.
To understand more about the features of human IgA influencing such proteolytic cleavage, and to begin assessing the feasibility
of preparing specific inhibitors for the IgA1 proteases, this study
sought to examine the influence of variations in the structure and
size of the IgA hinge on its sensitivity to cleavage. A series of IgA
Abs with defined hinge mutations were constructed and tested for
their susceptibility to cleavage by different IgA1 proteases.
Materials and Methods
Primers
Primers A1H6 and A2SEQ2, which anneal upstream of the CH1 exon and
within the CH2 exon, respectively, of human IgA2m(1) have been previously described (21). Primer 4PDELS (5⬘-TGCTGCCACCCCCGACT
GTCGCTGCAC-3⬘) contained the nucleotide sequence 701–727 of the
CH2 exon of human IgA2m(1). Primer 4PDELAS (5⬘-AGATGGGGTAG
0022-1767/05/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
The influences of IgA hinge length and composition on its susceptibility to cleavage by bacterial IgA1 proteases were examined
using a panel of IgA hinge mutants. The IgA1 proteases of Streptococcus pneumoniae, Streptococcus sanguis strains SK4 and SK49,
Neisseria meningitidis, Neisseria gonorrhoeae, and Haemophilus influenzae cleaved IgA2-IgA1 half hinge, an Ab featuring half of
the IgA1 hinge incorporated into the equivalent site in IgA1 protease-resistant IgA2, whereas those of Streptococcus mitis, Streptococcus oralis, and S. sanguis strain SK1 did not. Hinge length reduction by removal of two of the four C-terminal proline residues
rendered IgA2-IgA1 half hinge resistant to all streptococcal IgA1 metalloproteinases but it remained sensitive to cleavage by the
serine-type IgA1 proteases of Neisseria and Haemophilus spp. The four C-terminal proline residues could be substituted by alanine
residues or transferred to the N-terminal extremity of the hinge without affect on the susceptibility of the Ab to cleavage by
serine-type IgA1 proteases. However, their removal rendered the Ab resistant to cleavage by all the IgA1 proteases. We conclude
that the serine-type IgA1 proteases of Neisseria and Haemophilus require the Fab and Fc regions to be separated by at least ten
(or in the case of N. gonorrhoeae type I protease, nine) amino acids between Val222 and Cys241 (IgA1 numbering) for efficient access
and cleavage. By contrast, the streptococcal IgA1 metalloproteinases require 12 or more appropriate amino acids between the Fab
and Fc to maintain a minimum critical distance between the scissile bond and the start of the Fc. The Journal of Immunology,
2005, 174: 7792–7799.
The Journal of Immunology
Construction of mutant Ab expression vectors
The Ab expression vectors constructed, the nomenclature of the Abs they
generated, and their amino acid sequence in the hinge region are illustrated
(see Fig. 1). The IgA2-IgA1 half hinge expression vector pBS2 carried
downstream of the mouse VNP gene, the ␣-chain gene of human IgA2m(1)
with nucleotides coding for half of the hinge of human IgA1 inserted between the CH1 and CH2 domains (22). A BamHI and XhoI fragment
(⬃760 bp) comprising the 5⬘ end of this ␣-chain construct was ligated into
the multiple cloning site of pSP73 to generate pBS3. Using primers
4PDELS and 4PDELAS, and pBS3 as template, a product of ⬃3.2 kb was
formed by inverted PCR (23), which was phosphorylated and self-ligated.
The resultant plasmid was cleaved with BamHI and XhoI and the ⬃730 bp
fragment ligated into pBS2, replacing the original BamHI-XhoI fragment.
Sequence analysis revealed that accidental deletion of an additional base
had occurred 3⬘ to the intended deletion. This error was repaired through
a further round of overlap PCR using primers DELREP1 and DELREP2 as
internal primers and A1H6 and A1H5 as flanking primers and the same
BamHI and XhoI sites for insertion of the corrected segment into the expression vector to generate pBS5.
Plasmid pBS14 was constructed by PCR overlap extension mutagenesis
(24) using pBS2 as template and A1H6 and A2SEQ2 as flanking primers
and 4ALREPS and 4ALREPAS as internal primers. Plasmids pBS13 and
pBS15 were constructed in a similar way with the same flanking primers
but with pBS5 DNA as template, and 2PROADDS and 2PROADDAS as
internal primers for pBS13, and 4PRONS and 4PRONAS as internal primers for pBS15. In each case, the ⬃915 bp fragment formed, which contained a mutated form of half the IgA1 hinge region, was cleaved with
BamHI and XhoI and the product was ligated into the BamHI- and XhoIcleaved site of the original IgA2m(1) expression vector (25), replacing the
wild-type sequence in this region.
The Ab expression vector pBS26 was also constructed by PCR overlap
extension mutagenesis but with plasmid pBS1 (pSP73 containing a
BamHI-XhoI fragment of the 5⬘ end of the human IgA2m(1) gene in its
multiple cloning site) as template DNA and A1H6 and A1H5 as flanking
primers and PTPSHINGE1 and PTPSHINGE2 as internal primers. The
product of ⬃1100 bp was cleaved with BamHI and XhoI, and the ⬃760 bp
product was ligated into the BamHI- and XhoI-cleaved site of the original
IgA2m(1) expression vector (25), replacing the wild-type sequence in this
region.
For all the constructed expression vectors, sequencing by an ABI 377
DNA sequencer confirmed that the base sequence around the half hinge of
IgA1 had been modified as intended and that no PCR-generated errors had
occurred in other coding regions.
Preparation of recombinant mutant Igs
Chinese hamster ovary CHO-K1 cells stably transfected previously with an
appropriate mouse ␭ L chain (25) were seeded in tissue culture-grade petri
dishes and transfected with a constructed ␣ H chain expression vector
using calcium phosphate as previously described (25). Positive transfectants were isolated by selection for the bacterial xanthine-guanine phosphoribosyltransferase selectable marker by growth in medium supplemented with hypoxanthine and thymidine (HT supplement; Invitrogen Life
Technologies), xanthine (0.25 mg/ml), and mycophenolic acid (10 ␮g/ml).
Several resistant colonies were picked, and cell lines producing the highest
yields of IgA were identified by an ELISA measuring binding to the Ag
NIP (3-nitro-4-hydroxy-5-iodophenylacetate) as previously described (25)
before expansion into large cultures. Recombinant Abs were purified from
the supernatants of the CHO-K1 transfectant cultures by affinity chromatography on NIP-Sepharose as previously described (25). The purified Abs
were supplemented with 0.1% sodium azide and stored in small aliquots at
⫺20°C.
Microbial IgA1 proteases
The IgA1 proteases used were from: S. pneumoniae strain SK690; Streptococcus oralis strain SK10; Streptococcus sanguis strains SK1 (American
Type Culture Collection 10556) (biovar 1), SK4 (biovar 2), and SK49
(biovar 4); Streptococcus mitis biovar 1 strains SK564, SK597, and SK599;
N. meningitidis group B serotype 14 strain 3564 (type 1 enzyme) and group
Y serotype 2c strain HF 13 (type 2 enzyme); N. gonorrhoeae serogroup WI
serovar 1A-2 strain 6092 (type 1 enzyme) and serogroup WII/III serovar
1B-6 strain 5489 (type 2 enzyme); and Haemophilus influenzae strains H23
(type 1 enzyme) and H15 (type 2 enzyme).
The streptococcal strains were cultured in 2TY broth (tryptone 1.6%,
yeast extract 1%, sodium chloride 0.5% in distilled water, pH 7) at 37°C in
air containing 5% CO2 and their IgA1 proteases concentrated and purified
from the culture supernatants by fractional ammonium sulfate precipitation
and subsequent dialysis against PBS (pH 7.2) containing 0.1% sodium
azide. The other bacteria were cultured at 37°C in air containing 5% CO2
on dialysis tubing membranes on the surface of appropriate solid culture
media as previously described (26) and their IgA1 proteases prepared similarly from the supernatants of the suspensions of the bacteria washed from
the dialysis tubing membranes with PBS containing 0.1% sodium azide.
Digestion of rIgs with microbial IgA1 proteases and
immunoblotting
Appropriate amounts of Ab and IgA1 protease in PBS (pH 7.2) containing
0.1% sodium azide in a final volume of 20 ␮l were incubated at 37°C for
24 h. The reactions were stopped by the addition of 10 ␮l of sample buffer
(8 M urea, 1% SDS, 10% glycerol, 4% 2-ME and a trace of bromophenol
blue dye in 50 mM Tris-HCl buffer pH 6.8) and boiling for 5 min. The
reduced reaction mixtures were electrophoresed on SDS-10% polyacrylamide gels and the separated proteins transferred to nitrocellulose membranes. The membranes were blocked by agitation for 30 min in 5% nonfat
dried milk powder in PBS containing 0.1% Tween 20 and then immersed
in a 1/1000 dilution of HRP-labeled goat Ab to human IgA (␣-Fab-specific;
Kirkegaard & Perry Laboratories) in PBS containing 0.1% Tween 20 and
agitated for 2 h at room temperature. After thorough washing in several
changes of PBS, the membranes were developed in 10 ml of 50 mM TrisHCl pH 7.6 buffer containing 0.3 mg/ml nickel chloride, 10 mg of diaminobenzidine, and 60 ␮l of 30% hydrogen peroxide.
Results
Previous experiments showed that all the different bacterial IgA1
proteases cleaved recombinant wild-type human IgA1 to give fragments of mass consistent with cleavage in the hinge (22, 27). However, recombinant human IgA2 was resistant to cleavage with
these enzymes. These findings indicated that the only proteolytic
activity in the different enzyme preparations was that of an IgA1
protease.
A series of mutants were produced based on a hybrid IgA2/IgA1
half hinge Ab in which a sequence representing half of the duplicated hinge region of IgA1 was incorporated into the equivalent
position in IgA2 (22) (Fig. 1). IgA2-IgA1 half hinge was cleaved
by the different IgA1 proteases of all the streptococcal strains
except for those of S. oralis strain SK10, S. sanguis strain SK1,
and S. mitis strains SK564, SK597, and SK599 (Fig. 2), which
also failed to cleave the Abs hh⌬4ProC, hh⌬2ProC, hh4AlaC,
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
GTGGAGTTGAGGGAAC-3⬘) was complementary to the nucleotide sequence of half of the hinge of human IgA1 (in italics) and to nucleotides
688 – 683 at the start of the CH2 exon of human IgA2m(1). Primer DELREP2 (5⬘-CTACCCCATCTTGCTGCCACCCC-3⬘) contained the nucleotide sequence of part of half of the IgA1 hinge (in italics) and that of
nucleotides 701–712 of human IgA2m(1). Primer DELREP1 (5⬘TCGGGGGTGGCAGCAAGATGGGGTAG-3⬘) was the complement of
primer DELREP2 extended by three bases at the 5⬘ end. Primer 4ALREPS
(5⬘-TACCCCATCTGCAGCTGCCGCATGCTGCCA-3⬘) contained the
nucleotide sequence of part of the hinge of human IgA1 (in italics), and the
nucleotide sequence 689 –708 of the CH2 exon of human IgA2m(1) in
which some C nucleotides had been substituted with a G nucleotide (in
bold) to code for alanine instead of proline. Primer 4ALREPAS was the
complement of primer 4ALREPS.
Primer 2PROADDS (5⬘-CACCTACCCCATCTCCACCTTGCTGCCA
CCCCCGA-3⬘) contained the nucleotide sequence of part of the hinge of
human IgA1 (in italics) and that of nucleotides 689 – 694 (underlined) and
701–715 of the CH2 exon of human IgA2m(1). Primer 2PROADDAS was
the complement of primer 2PROADDS. Primer 4PRONS (5⬘-CTCTC
CACTCCAGTTCCCCCACCTCCCCCATCAACTCCACCTACCCCA-3⬘)
contained the sequence of nucleotides 671–700 of human IgA2m(1) and
that of part of the hinge of human IgA1 (in italics). Primer 4PRONAS was
the complement of primer 4PRONS. Primer PTPSHINGE1 (5⬘-CTCTC
CACTCCAGTTCCCCCTACGCCAAGTCCACCTCCCCCATGCTGC3⬘) contained the sequence of nucleotides (in bold) coding for Pro, Thr,
Pro, and Ser between (underlined) nucleotides 671– 688 and 689 –706 at
the start of the CH2 exon of human IgA2m(1). Primer PTPSHINGE2 was
complementary to primer PTPSHINGE1. Primer A1H5 (5⬘-CCACCTCT
GACTTGA-3⬘) was complementary to nucleotides 424 – 438 of the vector
pSP73 (Promega).
7793
7794
IgA HINGE LENGTH ON SUSCEPTIBILITY TO IgA1 PROTEASES
FIGURE 1. The amino acid sequences of the hinge region of wild-type
human IgA1, IgA2m(1) and the mutant recombinant IgA Abs constructed.
The wild-type IgA1 hinge contains a duplicate of eight amino acids, one
underlined by a solid line, the other underlined by a broken line. The hinge
insertions into IgA2m(1) are shown in gray boxes. The sites of cleavage of
the different bacterial IgA1 proteases in the wild-type IgA1 hinge are
indicated.
FIGURE 2. Western blot analysis under reducing conditions of wildtype human IgA1 (lanes 1–5) and IgA2-IgA1 half hinge Ab (hh) (lanes
6 –10) untreated (⫺) (lanes 1 and 6) or treated with (⫹) IgA1 proteases
from S. pneumoniae (lanes 2 and 7), S. oralis (lanes 3 and 8), S. sanguis
strain SK1 (lanes 4 and 9), and S. mitis strain SK599 (lanes 5 and 10) and
probed with an anti-human ␣-chain-specific peroxidase conjugate that
bound to Fab epitopes. The positions of molecular mass markers (kilodaltons, left) are indicated. Although IgA1 proteases from all the streptococcal
species cleaved wild-type IgA1, those of S. oralis, S. mitis, and S. sanguis
strain SK1, unlike that of S. pneumoniae, were unable to cleave IgA2-IgA1
half hinge Ab. Some lanes contain Fab fragments of more than one size,
believed to represent different glycoforms of the Abs. Variation between
lanes in this respect reflects differential stripping of sugar moieties by glycosidases present to differing extents in the various species, which copurify
with the IgA1 protease.
create an Ab that was resistant to all the proteases of all the strains
tested. If only two of the proline residues were removed as in
hh⌬2ProC, the Ab was resistant to cleavage with the streptococcal
IgA1 proteases but remained sensitive to cleavage with the type 1
and 2 IgA1 proteases of N. meningitidis, N. gonorrhoeae, and H.
influenzae (Fig. 6).
Replacement of the four proline residues at the C terminus of the
IgA1 half hinge with alanine residues as in hh4AlaC, or their transfer to the N terminus of the IgA1 half hinge as in hh4ProN, resulted in the creation of Abs that were fully sensitive to the type 1
and 2 IgA1 proteases of N. meningitidis, N. gonorrhoeae, and H.
influenzae (Fig. 5 and Table I). Indeed, hh4ProN appeared as sensitive, if not more sensitive, to some of these IgA1 proteases than
IgA2-IgA1 half hinge from which it was derived (Fig. 7 and
Table I).
hh⌬STP in which the hinge region, taken to be the region lying
between Val222 and Cys241 (wild-type IgA1 numbering), was
shortened to only nine amino acids and was resistant to cleavage
by all of the IgA1 proteases except for that of N. gonorrhoeae type
1 (Fig. 8 and Table I). Thus for this enzyme, a mutation that effectively represents the insertion of just four amino acids (ProThr-Pro-Ser) into the hinge region of IgA2 is sufficient to render a
previously resistant Ab sensitive to cleavage.
FIGURE 4. Western blot analysis under reducing conditions of Ab
IgA2-IgA1 half hinge (hh) (lanes 1 and 2) and other Abs as indicated (lanes
3 to 10) treated with (⫹) S. pneumoniae IgA1 protease (lanes 2, 4, 6, 8, and
10) or untreated (⫺) (lanes 1, 3, 5, 7, and 9) and probed with an anti-human
␣-chain-specific peroxidase conjugate that bound to Fab epitopes. The positions of molecular mass markers (kilodaltons, left) are indicated. S. pneumoniae IgA1 protease cleaved IgA2-IgA1 hh and hh4AlaC but hh⌬4ProC,
hh⌬2ProC, and hh4ProN were resistant to cleavage. The slight diminution
in mass of the treated undigested IgA is a result of glycosidase activity in
the protease preparation.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
hh4ProN, and hh⌬STP derived from IgA2-IgA1 half hinge (Fig. 3
and Table I). The IgA1 proteases of the other streptococcal strains
that cleaved the IgA2-IgA1 half hinge Ab were also unable to
cleave Abs hh⌬4ProC, hh⌬2ProC, hh4ProN, and hh⌬STP but
most gave partial cleavage of the hh4AlaC Ab. The results of
incubation of some of these Abs with the protease of S. pneumoniae are shown in Fig. 4 as an example.
By contrast, the type 1 and type 2 IgA1 proteases from H. influenzae, N. meningitidis, and N. gonorrhoeae were much more
active than the streptococcal IgA1 proteases on IgA2-IgA1 half
hinge and most of the Abs derived from it. All these IgA1 proteases cleaved IgA2-IgA1 half hinge, hh4AlaC, hh4ProN, and
hh⌬2ProC. However, hh⌬4ProC was resistant to cleavage by all
the IgA1 proteases. The results of incubation of some of the Abs
with the N. gonorrhoeae type 2 enzyme are shown in Fig. 5 as an
example. Thus the effect of removing the four proline residues at
the C terminus of the IgA1 half hinge, as in hh⌬4ProC, was to
FIGURE 3. Western blot analysis under reducing conditions of Ab
IgA2-IgA1 half hinge (hh) (lanes 1 and 2) and other Abs as indicated
(lanes 3–10) treated with (⫹) S. oralis IgA1 protease (lanes 2, 4, 6, 8, and
10) or untreated (⫺) (lanes 1, 3, 5, 7, and 9) and probed with an anti-human
␣-chain-specific peroxidase conjugate that bound to Fab epitopes. The positions of molecular mass markers (kilodaltons, left) are indicated. All the
Abs were resistant to digestion with the S. oralis IgA1 protease. The slight
diminution in mass of the treated Abs is a result of glycosidase activity in
the protease preparation.
The Journal of Immunology
7795
Table I. Sensitivity of hinge mutants to bacterial IgA1 proteasesa
Sensitivity
Source of IgA1 protease
hh
hh⌬4ProC
hh⌬2ProC
hh4AlaC
hh4ProN
hh⌬STP
S. pneumoniae SK690
S. oralis SK10
S. sanguis SK1
S. sanguis SK4
S. sanguis SK49
S. mitis SK564
S. mitis SK597
S. mitis SK599
N. meningitidis type 1 3564
N. meningitidis type 2 HF13
N. gonorrhoeae type 1 6092
N. gonorrhoeae type 2 5489
H. influenzae type 1 H23
H. influenzae type 2 H15
⫹⫹
0
0
⫹⫹
⫹
0
0
0
⫹⫹⫹
⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
⫹⫹⫹
⫹⫹
⫹⫹
⫹⫹
⫹⫹
⫹
⫹
0
0
⫹
0
0
0
0
⫹⫹⫹⫹
⫹⫹⫹⫹
⫹⫹⫹⫹
⫹⫹⫹⫹
⫹⫹⫹⫹
⫹⫹
0
0
0
0
0
0
0
0
⫹⫹
⫹⫹⫹
⫹⫹⫹⫹
⫹⫹⫹
⫹⫹⫹⫹
⫹⫹⫹
0
0
0
0
0
0
0
0
0
0
⫹⫹
0
0
0
a
Sensitivities of the different hinge mutants to bacterial IgA1 proteases, expressed as the percentage of Ab cleaved after incubation at 37°C under the experimental conditions
outlined in Materials and Methods, determined by densitometric analysis of Western blots probed with anti-IgA Ab. hh, IgA2-IgA1 half hinge; 0, no cleavage; ⫹, 1–10%
cleavage; ⫹⫹, 11–25% cleavage; ⫹⫹⫹, 26 –50% cleavage; ⫹⫹⫹⫹, ⬎50% cleavage.
A necessary requirement, although not the only one (28), for IgA
sensitivity to cleavage by an IgA1 protease is the presence of a
suitable amino acid sequence in the hinge. The only known IgA
molecules to contain such a hinge sequence are the IgA1 isotypes
of human, chimpanzee, and gorilla and the IgA of the orangutan
(18). The hinge regions (lying between Val222 and Cys241 in human IgA1 or their equivalents) of these IgA1 protease-susceptible
substrates are 16 –18 aa long and are very similar in amino acid
sequence, being particularly rich in proline, serine, and threonine
(Table II). The hinge regions of the IgA2 isotypes in these species
are much shorter being only five amino acids long between the
equivalents of Val222 and Cys241 (human IgA1 numbering). These
IgA1 protease-resistant IgA2 Abs share very similar amino acid
sequences in the hinge, which are quite different from those of
their IgA1 counterparts (see Table II).
IgA1 proteases normally cleave either a Pro-Ser peptide bond
(type 1 enzymes) or a Pro-Thr peptide bond (type 2 enzymes).
Although there are several representatives of such peptide bonds in
the hinges of susceptible IgA, and the human and gorilla IgA1
hinges contain a tandem repeat of eight amino acids, each IgA1
FIGURE 5. Western blot analysis under reducing conditions of IgA2IgA1 half hinge (hh) (lanes 1 and 2) and other Abs as indicated (lanes
3–10) treated with (⫹) IgA1 protease from N. gonorrhoeae strain 5489
(lanes 2, 4, 6, 8, and 10) or untreated (⫺) and probed with an anti-human
␣-chain-specific peroxidase conjugate that bound to Fab epitopes. The positions of molecular mass markers (kilodaltons, left) are indicated. The type
2 IgA1 protease of N. gonorrhoeae cleaved IgA2-IgA1 half hinge,
hh⌬2ProC, hh4AlaC, and hh4ProN but hh⌬4ProC was resistant to
cleavage.
protease exhibits a remarkable degree of selectivity for the particular peptide bond it preferentially cleaves in the wild-type Ab
(Fig. 1).
In previous work (22) we created a hybrid Ab termed IgA2IgA1 half hinge in which one of the eight residue repeats of the
human IgA1 hinge was engineered into the hinge of IgA1 protease-resistant human IgA2. This hybrid Ab remained susceptible
to nearly all of the different bacterial IgA1 proteases including
those that cleave wild-type human IgA1 in the different duplicated
halves of the hinge. This finding indicated that although the IgA1
proteases cleaved wild-type IgA1 at a specific peptide bond in only
one of the duplicated half hinge regions, if the specific peptide
bond is represented only once as in the hybrid Ab, most the enzymes were still able to cleave it. Thus for most IgA1 proteases,
FIGURE 6. Western blot analysis under reducing conditions of wildtype human IgA1 (lanes 1–5) and hh⌬2ProC (lanes 6 –10) untreated (⫺)
(lanes 1 and 6) or treated with (⫹) the IgA1 protease from S. pneumoniae
strain SK690 (lanes 2 and 7), H. influenzae strain H23 type 1 (lanes 3 and
8), N. gonorrhoeae strain 5489 type 2 (lanes 4 and 9), N. meningitidis
strain 3564 type 1 (lanes 5 and 10), and probed with an anti-human
␣-chain-specific peroxidase conjugate that bound to Fab epitopes. The positions of molecular mass markers (kilodaltons, left) are indicated. The
metallo-IgA1 protease of S. pneumoniae, which cleaved wild-type IgA1
was unable to cleave hh⌬2ProC, whereas the serine-type IgA1 proteases of
Neisseria and Haemophilus spp. were able to cleave both Abs. Some lanes
contain Fab fragments of more than one size, believed to represent different
glycoforms of the Abs. Variation between lanes in this respect reflects
differential stripping of sugar moieties by glycosidases present to differing
extents in the various species, which copurify with the IgA1 protease.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Discussion
7796
IgA HINGE LENGTH ON SUSCEPTIBILITY TO IgA1 PROTEASES
FIGURE 7. Western blot analysis under reducing conditions of IgA2-IgA1 half hinge (hh) (lanes 1, 2, 5, 6, 9, 10, 13, 14, 17, and 18) and hh4ProN (lanes
3, 4, 7, 8, 11, 12, 15, 16, 19, and 20) untreated (⫺) (lanes 1, 3, 5, 7, 9, 11, 13, 15, 17, and 19) or treated with (⫹) IgA1 protease from H. influenzae strain
H23 type 1 (lanes 2 and 4), H. influenzae strain H15 type 2 (lanes 6 and 8), N. gonorrhoeae strain 6092 type 1 (lanes 10 and 12), N. gonorrhoeae strain
5489 type 2 (lanes 14 and 16) or N. meningitidis strain HF13 type 2 (lanes 18 and 20) and probed with an anti-human ␣-chain-specific peroxidase conjugate
that bound to Fab epitopes. hh4ProN was as sensitive or more sensitive to cleavage with the serine-type IgA1 proteases of Haemophilus and Neisseria spp.
than IgA2-IgA1 half hinge.
enzyme preparations was that of the IgA1 protease and arose
through cleavage of the hinge of IgA1. Although the precise site of
cleavage by each IgA1 protease in the hinges of the different mutant Abs was not determined, the masses of the cleavage products
formed were consistent with cleavage occurring only in the hinge.
Cleavage by streptococcal IgA1 proteases
Despite all the IgA1 proteases of the different streptococcal species
being zinc metalloproteases and cleaving the same peptide bond in
human IgA1 (29 –32), they showed different activities on the IgA2IgA1 half hinge Ab. Supporting and extending our earlier observations (22), we found that the IgA1 proteases of S. pneumoniae,
and some of the strains of S. sanguis, cleaved the hybrid whereas
those of S. oralis, S. mitis biovar 1 strains, and S. sanguis strain
SK1 did not. The failure of the latter group to cleave the hybrid Ab
(and its derivatives) may indicate that these enzymes require structures outside the half hinge for substrate recognition and that
theIgA2 framework does not serve as an acceptable alternative to
IgA1 for provision of these elements.
The finding that the IgA1 protease of S. sanguis strain SK1,
unlike that of the other S. sanguis strains tested, failed to cleave the
IgA2-IgA1 half hinge Ab may indicate that the C terminus of the
protease plays some role in the recognition or cleavage because
Table II. IgA1 protease sensitivity of certain mammalian IgA Absa
FIGURE 8. Western blot analysis under reducing conditions of wildtype human IgA1 (lanes 1 and 2), hh⌬STP (lanes 3 and 4) and wild-type
IgA2m(1) (lanes 5 and 6) untreated (⫺) (lanes 1, 3, and 5) or treated with
(⫹) N. gonorrhoeae type 1 IgA1 protease (lanes 2, 4, and 6) and probed
with an anti-human ␣-chain-specific peroxidase conjugate that bound to
Fab epitopes. N. gonorrhoeae type 1 IgA1 protease, which cleaved wildtype IgA1 but failed to cleave IgA2 was able to cleave Ab hh⌬STP, a
construct that represents the insertion of Pro-Thr-Pro-Ser into the hinge of
IgA2.
Antibody
Hinge Region Sequence
Susceptibility
to IgA1
Proteases
Human IgA1
Chimpanzee IgA1
Gorilla IgA1
Orangutan IgA
Human IgA2
Chimpanzee IgA2
Gorilla IgA2
VPSTPPTPSPSTPPTPSPS
GPSTPCPPTPSTPPTPSPS
VPSTPPTPSPSTPPTPSPP
VPRPTPTPSTPPCPPPS
VPPPPP
VPPPPP
VPPSPP
S
S
S
S
R
R
R
a
The amino acid sequence of the hinges of some IgA1 protease sensitive (S) and
resistant (R) mammalian IgA molecules. Sequences are taken from the translations of
nucleic acid sequences using the following accession numbers: J00220 (human IgA1),
J00221 (human IgA2), X53702 (chimpanzee IgA1), X53706 (chimpanzee IgA2),
X15045 (gorilla IgA1), X53707 (gorilla IgA2), and X53704 (orangutan IgA). Sequences shown begin at the first residue encoded by the hinge-C␣2 exon (Val222 in
human IgA1) and end at the residue preceding the first Cys residue encoded by this
exon (Cys241 in human IgA1), except in orangutan IgA, which because of an extra
Cys residue within the hinge, the sequence ends at the residue preceding the second
Cys residue of this exon.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
half of the normal human IgA hinge was sufficient for recognition
and cleavage by the proteases, and that if additional distal elements
were required, the IgA2 framework represented an acceptable alternative to that of IgA1.
Further work with different mutants of the hybrid Ab has shown
that IgA1 proteases can, if necessary, cleave alternative peptide
bonds to the ones normally cleaved. Thus half hinge mutants lacking a Pro-Ser peptide bond can be cleaved by type 1 IgA1 proteases and those lacking a Pro-Thr peptide bond can be cleaved by
type 2 IgA1 proteases (21). Furthermore, the substitution of proline for serine at the C-terminal end of the half hinge, thereby
creating a contiguous sequence of six proline residues, caused a
significant increase in the resistance of the Ab to cleavage despite
the presence in the hinge of potentially cleavable Pro-Ser and ProThr peptide bonds (21).
In the present study we aimed to determine the minimum size requirements of the hinge necessary to permit IgA1 protease cleavage.
We also sought to determine the influence on protease sensitivity of
the distance between susceptible peptide bonds in the hinge and the Fc
and Fab regions of the Ab, through mutation and repositioning of up
to four proline residues at the different ends of the hinge.
All the IgA1 protease preparations cleaved wild-type recombinant human IgA1 to yield Fab and Fc fragments whereas recombinant human IgA2, which lacks the hinge of IgA1, was resistant
to cleavage. This confirmed that all the proteolytic activity in the
The Journal of Immunology
Cleavage by IgA1 proteases of Haemophilus and Neisseria
In contrast to the streptococcal IgA1 proteases, those from H. influenzae, N. meningitidis, and N. gonorrhoeae were much more
active on the IgA2-IgA1 half hinge Ab and on many of the Abs it
derived. This activity may be a consequence of the nature of the
enzymes because although streptococcal IgA1 proteases are metalloproteases (31, 32), those of Haemophilus and Neisseria are
serine proteases, which have smaller active sites (35).
The sensitivity of the IgA2-IgA1 half hinge Ab to the type 1 and
type 2 IgA1 proteases of N. meningitidis, N. gonorrhoeae, and H.
influenzae was dramatically altered to resistance to all these IgA1
proteases by the removal of the four proline residues immediately
C-terminal to the half hinge as in hh⌬4ProC. However, the sensitivity of the IgA mutants derived from the IgA2-IgA1 half hinge
Ab to cleavage by these IgA1 proteases was dependent neither on
the presence specifically of these four proline residues, nor their
position, because when the prolines were substituted by four alanine residues as in hh4AlaC, or when the four proline residues
were moved to a position at the N-terminal end of the hinge as in
hh4ProN, the resultant Abs were sensitive to cleavage with these
IgA1 proteases. It appeared therefore that the four proline residues
acted as a spacer, in this case to separate the CH1 of the Fab region
from the CH2 domain of the Fc region and permit successful access of the serine-type IgA1 proteases of Neisseria and Haemophilus and interaction with the hinge substrate. Unlike the streptococcal IgA1 proteases, the requirement for such a spacer by the
proteases of Haemophilus and Neisseria spp. does not appear to
have a strict positional constraint, as it can function on either the
N-terminal or C-terminal side of the half hinge. The finding that
hh⌬2ProC was also sensitive to the type 1 and type 2 IgA1 proteases of N. meningitidis, N. gonorrhoeae, and H. influenzae suggests that even a short spacer is sufficient to allow access and
cleavage by these serine-type IgA1 proteases. Thus a total of 10 or
more residues between Val222 and Cys241 (IgA1 numbering), serving to separate the globular domains of the Fab and Fc regions,
appears to be necessary for this group of enzymes to recognize and
act upon a hinge region.
The recombinant Ab with the shortest hinge, hh⌬STP, contained
an insertion of just four amino acids, Pro-Thr-Pro-Ser, into the
hinge position in IgA2. As was expected, it was resistant to cleavage by all the streptococcal IgA1 proteases that had been unable to
cleave hh⌬2ProC, which had a slightly longer hinge. Of all the
IgA1 proteases that cleaved hh⌬2ProC, only that of N. gonorrhoeae type 1 was also able to cleave the even shorter hinge of Ab
hh⌬STP. Thus for this enzyme, a separation of just nine amino
acids between Val222 and Cys241 (IgA1 numbering) is sufficient to
facilitate access and allow cleavage of an appropriately placed
hinge region scissile bond.
It is not understood why the related type 1 IgA1 protease of N.
meningitidis, which cleaves the same Pro-Ser peptide bond in
wild-type human IgA1 as the N. gonorrhoeae type 1 enzyme,
failed to cleave hh⌬STP. Perhaps the distance separating the Fab
and Fc is simply too short to allow access, to allow appropriate
orientation for interaction, or both.
It was interesting to note that those IgA1 proteases that cleave
toward the C-terminal end of the hinge region in wild-type IgA1
were the most able to cleave those mutant half hinge Abs with very
short hinges. This would appear to be in keeping with the proposal
that amino acid sequences or structures outside the hinge and Cterminal to it may also be influential in determining the sensitivity
of the molecule to cleavage by IgA1 proteases (28).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
this region of protease of the S. sanguis strain SK1 is different from
the regions of the other streptococcal species, which share marked
similarities (32). It is also interesting to note that the amino acid
sequence in the N-terminal third of streptococcal IgA1 proteases,
unlike the remainder of the enzyme, is very variable. It contains
many repeat sequences that vary in number, size, and nucleotide
sequence. These repeats are not essential for enzyme activity but
are thought to contribute to antigenic diversity (33). The IgA1
proteases of S. mitis strains are known to display extensive antigenic variation but overall are more closely related to the IgA1
proteases of S. oralis than to those of the other streptococci (32).
Thus it is plausible that the S. mitis and S. oralis IgA1 proteases
interact with the substrate IgA2-IgA1 half hinge Ab in a different way than do the proteases of the other streptococcal species and are, thereby, unable to cleave it. For these reasons, it
was not particularly surprising to find that the IgA1 proteases of
those streptococcal species and strains unable to cleave the
IgA2-IgA1 half hinge hybrid Ab (S. oralis, S. sanguis SK1, and
S. mitis biovar 1) were also unable to cleave hinges of the same
or shorter size present in hh4⌬ProC, hh2⌬ProC, hh4AlaC,
hh4ProN, and hh⌬STP, which all derived from the half-hinge
hybrid (see Table I).
Although the IgA1 proteases of S. pneumoniae and the S. sanguis SK4 and SK49 strains were able to cleave the IgA2-IgA1 half
hinge hybrid, none of them were able to cleave hh4⌬ProC or
hh2⌬ProC, which lacked four and two proline residues, respectively, from the C-terminal end of the hinge region. The resistance
of the hh4⌬ProC and hh2⌬ProC Abs to these proteases might be
explained on the basis that in these Abs the hinge region was either
too small or conformationally constrained to allow optimal access
by the protease, or in some other way the activity of the protease
on the hinge region was restricted. However, when the size of the
hinge was restored to approximately the same as that in the IgA2IgA1 half hinge Ab by the engineering of four alanine residues at
the C terminus, as in hh4AlaC, the proteases of S. pneumoniae and
the S. sanguis SK4 could gain access and the hinge was cleaved.
Thus for cleavage by these two enzymes, it appears that there is a
requirement for some form of “spacer” between the scissile bond
and the Fc region of the Ab. If we assume that these enzymes
cleave at their preferred Pro-Thr bond in the available hinge region, the requirement would seem to be for a spacer of at least six
amino acids between this Thr and Cys241 at the start of the Fc. The
size of the spacer appears to be more important than its precise
sequence because alanine residues are able to substitute for proline
residues. Available evidence (34) indicates that residue Cys241
(considered the first residue of the CH2 domain in our study) on
one H chain forms a disulphide bridge to its counterpart on the
other H chain, and therefore represents a point of close approach
between the two H chains. One might speculate that this interchain
tether will tend to restrict movement of the two chains relative to
each other immediately upstream. Thus, in hh4⌬ProC and
hh2⌬ProC, it is likely that access to the scissile bond in the hinge
region of one H chain may be sterically obstructed by the other H
chain or by other parts of the Fc region. Only when sufficient
residues separate the cleavable portions of the hinge region from
Cys241 can the scissile bonds, or the hinge as a whole, adopt suitable conformations and/or become suitably accessible for cleavage
to occur. Interestingly, introduction of additional residues at the
N-terminal end of the half hinge region, as in hh4ProN, did not
help to overcome the restriction placed on cleavage by the loss of
four residues C-terminal to the hinge region because none of the
streptococcal proteases could cleave this mutant Ab (Table I).
7797
7798
IgA HINGE LENGTH ON SUSCEPTIBILITY TO IgA1 PROTEASES
Disclosures
The authors have no financial conflict of interest.
References
The hinge in wild-type IgA1 may be considered to comprise a
stretch of 18 amino acids lying between Val222, the point of leaving the globular CH1 domain, and residue Cys241, the tethering
point at the C-terminal end of the hinge region (Fig. 9). An extended hinge conformation is predicted (36), maintained by the
presence of numerous proline residues. Hence in wild-type IgA1
the Fab arms are seen to be held at some distance away from the
“top” of the Fc region, allowing IgA1 proteases access to both of
the duplicated halves of the hinge region. Our results indicate that
cleavage by the IgA1 proteases of Neisseria and Haemophilus spp.
can take place in a hinge where there are only 10 appropriate
amino acids separating the two residues considered to represent the
two limits of the hinge (Val222 and Cys241). The N. gonorrhoeae
type 1 protease can even cleave when the separation between these
two limits is further reduced to just nine appropriate amino acids.
However, we found no protease capable of cleaving a hinge shorter
than this. In contrast, cleavage by the streptococcal IgA1 proteases
requires a hinge of 12 residues or more between Val222 and Cys241.
A separation of nine amino acids between the two ends of the
hinge equates to the loss of the region separating Val222 and Ser232
in wild-type IgA1 (highlighted in Fig. 9) with the effect of bringing
the Fab arms much closer to the top of the Fc region. The result of
decreasing the separation of the Fab and Fc regions is presumably
to compromise access by the IgA proteases, explaining why sequences of less than nine residues between Val222 and Cys241 cannot be cleaved, even if their sequences carry bonds that are normally cleavable.
In summary, through analysis of the effects of varying hinge
length and composition, we have defined the minimum distances,
in terms of numbers of amino acid residues, required to separate
the Fab and Fc regions and to allow interaction with the hinge
region suitable for subsequent cleavage by this range of IgA1 proteases. This information makes an important addition to the growing understanding of the features of human IgA influencing proteolytic cleavage by this group of enzymes.
Acknowledgment
We are grateful to Professor Mogens Kilian for kindly supplying some of
the bacterial strains.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 9. Molecular model of human IgA1 based on coordinates
taken from Brookhaven Protein Data Bank as PDB code 1iga (36). H
chains are shown in white, and light chains are shown in gray. This model
predicts that the hinge of each H chain crosses over the CH2 domain of the
other H chain, and adopts an extended conformation. The arrow indicates
the predicted disulphide bridge between residue Cys241 on one H chain and
its counterpart on the other, which acts as a point of constraint at the
C-terminal end of the hinge region. The hinge is assumed to be relatively
mobile between this point and Val222 at the N-terminal end of the hinge.
Residues Val222 and Ser232 are highlighted as large spheres. Mutants in
which the hinge is shortened such that the end of the CH1 (V222) is placed
adjacent to the position occupied by S232 in the wild-type hinge may still
be cleaved by N. gonorrhoeae type 1 IgA1 protease. This represents the
closest approach of the Fab arms to the Fc region that is still compatible
with cleavage by an IgA1 protease. All other IgA1 proteases appear to
require a longer hinge region, with presumably greater separation of the
Fab and Fc regions, for cleavage to occur.
1. Plaut, A. G. 1983. The IgA1 proteases of pathogenic bacteria. Annu. Rev. Microbiol. 37: 603– 622.
2. Senior, B. W., L. M. Loomes, and M. A. Kerr. 1991. Microbial IgA proteases and
virulence. Rev. Med. Microbiol. 2: 200 –207.
3. Kilian, M., J. Reinholdt, H. Lomholt, K. Poulsen, and E. V. G. Frandsen. 1996.
Biological significance of IgA1 proteases in bacterial colonization and pathogenesis: critical evaluation of experimental evidence. APMIS 104: 321–338.
4. Mansa, B., and M. Kilian. 1986. Retained antigen-binding activity of Fab ␣
fragments of human monoclonal immunoglobulin A1 (IgA1) cleaved by IgA1
protease. Infect. Immun. 52: 171–174.
5. Kilian, M., J. Mestecky, and M. W. Russell. 1988. Defense mechanisms involving Fc-dependent functions of immunoglobulin A and their subversion by bacterial immunoglobulin A proteases. Microbiol. Rev. 52: 296 –303.
6. Vitovski, S., R. C. Read, and J. R. Sayers. 1999. Invasive isolates of Neisseria
meningitidis possess enhanced immunoglobulin A1 protease activity compared to
colonizing strains. FASEB J. 13: 331–337.
7. Mulks, M. H., and A. G. Plaut. 1978. IgA protease production as a characteristic
distinguishing pathogenic from harmless neisseriaceae. N. Engl. J. Med. 299:
973–976.
8. Kilian, M., J. Mestecky, and R. E. Schrohenloher. 1979. Pathogenic species of the
genus Haemophilus and Streptococcus pneumoniae produce immunoglobulin A1
protease. Infect. Immun. 26: 143–149.
9. Blake, M., K. K. Holmes, and J. Swanson. 1979. Studies on gonococcus infection. XVII. IgA1-cleaving protease in vaginal washings from women with gonorrhea. J. Infect. Dis. 139: 89 –92.
10. Kilian, M., J. Reinholdt, S. B. Mortensen, and C. H. Sorensen. 1983. Perturbation
of mucosal immune defence mechanisms by bacterial IgA proteases. Bull. Eur.
Phisiopathol. Resp. 19: 99 –104.
11. Ahl, T., and J. Reinholdt. 1991. Detection of immunoglobulin A1 protease-induced Fab ␣ fragments on dental plaque. Infect. Immun. 59: 563–569.
12. Gilbert, J. V., A. G. Plaut, B. Longmaid, and M. E. Lamm. 1983. Inhibition of
microbial IgA proteases by human secretory IgA and serum. Mol. Immunol. 20:
1039 –1049.
13. Brooks, G. F., C. J. Lammel, M. S. Blake, B. Kusecek, and M. Achtman. 1992.
Antibodies against IgA1 protease are stimulated both by clinical disease and
asymptomatic carriage of serogroup A Neisseria meningitidis. J. Infect. Dis. 166:
1316 –1321.
14. Devenyi, A. G., A. G. Plaut, F. J. Grundy, and A. Wright. 1993. Post-infectious
human serum antibodies inhibit IgA1 proteinases by interaction with the cleavage
site specificity determinant. Mol. Immunol. 30: 1243–1248.
15. Lin, L., P. Ayala, J. Larson, M. Mulks, M. Fukuda, S. R. Carlsson, C. Enns, and
M. So. 1997. The Neisseria type 2 IgA1 protease cleaves LAMP1 and promotes
survival of bacteria within epithelial cells. Mol. Microbiol. 24: 1083–1094.
16. Beck, S. C., and T. F. Meyer. 2000. IgA1 protease from Neisseria gonorrhoeae
inhibits TNF␣-mediated apoptosis of human monocytic cells. FEBS Lett. 472:
287–292.
17. Senior, B. W., W. W. Stewart, C. Galloway, and M. A. Kerr. 2001. Cleavage of
the hormone human chorionic gonadotropin, by the type 1 IgA1 protease of
Neisseria gonorrhoeae, and its implications. J. Infect. Dis. 184: 922–925.
18. Qiu, J., G. P. Brackee, and A. G. Plaut. 1996. Analysis of the specificity of
bacterial immunoglobulin A (IgA) proteases by a comparative study of ape serum
IgAs as substrates. Infect. Immun. 64: 933–937.
19. Janoff, E. N., J. B. Rubins, C. Fasching, A. Plaut, and J. N. Weiser. 2002. Inhibition of IgA-mediated killing of S. pneumoniae (SPN) by IgA1 protease
(IgA1P). 11th International Congress of Mucosal Immunology. Mucosal Immunol. Update 10: 2839(Abstr.).
20. Weiser, J. N., D. Bae, C. Fasching, R. W. Scamurra, A. J. Ratner, and
E. N. Janoff. 2003. Antibody-enhanced pneumococcal adherence requires IgA1
protease. Proc. Natl. Acad. Sci. USA 100: 4215– 4220.
21. Senior, B. W., and J. M. Woof. 2005. Effect of mutations in the human immunoglobulin A1 (IgA1) hinge on its susceptibility to cleavage by diverse bacterial
IgA1 proteases. Infect. Immun. 73: 1515–1522.
22. Senior, B. W., J. I. Dunlop, M. R. Batten, M. Kilian, and J. M. Woof. 2000.
Cleavage of a recombinant human immunoglobulin A2 (IgA2)-IgA1 hybrid antibody by certain bacterial IgA1 proteases. Infect. Immun. 68: 463– 469.
23. Imai, Y., Y. Matsushima, T. Sugimura, and M. Terada. 1991. A simple and rapid
method for generating a deletion by PCR. Nucleic Acids Res. 19: 2785.
24. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989.
Engineering hybrid genes without the use of restriction enzymes: gene splicing by
overlap extension. Gene 77: 61– 68.
25. Morton, H. C., J. D. Atkin, R. J. Owens, and J. M. Woof. 1993. Purification and
characterization of chimeric human IgA1 and IgA2 expressed in COS and Chinese hamster ovary cells. J. Immunol. 151: 4743– 4752.
26. Loomes, L. M., B. W. Senior, and M. A. Kerr. 1990. A proteolytic enzyme
secreted by Proteus mirabilis degrades immunoglobulins of the immunoglobulin
A1 (IgA1), IgA2, and IgG isotypes. Infect. Immun. 58: 1979 –1985.
The Journal of Immunology
27. Batten, M. R., B. W. Senior, M. Kilian, and J. M. Woof. 2003. Amino acid
sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for
cleavage by streptococcal IgA1 proteases. Infect. Immun. 71: 1462–1469.
28. Chintalacharuvu, K. R., P. D. Chuang, A. Dragoman, C. Z. Fernandez, J. Qiu,
A. G. Plaut, K. R. Trinh, F. A. Gala, and S. L. Morrison. 2003. Cleavage of the
human immunoglobulin A1 (IgA1) hinge region by IgA1 proteases requires
structures in the Fc region of IgA. Infect. Immun. 71: 2563–2570.
29. Plaut, A. G. 1978. Microbial IgA proteases. N. Engl. J. Med. 298: 1459 –1463.
30. Kilian, M., J. Mestecky, R. Kulhavy, M. Tomana, and W. T. Butler. 1980. IgA1
proteases from Haemophilus influenzae, Streptococcus pneumoniae, Neisseria
meningitidis, and Streptococcus sanguis: comparative immunochemical studies.
J. Immunol. 124: 2596 –2600.
31. Gilbert, J. V., A. G. Plaut, and A. Wright. 1991. Analysis of the immunoglobulin
A protease gene of Streptococcus sanguis. Infect. Immun. 59: 7–17.
32. Poulsen, K., J. Reinholdt, C. Jespersgaard, K. Boye, T. A. Brown, M. Hauge, and
M. Kilian. 1998. A comprehensive genetic study of streptococcal immunoglob-
7799
33.
34.
35.
36.
ulin A1 proteases: evidence for recombination within and between species. Infect.
Immun. 66: 181–190.
Gilbert, J. V., J. P. Ramakrishna, A. Wright, and A. G. Plaut. 1993. Streptococcal
IgA protease tandem repeat influences antigenicity but not activity. J. Dent. Res.
72: 327–336.
Herr, A. B., E. R. Ballister, and P. J. Bjorkman. 2003. Insights into IgA-mediated
immune responses from the crystal structures of human Fc␣RI and its complex
with IgA1-Fc. Nature 423: 614 – 620.
Bachovchin, W. W., A. G. Plaut, G. R. Flentke, M. Lynch, and C. A. Kettner.
1990. Inhibition of IgA1 proteinases from Neisseria gonorrhoeae and Haemophilus influenzae by peptide prolyl boronic acids. J. Biol. Chem. 265:
3738 –3743.
Boehm, M. K., J. M. Woof, M. A. Kerr, and S. J. Perkins. 1999. The Fab and Fc
fragments of IgA1 exhibit a different arrangement from that in IgG: a study by
X-ray and neutron solution scattering and homology modelling. J. Mol. Biol. 286:
1421–1447.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017