One Cycle Ahead – when Q stands for quick in qPCR with its design and running outperforming expectations Agilent Technologies qPCR eSeminar Robert Loewe GeneWake GmbH July 30, 2015 For Research Use Only. Not for Use in Diagnostic Procedures 1 What’s on the agenda Minor Notes on the side: Gene Expression: Things to ponder in the darkest hour Not all experiments are created equal Bisulfite Treated DNA: A cautionary tale HRM: From Design to Outcome Multiplex: The more the merrier? Impact of Instrumentation: How data can look like and how to interpret For Research Use Only. Not for Use in Diagnostic Procedures Minor Notes on the side For Research Use Only. Not for Use in Diagnostic Procedures 3 Difficult samples for qPCR Minute amount of starting material (down to single cells) Degraded NA (FFPE, bisulfite converted DNA) Presence of Inhibitors in isolated NA (NA from Urine) For Research Use Only. Not for Use in Diagnostic Procedures 4 First know your qPCR assay Efficiency efficient PCR comes earlier Product (size, melting point …) smaller amplicon can have faster PCR Limit of detection amount near limit of detection might need more cycles and Cq’s between replicates vary For Research Use Only. Not for Use in Diagnostic Procedures 5 Quantitative PCR – dilution series For Research Use Only. Not for Use in Diagnostic Procedures Quantitative PCR – Limit of detection For Research Use Only. Not for Use in Diagnostic Procedures Secondly adjust your qPCR settings Minute amount of starting material (down to single cells) carrier NA Degraded NA (FFPE, bisulfite converted DNA) short amplicons, short initial heating Presence of Inhibitors in isolated NA (NA from Urine) dilute NA, design new primer, clean up change isolation method For Research Use Only. Not for Use in Diagnostic Procedures 8 Gene Expression For Research Use Only. Not for Use in Diagnostic Procedures 9 Prostate cancer set-up Biopsy Gleason Scoring biopsy – FFPE clinical data analysis RNA isolation gene expression profiling Surgery tissue from surgery – FFPE blood (Paxgene) and urine from day of surgery RNA isolation gene expression profiling Molecular Profiling Gene expression - Gleason Score patient stratification For Research Use Only. Not for Use in Diagnostic Procedures Bioinformatics For Research Use Only. Not for Use in Diagnostic Procedures 11 Biopsy analysis (FFPE) with gene expression profiling For Research Use Only. Not for Use in Diagnostic Procedures Blood analysis with gene expression profiling I BPH For Research Use Only. Not for Use in Diagnostic Procedures PCA 13 Blood analysis with gene expression profiling II For Research Use Only. Not for Use in Diagnostic Procedures 14 Bisulfite treated DNA For Research Use Only. Not for Use in Diagnostic Procedures 15 Bisulfite conversion – as a difficult example For Research Use Only. Not for Use in Diagnostic Procedures 16 Inhibition Effect I 1:2 dilution bisulfite treated DNA For Research Use Only. Not for Use in Diagnostic Procedures 17 Inhibition Effect II 1:4 dilution bisulfite treated DNA For Research Use Only. Not for Use in Diagnostic Procedures 18 Inhibition Effect III 1:10 dilution bisulfite treated DNA For Research Use Only. Not for Use in Diagnostic Procedures 19 Inhibition Effect IV Undiluted bisulfite treated DNA – different kit For Research Use Only. Not for Use in Diagnostic Procedures 20 Inhibition Effect V Undiluted bisulfite treated DNA – different kit For Research Use Only. Not for Use in Diagnostic Procedures 21 HRM For Research Use Only. Not for Use in Diagnostic Procedures 22 Introduction High Resolution Melting is viable method to screen for SNPs, InDels and Sequence Changes In essence it is working with intercalating dyes that insert themselves into the double strand Slow melting while making high resolution measurements results in a melting curve Temperature is gradually increased to find melting point of the amplicon Mismatches in the Sequence (e.g. Heterozygotes) show up as a “dent” in the melting curve PCR product remains intact and can be recycled Usable for high throughput screening For Research Use Only. Not for Use in Diagnostic Procedures What to detect SNPs: e.g. two Alleles A and B (pretending that in human genetics only homozygotes and heterozygotes exist) possible formats to measure Somatic Mutations: 100% A 50% A & 50% B 100% B (Homozygote for A) (Heterozygote) (Homozygote for B) Everything from 0 – 100% is theoretically possible For Research Use Only. Not for Use in Diagnostic Procedures EvaGreen Known Facts Things to remember For Research Use Only. Not for Use in Diagnostic Procedures EvaGreen: Things to remember EvaGreen can induce primer dimers More does not equal better! Perfect amount in extremely trial and error For Research Use Only. Not for Use in Diagnostic Procedures 26 Primer-Design Know your sequence!!!! Be aware of SNPs flanking your region of interest (roi) Try to limit yourself in regards to size 60-300bp is working for Homozygote/Heterozygote distinction in general, in difficult sequences shorter amplicons are better also for somatic mutations but too short gives lower fluorescence level Be aware of primer dimers and multimers Design more than one set if possible Maybe use melting probe for (e.g. small oligo that specifically binds to your roi) Be Aware of Pseudogenes For Research Use Only. Not for Use in Diagnostic Procedures Example: SNP rs4988235 (lactose intolerance) AGCTGGGTATTCACAAGGATGTATGTGAAAAAACTCACCATGCCATACATTTCCCTTTTTATAAATTATACCTCAGTC ACACTGTAAAAAAAAGCCAAACCCCCTTTTCAAAGACGACCTTACATCAAACCTATTAATAAAACTAGGAAAAAG CAGGGCTGCTTTGGTTGAAGCGAAGATGGGACGCTTGAATGCCCTTTCGTACTACTCCCCTTTTACCTCGTTAATA CCCACTGACCTATCCTCGTGGAATGCAGGGCTCAAAGAACAATCTAAAAATCAAACATTATACAAATGCAACCTAA GGAGGAGAGTTCCTTTGAGGCCAGGG [G/A] CTACATTATCTTATCTGTATTGCCAGCGCAGAGGCCTACTAGTACATTGTAGGGTCTAAGTACATTTTTCCTGAATGA AAGGTATTAAATGGTAACTTACGTCTTTATGCACTCTATAAACTATGACGTGATCGTCTCCGTCTAACAACTACACTC AAATGCTTACCAAGCTCTTTAAAGGGAAGAATTCCATGGTCGTATGAGCATTCAACAGTTACATAAAAATGTATTT GCAGTGAATTCTAGTATGTCCCATACCAAAGATTAAAAACATGCAACAAATCTGTTTATCTCTGCTCTCATCATATCA AAGTGACTCTGATACCTCATCACAGCAGTGCATCCGAGCCATAGCTTC 18 Forward primers and 10 reverse primers 60 – 653 bp amplicon length For Research Use Only. Not for Use in Diagnostic Procedures 28 Chemistry Run protocol is essential Input amount of samples to be compared should be equal Primer amount should be sufficient but not too high Subsequent results will be generated with the AriaMX or the LightCycler480 using the Agilent HRM Ultra-Fast Loci Master For Research Use Only. Not for Use in Diagnostic Procedures For Research Use Only. Not for Use in Diagnostic Procedures Initial Denaturation 3 minutes Cycling: e.g. 10s 95°C 15s 60°C 25s 72°C Or 10s 95°C 30s 60°C In Fast Mode 5s 95°C 10s 60°C 30 Some Pictures Different sizes 17/1 12/2 5/2 2/5 69 bp 112 bp 187 bp 278 bp Different Percentages 0%, 5%, 10%, 25%, 50%, 75%, 90%, 95%, 100% For Research Use Only. Not for Use in Diagnostic Procedures 69 bp 112 bp 5% Detection 32 Picture Perfect Initial Denaturation 3 minutes Cycling: 10s at 95°C & 30s at 60°C Multiplex For Research Use Only. Not for Use in Diagnostic Procedures 34 Multiplexing is not always the solution, but is sometimes the answer to too much work in too little time. 35 Impact of Instrumentation For Research Use Only. Not for Use in Diagnostic Procedures 36 Important facts needed • • • • • Homogenous plate cycling is essential Inter / Intra plate variation Plate calibrator needed for variable Cq interrun Standardized Cq calling advisable Unbiased scanning of different wells is important • Rapid and precise cycling vital For Research Use Only. Not for Use in Diagnostic Procedures 37 Thank you for spending your time with me and special thanks to Agilent Technologies for letting me talk [email protected] WWW.GENEWAKE.COM For Research Use Only. Not for Use in Diagnostic Procedures
© Copyright 2024 Paperzz