Molecular Cardiology
Loss of Methyl-CpG–Binding Domain Protein 2 Enhances
Endothelial Angiogenesis and Protects Mice Against
Hind-Limb Ischemic Injury
Xiaoquan Rao, MD; Jixin Zhong, PhD; Shu Zhang, PhD; Yushan Zhang, PhD; Qilin Yu, PhD;
Ping Yang, BS; Mong-Heng Wang, PhD; David J. Fulton, PhD; Huidong Shi, PhD; Zheng Dong, PhD;
Daowen Wang, MD, PhD; Cong-Yi Wang, MD, PhD
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Background—Despite intensive investigation, how DNA methylation influences endothelial function remains poorly
understood. We used methyl-CpG– binding domain protein 2 (MBD2), an interpreter for DNA methylome– encoded
information, to dissect the impact of DNA methylation on endothelial function in both physiological and pathophysiological states.
Methods and Results—Human umbilical vein endothelial cells under normal conditions express moderate levels of MBD2,
but knockdown of MBD2 by siRNA significantly enhanced angiogenesis and provided protection against H2O2-induced
apoptosis. Remarkably, Mbd2⫺/⫺ mice were protected against hind-limb ischemia evidenced by the significant
improvement in perfusion recovery, along with increased capillary and arteriole formation. Loss of MBD2 activated
endothelial survival and proangiogenic signals downstream of vascular endothelial growth factor signaling characterized
by an increase in endothelial nitric oxide synthase (eNOS) and vascular endothelial growth factor receptor 2 expression,
along with enhanced extracellular signal-regulated kinase 1/2 activation and BCL-2 expression. Mechanistic studies
confirmed the methylation of CpG elements in the eNOS and vascular endothelial growth factor receptor 2 promoter.
MBD2 binds to these methylated CpG elements and suppresses eNOS promoter activity. On ischemic insult, key
endothelial genes such as eNOS and vascular endothelial growth factor receptor 2 undergo a DNA methylation turnover,
and MBD2 interprets the changes of DNA methylation to suppress their expressions. Moreover, MBD2 modulation of
eNOS expression is likely confined to endothelial cells because nonendothelial cells such as splenocytes fail to express
eNOS after loss of MBD2.
Conclusions—We provided direct evidence supporting that DNA methylation regulates endothelial function, which forms the
molecular basis for understanding how environmental insults (epigenetic factor) affect the genome to modify disease
susceptibility. Because MBD2 itself does not affect the methylation of DNA and is dispensable for normal physiology in mice, it
could be a viable epigenetic target for modulating endothelial function in disease states. (Circulation. 2011;123:2964-2974.)
Key Words: angiogenesis 䡲 DNA methylation 䡲 endothelium 䡲 MBD2 protein 䡲 nitric oxide synthase type III
E
ndothelial cells (ECs) are the initial line of defense in
many vascular diseases, and frequently the first casualty.
Therefore, altered endothelial function is associated with
numerous human pathologies, such as atherosclerosis, allograft vasculopathy, heart failure, diabetic retinopathy, and
scleroderma. Given the essential role that ECs played in
angiogenesis, their functional impairment is associated with
attenuated angiogenic response that features prominently in
patients with poor clinical outcomes after peripheral and/or
myocardial ischemia,1,2 and an epigenetic factor is implicated
in the disease process.3
Editorial see p 2916
Clinical Perspective on p 2974
As a major epigenetic mechanism, DNA methylation acts
as a footprint, reflecting the consequences of environmental
insults in different types of cells.4 Therefore, alterations in
DNA methylome are commonly seen in animals and patients
with vascular diseases,5,6 which are read by a conserved
family of methyl-CpG– binding domain (MBD) proteins (ie,
MBD1, MBD2, MBD3, MBD4, and MeCP2).7–9 The MBD
proteins actively implicate in DNA methylation–mediated
Received May 14, 2010; accepted March 23, 2011.
From the Center for Biomedical Research, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
(X.R., S.Z., Q.L., P.Y., D.W., C.Y.W.), and Center for Biotechnology and Genomic Medicine (X.R., J.Z., Y.Z., P.Y., C.Y.W.), Department of Physiology
(M.H.W.), Vascular Biology Center (D.J.F.), Cancer Center (H.S.), and Department of Anatomy and Cell Biology (Z.D.), Georgia Health Sciences
University, Augusta.
The online-only Data Supplement is available with this article at http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.110.966408/DC1.
Correspondence to Cong-Yi Wang or Daowen Wang, Center for Biomedical Research, Tongji Hospital, Tongji Medical College, Huazhong University
of Science and Technology, 1095 Jiefang Ave, Wuhan 430030, China. E-mail [email protected] or [email protected]
© 2011 American Heart Association, Inc.
Circulation is available at http://circ.ahajournals.org
DOI: 10.1161/CIRCULATIONAHA.110.966408
2964
Rao et al
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
transcriptional repression and/or heterochromatin formation
and are responsible for maintaining and interacting with DNA
methylome. They are distinguished by the binding affinity to
methylated DNA, and MBD2 binds with the highest affinity,
but MBD3 fails to selectively recognize methylated DNA.8
Animals deficient in MeCP2, MBD1, MBD2, and MBD4 are
viable; deficiency in MBD3 leads to embryonic lethality.9
Mice lacking MeCP2 or MBD1 exhibit specific neurological
defects,10,11 whereas loss of MBD4 suppresses CpG mutability and tumorigenesis.12,13 In contrast, mice deficient in
MBD2 are generally normal except for a minor phenotype in
maternal behavior.14
In the present study, we used MBD2 as a model to dissect
the effect of DNA methylation on endothelial function. We
hypothesized that MBD2 deciphers DNA methylome– encoded information and modulates endothelial gene expression
implicated in endothelial apoptosis and angiogenesis. We
demonstrated evidence supporting the methylation of CpG
elements in the endothelial nitric oxide synthase (eNOS) and
vascular endothelial growth factor (VEGF) receptor 2
(VEGF-R2) promoter. We also verified that MBD2 interprets
DNA methylome– encoded information by binding to the
methylated CpG elements. As a result, knockdown of MBD2
significantly enhanced angiogenesis and protected ECs from
H2O2-induced apoptosis. Consistently, Mbd2⫺/⫺ mice were
protected from hind-limb ischemic injury.
Methods
Animals
Mice deficient in MBD2 (Mbd2⫺/⫺) on a C57BL/6 background were
kindly provided by Dr Adrian Bird (Edinburgh University, Edinburgh, UK).14 Eight-week-old male Mbd2⫺/⫺ mice and their wildtype (WT) littermates were used in the study. All mice were housed
in a standard specific pathogen free (SPF) facility in microisolator
cages. All studies were performed in compliance with the Georgia
Health Sciences University and Tongji Medical College Animal Care
and Use Committee guidelines.
Cell Culture and Transfection
Human umbilical vein ECs (HUVECs) were cultured in EBM-2 EC
basal medium with the SingleQuot kit (Lonza/Cambrex, Walkersville, MD). For siRNA transfection, the cells were seeded in 12-well
plates at a density of 4⫻104 cells per well. On the second day, 50 or
100 nmol/L control or MBD2 siRNA was transfected into the cells
with the lipofectamine reagent (Invitrogen, Carlsbad, CA).
Flow Cytometry Analysis of Endothelial Apoptosis
ECs were treated with 0.2 mmol/L H2O2 for 24 hours to induce
apoptosis, followed by flow cytometric analysis of apoptotic cells.
In Vitro Angiogenesis Assay
Twenty-four hours after transfection, the ECs (2⫻104 cells) were
added into each well of a 96-well plate and cultured for additional 24
hours. Endothelial tubes were then examined under a light microscope every other 4 hours by inspection of the overall tube length and
branch points. 3H-thymidine incorporation was used for analysis of
endothelial proliferation and presented as counts per minute.
Hind-Limb Ischemic Model and Assessments
After anesthetization, a 1-cm-long incision was made in the skin at
the medial thigh to expose the femoral artery. The proximal end of
the femoral artery was occluded with double knots. The segment of
femoral artery between the distal and proximal knots was then
transected. Hind-limb blood flow in mice that had undergone
MBD2 Regulates Endothelial Function
2965
hind-limb ischemia was measured with a laser Doppler imaging
system (Perimed, Stockholm, Sweden).
Immunostaining of Methyl-CpG–Binding Domain
Protein 2, Capillaries, and Arterioles
A sheep anti-MBD2 antibody and a FITC-conjugated bovine antisheep IgG were used to detect MBD2 expression. Staining of
CD31-positive cells was used to define capillary formation, and
␣-actin–positive cells were used to evaluate arteriole formation.
Western Blotting
An enhanced chemiluminescence Western blotting kit (Millipore,
Temecula, CA) was used for analyses of total and phosphorylated
protein levels.
Chromatin Immunoprecipitation Assay,
Electrophoretic Mobility Shift Assay, and
Endothelial Nitric Oxide Synthase Promoter
Reporter Assay
Chromatin immunoprecipitation (ChIP) assay was carried out with a
ChIP assay kit (Upstate Biotechnology, Lake Placid, NY). The
primers used in ChIP assay are summarized in Table I of the
online-only Data Supplement. Electrophoretic mobility shift assay
was carried out with a LightShift chemiluminescent electrophoretic
mobility shift assay kit (Thermo Scientific, Rockford, IL), and a dual
luciferase reporter system (Promaga, Madison, WI) was used for
eNOS promoter reporter assays.
DNA Bisulfite Sequencing Analysis
Genomic DNA from each preparation was first undergone bisulfite
conversion with an EZ DNA Methylation kit, followed by polymerase chain reaction amplification of targeted sequences. The resulting
polymerase chain reaction products were directly cloned into a TA
vector. The methylation state of each targeted sequence was then
analyzed by DNA sequencing.
Statistical Analysis
For pairwise comparisons, the data were analyzed by use of a Student
t test. Comparison between multiple experimental groups was accomplished by a Bonferroni test with SPSS 17.0 for Windows. For the blood
flow imaging data, repeated measures ANOVA was used. A 3-way
repeated measures ANOVA was used to analyze the blood flow of
Mbd2⫺/⫺ and WT mice with or without NG-nitro-L-arginine methyl
ester (L-NAME) treatment. All data are presented as mean⫾SEM. In all
cases, values of P⬍0.05 were considered statistically significant.
A detailed version of Methods is available in the online-only Data
Supplement.
Results
Knockdown of Methyl-CpG–Binding Domain
Protein 2 Promotes Angiogenesis and Protects
Endothelial Cells From H2O2-Induced Apoptosis
The HUVECs were transfected with either an MBD2 or a
control siRNA to examine the potential influence of MBD2 on
endothelial function. Moderate levels of MBD2 were detected in
HUVECs under control conditions, whereas the MBD2 siRNA
dose dependently suppressed MBD2 expression. When HUVECs
were transfected with 100 nmol/L MBD2 siRNA, MBD2 was
almost undetectable (Figure 1A). We next seeded siRNAtransfected HUVECs into culture plates preconditioned with
growth factor–reduced Matrigel (BD Bioscience). Knockdown of MBD2 expression in HUVECs led to a significantly
enhanced capacity for tube formation (Figure 1B). Tube
formation was observed as early as 4 hours after seeding of
HUVECs lacking MBD2, whereas almost no discernable tube
2966
Circulation
June 28, 2011
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Figure 1. Inhibition of methyl-CpG– binding domain protein 2 (MBD2) promotes angiogenesis and protects human umbilical vein endothelial cells (HUVECs) against H2O2-induced apoptosis. A, MBD2 siRNA dose dependently suppressed MBD2 expression in HUVECs.
The MBD2 levels in siRNA-transfected HUVECs were determined by Western blotting. A 70% reduction was observed when HUVECs
were transfected with 100 nmol/L MBD2 siRNA (n⫽4). B, Knockdown of MBD2 promoted tube formation. The HUVEC tube formation
was examined under a light microscope every other 4 hours, and pictures were taken 24 hours after culture. Left, Representative
images for tube formation. Right, Average tube length (n⫽4). Tube length was calculated by measuring the cumulative tube length in 5
randomly selected microscopic fields for each experiment with the Axiovision LE software. C, Inhibition of MBD2 enhanced proliferation. Proliferation of HUVECs was assayed by 3H-labeled thymidine incorporation and presented as mean⫾SEM (n⫽3). D, Knockdown
of MBD2 protected HUVECs from H2O2-induced apoptosis. Twenty-four hours after siRNA transfection, HUVECs were treated with
0.2 mmol/L H2O2 to induce apoptosis. Left, Representative flow cytometric data. Right, A graph showing the results from 4 independent experiments. Ctl indicates control. **P⬍0.001; *P⬍0.01.
formation was observed for control siRNA-transfected cells
(data not shown). The average total tube length 24 hours after
transfection in each randomly selected field was significantly
higher in MBD2 siRNA-transfected cells than control
siRNA-transfected cells (Figure 1B).
To examine the impact of MBD2 on HUVEC proliferation,
siRNA-transfected cells were cultured in the presence of
3
H-labeled thymidine, followed by measurement of the incorporated radioactivity. Knockdown of MBD2 significantly
enhanced HUVEC proliferation compared with control
siRNA-transfected cells (Figure 1C). To investigate whether
MBD2 regulates endothelial apoptosis, the transfected HUVECs
were treated with H2O2 (0.2 mmol/L) for 24 hours to induce
apoptosis. Interestingly, knockdown of MBD2 significantly
protected HUVECs from H2O2-induced apoptosis (Figure
1D). Together, these results suggest that MBD2 negatively
regulates angiogenesis and sensitizes ECs to H2O2-induced
apoptosis.
Loss of Methyl-CpG–Binding Domain Protein 2
Protects Mice Against Hind-Limb Ischemia
Individuals with cardiovascular disease have an attenuated
angiogenic response to ischemia that is associated with poor
clinical outcomes.15,16 Given the observation that MBD2
negatively regulates endothelial angiogenesis in cultured
cells, we next examined its impact on perfusion recovery after
Rao et al
MBD2 Regulates Endothelial Function
2967
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Figure 2. Temporal expression analysis
of methyl-CpG– binding domain protein 2
(MBD2) after hind-limb ischemic injury.
A, MBD2 was absent in the blood vessels of Mbd2⫺/⫺ mice. B, Temporal
expression changes of MBD2 in the hind
limb after ischemic insult. MBD2 expression was examined by Western blotting
with hind-limb lysates (left), and the relative amount of MBD2 was estimated by
the ratio to ␤-actin (right; n⫽5). C, Coimmunostaining of ECs and MBD2 in the
ischemic and nonischemic hind-limb
sections. Nuclei were stained with DAPI
(a and e; blue); endothelial cells (ECs)
were stained with anti-CD31 (b and f;
red); and MBD2 was stained green (c
and g). Merged images (d and h) were
generated by overlay of DAPI, antiCD31, and MBD2 staining. Inset images
with higher resolution in d and h show
the colocalization of MBD2 and ECs.
The images (⫻200) are representative of
consistent results obtained from 4 mice
analyzed in each group.
ischemic injury in vivo. We first confirmed the absence of
MBD2 protein in blood vessels of Mbd2⫺/⫺ mice (Figure
2A). We next examined MBD2 temporal expression changes
in WT mice after femoral artery excision. Under control
conditions, MBD2 was very low in the hind limb. However,
a steady increase in MBD2 was noticed after ischemic
induction; the highest level was observed 4 days after
ischemic surgery. After that point, MBD2 underwent a steady
decrease and then returned to a relative low level after
postsurgery day 14 (Figure 2B). Immunostaining revealed
that MBD2 expression (green) in the nonischemic muscle
sections was limited to the location of blood vessels and was
localized mainly to ECs (CD31 positive; red; Figure 2C, top).
In line with vascular neogenesis in response to ischemic
insult, significantly more ECs (CD31-positive cells) were
found, along with much higher levels of MBD2 expression, in
the ischemic sections (Figure 2C, bottom), suggesting that
ECs undergoing vascular neogenesis are associated with
enhanced MBD2 expression.
To determine the role of MBD2 in perfusion recovery,
unilateral hind-limb ischemia was induced in Mbd2⫺/⫺ and
WT male mice. All mice survived the surgical procedure, and
blood flow in the ischemic (left side) and nonischemic (right
side) limbs was monitored with a laser Doppler imaging
system. Blood flow in the ischemic hind limbs was almost
undetectable in both Mbd2⫺/⫺ and WT mice right after
femoral artery excision. Remarkably, Mbd2⫺/⫺ mice showed
partial blood flow restoration 2 days after induction, and
blood flow was restored to ⬇50% at day 7 and almost
completely recovered at day 14 after the ischemic insult
(Figure 3A). However, no visible blood flow restoration was
observed in WT mice until day 4, and blood flow was
restored to only ⬇30% and 60% at days 7 and 14 after
ischemic surgery, respectively.
To investigate differences in neovascularization, we examined capillary (CD31-positive cells) and arteriole (␣-actin–
positive cells) formation. The numbers of CD31-positive cells
(ECs; Figure 3B) and ␣-actin positive cells (smooth muscle
cells; Figure 3C) were significantly higher in the ischemic
sections of Mbd2⫺/⫺ mice than in WT mice. Taken together,
our results demonstrate that loss of MBD2 promoted both
angiogenesis and arteriogenesis and was associated with
significantly improved perfusion after hind-limb ischemia.
Suppression of Methyl-CpG–Binding Domain
Protein 2 Activates Endothelial Cell Survival and
Proangiogenic Signals
To dissect the mechanisms by which MBD2 regulates endothelial survival, we examined 2 major endothelial survival
signals, the extracellular signal-regulated kinase 1/2
(ERK1/2) and the serine-threonine kinase Akt, in siRNAtransfected HUVECs. Interestingly, MBD2 siRNA did not
show a significant impact on Akt expression and activation
(Figure I in the online-only Data Supplement). However,
MBD2 siRNA promoted ERK1/2 activation, as revealed by
the presence of higher phosphorylated (p-) ERK1/2, although
total ERK1/2 did not change (Figure 4A). In line with the role
of p-ERK1/2 in BCL-2 stabilization,17 higher BCL-2 expression was noticed in MBD2 siRNA-transfected cells on H2O2
treatment (Figure 4B). Surprisingly, no perceptible difference
was detected after knockdown of MBD2 for Mn superoxide
dismutase and Cu/Zn superoxide dismutase, the 2 enzymes
detoxifying reactive oxygen species (Figure II in the onlineonly Data Supplement). Our results suggest that MBD2
regulates endothelial apoptosis probably by modulating survival signals relevant to ERK1/2 and BCL-2 signaling.
To study the mechanism underlying MBD2 regulation of
angiogenesis, we analyzed the activity of eNOS and VEGF-R2,
the 2 key proangiogenesis signals.18,19 Remarkably, knockdown
of MBD2 increased both total and activated eNOS (p-eNOS)
and VEGF-R2 compared with control siRNA-transfected
HUVECs (Figure 4C). Importantly, blood vessels isolated from
Mbd2⫺/⫺ mice also showed enhanced eNOS and VEGF-R2
expression compared with their control counterparts (Figure
4D); a similar trend was noticed in ischemic tissues of Mbd2⫺/⫺
mice (Figure III in the online-only Data Supplement). In con-
2968
Circulation
June 28, 2011
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Figure 3. Mbd2⫺/⫺ mice show a significantly improved perfusion recovery after hind-limb ischemia. A, Blood flow restoration after
hind-limb ischemia. Blood flow was measured with a laser Doppler imaging system and presented as changes in the laser frequency
manifested by different color pixels (left). The mean hind-limb blood flow was calculated as the ratio of ischemic (left) side to nonischemic (right) side (right; n⫽6). B, Mbd2⫺/⫺ mice showed significant higher capillary formation at day 7 of ischemic injury. The amount of
endothelial cells (CD31-positive; red) in hind-limb sections (⫻200) served as an indicator of capillary formation (left). The average capillary density for each group was shown in a bar graph (right; n⫽5). C, Arteriole formation at day 7 of ischemic injury. Similarly, the
amount of smooth muscle cells (␣-actin positive; red) in hind-limb sections (⫻200) was used as an indicator for arteriole formation (left),
and the mean arteriole density was shown in a bar graph (right; n⫽5). **P⬍0.001; *P⬍0.01.
trast, MBD2 did not show a significant impact on total p38, but
higher p-p38 was detected in MBD2 siRNA-transfected HUVECs
(Figure 4E), and studies in Mbd2⫺/⫺ blood vessels showed
similar results (Figure IV in the online-only Data Supplement).
Together, loss of MBD2 facilitates the activation of cell survival
and proangiogenic signals to enhance endothelial survival and to
promote angiogenesis.
Endothelial Nitric Oxide Synthase Synergizes With
Vascular Endothelial Growth Factor Receptor 2 to
Promote Endothelial Survival and Angiogenesis
To demonstrate the connection of the signals characterized
above, we treated HUVECs with VEGF in the presence of
blockades for either VEGF-R2 or eNOS. Stimulation with
VEGF did not affect total VEGF-R2, eNOS, and ERK1/2
expression but promoted VEGF-R2, eNOS, and ERK1/2
activation, along with enhanced BCL-2 expression (Figure
5A). As expected, VEGF-R2–neutralizing antibody or inhib-
itor (SU1498) suppressed VEGF-induced VEGF-R2 activation and diminished VEGF-induced ERK1/2 activation and
BCL-2 upregulation. Blockade of VEGF-R2 also led to a
modest decrease in p-eNOS (Figure 5A). Notably, blockade
of eNOS by L-NAME not only inhibited eNOS activation
(p-eNOS) but also suppressed VEGF-induced p–VEGF-R2,
along with a significant decrease in p-ERK1/2 and BCL-2
expression (Figure 5A). These results suggest that ERK1/2
and BCL-2 are downstream molecules of eNOS and
VEGF-R2 signaling. Our data also suggest crosstalk between
eNOS and VEGF-R2 signaling in which eNOS plays a
predominant role by synergizing with VEGF-R2 to enhance
endothelial survival and to promote angiogenesis.
To confirm the above conclusion, we next treated Mbd2⫺/⫺
and control mice after hind-limb ischemic surgery with the
eNOS inhibitor L-NAME. Administration of L-NAME significantly impaired blood flow restoration in both Mbd2⫺/⫺
and control mice (Figure V in the online-only Data Supple-
Rao et al
MBD2 Regulates Endothelial Function
2969
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Figure 4. Loss of methyl-CpG– binding domain protein 2 (MBD2) activates endothelial survival and proangiogenic signals. A, Knockdown of MBD2 enhanced extracellular signal-regulated kinase 1/2 (ERK1/2) activity. Left, A representative Western blot results for total
and phosphorylated ERK1/2 (p-ERK1/2). Right, Quantitative analysis of p-ERK1/2 in transfected human umbilical vein endothelial cells
(HUVECs; n⫽3). B, MBD2 siRNA-transfected HUVECs showed increased BCL-2 levels. A 1.2-fold higher BCL-2 was observed in MBD2
siRNA-transfected cells. C, Inhibition of MBD2 in HUVECs enhanced endothelial nitric oxide synthase (eNOS) and vascular endothelial
growth factor receptor 2 (VEGF-R2) expression. MBD2 siRNA transfected HUVECs showed much higher levels of total eNOS and
VEGF-R2. The increased eNOS expression was associated with higher Ser-1177 phosphorylated (p-) eNOS (left). The graph shows the
results of quantitative analysis for total eNOS and VEGF-R2 (n⫽3). D, Analysis of blood vessels derived from Mbd2⫺/⫺ mice showed
results similar to those of HUVECs after knockdown of MBD2 (n⫽3). E, Suppression of MBD2 in HUVECs promoted p38 activation. A
1.3-fold higher p-p38 was observed by quantitative analysis (n⫽3). Twenty-four hours after transfection, HUVECs were treated with
0.2 mmol/L H2O2 for 24 hours; then, cell lysates were used for Western blot analysis of ERK1/2 and BCL-2. In contrast, lysates from
HUVECs 24 hours after transfection were directly used for Western blot analysis of eNOS, VEGF-R2, and p38. Ctl indicates control.
**P⬍0.001; *P⬍0.01.
ment). More significantly, L-NAME treatment completely
abolished the protective effect seen in Mbd2⫺/⫺ mice as
manifested by the similar extent of impaired perfusion after
ischemic injury (Figure 5B).
Methyl-CpG–Binding Domain Protein 2 Binds to
the Methylated CpG Elements in the Endothelial
Nitric Oxide Synthase and Vascular Endothelial
Growth Factor Receptor 2 Promoter
Previous studies suggested evidence supporting a role for
DNA methylation regulating eNOS and VEGF-R2 transcription.3,20,21 We therefore hypothesized that MBD2 represses
eNOS and VEGF-R2 expression by directly binding to the
methylated CpG elements in their promoter. Although no
typical CpG island exists in the eNOS promoter, a region
containing CpG elements is found in the 5⬘-flanking region
(Figure 6A). On the contrary, bioinformatic analysis characterized 2 putative CpG islands in the VEGF-R2 promoter
(Figure 6B). To test our hypothesis, we first treated HUVECs
with 5-aza-2⬘-deoxycytidine (5-azadC), a DNA methylation
inhibitor. Remarkably, knockdown of MBD2 by siRNA had
no perceptible effect on 5-azadC–treated HUVECs (Figure
VI in the online-only Data Supplement), indicating that the
effect of MBD2 involves DNA methylation. Then, ChIP was
used to pull down the MBD2/DNA complexes. Primers
flanking the entire eNOS promoter/5⬘-flanking region and the
putative CpG islands of VEGF-R2 were used to amplify the
MBD2-targeted DNA with the resultant precipitates. No amplification was observed for all primers in the eNOS promoter, but
primers (F9/R9 and F10/R10) in the 5⬘-flanking region yielded
positive results (Figure 6C). Surprisingly, among the 3 primer
pairs used to flank the putative CpG islands for VEGF-R2, only
primers (F3/R3) covering the region between ⫺64 and 166
yielded positive results (Figure 6D).
To confirm the above ChIP assay results, we specifically
examined the methylation states of 13 CpG elements in the
eNOS 5⬘-flaking region by bisulfite DNA sequencing. Indeed, we detected CpG methylation in both the physiological
and ischemic condition (Figure VII in the online-only Data
Supplement). We also characterized a significant DNA meth-
2970
Circulation
June 28, 2011
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Figure 5. Endothelial nitric oxide synthase (eNOS) synergizes with vascular endothelial growth factor (VEGF) receptor 2 (VEGF-R2) to
promote endothelial survival and angiogenesis. A, Blocking assays identified a network downstream of VEGF signaling. Human umbilical vein endothelial cells (HUVECs) were stimulated with VEGF in the presence of blockades for either VEGF-R2 (blocking antibody or
SU1498) or eNOS (with NG-nitro-L-arginine methyl ester [L-NAME]). Extracellular signal-regulated kinase 1/2 activation and BCL-2
expression were shown to be regulated by eNOS and VEGF-R2 signaling, whereas eNOS and VEGF-R2 were found to be downstream
molecules of VEGF signaling. It was also found that eNOS synergizes with VEGF-R2 to promote endothelial survival and angiogenesis.
B, Blockade of eNOS by L-NAME abolished the improvement of perfusion recovery in Mbd2⫺/⫺ mice. Mice after hind-limb ischemic
surgery were provided drinking water containing L-NAME (1 mg/mL) to inhibit eNOS signaling, and mice provided with regular drinking
water served as controls. Blood flow was monitored as described earlier. **P⬍0.001.
ylation turnover on ischemic insult (hypoxia plus serum
starvation) in HUVECs as evidenced by a 1-fold increase in
the methylation rate of these CpG elements (Figure 6E).
Electrophoretic mobility shift assay was then carried out to
further confirm that MBD2 binds to the methylated CpG
elements within this region. Biotin-labeled polymerase chain
reaction products flanking 31 to 197 were first methylated by
SssI methylase and then used as the probe to detect MBD2
binding activity. It was found that MBD2 bound to those
methylated polymerase chain reaction products with high
affinity (Figure VIII in the online-only Data Supplement). To
address that MBD2 represses eNOS transcription by binding
to those methylated CpG elements, eNOS promoter (⫺1700
to 350) was subcloned into a pGL-2 vector (pGL-eNOS). A
mutated eNOS promoter reporter (pGL-eNOSm), in which
cytosines in all CpG elements between ⫺200 and 300 were
mutated to adenosine, was also constructed. Luciferase assays
were then performed with those in vitro methylated reporters
along with a pcDNA-MBD2 plasmid in HUVECs, respectively. Consistently, only those methylated reporters showed
differences for luciferase activities, in which loss of CpG
elements resulted in a 1-fold increase in the reporter activities. In contrast, both pGL-eNOS and pGL-eNOSm showed
similar reporter activities in the unmethylated condition
(Figure IX in the online-only Data Supplement). Taken
together, these results suggest that MBD2 represses eNOS
and VEGF-R2 transcription by directly binding to the methylated CpG elements in their promoter region.
Methyl-CpG–Binding Domain Protein 2
Repression of Endothelial Nitric Oxide Synthase
Transcription Involves Chromatin Remodeling and
Is Confined to Endothelial Cells
It has been suggested that MBD2-mediated transcriptional
repression is associated with chromatin remodeling that
involves histone deacetylases (HDACs).22,23 To check
whether MBD2 repressing eNOS transcription also involves
chromatin remodeling, we exposed cells to trichostatin A
(TSA), an HDAC inhibitor that inhibits eNOS transcription,24
into HUVECs transfected with MBD2 or control siRNA.
Surprisingly, the effect of MBD2 siRNA on eNOS expression
was completely abolished by TSA treatment, as revealed by
the same levels of eNOS expression in both MBD2 and
control siRNA-transfected HUVECs (Figure 7A).
Because TSA has been shown to induce eNOS expression
in non-EC types,24 we wondered whether loss of MBD2
would lead to eNOS expression in non-ECs. We then treated
siRNA-transfected HeLa cells with either TSA or dimethyl
sulfoxide (vehicle). Surprisingly, knockdown of MBD2 failed
to induce eNOS expression in HeLa cells, but eNOS was
detected in the same cells after TSA treatment (Figure 7B).
Studies in HEK293 cells yielded similar results (data not
shown). Next, we analyzed eNOS expression in splenocytes
originated from Mbd2⫺/⫺ and control mice and found that
eNOS was absent in both Mbd2⫺/⫺ and WT splenocytes.
However, eNOS was induced in all cells after TSA treatment
(Figure 7C). Together, our results indicate that MBD2 repressing eNOS expression involves chromatin remodeling
and that this effect is likely confined to ECs.
Discussion
Tissue- or organ-specific gene expression patterns after embryonic development are maintained and controlled by epigenetic changes instead of DNA sequence alterations.25 DNA
methylation as a major epigenetic mechanism of the genome
provides a new perspective on transcriptional control paradigms in ECs. Despite intensive investigation, how DNA
methylation influences endothelial function remains poorly
understood. In the present report, we used MBD2, an epige-
Rao et al
MBD2 Regulates Endothelial Function
2971
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Figure 6. Methyl-CpG– binding domain protein 2 (MBD2) binds to the methylated CpG-elements in endothelial nitric oxide synthase
(eNOS) 5⬘-flanking region and vascular endothelial growth factor receptor 2 (VEGF-R2) promoter. A, The eNOS 5⬘-flanking region (⫺135
to 500 bp; transcriptional starting site as position 1) enriches with CpG elements. Primer pairs flanking the entire eNOS promoter and
5⬘-flanking region were indicated. B, Two putative CpG islands were characterized in the VEGF-R2 promoter, and 3 primer pairs flanking this region were indicated. C, Chromatin immunoprecipitation (ChIP) results for eNOS. Polymerase chain reaction amplifications
were performed with purified total input DNA (input), immunoprecipitates resulting from a specific antibody (MBD2 antibody) or an unrelated antibody (␤-actin antibody), and human umbilical vein endothelial cell (HUVEC) genomic DNA (positive control), respectively. Only
primer pairs F9/R9 (31 to 198) and F10/R10 (275 to 396) yielded positive results. D, ChIP results for VEGF-R2. Polymerase chain reaction amplifications were carried out as above, but only primer pair F3/R3 (⫺64 to 166) produced positive results. E, The eNOS
5⬘-flanking region underwent a DNA methylation turnover after ischemic insult in HUVECs. Bisulfite sequencing analysis was carried out
for the region between ⫺135 and 419 of the eNOS 5⬘-flanking region, which contains 13 CpG elements. Analysis of 10 randomly
selected clones revealed a 1-fold increase in the average methylation rate of these CpG elements in the ischemic condition compared
with the physiological condition.
netic interpreter, to decipher DNA methylome– encoded information in the regulation of endothelial function in both
physiological and disease states. For the first time, our studies
provided direct evidence that DNA methylation regulates
endothelial survival and proangiogenic signals, which constitutes the molecular basis for understanding how an epigenetic
factor affects the genome to modify disease susceptibility.
An interesting finding was that MBD2 was dispensable for
the normal physiology of ECs and animals. Endothelial cells
under physiological condition expressed only moderate levels
of MBD2, but loss of MBD2 significantly enhanced angiogenesis and protected ECs from H2O2-induced apoptosis
(Figure 1). Hind-limb ischemia was then used to address the
importance of MBD2 in disease pathogenesis. In the hindlimb ischemic model, ischemic injury was positively correlated with MBD2 expression (Figure 2). As a result, loss of
MBD2 afforded significantly improved recovery of perfusion
after ischemic surgery, along with increased capillary and
arteriole formation (Figure 3). Given the fact that MBD2
itself does not affect the methylation of DNA and is dispensable for routine physiological activities,14 our results high-
light the potential of MBD2 to be an epigenetic therapeutic
target relevant to disease states.
Survival signals conducted by ERK1/2 and Akt signaling
have been increasingly recognized to be critical for endothelial viability.26 Interestingly, MBD2 only selectively influences the activation of ERK1/2, as evidenced by higher levels
of p-ERK1/2 (Figure 4A) but no perceptible changes in
p-Akt. Because ERK1/2 has been found to phosphorylate
BCL-2 and to prevent its ubiquitin-dependent degradation,17
we also detected significantly higher levels of BCL-2 after
knockdown of MBD2 (Figure 4B). These results suggest that
ECs with reduced MBD2 expression exhibit enhanced
ERK1/2 activity, which antagonizes proapoptotic stimuli by
increasing BCL-2 expression.
Studies in MBD2 siRNA-transfected HUVECs and
Mbd2⫺/⫺ mice consistently demonstrated that MBD2 negatively regulates eNOS and VEGF-R2 expression (Figure 4C
and 4D). The importance of eNOS in endothelial function is
underscored by the observation that eNOS⫺/⫺ animals develop systemic and pulmonary hypertension, altered vascular
remodeling, abnormal angiogenesis, impaired wound healing,
2972
Circulation
June 28, 2011
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Figure 7. Methyl-CpG– binding domain protein 2 (MBD2) repression of eNOS expression is confined to endothelial cells (ECs).
A, Trichostatin A (TSA) treatment abolished the effect of MBD2
siRNA on endothelial nitric oxide synthase (eNOS) expression in
human umbilical vein ECs (HUVECs). Transfected HUVECs were
treated with TSA or control vehicle for 48 hours and then subjected to Western blot analysis. Similar levels of eNOS were
detected in MBD2 and control siRNA-transfected HUVECs on
TSA treatment. B, Knockdown of MBD2 failed to induce eNOS
expression in HeLa cells. No detectable eNOS was observed in
HeLa cells transfected with either MBD2 or control siRNA; however, the addition of TSA induced eNOS expression in both
transfected cells. C, Splenocytes derived from Mbd2⫺/⫺ mice
did not express eNOS, but TSA induced eNOS expression in
both Mbd2⫺/⫺ and wild-type (WT) splenocytes. Splenocytes
derived from both Mbd2⫺/⫺ and WT mice were treated with TSA
for 48 hours before Western blot analysis.
and defective mobilization of stem and progenitor cells.27,28
Similar to eNOS, VEGF-R2 transduces most of the VEGFmediated mitogenic, survival, and vascular permeability signals critical for angiogenesis.29,30 We first demonstrated
evidence suggesting that MBD2 regulates angiogenesis by
affecting VEGF downstream signaling because VEGF stimulation of HUVECs activated signals similar to those of
knockdown of MBD2 expression (Figure 5A). Interestingly,
blocking either eNOS or VEGF-R2 signaling inhibited
VEGF-induced ERK1/2 activation and BCL-2 expression,
indicating that ERK1/2 and BCL-2 are downstream molecules of the eNOS and VEGF-R2 signaling. Given the fact
that MBD2 did not show a perceptible impact on ERK1/2
expression, this result suggests that the enhanced ERK1/2
activation and BCL-2 expression after knockdown of MBD2
could be indirect effects resulting from increased eNOS and
VEGF-R2 expression. Of important note, studies in VEGFstimulated HUVECs also suggested evidence supporting
crosstalk between eNOS and VEGF-R2 signaling in which
eNOS synergizes with VEGF-R2 to enhance endothelial
survival and angiogenesis; therefore, blockade of eNOS by
L-NAME completely abolished the protective effect against
hind-limb ischemia seen in Mbd2⫺/⫺ mice (Figure 5B).
We also noticed higher p38 activation after knockdown of
MBD2 expression (Figure 4E). The exact role for p38 in
endothelial function, however, remains controversial.31,32 It is
likely that the activation of p38 may serve a number of
different functions, depending on the cellular context or
rather the activation state of other signaling pathways. The
role of p38 in the epigenetic pathways affected by MBD2
remains unclear in the present study; therefore, dissecting the
role of p38 signaling in MBD2 deficiency–related phenotypes
would be a critical focus of future studies.
A key question is how MBD2 regulates eNOS and
VEGF-R2 expression. We assumed that MBD2 executes this
function by binding to the methylated CpG elements in their
promoter region. Although a previous study suggested evidence for DNA methylation in restricting eNOS expression to
the vascular endothelium,21 direct evidence indicating the
methylation of CpG elements in its promoter is lacking.
Treatment of MBD2 siRNA-transfected HUVECs with
5-azadC yielded the first line of evidence supporting that
MBD2 regulation of eNOS and VEGF-R2 expression implicates the methylation of CpG elements (Figure VI in the
online-only Data Supplement). Indeed, bisulfite sequencing
analysis of the eNOS 5⬘-flanking region demonstrated direct
evidence confirming the methylation of these CpG elements
(Figure VII in the online-only Data Supplement). The eNOS
5⬘-flanking region (⫺135 to 419) contains 13 CpG elements.
Under the ischemic condition, the average methylation rate of
these CpG elements increased by 1-fold compared with that
in the physiological condition (Figure 6E). Our subsequent
ChIP, electrophoretic mobility shift assay, and eNOS promoter reporter assays provided convincing evidence that
MBD2 directly binds to the methylated CpG elements in the
eNOS 5⬘-flanking region and suppresses its transcription
(Figure 6B and 6D and Figures VIII and IX in the online-only
Data Supplement). Collectively, our data suggest that ECs in
the ischemic condition undergo a DNA methylation turnover
that encodes the information in favor of disease pathologies
and that MBD2 deciphers the change of DNA methylome by
binding to the methylated CpG elements of targeted genes.
Previous studies have revealed that MBD2 responds to
methylated DNA by recruiting HDACs and other transcription repression factors to the chromatin.23 Unexpectedly,
administration of TSA, a specific inhibitor of HDACs,
completely abolished the effect of MBD2 siRNA on eNOS
expression in HUVECs (Figure 7). Strikingly, unlike TSA,
which induces eNOS expression in non-ECs,33 the effect of
MBD2 silencing on eNOS expression was observed only in
ECs. For example, HeLa cells or HEK293 cells with reduced
MBD2 failed to express eNOS, and eNOS was undetectable
in splenocytes derived from Mbd2⫺/⫺ mice. On the contrary,
TSA treatment induced eNOS expression in both WT and
MBD2-deficient splenocytes. Together, our results suggest
Rao et al
that MBD2 regulation of eNOS expression is probably
confined to ECs. In contrast to this conclusion, we also
noticed an enhanced arteriogenesis in Mbd2⫺/⫺ mice after
ischemic insult as evidenced by the increase in ␣-actin–
positive cells (Figure 3C). However, this phenotype is probably an indirect effect resulting from enhanced eNOS expression because eNOS also plays an essential role in inducing
arteriogenesis.34,35
9.
10.
11.
12.
Conclusions
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
The present report demonstrates evidence that MBD2
deciphers DNA methylome– encoded information to modulate endothelial function. On environmental insults, ECs
undergo a DNA methylation turnover that encodes the
information in favor of disease pathologies. MBD2 deciphers the change in DNA methylome by binding to the
methylated CpG elements of targeted genes. As a result,
inhibition of MBD2 enhances angiogenesis and protects
ECs from H2O2-induced apoptosis. Mice deficient in
MBD2 also show significantly improved perfusion after
hind-limb ischemic injury. Given the fact that MBD2 itself
does not modify the patterns of DNA methylation and
appears to be dispensable for normal physiology, our
results suggest that MBD2 could be a viable epigenetic
target to modulate endothelial function in disease states
such as targeting MBD2 to prevent endothelial dysfunction
during the course of atherosclerosis and diabetic
nephropathy.
Acknowledgments
13.
14.
15.
16.
17.
18.
19.
20.
We thank Dr Adrian Bird for providing us the MBD2 knockout mice
and Drs Weiguo Li and Junfeng Pang for technical assistance.
21.
Sources of Funding
This study was supported by grants from the Juvenile Diabetes
Research Foundation International and the European Foundation for
the Study of Diabetes/Chinese Diabetes Society/Lilly Program) to Dr
C-Y Wang.
22.
23.
Disclosures
None.
24.
References
1. Losordo DW, Dimmeler S. Therapeutic angiogenesis and vasculogenesis
for ischemic disease, part I: angiogenic cytokines. Circulation. 2004;109:
2487–2491.
2. Ware JA, Simons M. Angiogenesis in ischemic heart disease. Nat Med.
1997;3:158 –164.
3. Matouk CC, Marsden PA. Epigenetic regulation of vascular endothelial
gene expression. Circ Res. 2008;102:873– 887.
4. Ushijima T, Nakajima T, Maekita T. DNA methylation as a marker for
the past and future. J Gastroenterol. 2006;41:401– 407.
5. Kim M, Long TI, Arakawa K, Wang R, Yu MC, Laird PW. DNA
methylation as a biomarker for cardiovascular disease risk. PLoS One.
2010;5:e9692.
6. Dong C, Yoon W, Goldschmidt-Clermont PJ. DNA methylation and
atherosclerosis. J Nutr. 2002;132:2406S–2409S.
7. Dhasarathy A, Wade PA. The MBD protein family: reading an epigenetic
mark? Mutat Res. 2008;647:39 – 43.
8. Fraga MF, Ballestar E, Montoya G, Taysavang P, Wade PA, Esteller M.
The affinity of different MBD proteins for a specific methylated locus
25.
26.
27.
28.
29.
MBD2 Regulates Endothelial Function
2973
depends on their intrinsic binding properties. Nucleic Acids Res. 2003;
31:1765–1774.
Fatemi M, Wade PA. MBD family proteins: reading the epigenetic code.
J Cell Sci. 2006;119:3033–3037.
Chen WG, Chang Q, Lin Y, Meissner A, West AE, Griffith EC, Jaenisch
R, Greenberg ME. Derepression of BDNF transcription involves calciumdependent phosphorylation of MeCP2. Science. 2003;302:885– 889.
Allan AM, Liang X, Luo Y, Pak C, Li X, Szulwach KE, Chen D, Jin P,
Zhao X. The loss of methyl-CpG– binding protein 1 leads to autism-like
behavioral deficits. Hum Mol Genet. 2008;17:2047–2057.
Sansom OJ, Zabkiewicz J, Bishop SM, Guy J, Bird A, Clarke AR. MBD4
deficiency reduces the apoptotic response to DNA-damaging agents in the
murine small intestine. Oncogene. 2003;22:7130 –7136.
Yoon JH, Iwai S, O’Connor TR, Pfeifer GP. Human thymine DNA
glycosylase (TDG) and methyl-CpG– binding protein 4 (MBD4) excise
thymine glycol (Tg) from a Tg:G mispair. Nucleic Acids Res. 2003;31:
5399 –5404.
Hendrich B, Guy J, Ramsahoye B, Wilson VA, Bird A. Closely related
proteins MBD2 and MBD3 play distinctive but interacting roles in mouse
development. Genes Dev. 2001;15:710 –723.
Hazarika S, Dokun AO, Li Y, Popel AS, Kontos CD, Annex BH.
Impaired angiogenesis after hindlimb ischemia in type 2 diabetes mellitus: differential regulation of vascular endothelial growth factor receptor
1 and soluble vascular endothelial growth factor receptor 1. Circ Res.
2007;101:948 –956.
Arenillas JF, Sobrino T, Castillo J, Davalos A. The role of angiogenesis in damage and recovery from ischemic stroke. Curr Treat
Options Cardiovasc Med. 2007;9:205–212.
Breitschopf K, Haendeler J, Malchow P, Zeiher AM, Dimmeler S. Posttranslational modification of Bcl-2 facilitates its proteasome-dependent
degradation: molecular characterization of the involved signaling
pathway. Mol Cell Biol. 2000;20:1886 –1896.
Murohara T, Asahara T, Silver M, Bauters C, Masuda H, Kalka C,
Kearney M, Chen D, Symes JF, Fishman MC, Huang PL, Isner JM. Nitric
oxide synthase modulates angiogenesis in response to tissue ischemia.
J Clin Invest. 1998;101:2567–2578.
Munoz-Chapuli R, Quesada AR, Angel MM. Angiogenesis and signal
transduction in endothelial cells. Cell Mol Life Sci. 2004;61:2224 –2243.
Kim JY, Hwang JH, Zhou W, Shin J, Noh SM, Song IS, Kim JY, Lee
SH, Kim J. The expression of VEGF receptor genes is concurrently
influenced by epigenetic gene silencing of the genes and VEGF
activation. Epigenetics. 2009;4:313–321.
Chan Y, Fish JE, D’Abreo C, Lin S, Robb GB, Teichert AM,
Karantzoulis-Fegaras F, Keightley A, Steer BM, Marsden PA. The cellspecific expression of endothelial nitric-oxide synthase: a role for DNA
methylation. J Biol Chem. 2004;279:35087–35100.
Angrisano T, Lembo F, Pero R, Natale F, Fusco A, Avvedimento VE,
Bruni CB, Chiariotti L. TACC3 mediates the association of MBD2 with
histone acetyltransferases and relieves transcriptional repression of methylated promoters. Nucleic Acids Res. 2006;34:364 –372.
Ng HH, Zhang Y, Hendrich B, Johnson CA, Turner BM, ErdjumentBromage H, Tempst P, Reinberg D, Bird A. MBD2 is a transcriptional
repressor belonging to the MeCP1 histone deacetylase complex. Nat
Genet. 1999;23:58 – 61.
Robb GB, Carson AR, Tai SC, Fish JE, Singh S, Yamada T, Scherer SW,
Nakabayashi K, Marsden PA. Post-transcriptional regulation of endothelial nitric-oxide synthase by an overlapping antisense mRNA transcript.
J Biol Chem. 2004;279:37982–37996.
Pontes O, Lawrence RJ, Silva M, Preuss S, Costa-Nunes P, Earley K,
Neves N, Viegas W, Pikaard CS. Postembryonic establishment of
megabase-scale gene silencing in nucleolar dominance. PLoS One. 2007;
2:e1157.
Berk BC, Abe JI, Min W, Surapisitchat J, Yan C. Endothelial atheroprotective and anti-inflammatory mechanisms. Ann N Y Acad Sci. 2001;947:
93–109.
Fish JE, Marsden PA. Endothelial nitric oxide synthase: insight into
cell-specific gene regulation in the vascular endothelium. Cell Mol Life
Sci. 2006;63:144 –162.
Liu VW, Huang PL. Cardiovascular roles of nitric oxide: a review of
insights from nitric oxide synthase gene disrupted mice. Cardiovasc Res.
2008;77:19 –29.
Millauer B, Wizigmann-Voos S, Schnurch H, Martinez R, Moller NP,
Risau W, Ullrich A. High affinity VEGF binding and developmental
expression suggest Flk-1 as a major regulator of vasculogenesis and
angiogenesis. Cell. 1993;72:835– 846.
2974
Circulation
June 28, 2011
30. Rissanen TT, Vajanto I, Hiltunen MO, Rutanen J, Kettunen MI, Niemi M,
Leppanen P, Turunen MP, Markkanen JE, Arve K, Alhava E, Kauppinen
RA, Yla-Herttuala S. Expression of vascular endothelial growth factor and
vascular endothelial growth factor receptor-2 (KDR/Flk-1) in ischemic
skeletal muscle and its regeneration. Am J Pathol. 2002;160:1393–1403.
31. Matsumoto T, Turesson I, Book M, Gerwins P, Claesson-Welsh L. p38 MAP
kinase negatively regulates endothelial cell survival, proliferation, and differentiation in FGF-2-stimulated angiogenesis. J Cell Biol. 2002;156:149–160.
32. Zhang CL, Song F, Zhang J, Song QH. Hypoxia-induced Bcl-2
expression in endothelial cells via p38 MAPK pathway. Biochem Biophys
Res Commun. 2010;394:976 –980.
33. Gan Y, Shen YH, Wang J, Wang X, Utama B, Wang J, Wang XL. Role
of histone deacetylation in cell-specific expression of endothelial
nitric-oxide synthase. J Biol Chem. 2005;280:16467–16475.
34. Yu J, deMuinck ED, Zhuang Z, Drinane M, Kauser K, Rubanyi GM,
Qian HS, Murata T, Escalante B, Sessa WC. Endothelial nitric oxide
synthase is critical for ischemic remodeling, mural cell recruitment,
and blood flow reserve. Proc Natl Acad Sci U S A. 2005;102:1099911004.
35. Cui X, Chopp M, Zacharek A, Zhang C, Roberts C, Chen J. Role of
endothelial nitric oxide synthetase in arteriogenesis after stroke in mice.
Neuroscience. 2009;159:744 –750.
CLINICAL PERSPECTIVE
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Functional impairment for endothelial cells is associated with an attenuated angiogenic response that features prominently
in patients with poor clinical outcomes after peripheral and/or myocardial ischemia. Although DNA methylation has long
been implicated in endothelial pathologies, the underlying mechanisms remain poorly understood. The present article
reports the impact of methyl-CpG– binding domain protein 2 (MBD2), an interpreter for DNA methylome-encoded
information, on endothelial function in both physiological and disease states. Moderate levels of DNA methylation were
characterized for some key endothelial genes, such as endothelial nitric oxide synthase and vascular endothelial growth
factor receptor 2 in the physiological condition. However, these genes undergo a significant DNA methylation turnover
when endothelial cells are under ischemic condition. MBD2 deciphers this methylation turnover– encoded information by
directly binding to the methylated CpG elements, leading to the suppression of their transcription in favor of endothelial
pathologies. Therefore, suppression of MBD2 expression enhances endothelial nitric oxide synthase and vascular
endothelial growth factor receptor 2 transcription, which then promote extracellular signal-regulated kinase 1/2 activation
and BCL-2 expression. Consistent with these results, knockdown of MBD2 by siRNA enhanced endothelial angiogenesis
and provided protection against H2O2-induced apoptosis. Mice deficient in MBD2 showed remarkably improved perfusion
recovery after hind-limb ischemic surgery. Furthermore, MBD2 regulation of endothelial nitric oxide synthase expression
is likely confined to endothelial cells because other types of cells fail to express endothelial nitric oxide synthase after loss
of MBD2 such as splenocytes. These discoveries are important for understanding how an epigenetic factor affects the
genome to modify disease susceptibility. Because MBD2 itself does not affect DNA methylation and is dispensable for
normal physiology in mice, it could be a viable epigenetic target for modulating endothelial function in disease states.
Loss of Methyl-CpG−Binding Domain Protein 2 Enhances Endothelial Angiogenesis and
Protects Mice Against Hind-Limb Ischemic Injury
Xiaoquan Rao, Jixin Zhong, Shu Zhang, Yushan Zhang, Qilin Yu, Ping Yang, Mong-Heng
Wang, David J. Fulton, Huidong Shi, Zheng Dong, Daowen Wang and Cong-Yi Wang
Downloaded from http://circ.ahajournals.org/ by guest on June 18, 2017
Circulation. 2011;123:2964-2974; originally published online June 13, 2011;
doi: 10.1161/CIRCULATIONAHA.110.966408
Circulation is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2011 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7322. Online ISSN: 1524-4539
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circ.ahajournals.org/content/123/25/2964
Data Supplement (unedited) at:
http://circ.ahajournals.org/content/suppl/2011/06/24/CIRCULATIONAHA.110.966408.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation is online at:
http://circ.ahajournals.org//subscriptions/
SUPPLEMENTAL MATERIAL
Supplemental Methods
Reagents
Trichostatin A (TSA), 5-aza-2'-deoxycytidine (5-azadC) and N (G)-nitro-L- arginine methyl
ester (L-NAME), were purchased from Sigma (St. Louis, MO). Antibodies for phosphor-MAPK
P38, total P38, phosphor-ERK 1/2, total ERK 1/2 and phosphor-eNOS (Ser-1177) were
purchased from Cell Signaling (Beverly, MA). eNOS antibody, MBD2 siRNA and control
siRNA were purchased from Santa Cruz (Santa Cruz, CA). Antibody for MBD2 in ChIP assay
was purchased from Bethyl (Montgomery, TX), and VEGF-R2 antibody was obtained from
Upstate (Lake Placid, NY). Recombinant human VEGF165 was purchased from PeproTech
(Rocky Hill, NJ). VEGF-R2 neutralizing antibody was purchased from R&D (Minneapolis,
MN). SU1498 was obtained from Calbiochem (San Diego, CA).
Cell Culture and Transfection
Human Umbilical Vein Endothelial Cells (HUVECs, ATCC) were cultured at 37°C with 5%
CO2 in EBM-2 endothelial cell basal medium with SingleQuot Kit (Lonza/Cambrex,
Walkersville, MD) as instructed. HeLa cells were cultured in DMEM (Hyclone, Logan, Utah)
with 10% fetal bovine serum (FBS) at 37°C with 5% CO2. For siRNA transfection, the cells
were seeded in 12-well plate at a density of 4 x 104 cells per well. On the second day, 50 or 100
nmol/L of control siRNA or MBD2 siRNA (Santa Cruz, Santa Cruz, CA) were transfected into
the cells using the lipofectamine reagent (Invitrogen, Carlsbad, CA) as instructed. For TSA
treatment, TSA (0.2 μg/ml) was added into the cultures and the cells were cultured for additional
48h. For 5-azadC treatment, HUVECs were cultured in the presence of 5-azadC (2 μmol/l) for 2
days, followed by siRNA transfection and subjected to Western blot analysis after 2 days. Cells
cultured with same volume of DMSO were used as a control. For blocking assays, HUVECs
were pre-incubated with a VEGF-R2 neutralizing Ab (1μg/ml) or SU1498 (10 μmol/l) or LNAME (200 μmol/l) for 30 min, followed by stimulation with human recombinant VEGF165 (20
ng/ml) for 10 min.
Flow Cytometry Analysis of Endothelial Apoptosis
ECs transfected with control or MBD2 siRNA were treated with 0.2mmol/L H2O2 for 24h to
induce apoptosis followed by annexin-V and propidium iodide (PI) (Invitrogen, Carlsbad, CA)
staining. Apoptotic (annexin-V and PI positive) cells were analyzed by flow cytometry as
previously reported1. At least 10,000 events were collected. Data was analyzed with CellQuest
v3.3 software (BD Bioscience, San Jose, CA) as instructed.
In Vitro Angiogenesis Assay
ECs were transfected with control or MBD2 siRNA 24h before the assay. To examine tube
formation, growth factor-reduced Matrigel (BD Bioscience, San Jose, CA) was placed in 96-well
tissue culture plates (100μL/well) and allowed to form a gel at 37°C for at least 30min. ECs (2 x
104 cells) after 24h of transfection were added into each well and incubated in 2% FBS EBM-2
endothelial cell basic medium at 37°C for 24h under a 5% CO2 atmosphere. Endothelial tubes
were then examined under a light microscope every other 4h by inspecting the overall tube
length and branch points. For endothelial proliferation assay, endothelial cells 24h after
transfection were trypsinized and seeded in 96-well tissue culture plates at a density of 5 x 103
cells per well. The cells were pulsed with 0.5µCi/well 3H-thymidine for 16h and then harvested
and counted in a 1450 MicroBeta TriLux Microplate Scintillation and Luminescence Counter
(PerkinElmer, Boston, MA)1. EC proliferation was determined by 3H-thymidine incorporation
and present as counts per minute (cpm).
Hindlimb Ischemia Model and Assessments
Mbd2-/- or WT mice were subjected to unilateral hindlimb surgery2 under anesthesia with
intraperitoneal administration of ketamine (85 mg/kg) and xylazine (15 mg/kg). The mice were
put on a dissection microscope at 10X or 20X magnification to obtain an enlarged view of the
left hindlimb region. A 1-cm long incision was made in the skin at the medial thigh to expose the
femoral artery. The femoral artery in the left hindlimb was separated from the femoral vein and
nerve at the proximal location near the groin. A strand of 7-0 silk suture was passed through
underneath the proximal end of the femoral artery and occluded the proximal femoral artery
using double knots. The segment of femoral artery between the distal and proximal knots was
then transected using a pair of spring scissors. The incision was then closed using 5-0 sutures.
Hindlimb blood flow in mice undergone hindlimb ischemia was measured with a PIM 3 scanning
Laser Doppler imaging system (Perimed, Stockholm, Sweden). Animals were anesthetized and
maintained at 37°C on a heating plate to minimize temperature variation. Laser Doppler Blood
Flow (LDBF) analyses were performed on legs and feet before/post surgery on days 0, 2, 4, 7,
and 14. Blood Flow images of hindlimbs (3 per animal) were then acquired. Blood flow was
presented as changes in the laser frequency, represented by different color pixels. The mean
hindlimb blood flow was calculated as the ratio of ischemic side to nonischemic side. Six mice
were analyzed in each group. For treatment of mice with L-NAME, the mice after ischemic
surgery were provided drinking water containing 1mg/ml L-NAME during the perfusion
recovery period. Mice provided with regular drinking water were served as controls.
Immunostaining of MBD2, Capillaries and Arterioles
Tissue sections (10-μm) prepared from OCT-embedded ischemic and control hindlimbs were
used for immunostaining. To detect MBD2 expression, the sections were incubated with a sheep
anti-MBD2 antibody (Millipore, Bedford, MA), followed by staining with a FITC-conjugated
bovine anti-sheep IgG (Santa Cruz, Santa Cruz, CA). For defining capillaries, a rat anti-mouse
CD31 antibody (BD pharmingen, San Diego, CA) was used to detect endothelial cells, followed
by staining with a Texas red-conjugated goat anti-rat IgG (Santa Cruz, Santa Cruz, CA). A rabbit
polyclonal anti-smooth muscle α-actin (Abcam, Cambridge, MA) was used to satin smooth
muscle cells in the arterioles, and the sections were next stained with a Texas red-conjugated
goat anti-rabbit IgG (Santa Cruz, Santa Cruz, CA). The relative amount of MBD2-, CD31- and
α-actin-positive cells were counted in 5 randomly selected high-power fields (magnification
x200) with 4 mice for each group, respectively.
Western Blotting Proteins were separated by 8% SDS-PAGE and then transferred onto PVDF membranes. After
blocking with 5% nonfat milk in TBS-T, the membranes were incubated with indicated primary
antibodies for 16h at 4 ºC, followed by incubation with secondary horseradish peroxidaseconjugated antibody for 1h at RT. After extensive washes with TBS-T, the membrane was
visualized with ECL plus reagents (Pierce, Rockford, IL)3. All primary antibodies were used at
the recommended dilutions provided by the manufacturers.
Chromatin Immunoprecipitation (ChIP) Assay
ChIP assay was carried out using a Chromatin Immunoprecipitation Assay Kit (Upstate
Biotechnology, Lake Placid, NY) as instructed. A β-actin antibody was used to demonstrate nonspecific precipitation (negative control). Briefly, 5 x 106 HUVECs were incubated with 1%
formaldehyde to cross-link DNA-interacting protein to chromatin DNA. Cells were then lysed
with 200μl SDS lysis buffer followed by sonication. DNA/protein complexes were then diluted
with 1.8ml dilution buffer and pulled down with agarose beads conjugated with an anti-MBD2 or
a control antibody. The complexes were then eluted with 500μl elution buffer, and the DNA was
released from crosslinks by incubating with 200mM NaCl. One microliter of resulting solution
was then used as template to amplify MBD2 targeted DNA sequences. One microliter of
solutions before incubation with antibody was used as input. Primers that generate overlapped
PCR fragments (around 100 – 240bp for each) to flank the entire eNOS promoter and the
putative CpG islands of the VEGF-R2 promoter were used to detect the MBD2 targeted
sequences. The CG percentage and CpG islands were analyzed using EMBOSS CpGPlot
software (http://www.ebi.ac.uk/ Tools/emboss/cpgplot/index.html). All primer sequences and
locations are summarized in the Online Data Supplement (Table 1).
DNA Bisulfite Sequencing Analysis
HUVECs were cultured in the hypoxic condition with serum starvation for 16h to mimic
ischemic insult in animals. Genomic DNA was then extracted using a QIAamp DNA mini kit
(QIAGEN, Valencia, CA) from HUVECs cultured in the normal and ischemic condition,
respectively. Around 0.5 to 1μg DNA from each preparation were then employed for bisulfite
conversion using an EZ DNA Methylation™ Kit (Zymo Research Corporation, Orange, CA) as
instructed. After bisulfite conversion, the eNOS 5'-flanking region was amplified using following
primers (product size, 554bp): forward, 5'-GGA GTT GAG GTT TTA GAG TTT TTT AG-3';
reverse, 5'-CCC TTA CTC CCA ACT TTC ACC T-3'. PCR amplifications were carried out at
95°C for 10 minutes, followed by 38 cycles of 95°C for 30 seconds, 57°C for 30 seconds and
72°C for 30 seconds, with final extension at 72°C for 10 minutes. The resulting PCR products
were first checked by agarose gel electrophoresis and then subcloned into a TA vector using a
TOPO® Cloning Kit (Invitrogen, Carlsbad, CA). Ten positive clones originated from each PCR
products were randomly selected for DNA sequencing analysis with T3 and T7 primers in an
ABI 310 automated sequencing system (Perkin Elmer, Foster City, California). DNA sequencing
results were analyzed by software Sequencher 4.7 (Ann Arbor, MI).
Electrophoretic Mobility Shift Assay (EMSA)
Nuclear proteins were extracted from HEK293 cells transfected with a pcDNA-MBD2 construct
(provided by Dr. Wen-Cheng Xiong, Medical College of Georgia) using the NE-PER® Nuclear
and Cytoplasmic Extraction Reagents (Thermo Scientific, Rockford, IL), which were then used
for EMSA with a LightShift® Chemiluminescent EMSA Kit (Thermo Scientific, Rockford, IL)
as instructed. A biotin-labeled double-stranded probe (position +31 to +197) was prepared by
PCR amplification from HUVECs using the following primers: Biotin-F9, Biotin-5'- CAG AGT
GGA CGC ACA GTA ACA T-3'; R9, 5'-CGC TGG TGG GAG TAG GGA T-3'. The resulting
products were first examined on a 2% agarose gel and then methylated by SssI as detailed below.
A mixture of probe (1:200, Biotin-labeled vs. unlabeled) was used as a competitive control.
Probes without biotin were prepared using primers F9 and R9 followed by SssI treatment.
eNOS Promoter reporter Assay
eNOS promoter (-1700 to +350) was directly amplified from HUVECs and subcloned into a
pGL-2 reporter vector (Promaga, Madison, WI; pGL-eNOS) as instructed. The mutated eNOS
promoter was the same as the wild-type promoter except for that cytosines in all CpG-elements
between -200 to +300 were mutated to A, which was directly synthesized by GeneScript
(Piscataway, NJ) and then subcloned into the pGL-2 vector (pGL-eNOSm). Both constructs were
next methylated by incubating with SssI methylase (New England BioLabs, Beverly, MA) at
10mM Tris, pH7.9, 50mM NaCl, 10mM MgCl2, 1mM DTT, and 160μM S-adenosylmethionine
at 37oC for 1h. After purification, each reporter vector was co-transfected with a pcDNA-MBD2
plasmid along with an internal control reporter (pGL-Tk) into HUVECs using the lipofectamine
2000 transfection reagent (Invitrogen, Carlsbad, CA). Luciferase reporter activity was
determined 48h after transfection using the Dual-Luciferase reporter assay system (Promega,
Madison, WI) as previously reported.4 The relative luciferase activity was normalized by the
internal pGL-Tk reporter.
Table 1. The sequence of primers used in ChIP.
Three primer pairs were used to cover the two putative CpG islands characterized in the VEGFR2 promoter region. Ten primer pairs were used to flank the entire eNOS promoter and 5'untranslated region (5'-UTR). The promoter sequences for VEGF-R2 and eNOS are retrieved
from website http://rulai.cshl.edu/cgi-bin/TRED/tred.cgi?process=home, and the accession
numbers are 32514 and 38471, respectively.
Gene Primer Position and Name (transcriptional starting site as +1) ‐709 to ‐532 (178bp) VEGF‐R2 ‐547 to ‐352 (196bp) ‐64 to +167 (233bp) ‐1,426 to ‐1,210 (217bp) ‐1,230 to ‐1,038 (193bp) ‐1,118 to ‐948 (171bp) ‐904 to ‐763 (142bp) ‐684 to ‐562 (123bp) eNOS ‐493 to ‐301 (193bp) ‐318 to ‐208 (111bp) ‐189 to ‐87 (103bp) +31 to +197 (167bp) +275 to +395 (121bp) F1 R1 F2 R2 F3 R3 F1 R1 F2 R2 F3 R3 F4 R4 F5 R5 F6 R6 F7 R7 F8 R8 F9 R9 F10 R10 Sequence GAATGTTGGCGAACTGGG CACAAGGGAGAAGCGGATA CCGCTTCTCCCTTGTGGCT ACTCGGTAACGGGCGCTGA TGGTCGCTGCGTTTCCTC CGGGAGCCGGTTCTTTC CATGGTAGAAGATGCCTGAAA TGGAGGATGGAGGGTGAA CCCTTCACCCTCCATCCT GGAGCAGCAGACAGACAGAC CAACCTTATCCTCCACTGCT GGTCGAAGCCTCGTGATT CAGATGGCACAGAACTACAAA GCCAGGGAAGAGCTTGAT GGGTGGAGGCACTGGAA CCTTGAGTCTGACATTAGGGTAT CCAGGAGTTCTTGTATGTATGG GGTCCTTCTGTGATGTGGC GGTGCCACATCACAGAAGG AGCCCAGGTGTCCAGCA TCCTCACAGCGGAACCC CAATGGGACAGGAACAAGC CAGAGTGGACGCACAGTAACAT CGCTGGTGGGAGTAGGGAT GGGAAGGTCTGGAACTTGTA CCGACTCTGATCCTGGTCT AKT
p-AKT
siRNA:
Supplemental Figure I
Ctl
MBD2
β-actin MnSOD Cu/ZnSOD
siRNA:
Supplemental Figure II
Ctl
MBD2
WT
VEGFR-2
eNOS
p-ERK
GAPDH
Supplemental Figure III
Mbd2-/-
P38
p-p38
WT
Supplemental Figure IV
Mbd2-/-
MBD2-/B6
MBD2-/-, L-NAME
B6, L-NAME
BS
AS
DAY 2
DAY4
DAY7
BS: the day before ischemic surgery;
AS: the day after ischemic surgery
Supplemental Figure V
DAY14
AZA
β-actin VEGFR2
eNOS
siRNA
Supplemental Figure VI
Ctl
MBD2
Ctl
MBD2
FP
TS
-72 -23
+39
-109 -67
+1
+94 +150+195
+67
+127 +167
+392
+301
RP
NC1
NC2
NC3
NC4
NC5
NC6
NC7
NC8
NC9
NC10
IC1
IC2
IC3
IC4
IC5
IC6
IC7
IC8
IC9
IC10
FP: forward primer; RP: reverse primer; TS: transcription site
unmethylated
Supplemental Figure VII
methylated
Lysates
+
Biotin-Probe
Unlabeled-probe -
Shifted band
Free probe
Supplemental Figure VIII
+
+
+
+
+
Supplemental Figure IX
Supplemental Figure Legends
Figure I. Knockdown of MBD2 by siRNA shows no perceptible effect on Akt signaling.
MBD2 or control siRNA transfected HUVECs were treated with 0.2mmol/L H2O2 for 24h. Cell
lysates were then used for Western blot analysis of total Akt and activated or phosphorylated Akt
(p-Akt). No significant difference was detected for both total Akt and p-Akt between MBD2
siRNA and control siRNA transfected cells.
Figure II. Altered MBD2 expression does not affect Cu/ZnSOD and MnSOD transcription.
HUVECs 24h after MBD2 or control siRNA transfection were treated with 0.2mmol/L H2O2 for
24h. The cells were then harvested for Western blot analysis of Cu/ZnSOD and MnSOD
expression. No significant change for both Cu/ZnSOD and MnSOD was observed after
knockdown of MBD2 by siRNA.
Figure III. Mbd2-/- mice after hindlimb ischemic surgery show enhanced eNOS and VEGFR2 expression along with higher ERK1/2 activation.
Ischemic tissues were collected from Mbd2-/- and WT mice after day 7 of ischemic surgery.
Tissue lysates were then analyzed by Western blotting for the expression levels of eNOS and
VEGF-R2 as well as the levels of phosphorylated ERK1/2 (p-ERK1/2). GAPGH was used for
normalization. Much higher eNOS and VEGF-R2 expressions along with higher ERK1/2
activation were observed in Mbd2-/- mice than that of WT mice. The molecular changes for
eNOS and VEGF-R2 expression and ERK1/2 activation were correlated with improved
perfusion recovery in Mbd2-/- mice as compared with that of WT mice.
Figure IV. Enhanced p38 activation in the blood vessels of Mbd2-/- mice.
Blood vessels were isolated from both WT and Mbd2-/- mice and subjected to Western blot
analysis of total and phosphorylated or activated p38 (p-p38). No significance was observed for
total p38, but Mbd2-/- mice showed higher levels of p-p38 as compared with that of control mice.
Figure V. Blockade of eNOS by L-NAME abrogates the improved blood flow restoration in
Mbd2-/- mice.
Mbd2-/- and WT mice after hindlimb ischemic surgery were provided with drinking water
containing 1mg/ml L-NAME to block eNOS signaling during the perfusion recovery period.
Mice provided with regular drinking water were served as controls. Blood flow was measured
using a Laser Doppler imaging system as described earlier. Images shown here are
representatives of three mice analyzed for each study group. The improved blood flow in Mbd2-/mice was completely abolished after blockade of eNOS signaling by L-NAME.
Figure VI. Treatment of HUVECs with 5-azadC abolishes the effect of MBD2 siRNA on
eNOS and VEGF-R2 expression.
HUVECs 6h after MBD2 siRNA or control siRNA transfection were cultured in the presence of
5-azadC (2 μmol/l) for 2 days, followed by Western blot analysis of the expression levels for
eNOS and VEGF-R2. It was interestingly noted that 5-azadC treatment completely abolished the
enhancing effect of MBD2 siRNA on eNOS and VEGF-R2 expression.
Figure VII. DNA bisulfite analysis results for the eNOS 5'-flanking region.
Ten clones originated from PCR products of HUVECs in the normal and ischemic condition
were analyzed by direct DNA sequencing, respectively. The location for each CpG-element in
the eNOS 5'-flanking region is indicated. The methylation state for each CpG-element is present
either with an empty circle (unmethylated) or filled circle (methylated). The overall methylation
rate for all of these CpG-elements was much higher in ischemic condition as compared with that
of normal condition.
Figure VIII. MBD2 binds to the methylated CpG-elements in the eNOS 5'-flanking region.
Biotin-labeled probe (+31 to +197) was prepared using a Biotin-labeled F9 primer and a reverse
R9 primer as described. The resulting PCR products were first examined on a 2% agarose gel
followed by treatment with SssI methylase. Native MBD2 was harvest from pcDNA-MBD2
transfected HEK293 cells. EMSA assays were carried out in the presence of SssI treated probes.
Lane 1, Negative control (biotin-labeled probe only); lane 2, biotin-labeled probe; and lane 3,
1:200 biotin-labeled probe vs. unlabeled probe (competitive control).
Figure IX. MBD2 suppresses eNOS promoter reporter activity.
pGL-eNOS and pGL-eNOSm were first treated with SssI methylase, and then co-transfected
with a pcDNA-MBD2 palsmid into HUVECs, respectively. pGL-eNOS and pGL-eNOSm
without SssI treatment were used as controls. Luciferase reporter activities were assayed 48h
after transfection and were normalized with an internal pGL-Tk reporter.
Reference List
1. Zhong J, Yang P, Muta K, Dong R, Marrero M, Gong F, Wang CY. Loss of Jak2
selectively suppresses DC-mediated innate immune response and protects mice from lethal
dose of LPS-induced septic shock. PLoS One. 2010; 5:e9593.
2. Niiyama H, Huang NF, Rollins MD, Cooke JP. Murine model of hindlimb ischemia. J Vis
Exp. 2009.
3. Wang CY, Yang P, Li M, Gong F. Characterization of a negative feedback network
between SUMO4 expression and NFkappaB transcriptional activity. Biochem Biophys Res
Commun. 2009; 381:477-81.
4. Guo D, Li M, Zhang Y, Yang P, Eckenrode S, Hopkins D, Zheng W, Purohit S, Podolsky
RH, Muir A, Wang J, Dong Z, Brusko T, Atkinson M, Pozzilli P, Zeidler A, Raffel LJ,
Jacob CO, Park Y, Serrano-Rios M, Larrad MT, Zhang Z, Garchon HJ, Bach JF, Rotter JI,
She JX, Wang CY. A functional variant of SUMO4, a new I kappa B alpha modifier, is
associated with type 1 diabetes. Nat Genet. 2004; 36:837-41.