Biochem. J. (2010) 430, 107–117 (Printed in Great Britain)
107
doi:10.1042/BJ20100350
Regulation of plasma-membrane-associated sialidase NEU3 gene
by Sp1/Sp3 transcription factors
Kazunori YAMAGUCHI*, Koichi KOSEKI*, Momo SHIOZAKI*, Yukiko SHIMADA*†, Tadashi WADA* and Taeko MIYAGI*1
*Division of Biochemistry, Miyagi Cancer Center Research Institute, Natori, Miyagi, 981-1293, Japan, and †Friedrich Miescher Institute, CH-4058, Basel, Switzerland
Gene expression of the human plasma membrane-associated
sialidase (NEU3), a key enzyme for ganglioside degradation,
is relatively high in brain and is modulated in response to
many cellular processes, including neuronal cell differentiation
and tumorigenesis. We demonstrated previously that NEU3 is
markedly up-regulated in various human cancers and showed
that NEU3 transgenic mice developed a diabetic phenotype and
were susceptible to azoxymethane-induced aberrant crypt foci
in their colon tissues. These results suggest that appropriate
control of NEU3 gene expression is required for homoeostasis of
cellular functions. To gain insights into regulation mechanisms,
we determined the gene structure and assessed transcription factor
involvement. Oligo-capping analysis indicated the existence of
alternative promoters for the NEU3 gene. Transcription started
from two clusters of multiple TSSs (transcription start sites);
one cluster is preferentially utilized in brain and another in other
tissues and cells. Luciferase reporter assays showed further that
the region neighbouring the two clusters has promoter activity
in the human cell lines analysed. The promoter lacks TATA, but
contains CCAAT and CAAC, elements, whose deletions led to
a decrease in promoter activity. Electrophoretic mobility-shift
assays and chromatin immunoprecipitation demonstrated binding
of transcription factors Sp (specificity protein) 1 and Sp3 to the
promoter region. Down-regulation of the factors by siRNAs (short
interfering RNAs) increased transcription from brain-type TSSs
and decreased transcription from other TSSs, suggesting a role for
Sp1 and Sp3 in selection of the TSSs. These results indicate that
NEU3 expression is diversely regulated by Sp1/Sp3 transcription
factors binding to alternative promoters, which might account for
multiple modulation of gene expression.
INTRODUCTION
in tumours was first found in human colon cancers and further
investigation revealed suppressive effects on cell apoptosis [10].
Consistent with these observations, mice overexpressing human
NEU3 showed a high propensity for azoxymethane-induced ACF
(aberrant crypt foci) formation in the colon [11]. Down-regulation
of NEU3 by siRNA (short interfering RNA)-mediated gene
silencing induced apoptosis in cancer cells, but not in normal
cells [12]. In addition, NEU3 transgenic mice develop an insulinresistant diabetic phenotype showing low glucose tolerance and
enlarged pancreatic islets by 18–20 weeks [9].
We have reported levels of NEU3 gene expression in normal
tissues and its chromosomal location previously [13], and other
groups have reported genomic organization [14] and changes
in NEU3 mRNA levels during cell differentiation and mitotic
activation [15–17]. However, detailed information about the
gene structure and control mechanism of the NEU3 gene is
not available. In the present study, we identified cis-elements
controlling its promoter and obtained evidence of regulation
by Sp1 and Sp3 transcription factors that have attracted
wide interest for their intimate involvement in growth control
and tumorigenesis [18,19]. This work provides an important
framework for further dissection of NEU3 gene regulation and
a first step to unveiling the full significance of the NEU3
gene in biological processes, including cell differentiation and
tumorigenesis.
Gangliosides, sialic acid-containing glycosphingolipids, are
components of cell-surface membranes which exert a wide
variety of biological functions, alterations being associated with
cell growth, differentiation and tumorigenesis [1]. Furthermore,
inherited defects in ganglioside catabolism are known to result in
a lysosomal storage disease, gangliosidosis [2]. Thus strict control
of biosynthesis and degradation of gangliosides is prerequisite for
homoeostasis of cell functions, although the control mechanisms
remain largely unclear [3,4]. Recent work on gene regulation
of enzymes involved in ganglioside metabolism suggest that
transcriptional regulation may participate. Interestingly, some
of the genes might undergo concerted regulation at the
transcriptional level because of the presence of common promoter
structures that lack TATA motifs and contain abundant GC
elements and binding sites for Sp (specificity protein)/KLF
(Krüppel-like factor) family transcription factors [5].
Plasma-membrane-associated sialidase Neu3 is one of four
mammalian sialidases, and the human orthologue NEU3 shows
strict preference for gangliosides as substrates [6]. Our recent
data indicated that NEU3 could modulate signal transduction
in the vicinity of the plasma membrane [7] and that aberrant
expression of the NEU3 gene could be causative of tumorigenesis
[8] and diabetes mellitus [9]. Up-regulation of gene expression
Key words: alternative promoter, ganglioside, sialidase, specificity protein 1 (Sp1), specificity protein 3 (Sp3), transcription.
Abbreviations used: ACF, aberrant crypt foci; ChIP, chromatin immunoprecipitation; EGFR, epidermal growth factor receptor; EMSA, electrophoretic
mobility-shift assay; HEK, human embryonic kidney; KLF, Krüppel-like factor; NHEK, normal human epidermal keratinocyte; RACE, rapid amplification of
cDNA ends; RT, reverse transcription; Sp, specificity protein; siRNA, short interfering RNA; TSS, transcription start site; UTR, untranslated region.
1
To whom correspondence should be addressed, at the present address: Division of Cancer Glycosylation Research, Institute of Molecular
Biomembrane and Glycobiology, Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai, 981-8558, Japan (email [email protected]).
c The Authors Journal compilation c 2010 Biochemical Society
108
K. Yamaguchi and others
EXPERIMENTAL
Reagents and cell lines
Oligonucleotides were synthesized by Sigma–Aldrich or IDT with
the sequences listed in Supplementary Table S1 (http://www.
BiochemJ.org/bj/430/bj4300107add.htm). Antibodies against
Sp1 (07-645), Sp3 (D-20) and Neo (ab33595) were purchased
from Upstate Biotechnology, Santa Cruz Biotechnology and
Abcam respectively. Human cell lines A172, IMR32, PC-3
and DLD-1 were obtained from the Human Science Research
Resources Bank (Tokyo, Japan). HT-29, HCT116, and LNCap
cells were from the A.T.C.C. (Manassas, VA, U.S.A.). HeLa,
A549, MCF7 and NB-1 cells were from the Cell Resource
Center for Biomedical Research (Tohoku University, Sendai,
Japan). HEK (human embryonic kidney)-293 cells were from
the RIKEN BioResource Center (Tsukuba, Japan). Cells were
cultured in Dulbecco’s modified Eagle’s medium (Sigma–
Aldrich) supplemented with 10 % fetal bovine serum (Invitrogen)
at 37 ◦C in a 5 % CO2 atmosphere. NHEKs (normal human
epidermal keratinocytes) were purchased from Kurabo (Osaka,
Japan) and maintained according to the supplier’s instructions.
Isolation of genomic clones
Genomic DNA fragments containing the human NEU3 gene
were obtained by a combination of library screening and
PCR. A cosmid library from human placental DNA (Clontech)
was screened with the 32 P-labelled EcoRI fragment of NEU3
cDNA [13]. Eleven cosmid clones were isolated with the first
screening, and the inserts were subcloned into pBluescript II SK+
(Stratagene), followed by DNA sequencing. Among them, eight
clones had the same insert and were revealed to encompass exons
3–4 of the NEU3 gene. A DNA fragment encompassing
exons 2–3 was obtained by PCR using primers GSP-01, a
sense primer derived from the 5 -portion of NEU3 cDNA (K.
Yamaguchi, T. Wada, Y. Shimada and T. Miyagi, unpublished
work), and GSP-02, an antisense primer from nucleotides 377
to 348 of the cDNA [14]. The PCR product (6 kb) obtained was
subcloned into the SmaI site of pBluescript II SK+. To clone
a DNA fragment containing exon 1 and the 5 -flanking region,
the 5 -region of the PCR fragment subcloned was digested with
BamHI and HindIII and used as a probe for screening of a human
genomic λ phage library (Human Genome Center, Tokyo, Japan).
Nine clones were obtained by first screening, and their inserts
were excised by digestion with NotI followed by subcloning into
the NotI site of pBluescript II SK+. Five clones were found to
have the same insert of 11 kb and to contain a 5 -flanking region
and exon 1 of the NEU3 gene. One of the clones, pN07, was used
for construction of the reporter plasmids described below.
3 -RACE (rapid amplification of cDNA ends)
The 3 -UTR (untranslated region) of the NEU3 cDNA was
obtained by the 3 -RACE method as described previously [20].
Briefly, to prepare cDNA for RACE, 0.7 μg of poly(A)+ RNA
from DLD-1 cells was reverse-transcribed with Superscript II
(Invitrogen) using a (dT)17 adaptor primer. The cDNA generated
was used for first PCR with the adaptor primer and a genespecific primer, GSP-03. Nested PCR was performed with the
adaptor primer and a nested primer, GSP-04. PCRs were carried
out with LA-Taq polymerase (TaKaRa Bio) under the following
conditions: initial denaturation at 95 ◦C for 5 min followed by 40
cycles of denaturation at 95 ◦C for 30 s, annealing at 55 ◦C for 30 s
and elongation at 72 ◦C for 2.5 min. PCR products were blunted
with T4 DNA polymerase, phosphorylated by T4 polynucleotide
c The Authors Journal compilation c 2010 Biochemical Society
kinase (both TaKaRa Bio) and then subcloned into the SmaI site
of pBluescript II SK+. The cloned fragments were sequenced
with a BigDye Terminator Cycle Sequencing kit and a 3130 Gene
Analyzer (Applied Biosystems).
Oligo-capping
Total RNAs of cultured cells were prepared with an RNeasy mini
kit (Qiagen). Poly(A)+ RNAs from human liver, brain and colon
were purchased from Clontech. Dephosphorylation, TAP (tobacco
acid pyrophosphatase) treatment, and RNA-linker ligation of
RNA were carried out by using a RACE kit (Ambion) following
the manufacturer’s recommendations. Reverse transcription of
processed RNA and subsequent PCR were achieved using a
PrimeScript cDNA synthesis kit (TaKaRa Bio) and LA-Taq
polymerase respectively. Primers used for PCR were as follows;
for first PCR, outer-primer (provided in the RACE kit) and
OCP-01; for nested PCR, the inner-primer (provided in the kit)
and OCP-02. For oligo-capping analysis of luciferase reporter
constructs, primers OCP-luc1 and OCP-luc2 were used instead of
OCP-01 and OCP-02 respectively. The amplified DNA fragments
were gel-purified, digested with BamHI and NotI, and ligated
to BamHI- and NotI-digested pBluescript II KS+ followed by
transformation with Escherichia coli (XL-1 Blue) competent
cells. Plasmid DNAs were prepared from randomly selected
clones (approx. 50 clones per oligo-capping reaction) and used as
templates for DNA sequencing.
Primer extension
Primer extension analysis was performed as described previously
[21]. Briefly, a 32 P-labelled primer, PEP-01, was hybridized
with 5 μg of poly(A)+ RNA prepared from HeLa cells in
80 % formamide, 40 mM Pipes (pH 6.3), 1 mM EDTA and
400 mM NaCl at 50 ◦C for 12 h. After ethanol precipitation, the
reaction mixture was incubated with 200 units of Superscript II
(Invitrogen) under the conditions recommended by the
manufacturer. Extended products were resolved on an 8 %
polyacrylamide, 8.3 M urea-denaturing gel and analysed with the
FLA-3000 imaging system (FujiFilm).
Construction of reporter plasmids
Reporter plasmids for promoter activity assays were prepared as
follows. After digestion of subclone pN07 with NcoI plus BamHI
(6 kb), XbaI (2 kb) or EcoRI (1 kb), generated DNA fragments
containing the 5 -flanking region of the NEU3 gene were blunted
with T4 DNA polymerase (TaKaRa Bio) and inserted into the
SmaI site of the promoter- and enhancer-less luciferase reporter
vector PGV-B (Wako Pure Chemicals). Orientation of inserted
fragments was confirmed by restriction digestion. To introduce
deletion mutation in the minimal promoter region, the blunted
NcoI/EcoRI fragment was subcloned into the HincII site of
pBluescript II SK+ and subjected to PCR-based mutagenesis
[22]. Primers for each construct that is illustrated in Figure 4 were
as follows; for A, MP01 and MP02; for B, MP10 and MP03;
for C, MP11 and MP04; for D, MP12 and MP05; for E,
MP13 and MP06; for F, MP14 and MP07; for G, MP15 and
MP08; and for H, MP16 and MP09. Deletion (Figure 3) was
performed with the primer sets of MP17 and MP18 for the CCAAT
motif, and with MP19 and MP20 for CAAC motifs respectively.
Mutation of Sp1-binding sites (Figure 7) was introduced
sequentially by using primers MP21 and MP22 and then MP23
and MP24. PCR was achieved by using KOD polymerase
(Toyobo) following the manufacturer’s recommendations. After
Identification of human sialidase NEU3 gene promoter
confirmation of DNA sequences, mutated fragments were excised
by digestion with XhoI and SmaI, and inserted into PGV-B
digested with XhoI and SmaI. All reporter plasmids were prepared
for transfection using a Qiagen plasmid kit.
Table 1
109
Exon/intron junction of the human NEU3 gene
Capital letters represent exon sequences and lower-case letters represent intron sequences.
Consensus sequences for donor and acceptor sites of introns are underlined. The first ATG
codon of open reading frame is double-underlined, which is in the third exon. Sizes of exons
and introns are indicated in bp. The size of the first exon is based on the published cDNA
sequence as described in the Results section.
Luciferase assay
HCT116 cells and DLD-1 cells (0.8 × 105 ) were seeded into
wells of 12-well plates 16 h before transfection. Transfection
was carried out using Effectene (Qiagen) according to the
manufacturer’s instructions. For each well, 0.5 μg of reporter
plasmid was transfected with 25 ng of pRL-TK vector (Promega)
used for normalization. After 48 h, cells were harvested and
assayed for luciferase activity, using the Dual-Luciferase Reporter
Assay System (Promega). All experiments were performed
independently at least three times.
EMSA (electrophoretic mobility-shift assay)
Nuclear extracts from the cells were prepared as described by
Dignam et al. [23]. For preparation of probes, oligonucleotides
were end-labelled with polynucleotide kinase (Toyobo) and
[γ -32 P]ATP (PerkinElmer). Labelled oligonucleotides were
purified with a NICKTM column (GE Healthcare) and annealed.
Nucleotide sequences of probes and competitors are described
in Supplementary Table S1 (only the upper strands are shown).
Nuclear extract (1 μg) was pre-incubated on ice for 15 min
in binding buffer [10 mM Hepes (pH 7.8), 50 mM KCl, 1 mM
EDTA, 5 mM MgCl2 , 10 % glycerol, 5 mM dithiothreitol, 0.5 mM
PMSF, 100 μg/ml BSA, 25 μg/ml poly(dI-dC) · (dI-dC) (GE
Healthcare), 2 μg/ml aprotinin, 2 μg/ml leupeptin and 2 μg/ml
pepstatin] with or without non-radioactive oligonucleotides (20molar excess) or antibodies (2 μg) before the addition of
labelled probe and incubation for 20 min at room temperature
(25 ◦C). Samples were resolved in non-denaturing 0.5 × TGE
(Tris/glycine/EDTA)/4 % polyacrylamide gels and processed
with the FLA3000 imaging system.
ChIP (chromatin immunoprecipitation) assay
ChIP assays were carried out using an assay kit from Upstate
Biotechnology. Cells were fixed by the addition of 1 ml of fixation
buffer (50 mM Hepes, pH 8.0, 11.1 % formaldehyde, 100 mM
NaCl, 1 mM EDTA and 0.5 mM EGTA) to 10 ml of culture
medium and incubation for 10 min at room temperature on a
rocking platform. Fixation was stopped by the addition of glycine
(0.125 M final concentration) followed by incubation for 10 min
at room temperature. Fixed cells (5 × 106 ) were washed twice
with ice-cold PBS, resuspended in 1 ml of the sonication buffer
provided in the kit, and sonicated with Bioruptor (Cosmo Bio) to
shear DNA into approx. 500-bp lengths. The lysate was clarified
by brief centrifugation at 13 400 g for 5 min and the supernatant
was diluted 10-fold with the dilution buffer provided in the kit. For
one assay, 2 ml of diluted lysate was pre-cleared and subjected to
immunoprecipitation, and DNA in the washed immunocomplex
was recovered according to the manufacturer’s instructions.
PCR was carried out with LA-Taq using primers CAP-01 and
CAP-02 (Supplementary Table S1).
siRNA-mediated gene silencing
siRNAs against Sp1 (used as a pool of #116546, #116547
and #143158) and Sp3 (a pool of #115336, #115337 and
#115338) were purchased from Ambion. siRNAs against
PURα (UAAACACGCCGUACUUGUUGGAGCC) and PURβ
Exon
Intron
Number
Size (bp)
Splice donor
Size (bp)
Splice acceptor
I
II
III
IV
28
137
212
5502
ACTGAGgtgggc
GTGCAGgtgagc
GTACAGgtgact
–
292
5354
10 692
–
tctcagTCTCCC
ttgcagAGGTCATG
gtctagTGGGGG
–
(UUGAAGGGUACGGUGAUGGCAUUGC) were purchased
from Invitrogen. Transfection of siRNA was accomplished with
LipofectamineTM 2000 (Invitrogen) following the manufacturer’s
instructions. Total RNA was prepared from cells 24 h after
transfection with an RNeasy mini kit and reverse transcribed with
the aid of a PrimeScript kit using 1 μg of total RNA. Real-time
PCR was performed on a LightCycler (Roche) with SYBR Green
master mix (Qiagen). Primers used for PCR were as follows:
evaluation for transcripts from TSS0, primers SSP-01 and SSP03; for those from TSS1, SSP-02 and SSP-03; for 18S rRNA as a
reference, SSP-06 and SSP-07.
RESULTS
Organization of the human NEU3 gene
To explore the structure of the human NEU3 gene, genomic DNA
clones were isolated from a human genomic library by screening
with a NEU3 cDNA fragment as a probe. After DNA sequencing
of the obtained genomic clones and comparing with a seuence of the cDNA cloned from a human brain cDNA library [13],
the NEU3 gene was found to span approx. 22 kb and consisted of
four exons. The third and the fourth exons encode the open reading
frame for NEU3 (Figure 1A). All of the exon/intron boundary
sequences adhere to the GT-AG rule for eukaryotic genes [24],
as summarized in Table 1. The structure of the 3 -region of the
NEU3 gene was determined by 3 -RACE with poly(A)+ RNA of
DLD-1 cells and the primers listed in Supplementary Table S1.
After two rounds of PCR, amplified products of 0.5 and 5 kb
were obtained (results not shown). The sequence of the 0.5-kb
fragment was identical with the 3 -UTR of the reported cDNA
[13]. Sequencing of the 5-kb fragment identified other distal
polyadenylation signals, allowing transcripts with an elongated
3 -UTR. These results are consistent with our previous finding
that transcripts of 2.5 and 7 kb can be detected by Northern blot
analysis in various human tissues [13]. The reported consensus
motif (ATTTA) for destabilization of mRNA [25] was found to
be present in the 3 -UTR, although its physiological significance
for NEU3 gene expression has yet to be determined.
Multiple TSSs (transcription start sites) of the NEU3 gene
TSSs were determined using the oligo-capping method [26],
utilizing the cap structure of mRNAs to determine the precise
5 -terminal nucleotides of mRNAs. The results using RNAs from
human brain and HCT116 cells are shown in Figure 1(B). In the
case of brain, transcription appeared to start mainly from multiple
start sites distributed approx. 50 bp upstream of the 5 -end of
the published cDNA sequence (indicated by arrows above the
c The Authors Journal compilation c 2010 Biochemical Society
110
K. Yamaguchi and others
Figure 2 Transactivation activity of the 5 -flanking region of the human
NEU3 gene
Restriction fragments containing various lengths of the 5 -flanking region were subcloned into
promoter-less PGV-B luciferase vector, transiently transfected into HCT116 cells and tested for
its promoter activity by luciferase assays as described in the Experimental section. The values
are expressed as fold activation (PGV-B was considered as 1). Results in the histogram are
means + S.D. for data obtained from three independent transfection experiments.
430/bj4300107add.htm). To confirm the existence of the upstream
minor TSSs, primer extension analysis was conducted by using
poly(A)+ RNA of HeLa cells as a template and an upstream primer
(Figure 1B), resulting in assignment of TSSs in a similar upstream
region (indicated by arrowheads in Figure 1B). These results
suggest that the NEU3 gene possesses alternative promoters
[27,28] which are employed in a tissue-specific manner. For
the present study, the TSSs used frequently in most cells and
tissues are designated as TSS1 and those used mainly in brain are
designated as TSS0. In addition, the most frequently used TSS in
c
the TSS1 is numbered + 1 (Figure 1B, ).
Core promoter elements of the NEU3 gene
Figure 1
Structure of the human NEU3 gene
(A) Genomic organization of the human NEU3 gene. Open boxes and closed boxes are
untranslated and translated exons respectively. Positions of putative poly(A)-additional signals
(AATAAA) and of destabilization signals (ATTTA) [25] are indicated by arrowheads. (B) TSSs
of the human NEU3 gene. The nucleotide sequence surrounding TSSs of the NEU3 gene is
shown. Upper-case letters indicate exon sequences (exons I and II in A) deduced from the
published cDNA [13], and lower-case letters for intron sequences. Arrows above the sequence
indicate TSSs of brain assigned using the oligo-capping method and those under the sec
quence for HCT116 cells. The most frequently used TSS in TSS1 was assigned as + 1 ().
Labelled arrows indicate the existence of TSSs at one specific nucleotide in the pool of tags
selected randomly and sequenced, as described in the Experimental section. The upstream TSSs
were confirmed in HeLa cells using the primer extension method and indicated by arrowheads.
The complementary sequence of the primer used for the primer extension is boxed. Core
promoter elements CCAAT or CAAC are double- or single-underlined respectively.
sequence in Figure 1B). On the other hand, in HCT116 cells,
transcription appeared to start mainly from multiple sites in the
first intron (indicated by arrows below the sequence in Figure 1B).
A search of the ESTs (expressed sequence tags) of NEU3
deposited in dbEST revealed multiple TSSs in the region identified
in the present study (see Supplementary Figure S1 at http://www.
BiochemJ.org/bj/430/bj4300107add.htm), supporting the results
obtained by the oligo-capping method. Several human tissues
and cultured cell lines showed similar results as HCT116 cells
(see Supplementary Figure S2 at http://www.BiochemJ.org/bj/
c The Authors Journal compilation c 2010 Biochemical Society
The promoter region of the NEU3 gene was determined by
luciferase reporter assay. To accomplish this, different lengths
of the 5 -upstream region were prepared by digestion with the
restriction enzymes shown in Figure 2, and inserted into a
luciferase reporter vector. These reporter vectors were tested for
their ability to promote transcription of the luciferase gene with
transient transfection followed by a luciferase assay. All fragments
prepared showed significant promoter activity in HCT116 cells
(Figure 2), except when the orientation of cloned fragments was
opposite with respect to the luciferase gene (results not shown).
The reporter vector harbouring the EcoRI/NcoI fragment showed
promoter activity comparable with that of the 5-kb XbaI/NcoI
fragment, suggesting its minimal promoter activity. Although
the EcoRI/NcoI and the ApaI/NcoI fragments showed similar
promoter activities, we analysed further the former for the core
promoter element of the NEU3 gene since it contains the CCAAT
element that plays a critical role in transcriptional control of the
gene as presented in Figure 3. At present, we do not know the exact
reason that deletion of the EcoRI/ApaI fragment appeared to affect
scarcely the overall promoter activity. However, it was suggested
from the results in Figure 4(C) that repressive element might
exist in the deleted region. Deletion of the ApaI/NcoI fragment
yielded decreased promoter activity, presumably because of
deficiency in the TSS1 region. Utilization of the TSS1 in luciferase
reporter vectors was confirmed using the oligo-capping method
(Figure 4B, wild-type). We also tested promoter activity of
these constructs in other human cell lines including DLD-1,
HT29 (colon cancer cell), HeLa (cervical carcinoma cell), IMR32
(neuroblastoma), A172 (glioblastoma) and HEK-293 (kidney)
Identification of human sialidase NEU3 gene promoter
111
mainly promote transcription from TSS1. When both elements
were deleted simultaneously, promoter activity decreased only
to a level similar to that which resulted after each of the single
deletion mutations (Figure 3A). This result implies that another
undefined promoter element(s) drives the transcription of the
NEU3 gene. There also exist other core promoter elements, an
XCPE (X core promoter element) motif [35] 110-bp upstream
of TSS1 and a TATA-like motif 120 bp upstream of TSS0, but
deletions of these regions did not affect the promoter activity
as assessed using the luciferase assay (results not shown). The
sequence of the EcoRI/NcoI fragment shows a high G + C
content and high frequency of CG dinucleotides, satisfying the
criteria of an CpG island [36,37], thought to be a target of gene
regulation through methylation/demethylation on cytidines of
CG dinucleotides. However, significant methylation on cytidines
within the EcoRI/NcoI fragment has not been found in human
tissues or cells so far examined (K. Koseki, K. Yamaguchi and
T. Miyagi, unpublished work).
Determination of the promoter region for the NEU3 gene expression
Figure 3
Effects of deletion of core promoter elements on promoter activity
(A) Reporter constructs lacking CCAAT motif and/or CAAC elements were transiently transfected
into HCT116 cells and assayed for their promoter activity. Results are percentages of the
activity of the wild-type construct obtained from three independent transfection experiments.
(B) Usage of TSSs was examined for deletion constructs. RNA was prepared from cells transfected
with each reporter construct and subjected to RT–PCR for quantification. For PCR, one primer
(OCP-luc1) was a common primer on the luciferase gene and another is a primer in the vicinity
of TSS0 (SSP-01) or TSS1 (SSP-02). Positions of the primers on the reporter constructs
are indicated schematically as arrowheads in (A) and the sequences of the primers are
provided in Supplementary Table S1 at http://www.BiochemJ.org/bj/430/bj4300107add.htm.
For normalization, pcDNA3.1+ was co-transfected with each construct and the transcripts from
neomycin gene of pcDNA3.1+ were measured using primers SSP-04 and SSP-05. RNA amounts
are expressed as mean + S.D. percentages of that transcribed from the wild-type construct for
three independent transfection experiments.
cells and obtained similar results, indicating that the EcoRI/NcoI
fragment contains a minimal promoter region (results not shown).
In the sequence of this EcoRI/NcoI fragment, there are two
core promoter elements. One is a CCAAT motif 80 bp upstream
of the TSS0 (double-underlined in Figure 1B) and another is
a cluster of CAAC elements near the TSS1 (underlined in
Figure 1B). The CCAAT motif is one of the well-characterized
promoter elements recognized by several transcription factors
including C/EBP (CCAAT/enhancer-binding protein) [29] and
NF-Y (nuclear factor Y) [30,31]. The CAAC motif is also found in
several genes [32–34] and is thought to function as a core promoter
element, although transcription factor(s) for this motif have so
far not been identified. Deletions in each of these two elements
led to decreased promoter activity (Figure 3A), suggesting that
both act as positive regulators of NEU3 gene expression. Since
the NEU3 gene has alternative promoters, the question arose as
to which promoter is affected by these elements. To address
this, amounts of mRNA transcribed from TSS0 or TSS1 were
measured by RT (reverse transcription)–PCR. After transfection
of luciferase reporter vectors containing the deletion, total RNA
was prepared from the transfected cells and reverse-transcribed
followed by quantitative PCR using two different primer sets to
distinguish utilization of each TSS as described in the legend of
Figure 3. As shown in Figure 3(B), deletion of the CCAAT motif
decreased transcription from both promoters, implying roles in
positive regulation of TSS0 and TSS1 in common. In contrast,
deletion of CAAC elements decreased transcription from TSS1,
but scarcely affected that from TSS0, suggesting that the elements
To characterize the promoter region more precisely, sequential
deletion mutations were introduced into the EcoRI/NcoI fragment
and tested for their effects on promoter activity. Each deleted
region is approx. 100 bp in length except 50 bp for G region,
which encompasses TSS1. As shown in Figure 4(A), deletion
of the F or H region resulted in decreased promoter activity.
The F region contains CAAC elements whose deletion led to
decreased promoter activity (Figure 3A). In the H region, we
did not find any known core promoter elements. Use of a
luciferase reporter vector revealed that these two regions, F and
H, had different effects on the selection of TSSs. As shown in
Figure 4(B), the wild-type reporter vector preferentially utilized
TSS1 and showed a similar distribution pattern of TSSs to that
of the endogenous NEU3 gene in HCT116 cells (Supplementary
Figure S2). The H-deleted reporter vector also utilized TSS1,
although the distribution pattern was slightly different from those
of the endogenous NEU3 gene and the wild-type reporter vector.
Deletion of the F region resulted in a shift from TSS1 to TSS0,
the latter not normally being utilized in HCT116 cells, suggesting
suppression of transcription from TSS0 by the F region. These
data suggest that the F region is likely to act as an activator
of transcription from TSS1 through its CAAC motifs and, in
contrast, as a suppressor for transcription from TSS0. Although
deletion of the CCAAT motif led to a decrease in promoter
activity (Figure 3A), deletion of the D region containing the motif
appeared to have no effect on promoter activity (Figure 4A). This
discrepancy cannot be explained at present, but deletion of the D
region resulted in increased transcription from TSS1 (Figure 4C)
and decreased transcription from TSS0. Oligo-capping analysis
also indicated the preferential usage of TSS1 in the D-deleted
reporter vector (Figure 4D). A repressive element(s) not yet
identified may exist in the D region as well as the positive regulator
CCAAT motif, so deletion of the D region might not cause a
significant change in gross promoter activity assessed by the
luciferase reporter assay. Although oligo-capping analysis shown
in Figure 4(D) appeared to indicate no transcription initiation
from TSS0 of D-deleted reporter vector, we could not exclude the
possibility of a low level of TSS0 utilization because the RT–PCR
experiment in Figure 4(C) suggested low but substantial initiation
from TSS0. Therefore RT–PCR is considered to be more sensitive
and suitable for measurement of a low level of transcripts than
oligo-capping that counted approx. 50 tags for each experiment.
Our previous results indicated that human NEU3 and mouse
Neu3 genes show similar expression patterns in normal tissues
c The Authors Journal compilation c 2010 Biochemical Society
112
Figure 4
K. Yamaguchi and others
Promoter activity and TSS usage of serial deletion constructs
(A) Serial deletions were introduced in the EcoRI/NcoI fragment of the human NEU3 gene promoter and their effects on promoter activity were examined as described in the Experimental section.
Results are mean + S.D. percentages of the activity of the wild-type construct obtained from three independent transfection experiments. (B) TSSs of the transcripts from wild-type, F and H
mutants were determined by oligo-capping. The frequency and position of each TSS are shown. Each construct is presented schematically beneath each panel, where deleted regions are shaded.
(C) TSSs of the D construct were evaluated as described in Figure 3(B). RNA amounts are expressed as mean + S.D. percentages of that transcribed from the wild-type construct for three
independent transfection experiments. (D) TSSs of the transcripts from D mutants were determined by oligo-capping.
[13,38]. The Comparative Viewer of the DBTSS revealed that the
core promoter elements mentioned above also occurs in a predicted promoter region of mouse Neu3 gene, suggesting that the
human and mouse genes transcription might be regulated in a
similar manner (results not shown).
Determination of trans -factors affecting NEU3 gene expression
A search of databases (TFSEARCH, MatInspector) revealed
putative binding motifs for several transcription factors in F and
H regions as shown in Figure 5(A) and Supplementary Figure
S3 (at http://www.BiochemJ.org/bj/430/bj4300107add.htm). To
determine which transcription factors are involved in modulation
of NEU3 gene expression, an EMSA was conducted using sets of
c The Authors Journal compilation c 2010 Biochemical Society
labelled oligonucleotide probes covering the F or H regions and
unlabelled competitors containing respective consensus binding
motifs for transcription factors. As shown in Figure 5(B), probes
F-1, -2 and -4 gave similar shifted bands (lanes 2, 13 and 23). They
were specifically competed by oligonucleotides containing a GC
box (lanes 6, 16 and 26) or a GT box (lanes 7, 17 and 27) which are
consensus binding motifs of Sp/KLF family transcription factors
[39,40]. In addition, mutations introduced in recognition motifs
of the Sp/KLF transcription factors abolished competing activity
(results not shown). These results suggest specific binding of
the Sp/KLF transcription factor(s) to the F region of the human
NEU3 gene. Interestingly, oligonucleotides F-1, -2 and -4 were
able to compete with each other (lanes 9, 11, 19, 21, 29 and
30), suggesting that these probes might be recognized and bound
Identification of human sialidase NEU3 gene promoter
Figure 5
113
Interaction of Sp1 and Sp3 with the F region of the human NEU3 gene promoter in vitro and in vivo
(A) DNA sequence of the F region. Deduced recognition sites for transcription factors and probes used in EMSA experiments in (B) and (C) are indicated. Positions of primers used for the ChIP
assay in (D) are indicated by double-underlining. (B) Transcription factors were searched by EMSAs employing unlabelled competitors. Nuclear extracts of HCT116 cells were incubated with or
without 32 P-labelled probes shown in (A) in the presence or absence of unlabelled competitors (20 × molar excess) and the resulting DNA–protein complexes were resolved by PAGE as described
in the Experimental section. Sequences of the competitors are listed in Supplementary Table S1 at http://www.BiochemJ.org/bj/430/bj4300107add.htm. Arrows indicate shifted bands suggesting
specific DNA–protein complexes. Asterisks indicate non-specific bands which could not be competed by the probe itself as a unlabelled competitor. Arrowheads indicate free probes. (C) EMSAs
were performed with a specific antibody against Sp1 or Sp3 to identify transcription factors binding to the F region. Specific shifted bands (indicated by arrows) were supershifted by the antibody
against Sp1 (lanes 2, 6 and 10) or Sp3 (lanes 3, 7 and 11). (D) Interactions of Sp1 and Sp3 with the F region were examined by ChIP assay. Chromatin fractions prepared from HCT116 or HeLa
cells were immunoprecipitated with the indicated antibodies followed by PCR as described in the Experimental section. The assays without antibody (no) or with rabbit polyclonal antibodies against
neomycin phosphotransferase 2 (Neo) were carried out as negative controls. Input DNA was used as positive controls for PCRs.
by the same member(s) of the Sp/KLF family. As shown in
Figure 5(A), putative binding sites for transcription factors other
than Sp/KLF transcription factors were predicted in the F region,
but unlabelled competitors containing each consensus binding
motifs for these transcription factors (listed in Supplementary
Table S1) failed to prevent the DNA–protein complex formation
(Figure 5B, lanes 4, 5, 8, 15, 18, 25 and 28). Probe F-3 containing
CAAC motifs did not give any shifted band in our system (results
not shown). The Sp/KLF transcription factor family comprises 25
members that play common or distinctive physiological roles in
transcription [41]. To determine which member(s) of the Sp/KLF
family binds to the F region, supershift assays were conducted
using antibodies against Sp1 and Sp3, both of which are expressed
in cells and tissues ubiquitously. As illustrated in Figure 5(C),
anti-Sp1 and anti-Sp3 antibodies effectively supershifted the
three complexes, indicating that the two factors are capable of
recognizing and binding to the F region. Next, binding of Sp1 and
Sp3 to the F region in vivo was confirmed by ChIP assays. AntiSp1 and anti-Sp3 antibodies specifically immunoprecipitated
chromatin containing the F region, whereas species-matched
control antibodies did not (Figure 5D). Involvement of other
members of the Sp/KLF family, Sp4, KLF4, KLF5 and KLF6 were
examined by siRNA-mediated gene silencing of these factors, but
no effects on NEU3 gene expression were observed (results not
shown).
In the same way, transcriptional factor(s) binding to the H
region was investigated by EMSA (Supplementary Figure S3).
Probes covering this region gave a similar pattern of shifted
bands and competition was seen among the probes, suggesting that
the same transcription factor(s) binds to this region. Although the
bands were competed completely by consensus motifs for
the GA-binding factors, PURα and PURβ, further experiments
using siRNA-mediated knockdown of these factors failed to show
involvement in modulation of NEU3 gene expression (results not
shown).
Opposite effects of down-regulation of Sp1 and Sp3 on TSS0 and
TSS1
Involvement of Sp1 and Sp3 in modulation of NEU3 gene expression was examined further by siRNA-mediated gene
silencing. Pooled siRNAs against Sp1 or Sp3 were transiently
transfected into HCT116 cells, which resulted in a more than
50 % decrease in the levels of target gene transcripts (Figure 6A).
In these treated cells, transcription from TSS0 (Figure 6B)
increased, and this increase was enhanced by simultaneous
knockdown of both factors. On the other hand, the knockdown
decreased transcription from TSS1. Similar results were obtained
from the knockdown experiments using DLD-1 (Figure 6C)
and HeLa (Figure 6D) cells. To examine the involvement of
c The Authors Journal compilation c 2010 Biochemical Society
114
Figure 6
K. Yamaguchi and others
Effects of Sp1- and Sp3-knockdown on human NEU3 gene expression
(A) Knockdown efficiencies of the siRNA transfection experiments in HCT116 cells were confirmed by quantitative PCR using primers SSP-10 and SSP-11 for Sp1 or SSP-12 and SSP-13 for Sp3
respectively. HCT116 (B), DLD-1 (C) or HeLa (D) cells were transiently transfected with siRNA(s) against Sp1, Sp3 or both and were incubated for 48 h. RNA was prepared from the transfected cells
and transcripts starting from TSS0 or TSS1 were measured by RT–PCR using primers SSP-01 and SSP-03 or SSP-02 and SSP-03 respectively. For normalization, the level of 18S ribosomal RNA
was measured by using primers SSP-06 and SSP-07. RNA amounts are expressed as mean + S.D. percentages of the amounts of the untransfected cells and compared with those of cells transfected
with negative control siRNA (control) obtained from at least three independent transfection experiments. *P < 0.05.
Figure 7
Effects of Sp/KLF-binding sites on transcription initiation
Usage of TSSs was examined for the mutant reporter vector constructed as described in the
Experimental section. RNA was prepared from cells transfected with the reporter construct and
subjected to RT–PCR for quantification as described in the legend of Figure 3(B). Results are
means + S.D. for three independent transfection experiments.
Sp1/Sp3-binding motifs on the F region in the regulation of
transcription from TSS0 or from TSS1, luciferase reporter vectors
containing a mutation in the Sp1/Sp3-binding sites were tested
for their transcription initiation sites. As shown in Figure 7,
transcription from TSS1 decreased in the mutants, whereas that
from TSS0 increased. These results, together with the result of
the ChIP assay (Figure 6D), strongly suggest that Sp1 and Sp3
bound to the F region promote transcription from TSS1 and
repress that from TSS0. The involvement of Sp1 and Sp3 in NEU3
gene expression was supported further by comparative evaluation
Figure 8
of expression levels of NEU3 and these factors in human cell
lines. As shown in Supplementary Figure S4 and Supplementary
Table S2 (http://www.BiochemJ.org/bj/430/bj4300107add.htm),
expression levels of NEU3 and that of Sp1 or Sp3 showed good
correlations (P = 0.0087, r = 0.72, and P = 0.0005, r = 0.85,
respectively), implying that Sp1 and Sp3 play a promoting role
in NEU3 gene transcription. All of the results are illustrated
schematically in Figure 8, indicating diverse regulation of NEU3
gene expression by Sp1/Sp3 transcription factors binding to the
promoter.
DISCUSSION
Human plasma membrane-associated sialidase, NEU3, is a key
enzyme in the degradation of gangliosides, for which it exhibits
an especial substrate preference. It has been shown to control
transmembrane signalling for many cellular processes, and we
demonstrated previously marked up-regulation in various cancers,
including colon, renal, ovarian and prostate lesions [8]. Our
further observations on NEU3 revealed that the sialidase activates
molecules including EGFR (epidermal growth factor receptor),
FAK (focal adhesion kinase), ILK (integrin-linked kinase), Shc,
integrin β4 and Met [8], which often become up-regulated
during tumorigenesis, and may thus contribute to accelerated
development of malignant phenotypes in cancer cells. NEU3
Regulation of the human NEU3 gene
Cis - and trans -elements which were shown in the present study to regulate the NEU3 gene are indicated schematically. The regulation is represented by solid arrows (promotion) and T-bars
(repression). Transcription from TSS0 is promoted by the CCAAT-motif and repressed by Sp1 and Sp3. Transcription from TSS1 is promoted by the CCAAT motif, CAAC elements, and Sp1 and Sp3.
c The Authors Journal compilation c 2010 Biochemical Society
Identification of human sialidase NEU3 gene promoter
involvement in tumorigenesis is also suggested by the high
incidence of azoxymethane-induced ACF in colon mucosa of
NEU3 transgenic mice [11]. Moreover, NEU3 overexpression
causes impaired glucose tolerance and hyperinsulinaemia together
with overproduction of insulin in enlarged islets in the transgenic
animals [9]. Although the mechanisms underlying the different
pathogenesis caused by NEU3 up-regulation in mice remain
obscure, it is feasible that NEU3 brings about a signalling
disturbance in cell apoptosis and in insulin responses, probably
through cross-talk between signalling pathways. Supporting
this idea, epidemiological reports [42,43] describing higher
incidences of cancers in diabetic patients than in controls have
suggested that these diseases might be closely related to each
other in pathogenesis.
In the present study, we obtained strong evidence showing
regulation of NEU3 gene expression by Sp1 and Sp3 transcription
factors which were initially considered as constitutive activators
of housekeeping genes and other TATA-less genes, but have been
shown to play critical roles in regulating the transcription of genes
involved in cell growth control and tumorigenesis [18,19,44].
They may even affect genes in response to extracellular signals
such as insulin [45]. Involvement of Sp1 and Sp3 is consistent
with results of previous studies analysing NEU3 gene expression
in tissues and cells. In normal human tissues, the NEU3
gene is expressed ubiquitously, but expression levels vary
considerably [13,46], apparently influenced by cell growth [15]
and differentiation [16,17,47]. In particular, up-regulation of
NEU3 may be a cause for resistance to apoptosis and for abnormal
growth of cancer cells and Sp1-mediated activation might be
attributable for aberrant expression. In fact, Sp1 target genes
are known to include cyclin D1, c-Myc, c-Jun, c-Fos, c-Src and
receptor tyrosine kinases such as EGFR and PDGFR (plateletderived growth factor receptor) [19] and up-regulation of Sp1 has
been reported in human cancer tissues [48–50]. We propose that
NEU3 is also an Sp1 target gene, in common with these genes
essentially involved in cell growth and oncogenesis.
The present study also demonstrated the existence of alternative
promoters in the NEU3 gene and repression of brain-type TSSs
(TSS0) in other tissues and cells. It is likely that these alternative
promoters might confer differences in regulation of NEU3
transcription in brain and other tissues. The exact physiological
significance of alternative promoters has yet to be addressed, but
is thought to allow complex transcriptional regulation. Besides,
it may confer different 5 -UTRs on transcripts, which may
permit different post-transcriptional control. Consistent with these
possibilities, comprehensive analysis on TSSs of human genes
has shown occurrence of alternative promoters preferentially in
genes encoding signalling molecules or molecules specifically
expressed in brain or testis, as they are regulated in response
to various cell conditions or in a tissue-specific manner [27].
Although we do not know at present why brain-type TSSs of
the NEU3 gene are repressed in other tissues and cells, several
genes expressed in nerves are repressed in other cells [51,52].
Disturbance of this repression results in abnormal development
[53] or in diseases, including colon cancer [54,55], suggesting that
some genes working in nerve cells should be repressed in other
cells to prevent their aberrant expression causing developmental
or growth abnormalities.
Our results indicate that Sp1 and Sp3 act as repressors for TSS0,
whereas they act as activators for TSS1. Although it is totally
unclear what makes this switch possible, several members of the
Sp/KLF family have been shown to function as either activators
or repressors through interaction with co-activators, co-repressors
and other transcription factors. For instance, Sp1 activates
genes through interaction with co-activators CRSP (cofactor
115
required for Sp1), p300/CBP [CREB (cAMP-response-elementbinding protein)-binding protein], or a component of basal
transcription machinery, TAFII130 (TATA-box-associated factor
II 130). Sp1 can also repress gene expression by recruiting HDACs
(histone deacetylases) to the promoters [56–58]. How Sp/KLF
transcription factors select their partners appears dependent
on the cellular and promoter context [39]. Detailed switching
mechanisms of Sp1 and Sp3 in the case of the NEU3 gene are
now under investigation.
Previously, we and other groups reported that overexpression
of the NEU3 gene in cells led to change in other genes for
gangliosides metabolism [12,59], implying concerted regulation
at the transcriptional level. There have also been several reports
of Sp/KLF-binding sites in genes encoding enzymes involved
in the metabolism of gangliosides [5]. Although few reports
have proved the actual binding of factors to the genes [60,61],
the concerted regulation of enzymes [5] by member(s) of the
Sp/KLF transcription family is highly conceivable. Our previous
results indicated that the four mammalian sialidase members
exhibit different tissue distributions or varied activation during
cell growth and differentiation [6]. Despite such differences in
sialidase gene expression, the genes might commonly be under the
control of Sp/KLF family transcription factors. Our preliminary
experiments showed that knockdown of Sp1 led to an increase in
NEU1 gene expression, whereas knockdown of Sp3 resulted in a
decrease in NEU2 gene expression (K. Koseki, K. Yamaguchi
and T. Miyagi, unpublished work). Further investigations are
now needed to test the hypothesis of a transcriptional network
that regulates sialidases and other genes involved in ganglioside
metabolism in relation to cell differentiation, cell growth and
tumorigenesis.
AUTHOR CONTRIBUTION
Kazunori Yamaguchi contributed the most to this study by designing and performing the
experimental work. Koichi Koseki, Momo Shiozaki and Yukiko Shimada participated in
investigation of organization and structure of the gene. Tadashi Wada, who was the first
author of the cDNA cloning work, contributed to determination of the promoter region of
the gene. Taeko Miyagi directed and supervised the whole work.
ACKNOWLEDGEMENTS
We are grateful for Dr M. Tone and Dr Y. Tone (University of Pennsylvania, Philadelphia,
PA, U.S.A.) for their helpful discussions. We also thank Dr S. Hashimoto (Tokyo University,
Tokyo, Japan) for his kind advice on oligo-capping analysis.
FUNDING
This work has been supported in part by Core Research for Evolutional Science and
Technology (CREST) of the Japan Science and Technology Agency and Grants-in Aid for
Scientific Research on Priority Areas in Cancer from the Ministry of Education, Culture,
Sports, Science and Technology of Japan.
REFERENCES
1 Hakomori, S. (1981) Glycosphingolipids in cellular interaction, differentiation, and
oncogenesis. Annu. Rev. Biochem. 50, 733–764
2 Kolter, T. and Sandhoff, K. (1998) Glycosphingolipid degradation and animal models of
GM2 -gangliosidoses. J. Inherit. Metab. Dis. 21, 548–563
3 Sandhoff, K. and Kolter, T. (2003) Biosynthesis and degradation of mammalian
glycosphingolipids. Philos. Trans. R. Soc. London Ser. B 358, 847–861
4 Tettamanti, G. (2004) Ganglioside/glycosphingolipid turnover: new concepts.
Glycoconjugate J. 20, 301–317
5 Yu, R. K., Bieberich, E., Xia, T. and Zeng, G. (2004) Regulation of ganglioside
biosynthesis in the nervous system. J. Lipid Res. 45, 783–793
c The Authors Journal compilation c 2010 Biochemical Society
116
K. Yamaguchi and others
6 Miyagi, T. and Yamaguchi, K. (2007) Sialic acids. In Comprehensive Glycoscience
(Kamerling, J. P., Boons, G.-J., Lee, Y. C., Suzuki, A., Taniguchi, N. and Voragen, A. G. J.,
eds), pp. 297–323, Elsevier, Oxford
7 Miyagi, T., Wada, T., Yamaguchi, K., Hata, K. and Shiozaki, K. (2008) Plasma
membrane-associated sialidase as a crucial regulator of transmembrane signalling. J.
Biochem. (Tokyo) 144, 279–285
8 Miyagi, T. (2008) Aberrant expression of sialidase and cancer progression. Proc. Jpn.
Acad. Ser. B 84, 407–418
9 Sasaki, A., Hata, K., Suzuki, S., Sawada, M., Wada, T., Yamaguchi, K., Obinata, M.,
Tateno, H., Suzuki, H. and Miyagi, T. (2003) Overexpression of plasma
membrane-associated sialidase attenuates insulin signaling in transgenic mice. J. Biol.
Chem. 278, 27896–27902
10 Kakugawa, Y., Wada, T., Yamaguchi, K., Yamanami, H., Ouchi, K., Sato, I. and Miyagi, T.
(2002) Up-regulation of plasma membrane-associated ganglioside sialidase (Neu3) in
human colon cancer and its involvement in apoptosis suppression. Proc. Natl. Acad. Sci.
U.S.A. 99, 10718–10723
11 Shiozaki, K., Yamaguchi, K., Sato, I. and Miyagi, T. (2009) Plasma membrane-associated
sialidase (NEU3) promotes formation of colonic aberrant crypt foci in azoxymethanetreated transgenic mice. Cancer Sci. 100, 588–594
12 Wada, T., Hata, K., Yamaguchi, K., Shiozaki, K., Koseki, K., Moriya, S. and Miyagi, T.
(2007) A crucial role of plasma membrane-associated sialidase in the survival of human
cancer cells. Oncogene 26, 2483–2490
13 Wada, T., Yoshikawa, Y., Tokuyama, S., Kuwabara, M., Akita, H. and Miyagi, T. (1999)
Cloning, expression, and chromosomal mapping of a human ganglioside sialidase.
Biochem. Biophys. Res. Commun. 261, 21–27
14 Monti, E., Preti, A., Venerando, B. and Borsani, G. (2002) Recent development in
mammalian sialidase molecular biology. Neurochem. Res. 27, 649–663
15 Wang, P., Zhang, J., Bian, H., Wu, P., Kuvelkar, R., Kung, T. T., Crawley, Y., Egan, R. W. and
Billah, M. M. (2004) Induction of lysosomal and plasma membrane-bound sialidases in
human T-cells via T-cell receptor. Biochem. J. 380, 425–433
16 Stamatos, N. M., Liang, F., Nan, X., Landry, K., Cross, A. S., Wang, L. X. and Pshezhetsky,
A. V. (2005) Differential expression of endogenous sialidases of human monocytes during
cellular differentiation into macrophages. FEBS J. 272, 2545–2556
17 Tringali, C., Anastasia, L., Papini, N., Bianchi, A., Ronzoni, L., Cappellini, M. D., Monti,
E., Tettamanti, G. and Venerando, B. (2007) Modification of sialidase levels and
sialoglycoconjugate pattern during erythroid and erythroleukemic cell differentiation.
Glycoconjugate J. 24, 67–79
18 Safe, S. and Abdelrahim, M. (2005) Sp transcription factor family and its role in cancer.
Eur. J. Cancer 41, 2438–2448
19 Wierstra, I. (2008) Sp1: emerging roles – beyond constitutive activation of TATA-less
housekeeping genes. Biochem. Biophys. Res. Commun. 372, 1–13
20 Miyagi, T., Wada, T., Iwamatsu, A., Hata, K., Yoshikawa, Y., Tokuyama, S. and Sawada, M.
(1999) Molecular cloning and characterization of a plasma membrane-associated
sialidase specific for gangliosides. J. Biol. Chem. 274, 5004–5011
21 Sato, K. and Miyagi, T. (1995) Genomic organization and the 5 -upstream sequence of the
rat cytosolic sialidase gene. Glycobiology 5, 511–516
22 Imai, Y., Matsushima, Y., Sugimura, T. and Terada, M. (1991) A simple and rapid method
for generating a deletion by PCR. Nucleic Acids Res. 19, 2785
23 Dignam, J. D., Lebovitz, R. M. and Roeder, R. G. (1983) Accurate transcription initiation
by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids
Res. 11, 1475–1489
24 Shapiro, M. B. and Senapathy, P. (1987) RNA splice junctions of different classes of
eukaryotes: sequence statistics and functional implications in gene expression. Nucleic
Acids Res. 15, 7155–7174
25 Ross, J. (1996) Control of messenger RNA stability in higher eukaryotes. Trends Genet.
12, 171–175
26 Maruyama, K. and Sugano, S. (1994) Oligo-capping: a simple method to replace the cap
structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138, 171–174
27 Kimura, K., Wakamatsu, A., Suzuki, Y., Ota, T., Nishikawa, T., Yamashita, R., Yamamoto,
J., Sekine, M., Tsuritani, K., Wakaguri, H. et al. (2006) Diversification of transcriptional
modulation: large-scale identification and characterization of putative alternative
promoters of human genes. Genome Res. 16, 55–65
28 Carninci, P., Sandelin, A., Lenhard, B., Katayama, S., Shimokawa, K., Ponjavic, J.,
Semple, C. A., Taylor, M. S., Engstrom, P. G., Frith, M. C. et al. (2006) Genome-wide
analysis of mammalian promoter architecture and evolution. Nat. Genet. 38, 626–635
29 McKnight, S. L., Lane, M. D. and Gluecksohn-Waelsch, S. (1989) Is
CCAAT/enhancer-binding protein a central regulator of energy metabolism? Genes Dev.
3, 2021–2024
30 Maity, S. N. and de Crombrugghe, B. (1998) Role of the CCAAT-binding protein
CBF/NF-Y in transcription. Trends Biochem. Sci. 23, 174–178
31 Mantovani, R. (1999) The molecular biology of the CCAAT-binding factor NF-Y. Gene
239, 15–27
c The Authors Journal compilation c 2010 Biochemical Society
32 Teng, C. T., Liu, Y., Yang, N., Walmer, D. and Panella, T. (1992) Differential molecular
mechanism of the estrogen action that regulates lactoferrin gene in human and mouse.
Mol. Endocrinol. 6, 1969–1981
33 Yoo, H. W., Warner, C. A., Chen, C. H. and Desnick, R. J. (1993) Hydroxymethylbilane
synthase: complete genomic sequence and amplifiable polymorphisms in the human
gene. Genomics 15, 21–29
34 Song, J., Ugai, H., Ogawa, K., Wang, Y., Sarai, A., Obata, Y., Kanazawa, I., Sun, K., Itakura,
K. and Yokoyama, K. K. (2001) Two consecutive zinc fingers in Sp1 and in MAZ are
essential for interactions with cis -elements. J. Biol. Chem. 276, 30429–30434
35 Tokusumi, Y., Ma, Y., Song, X., Jacobson, R. H. and Takada, S. (2007) The new core
promoter element XCPE1 (X core promoter element 1) directs activator-, mediator-, and
TATA-binding protein-dependent but TFIID-independent RNA polymerase II transcription
from TATA-less promoters. Mol. Cell. Biol. 27, 1844–1858
36 Gardiner-Garden, M. and Frommer, M. (1987) CpG islands in vertebrate genomes. J. Mol.
Biol. 196, 261–282
37 Takai, D. and Jones, P. A. (2002) Comprehensive analysis of CpG islands in human
chromosomes 21 and 22. Proc. Natl. Acad. Sci. U.S.A. 99, 3740–3745
38 Hasegawa, T., Yamaguchi, K., Wada, T., Takeda, A., Itoyama, Y. and Miyagi, T. (2000)
Molecular cloning of mouse ganglioside sialidase and its increased expression in
Neuro2a cell differentiation. J. Biol. Chem. 275, 8007–8015
39 Philipsen, S. and Suske, G. (1999) A tale of three fingers: the family of mammalian
Sp/XKLF transcription factors. Nucleic Acids Res. 27, 2991–3000
40 Kaczynski, J., Cook, T. and Urrutia, R. (2003) Sp1- and Krüppel-like transcription factors.
Genome Biol. 4, 206
41 Suske, G., Bruford, E. and and Philipsen, S. (2005) Mammalian SP/KLF transcription
factors: bring in the family. Genomics 85, 551–556
42 Nishii, T., Kono, S., Abe, H., Eguchi, H., Shimazaki, K., Hatano, B. and Hamada, H. (2001)
Glucose intolerance, plasma insulin levels, and colon adenomas in Japanese men. Jpn. J.
Cancer Res. 92, 836–840
43 Yoshida, I., Suzuki, A., Vallee, M., Matano, Y., Masunaga, T., Zenda, T., Shinozaki, K. and
Okada, T. (2006) Serum insulin levels and the prevalence of adenomatous and
hyperplastic polyps in the proximal colon. Clin. Gastroenterol. Hepatol. 4, 1225–1231
44 Black, A. R., Black, J. D. and Azizkhan-Clifford, J. (2001) Sp1 and Krüppel-like factor
family of transcription factors in cell growth regulation and cancer. J. Cell. Physiol. 188,
143–160
45 Samson, S. L. and Wong, N. C. (2002) Role of Sp1 in insulin regulation of gene
expression. J. Mol. Endocrinol. 29, 265–279
46 Monti, E., Bassi, M. T., Papini, N., Riboni, M., Manzoni, M., Venerando, B., Croci, G.,
Preti, A., Ballabio, A., Tettamanti, G. and Borsani, G. (2000) Identification and expression
of NEU3, a novel human sialidase associated to the plasma membrane. Biochem. J. 349,
343–351
47 Proshin, S., Yamaguchi, K., Wada, T. and Miyagi, T. (2002) Modulation of neuritogenesis
by ganglioside-specific sialidase (Neu 3) in human neuroblastoma NB-1 cells.
Neurochem. Res. 27, 841–846
48 Lietard, J., Musso, O., Theret, N., L’Helgoualc’h, A., Campion, J. P., Yamada, Y. and
Clement, B. (1997) Sp1-mediated transactivation of LamC1 promoter and coordinated
expression of laminin-γ 1 and Sp1 in human hepatocellular carcinomas. Am. J. Pathol.
151, 1663–1672
49 Shi, Q., Le, X., Abbruzzese, J. L., Peng, Z., Qian, C. N., Tang, H., Xiong, Q., Wang, B., Li,
X. C. and Xie, K. (2001) Constitutive Sp1 activity is essential for differential constitutive
expression of vascular endothelial growth factor in human pancreatic adenocarcinoma.
Cancer Res. 61, 4143–4154
50 Wang, L., Wei, D., Huang, S., Peng, Z., Le, X., Wu, T. T., Yao, J., Ajani, J. and Xie, K.
(2003) Transcription factor Sp1 expression is a significant predictor of survival in human
gastric cancer. Clin. Cancer Res. 9, 6371–6380
51 Jones, F. S. and Meech, R. (1999) Knockout of REST/NRSF shows that the protein is a
potent repressor of neuronally expressed genes in non-neural tissues. BioEssays 21,
372–376
52 Schoenherr, C. J. and Anderson, D. J. (1995) Silencing is golden: negative regulation in
the control of neuronal gene transcription. Curr. Opin. Neurobiol. 5, 566–571
53 Chen, Z. F., Paquette, A. J. and Anderson, D. J. (1998) NRSF/REST is required in vivo for
repression of multiple neuronal target genes during embryogenesis. Nat. Genet. 20,
136–142
54 Barrachina, M., Moreno, J., Juves, S., Moreno, D., Olive, M. and Ferrer, I. (2007) Target
genes of neuron-restrictive silencer factor are abnormally up-regulated in human
myotilinopathy. Am. J. Pathol. 171, 1312–1323
55 Westbrook, T. F., Martin, E. S., Schlabach, M. R., Leng, Y., Liang, A. C., Feng, B., Zhao,
J. J., Roberts, T. M., Mandel, G., Hannon, G. J. et al. (2005) A genetic screen for
candidate tumor suppressors identifies REST. Cell 121, 837–848
56 Doetzlhofer, A., Rotheneder, H., Lagger, G., Koranda, M., Kurtev, V., Brosch, G.,
Wintersberger, E. and Seiser, C. (1999) Histone deacetylase 1 can repress transcription by
binding to Sp1. Mol. Cell. Biol. 19, 5504–5511
Identification of human sialidase NEU3 gene promoter
57 Wilson, A. J., Byun, D. S., Nasser, S., Murray, L. B., Ayyanar, K., Arango, D., Figueroa, M.,
Melnick, A., Kao, G. D., Augenlicht, L. H. and Mariadason, J. M. (2008) HDAC4 promotes
growth of colon cancer cells via repression of p21. Mol. Biol. Cell 19, 4062–4075
58 Mottet, D., Pirotte, S., Lamour, V., Hagedorn, M., Javerzat, S., Bikfalvi, A., Bellahcene, A.,
Verdin, E. and Castronovo, V. (2009) HDAC4 represses p21WAF1/Cip1 expression in human
cancer cells through a Sp1-dependent, p53-independent mechanism. Oncogene 28,
243–256
117
59 Valaperta, R., Chigorno, V., Basso, L., Prinetti, A., Bresciani, R., Preti, A., Miyagi, T. and
Sonnino, S. (2006) Plasma membrane production of ceramide from ganglioside GM3 in
human fibroblasts. FASEB J. 20, 1227–1229
60 Schepers, U., Lemm, T., Herzog, V. and Sandhoff, K. (2000) Characterization of regulatory
elements in the 5 -flanking region of the GM2 activator gene. Biol. Chem. 381, 531–544
61 Xia, T., Zeng, G., Gao, L. and Yu, R. K. (2005) Sp1 and AP2 enhance promoter activity of
the mouse GM3 -synthase gene. Gene 351, 109–118
Received 10 March 2010/26 May 2010; accepted 2 June 2010
Published as BJ Immediate Publication 2 June 2010, doi:10.1042/BJ20100350
c The Authors Journal compilation c 2010 Biochemical Society
Biochem. J. (2010) 430, 107–117 (Printed in Great Britain)
doi:10.1042/BJ20100350
SUPPLEMENTARY ONLINE DATA
Regulation of plasma-membrane-associated sialidase NEU3 gene
by Sp1/Sp3 transcription factors
Kazunori YAMAGUCHI*, Koichi KOSEKI*, Momo SHIOZAKI*, Yukiko SHIMADA*†, Tadashi WADA* and Taeko MIYAGI*1
*Division of Biochemistry, Miyagi Cancer Center Research Institute, Natori, Miyagi, 981-1293, Japan, and †Friedrich Miescher Institute, CH-4058, Basel, Switzerland
Figure S1
TSSs of the human NEU3 gene assigned by ESTs
The 5 -ends of the ESTs deposited in dbEST are indicated by arrows labelled with the GenBank® accession number of each tag. The most frequently used TSS in HCT116 cells identified using the
oligo-capping method is indicated by an arrowhead and numbered as +1.
1
To whom correspondence should be addressed, at the present address: Division of Cancer Glycosylation Research, Institute of Molecular
Biomembrane and Glycobiology, Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai, 981-8558, Japan (email [email protected]).
c The Authors Journal compilation c 2010 Biochemical Society
K. Yamaguchi and others
Figure S2
Distribution of TSSs on the human NEU3 gene
TSSs used in several tissues and cell lines were determined using oligo-capping. The frequency
and position of each TSS are plotted. Exons I and II of the NEU3 gene are presented schematically
at the bottom.
c The Authors Journal compilation c 2010 Biochemical Society
Identification of human sialidase NEU3 gene promoter
Figure S3
EMSA for the H region of the human NEU3 gene promoter
(A) DNA sequence of the H region. Deduced recognition sites for transcription factors and probes used in EMSA experiments are indicated. (B) Transcription factors were searched by EMSAs
employing unlabelled competitors. Nuclear extracts of HCT116 cells were incubated with or without 32 P-labelled probes shown in (A) in the presence or absence of unlabelled competitors (20×
molar excess) and the resulting DNA–protein complexes were resolved by PAGE as described in the Experimental section of the main text. Sequences of the competitors are listed in Supplementary
Table S1. Arrows indicate shifted bands suggesting specific DNA–protein complexes. Arrowheads indicate free probes.
Figure S4 Correlation between expression levels of NEU3 , Sp1 and Sp3 in
various cell lines
Total RNA was prepared from the cell lines and used for evaluation of expression levels of
NEU3 , Sp1 and Sp3 genes by quantitative PCR as described in the Experimental section
of the main text. Left-hand panel: NEU3 against Sp1 (P = 0.0087, r = 0.72). Right-hand panel:
NEU3 against SP3 (P = 0.0005, r = 0.85). Cell lines and expression levels are provided in
Supplementary Table S2. Primers used for PCR were SSP-08 and SSP-09 for NEU3 , SSP-10
and SSP-11 for Sp1, SSP-12 and SSP-13 for Sp3 .
c The Authors Journal compilation c 2010 Biochemical Society
K. Yamaguchi and others
Table S1
Oligonucleotides used in the present study
Name
Isolation of genomic clones
GSP-01
GSP-02
3 -RACE
(dT)17 adaptor
Adaptor
GSP-03
GSP-04
Oligo-capping
OCP-01
OCP-02
OCP-luc1
OCP-luc2
Primer extension
PEP-01
Introduction of deletion mutation on promoter region†
MP01
MP02
MP03
MP04
MP05
MP06
MP07
MP08
MP09
MP10
MP11
MP12
MP13
MP14
MP15
MP16
MP17
MP18
MP19
MP20
MP21
MP22
MP23
MP24
EMSA, 32 P-labelled probe‡
F-1
F-2
F-3
F-4
H-1
H-2
H-3
H-4
EMSA, unlabelled competitor‡§
AP-2
GC box
GC box mutant
MYB
ETS/NRF-2
SNAIL
TST1
GT box
GT box mutant
MZF-1_1
MZF-1_2
EGR-1
ZNF35
ZBP-89
GATA
GAGA
HBP1
HES-1
ChIP assay
CAP-01
CAP-02
c The Authors Journal compilation c 2010 Biochemical Society
Sequence
5 -CGCGGATCCTGTAGCTCGGGGCTGTGGCACTGAAGAGAG-3
5 -CTGTACCAACTGCCCAATCCTCAACCCTCG-3
5 -CACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV-3 *
5 -CACGCGTATCGATGTCGAC-3
5 -TCATCCGAGTGTGA GGTTAC-3
5 -GGTTACAAGCAGGTGTCATG-3
5 -GGTAGGTAATCCCTCTGTCATC-3
5 -ACGCGGCCGCGGCTGTTGAAGGAGCATGTTGT-3
5 -ACCAGGGCGTATCTCTTCATAG-3
5 -ACGCGGCCGCAGCCTTATGCAGTTGCTCTCCA-3
5 -CAGTTCCCAACGGCCGCCTCCTC TC-3
5 -TTCTGTAAAGCTTCTGTAAATTTG-3
5 -TTCCAAAGCGCTGAGATTGTAGG-3
5 -TTCGCTTAAATTCCGGTACTGTGA-3
5 -TTCCATATTTTGCAAGGAGAGTA-3
5 -TTCGGGAAGCTTTAGGCGGTGAT-3
5 -TTCCCGAGCTGCGGGCTGGA-3
5 -TTCCCTCTTTTCGTTGCCGTTAC-3
5 -TTCTCTCGGGGCTTGTCTCCGTG-3
5 -TTCCCTGCCCCCGCGCCCCATGG-3
5 -TTCCCTACAATCTCAGCGCTTTG-3
5 -TTCTCACAGTACCGGAATTTAAG-3
5 -TTCAAAATGAAAATATATTCATA-3
5 -TTCTGGACAGCCTGAGAGTTGAG-3
5 -TTCCCACGGCGTGGGACCG-3
5 -TTCCGGGCGCAGGCTGTAGTCAG-3
5 -TTCAGCGAAGAGCGTGTCGACTG-3
5 -CTACTCTCCTTGCAAAATATG-3
5 -GCTCTGGACCTCTGGTCCTTTTTG-3
5 -CTACTCCGCGAGCCCTCCCC-3
5 -GCCACTGACTACAGCCTGCG-3
5 -TTCCTCGGCGCTGCCCCTCC-3
5 -TTCGGACGGGGAGGGCTCG-3
5 -TTCGGGCAGCGCCGAGGAAT-3
5 -TTCCCAGCCCGCAGCTCGGT-3
5 -ACGCCGTGGTGGGGACCGAGCTGCGGGCTGGAGGGAGGGGCAGCGCCGAG-3
5 -GAGGGAGGGGCAGCGCCGAGGGGGCGGGACGGGGAGGGCTCGCGGAGTAG-3
5 -GGGGAGGGCTCGCGGAGTAGGCCAACGGTTGGCCCCAACCGCCACTGACT-3
5 -GGCCCCAACCGCCACTGACTACAGCCTGCGCCCGCCTCTTTTCGTTGCCG-3
5 -TCTTCGCTTCTCGGGGCTTGTCTCCGTGTCCTCCGTCTCAGTTGTTTCTC-3
5 -CTCCGTCTCAGTTGTTTCTCCCTCTCTATCCTCCTCTGTCTCAGTCTCCC-3
5 -CTCCTCTGTCTCAGTCTCCCCAGCCTTGGGGCCGGTGCCTCTTCCGGGCT-3
5 -GCCGGTGCCTCTTCCGGGCTTCGGCGAATGAGACCTGCGGACCTGCCCCC-3
5 -GATCGAACTGACCGCCCGCGGCCCCT-3
5 -ATTCGATCGGGGCGGGGCGAGC-3
5 -ATTCGATCGGTTCGGGGCGAG-3
5 -TACAGGCATAACGGTTCCGTAGTGA-3
5 -GGGCTGCTTGAGGAAGTATAAGAAT-3
5 -GGCTGCCACCTGCAGGTGCGTCCC-3
5 -GTAGAAAGAACTGAATTACCATTCTAATAC-3
5 -CTGACCCCACCCATGAGCCTGAGAAGTGC-3
5 -CTGACCCCATTCATGAGCCTGAGAAGTGC-3
5 -GATCTAAAAGTGGGGAGAAAA-3
5 -GATCCGGCTGGTGAGGGGGAATCG-3
5 -GGATCCAGCGGGGGCGAGCGGGGGCGAACG-3
5 -CACCGGGAATACTTACCATG-3
5 -GAGGGACTGGGGGATTAGGGAAGTGCCCTCC-3
5 -CACTTGATAACAGAAAGTGATAACTCT-3
5 -GTGACAGAGAGAGAGAGAGGGAAA-3
5 -CGTTCATTCATTCAAC-3
5 -AGCGGTGCCGCGTGTCTTGGAGCT-3
5 -GGGACCGAGCTGCGGGCTGGA-3
5 -CGGGCGCAGGCTGTAGTCAGT-3
Identification of human sialidase NEU3 gene promoter
Table S1
Continued
Name
Sequence
Quantitative PCR
SSP-01
SSP-02
SSP-03
SSP-04
SSP-05
SSP-06
SSP-07
SSP-08
SSP-09
SSP-10
SSP-11
SSP-12
SSP-13
5 -AATATAAGAGCTCGGGGCTGTG-3
5 -CGTGTCCTCCGTCTCAGTTGTT-3
5 -GAGGGCTGTTGAAGGAGCATGT-3
5 -CTGGGCACAACAGACAATCG-3
5 -AGTGACAACGTCGAGCACAG-3
5 -CTGCCAGTAGCATATGCTTGTC-3
5 -GTTATCCAAGTAGGAGAGGAGC-3
5 -GACTGGTCATCCCTGCGTAT-3
5 -CACCTATGTGGGATCTCCAG-3
5 -CTTGGTATCATCACAAGCCAGTT-3
5 -TCCCTGATGATCCACTGGTAGTA-3
5 -TTGACTACATCTAGTGGGCAGGT-3
5 -TACAACAGGCTGTGCTGTAGAAA-3
*V=A, C or G.
†Half site for EcoRI recognition was included in each primer for identification of the mutated clone and is underlined.
‡Only upper strands are shown.
§Mutated bases are underlined.
Table S2
lines
Expression levels of NEU3 , Sp1 and Sp3 genes in human cell
Expression levels of the genes were normalized to that of GAPDH (glyceraldehyde-3-phosphate
dehydrogenase) and given in arbitrary units.
Cell lines
NEU3
Sp1
Sp3
HeLa
MCF7
DLD-1
HCT116
HT29
A549
LNCaP
PC-3
IMR32
NB-1
NHEK
0.065965
0.019844
0.020189
0.028502
0.085408
0.026919
0.025093
0.077814
0.04195
0.066374
0.038256
0.031465
0.014509
0.00936
0.012602
0.023803
0.006963
0.003906
0.014356
0.019379
0.029984
0.017116
0.185291
0.136399
0.1332
0.120886
0.277588
0.079627
0.057048
0.197853
0.178518
0.277879
0.152918
Received 10 March 2010/26 May 2010; accepted 2 June 2010
Published as BJ Immediate Publication 2 June 2010, doi:10.1042/BJ20100350
c The Authors Journal compilation c 2010 Biochemical Society