Reference: Biol. Bull. 228: 52– 64. (February 2015)
© 2015 Marine Biological Laboratory
Biogeography of Phallusia nigra: Is It Really Black
and White?
LAUREN E. VANDEPAS1, LIVIA M. OLIVEIRA2, SERINA S.C. LEE3, EUICHI HIROSE4,
ROSANA M. ROCHA2, AND BILLIE J. SWALLA1*
1
Biology Department, University of Washington, and Friday Harbor Laboratories, Seattle, Washington;
2
Departamento de Zoologia, Universidade Federal do Paraná, Curitiba, Paraná, Brazil; 3Tropical
Marine Science Institute, National University of Singapore, Singapore; and 4Department of Chemistry,
Biology, and Marine Science, University of the Ryukyus, Nishihara-cho, Okinawa, Japan
Abstract. Ascidians (Chordata, Tunicata) are an important group for the study of invasive species biology due to
rapid generation times, potential for biofouling, and role as
filter feeders in an ecosystem. Phallusia nigra is a putative
cosmopolitan ascidian that has been described as introduced
or invasive in a number of regions in the Indo-Pacific Ocean
(India, Japan, and Hawaii) and in the Mediterranean. The
taxonomic description of P. nigra includes a striking
smooth, black tunic and large size. However, there are at
least two similar Phallusia species—P. philippinensis and
P. fumigata—which also have dark black tunics and can be
difficult to discern from P. nigra. The distribution of P.
nigra broadly overlaps with P. philippinensis in the IndoPacific and P. fumigata in the Mediterranean. A morphological comparison of P. nigra from Japan, the Caribbean
coast of Panama, and Brazil found that Atlantic and Pacific
samples were different species and led us to investigate the
range of P. nigra using morphological and molecular analyses. We sequenced 18S rDNA and cytochrome oxidase B
of individual ascidians from the Red Sea, Greece, Singapore, Japan, Caribbean Panama, Florida, and Brazil. Our
results show that identification of the disparate darkly pigmented species has been difficult, and that several reports of
P. nigra are likely either P. fumigata or P. philippinensis.
Here we include detailed taxonomic descriptions of the
distinguishing features of these three species and sequences
for molecular barcoding in an effort to have ranges and
potential invasions corrected in the ascidian literature.
Introduction
Invasive invertebrate species often have a large effect on
native organisms by shifting species interactions and community organization (Strayer et al., 2011). The correct identification of invasive species is critical for their management
and eradication given that unique biological characteristics
of the species, such as timing of reproduction and physiological tolerances, are important for management strategies.
Ascidians (Chordata, Tunicata) are invertebrate chordates
that compose a major part of benthic ecosystems globally
and have recently been a major focus of invasive species
studies due to increasing numbers of reported invasions
(Lambert, 2007; Rius et al., 2008; Dupont et al., 2009;
Lejeusne et al., 2011). Ascidians are potent biofoulers and
effective invaders because sessile adults and free-swimming
tadpole larvae can be transported to new areas through
human vectors such as boat hulls, ballast waters, and aquaculture (Lambert, 2002, 2007).
Efforts to correctly identify species in this group are not
trivial. Historical taxonomic descriptions of species within
the ascidians are not always straightforward (Stefaniak
et al., 2009), and there may be significant morphological
variation within a single species (López-Legentil and Turon,
2006). Additionally, present taxonomic descriptions may be
inadequate for the separation of some ascidian species, as
molecular data have uncovered unexpected cryptic diversity
even in well-studied ascidian species (Tarjuelo et al., 2001;
Caputi et al., 2007; Iannelli et al., 2007b; Pérez-Portela and
Turon, 2008; Bock et al., 2012; Pérez-Portela et al., 2013).
However, rigorous morphology-based taxonomy is still central to the initial identification of an organism and can be
Received 29 November 2013; accepted 27 October 2014.
* To whom correspondence should be addressed. E-mail: bjswalla@
u.washington.edu
52
53
BIOGEOGRAPHY OF PHALLUSIA NIGRA
utilized in conjunction with molecular studies (SchlickSteiner et al., 2007; Shenkar and Swalla, 2011). Genetic
markers combined with morphological character analysis
have been instrumental in distinguishing native ascidians
from invaders (Nishikawa et al., 2014).
Phallusia nigra is one example of a widely distributed
species. It is a solitary ascidian with a striking smooth black
tunic usually devoid of epibionts, and a large size, up to 10
cm (see Fig. 1). It lives in tropical waters at shallow depths
on hard or rocky substrates, and is very common on artificial
substrates. P. nigra was originally described in the early
1800s from the Red Sea, but has been reported in many
tropical and subtropical locations since then. It has been
reported in the Mediterranean Sea (Izquierdo-Muñoz et al.,
2009), the Red Sea (Savigny, 1816; Shenkar et al., 2008;
Shenkar, 2012), the Pacific Ocean (Abbott et al., 1997;
Hirose, 1999; Lambert, 2003), the Indian Ocean (Michaelson, 1919; Monniot and Monniot, 1997; Subba Rao, 2005;
Abdul Jaffar Ali and Sivakumar, 2007; Abdul Jaffar Ali et
al., 2009), Gulf of Guinea (Millar, 1965), Angola (Millar,
1965), and widely in the west Atlantic Ocean and the
Caribbean (Rocha et al., 2005; Mendiola et al., 2006; Bonnet and Rocha, 2011; Carman et al., 2011) (see Fig. 3A).
Though its native range is not known, P. nigra has been
described as an introduced species in the Pacific (De Felice
et al., 2001), in the Indian Ocean (Abdul Jaffar Ali et al.,
2009), and in the Mediterranean Sea (Çinar et al., 2006;
Shenkar et al., 2008; Izquierdo-Muñoz et al., 2009; Kondilatos et al., 2010), and it has been labeled as either native
(Galil, 2007) or cryptogenic (Galil, 2007; Rocha et al.,
2012) in the western Atlantic.
Reports of the geographical distribution of P. nigra are
complicated by this species’ many synonyms: Ascidia nigra
Heller, 1878, Ascidia atra Lesueur, 1823, Ascidia somalensis Sluiter, 1905, Phallusia atra Traustedt, 1882, Phallusia
violacea Gould, 1852, Phallusiopsis nigra Hartmeyer,
1909, Thallusia nigra Hartmeyer, 1908, Tunica nigra
Hilton, 1913; but most reports in the last 70 years have used
either Ascidia nigra or Phallusia nigra, with a preference
for Phallusia in recent years (Shenkar and Swalla, 2011).
Further compounding the difficulty of identifying P. nigra
in the field are two other species in the genus Phallusia that
also have darkly pigmented tunics and whose geographical
range partially overlaps with that of P. nigra: Phallusia
philippinensis (Millar, 1975) and Phallusia fumigata (Gruber, 1864) (see Fig. 1). Phallusia fumigata has been described as native to the Mediterranean (Pérès, 1958), though
it is also found in the Atlantic, on the French coast along the
English Channel (Harant and Vernieres, 1933) where it is
typically found in shallow waters (up to 50-m depth) in rock
crevasses among sponges (Hircinia spp.) or algae (Codium
bursa). P. fumigata is referred to as the black bottle tunicate
(Harant and Vernieres, 1933), and its dark pigmentation can
be seen all over the body or concentrated in the anterior or
exposed area (though very young specimens may have a
predominantly light coloration). P. philippinensis also has a
tunic that is dark (from black-brown to gray), but usually
not as opaque as that of P. nigra. It is found on coarse
sediment of coral habitats in the Indo-Pacific (Monniot and
Monniot, 2001).
Since P. nigra has been repeatedly reported as introduced
in many localities and a morphological comparison between
populations of black Phallusia from Japan and the Caribbean coast of Panama by the authors has revealed important
distinctive characteristics, we hypothesized that some of the
previous reports might not be accurate. In this study, we
compared individuals from different populations of the
three darkly pigmented Phallusia species and detail major
morphological characters to distinguish them. We also sequenced the 18S ribosomal subunit DNA and cytochrome
oxidase B (cyt-B) from individual ascidians from populations of P. nigra, P. fumigata, and P. philippinensis. Published genetic data for this genus are limited, with only 6 of
the 19 recognized species in this genus represented in
GenBank, and there has not been wide-scale sequencing of
mitochondrial or nuclear genes of Phallusia until now.
Our results show that Phallusia nigra occurs in the Red
Sea, Singapore, and the West Atlantic, but it has been
confused with both P. fumigata and P. philippinensis in
other regions. In Japan and Hawaii, what has been reported
as P. nigra is actually P. philippinensis. We provide molecular sequences as well as detailed taxonomic descriptions
of the three darkly pigmented Phallusia species, which we
hope will be useful for future studies seeking to report
occurrences and locations of P. nigra, P. fumigata, and P.
philippinensis.
Materials and Methods
Ascidian samples
Morphological comparisons included individuals of
Phallusia with dark tunics from Brazil (Rio de Janeiro),
Panama (Bocas del Toro, Caribbean coast), Israel (Eilat),
Singapore, Japan (Okinawa), Taiwan, Hawaii, Australia,
and the Mediterranean (Spain and France). All specimens
were deposited at the Ascidiacea collection of the Zoology
Department, Federal University of Paraná, Brazil (DZUP).
We obtained samples for molecular analysis from the Atlantic and greater Caribbean (Florida, Brazil, and Panama),
the Mediterranean Sea (Greece), Singapore, Japan, and the
Red Sea (Eilat, Israel). The specimens from the Red Sea can
be regarded as topotype specimens of Phallusia nigra. Tissue samples were stored in 95% ethanol until DNA was
extracted.
54
L. E. VANDEPAS ET AL.
DNA extraction, polymerase chain reaction, and
sequencing
Genomic DNA was extracted using DNeasy Blood and
Tissue Kit (Qiagen, Valencia, CA). Though cytochrome oxidase subunit I (COI) is a commonly used mitochondrial gene
in barcoding studies, it did not readily amplify in our samples;
however, we successfully amplified cytochrome oxidase B,
another commonly used mitochondrial marker. Cytochrome
oxidase B (cyt-B) was amplified by modifying PCR conditions
previously described (Stefaniak et al., 2009), using forward
primer 5⬘TGRGGNCARATGWSNTTYTG3⬘ and reverse
primer 5⬘GCKAANARRAARTAYCAYTC3⬘. 18S ribosomal
DNA was amplified utilizing primers as previously described
(Swalla et al., 2000): 18S-A 5⬘CAGCAGCGCGGTAA
TTCCAGCTC3⬘, 18S-BS 5⬘CCTGGTTGATCCTGCCAG3⬘,
18S-B 5⬘AAAGGGCAGGGACGTAATCAACG3⬘, 18S-PH
5⬘TAATGATCCATCTGCAGGTTCACCT3⬘. PCR amplifications were carried out in 25-␮l reactions containing 0.2
mmol l–1 each dNTP (Qiagen, Valencia CA), 1.0 ␮g each
primer, 1⫻ GoTaq Flexi buffer (Promega Corp. Madison, WI),
1.5 mmol l–1 MgCl2, 0.5 ␮l of GoTaq Flexi polymerase
(Promega Corp. Madison, WI), and 25–50 ng total DNA.
Samples that did not amplify initially were amplified in 25-␮l
reactions containing 12.5 ␮l of PrimeSTAR MAX DNA Polymerase Premix (Clontech Laboratories, Mountain View, CA),
5.5 ␮l water, 1.0 ␮g each primer, and 25–50 ng total DNA.
Cycling conditions for PrimeSTAR MAX reactions are 35
cycles of 10 s denaturing at 98 °C, 15 s annealing at 48 °C, and
10 s elongation at 72 °C. Cycling conditions for GoTaq Flexi
polymerase amplifications of cyt-B consist of an initial denaturing step of 4 min at 94 °C, followed by 60 cycles of 10 s
denaturing at 94 °C, 30 s annealing at 47 °C, and 50 s
elongation at 72 °C, with a final elongation of 10 min at 72 °C.
Cycling conditions for GoTaq Flexi polymerase amplifications
of 18S ribosomal DNA consist of an initial denaturing step of
4 min at 94 °C, followed by 35 cycles of 1 min denaturing at
94 °C, 1 min annealing at 47 °C, and 1.5 min elongation at 72
°C, with a final elongation of 10 min at 72 °C. PCR product
was extracted from the agarose gel using Illustra GFX PCR
DNA and Gel Band Purification Kit (GE Healthcare, Pittsburgh, PA). DNA sequencing was performed using BigDye3.1
(Life Technologies, Carlsbad, CA) with a 3130 DNA analyzer
(Life Technologies, Carlsbad, CA) in the UW Biology Department Comparative Genomics Center.
Sequence alignments and phylogenetic analysis
18S ribosomal DNA and cyt-B sequences were edited in
MacVector (MacVector Inc., Cary, NC) and aligned using
MAFFT (Katoh and Standly, 2013). Bayesian analysis was
performed using Mr. Bayes 3.1.2 (Ronquist and Huelsenbeck, 2003) using a general time reversible (GTR) model
(nst ⫽ 6) with gamma-distributed rate variation across sites
and a proportion of invariable sites (rates ⫽ invgamma) run
for 1,000,000 Markov chain Monte Carlo generations, sampling every 5000 generations with a burn-in of 25%. Resulting
trees were visualized in FigTree ver. 1.3.1 (Rambaut, 2009).
Numbers of variable and informative sites were generated
using PAUP* ver. 4.0b10 (Swofford, 2002). Divergences of
cyt-B sequences within and between clades were estimated
using uncorrected pairwise distances (p-distances) calculated
in MEGA 5.2.2 (Tamura et al., 2011). Outgroups and other
Phallusia sequences were obtained from GenBank. GenBank
accession numbers for cyt-B: Ciona intestinalis, NC_004447.2;
Ciona savignyi, NC_004570.1; Phallusia nigra (India),
JN791272; Phallusia mammillata, NC_009833; Phallusia fumigata, NC_009834; Ascidiella aspersa, NC_021469. GenBank
accession numbers for 18S ribosomal DNA: Phallusia nigra
(Mediterranean coast of Israel), FM244845.1; Phallusia nigra
(India), JN791272.1; Phallusia mammillata, AF236803.2;
Phallusia fumigata, FM244844.1; Corella eumyota,
FM244846.1; Ascidia ceratodes, L12378.2; Chelyosoma
siboja, AF165821.2; Megalodicopia hians, AB075543.1;
Corella inflata, AY903930.1.
Results
Based on morphological and molecular characters, the
Phallusia reported in the Pacific (Hawaii, Japan, Taiwan,
and Australia) are Phallusia philippinensis. We have no
evidence that Phallusia nigra is present in Hawaii or Okinawa, Japan, while P. nigra and P. philippinensis co-occur
in Singapore. Atlantic populations of dark Phallusia, as well
as the Red Sea populations, were all P. nigra. Mediterranean specimens from Spain and France were Phallusia
fumigata.
Morphological comparison
Although P. nigra, P. philippinensis, and P. fumigata
show external resemblance when fixed (Fig. 1), the dissection and study of internal characters revealed morphological
differences that made the identification of the species
straightforward, including the musculature pattern on the
right side of the body, presence of projections on the peripharyngeal groove, presence of secondary papillae on the
pharynx, and size and position of the alimentary canal
(Table 1).
A close observation of living adult specimens also shows
some differences (Fig. 1, Table 1): P. nigra is really black,
with short siphons positioned close, the oral siphon curved
dorsally and almost touching the atrial siphon, the lobes of
the siphons rarely seen. P. philippinensis is more brownish,
with more distant siphons and conspicuous siphon lobes. P.
fumigata is also brownish or grayish, has a wrinkled tunic
with small papillae around the oral siphon, the siphons are
longer and distant from each other, and part of the body is
usually found inside crevices. Since descriptions available
in the literature are not detailed, especially for P. nigra and
BIOGEOGRAPHY OF PHALLUSIA NIGRA
55
Figure 1. Phallusia nigra, Phallusia philippinensis, and Phallusia fumigata adults. Left panel: live specimens. Note that all three species can have darkly pigmented tunics. P. nigra always has a smooth and opaque
blue-black tunic, short atrial siphon, and long, curved oral siphon. P. philippinensis tends to have upright
siphons, a dark or light brown tunic, and encrustations toward the attached base. P. fumigata also has dark
pigmentation that can either be all over the body, brownish or grayish, or concentrated in the exposed areas. (Photos
by Rosana Rocha, Euichi Hirose, Sébastien Darras, respectively). Middle panels and right panel: Morphological
differentiation between P. nigra—DZUP-PHA-34 Panama; P. philippinensis—DZUP-PHA-32 Hawaii; and P.
fumigata—CRBA-3084, Spain, and DZUP—PHA47, France. The middle two columns show the right and left side
of the animals without tunics, and the right column shows the dissected anterior region. Comparison details in Table
1. Arrows show anterior lamina with projections in P. philippinensis. Scale bar ⫽ 1 cm.
P. fumigata, we describe the three species based on the
material studied.
Phallusia nigra Savigny, 1816 (Fig. 1, top row)
Examined material. DZUP-PHA-34 Marina Bocas, Bocas
del Toro, Panama—7 ind; 20/vi/2011; Collector Rosana
Rocha. DZUP-PHA-33 Meia-Lua Bay, Pargos Island, Cabo
Frio, Rio de Janeiro, Brazil—7 ind; 30/iii/2011; Col. Rosana
Rocha. DZUP-PHA-01 Forno Beach, Arraial do Cabo, Rio de
Janeiro, Brazil—2 ind; 04/2002; Col. Rosana Rocha. DZUPPHA-35 St John Island, Singapore—1 ind.; 11/vii/2012; Col.
Serina Lee. DZUP-PHA 048-051 Kisoski Marina, Eilat,
Israel— 4 ind.; 20/iii/2014; Col. Gretchen Lambert.
Individuals are up to 10 cm long with the oral siphon
usually curved dorsally. The animals attach themselves by
the posterior left region and usually attain a vertical upright
position. The tunic is black and smooth without encrustations. The oral siphon is apical with 8 –10 lobes and the
atrial siphon is very close to it, with 8 –12 lobes, but in some
specimens these lobes are very shallow or absent. The right
side musculature is formed by both longitudinal and transverse fibers, the longitudinal wider and running toward both
the endostyle and the posterior region, the transverse forming a dense mat underneath the longitudinal fibers. There are
oblique fibers extending from the atrial siphon and from the
region posterior to it, which cross transverse fibers. On the
left side, there are only short longitudinal muscles extending from the oral and atrial siphons and ending before the
gut loop. There are 35–115 oral tentacles of three sizes, the
larger 2.5–5.5 mm long. There are papillae in the prepharyngeal area. The peripharyngeal groove has two
smooth margins and forms a rounded area around the dorsal
tubercle, which has a U-shaped opening. The neural gland
duct has 10 – 40 accessory apertures on the left side, and
only two animals (in 16) had 79 and 136. The pharynx has
75–121 longitudinal vessels on the right side. The alimentary canal is large and occupies more than 2/3 of the left
side. The anterior margin of the intestinal loop reaches the
base of the atrial siphon. The intestine is isodiametric,
though some individuals have a slightly dilated secondary
56
Anterior lamina with projections (arrows in Figure 1)
Absence of intermediate papillae
Occupies more than 2/3 of the left side; intestinal
loop anterior to the level of the base of the atrial
siphon
Both laminas smooth
Absence of intermediate papillae
Occupies more than 2/3 of the left side; intestinal loop
at the level of the base of the atrial siphon
Peripharyngeal groove
Pharyngeal papillae
Alimentary canal
Atrial siphon
Right side musculature
Smooth
Apical and upright, 6–10 visible lobes in living
animals
In the middle of the body
Mainly longitudinal fibers extending from both oral
and atrial siphons, only the latter extending till the
posterior margin
Tunic
Oral siphon
Smooth
Bent dorsally, 8–10 lobes, usually not visible in living
animals
Anterior to the middle of the body
Longitudinal, transverse, and oblique fibers; longitudinal
wider and running toward both the endostyle and the
posterior region
Dark grey with whitish tunic in buried
portions of the body
Small projections around the oral siphon
Apical and upright, 8 visible lobes in
living animals
Posterior to the middle of the body
Mainly transverse fibers extending
between the dorsal and ventral
margins in the first half and with an
interruption in the central region in
the second half
Both laminas smooth
Presence of intermediate papillae
Occupies half of the left side; intestinal
loop at the level of the base of the
atrial siphon
Dark gray or brown; light color when in the shadow
Black and shiny
Color of living animals
P. nigra
Morphological comparisons among dark species of Phallusia
Table 1
P. philippinensis
P. fumigata
L. E. VANDEPAS ET AL.
loop or rectum; however, this may be due to the presence of
food in the gut, and the intestine never forms a sac-like
structure.
Phallusia philippinensis (Millar, 1975) (Fig. 1, middle
row)
Examined material. DZUP-PHA-32 Kaneohe, Hawaii—7
ind; 14/iii/2012. Col. Euichi Hirose. DZUP-PHA-30 Penghu, Taiwan—1 ind; 09/iii/2011; Col. Shih-Wei Su. DZUPPHA-36; DZUP-PHA-37; DZUP-PHA-38; DZUP-PHA-39
Padang Buoy, Singapore— 4 ind; 23/vii/2012; Col. Serina
Lee. DZUP-PHA-31 Toya Fishery Port, Okinawa-Jima, Japan—7 ind; 08/iv/2011; Col. Euichi Hirose. DZUP—
PHA-44 Magnetic Island, Australia—3 ind., 18/xi/2011;
Col. Mari Carmen Piñeda.
Individuals are up to 6.5 cm long and attach themselves
by the posterior left region, usually attaining a vertical
upright position. The tunic is dark or light brown, with
encrustations only at the fixation base. The oral siphon is
apical with 6 –10 lobes and the atrial siphon is in the mid
dorsal line, with 6 – 8 lobes. The right side musculature is
formed mainly by longitudinal fibers extending from both
oral and atrial siphons. From the oral siphon, the ventral
ones are shorter and end in the first 1/3 of the body length,
while the middle are longer and end before the base of the
atrial siphon. The longitudinal fibers extending from the
atrial siphon end in the posterior margin. The transverse
fibers are more internal and extend between the dorsal and
ventral margins. On the left side, there are longitudinal
muscles extending only from the oral siphon and ending
before the gut loop. There are 30 –57 oral tentacles of four
sizes with very small ones (not counted) among the larger,
which are 2.5–5.5 mm long. There are papillae in the
prepharyngeal area. The peripharyngeal groove has two
margins, the anterior one with projections. It forms a V
around the dorsal tubercle, which has a U-shaped opening
with inrolled ends. The neural gland duct has 20 – 45 accessory apertures on the left side, with four individuals (in 17)
having less than 20. The pharynx has 46 – 63 longitudinal
vessels. The alimentary canal is large and occupies more
than 2/3 of the left side. The anterior margin of the intestinal
loop reaches beyond the base of the atrial siphon. The
intestine is isodiametric, though some individuals have a
slightly dilated secondary loop; this may be due to the
presence of food in the gut, and the intestine never forms a
sac-like structure.
Phallusia fumigata (Grube, 1864) (Fig. 1, bottom row)
Examined material. CRBA-3353 Punta Sarnella, Port de
la Selva, Spain—1 ind.; 12/iv/1981; CRBA-3084 Punta
Sarnella, Port de la Selva, Spain—1 ind; 22/iii/1981; Col.
Joan Cervantes. DZUP PHA47, Port Vendres, France–1
ind.; 28/vii/1992; Col. Rosana M. Rocha.
BIOGEOGRAPHY OF PHALLUSIA NIGRA
Individuals are up to 8 cm long. The animals attach
themselves inside crevices by the posterior region, leaving
only the siphons projecting above the substrate. The tunic is
dark brown or gray only in exposed parts, with thicker left
side and small papillae along the oral siphon. The oral
siphon is apical with 8 lobes, and the atrial siphon is
posterior to the mid dorsal line, with 6 lobes. The right side
musculature is formed mainly by transverse fibers extending
between the dorsal and ventral margins, in the first half.
Posterior to the base of the atrial siphon, the transverse
fibers are shorter and divide in two marginal bands lining
the central region without muscles. Longitudinal fibers extending from the oral siphon are very delicate and end
before the level of the atrial siphon. There are 31–33 oral
tentacles of four sizes, the larger 2.5– 4 mm long. There are
papillae in the prepharyngeal area. The peripharyngeal
groove has two smooth margins. It forms a V around the
dorsal tubercle, which is heart-shaped. We counted 32 and
48 accessory apertures on the left side in the two animals
from Spain. The pharynx has 58 – 67 longitudinal vessels on
the right side, with intermediate small papillae between
transverse vessels. The alimentary canal occupies half of the
left side and is covered by numerous renal vesicles. The
anterior margin of the intestinal loop reaches the base of
the atrial siphon. The intestine is isodiametric.
The detailed descriptions given in this study show that the
position of the atrial siphon, pattern of body musculature,
and size of the digestive tract are easily identifiable characters that can be observed by removing the animal from its
tunic. A further character to differentiate P. nigra from P.
philippinensis is the presence of small projections along the
peripharyngeal groove in the latter, while P. fumigata is the
only of these three species to have intermediate papillae
inside the pharynx. All the mentioned characters are constant in all individuals dissected. The number of oral tentacles and longitudinal vessels were larger in P. nigra, but
these characters usually increase in number as animals get
larger, and smaller P. nigra could have the same numbers as
the other species. The number of accessory apertures proved
to be too variable to be reliable as a distinguishing character
and its range overlaps among species.
Molecular analysis
Figure 2 shows a phylogenetic tree constructed with
cyt-B sequences (see Table 2 for GenBank accessions). The
samples that are the true P. nigra are from the Red Sea,
Singapore, and Caribbean Panama, Florida, and Brazil; they
form a monophyletic clade with high support. The Phallusia
samples we obtained from Greece genotyped as P. fumigata
when compared to sequences from GenBank (Iannelli et al.,
2007a). Sequences of P. philippinensis cyt-B obtained from
the two locations in Japan (East Okinawa: Atta Fishery Port,
dark gray boxes; West Okinawa: Toya Fishery Port, light
57
Figure 2. Bayesian phylogenetic tree for cytochrome oxidase B. Phallusia philippinensis sequences form a clade with samples collected in East
Okinawa (dark gray boxes) or in West Okinawa (light gray boxes). Samples obtained from Greece genotyped as P. fumigata. P. nigra from the Red
Sea, Caribbean Panama, Florida, and Brazil form a monophyletic clade
with high support. Posterior probabilities below 0.9 are not shown.
gray boxes) do not fall into discrete clades on the tree,
indicating that gene flow between the western and eastern
sides of the island of Okinawa may be occurring or has
occurred in the recent past. There is also a clade from West
Okinawa that clusters with high support and may be indicative of a separate population or subspecies of P. philippinensis, but further genetic analysis may be needed to confirm whether this clade of Phallusia in West Okinawa is
distinct.
The number of variable characters in available cyt-B
sequences of phlebobranch ascidians was 260 out of 419
characters, with 220 sites being parsimony-informative. The
number of variable sites in available 18S sequences of
phlebobranch ascidians was 256 out of 1715 characters,
with 166 sites being parsimony-informative. Because there
were so few parsimony-informative characters in phlebobranch 18S sequences, the tree has less resolution, but is
available in the appendix (Fig. A1). The maximum genetic
divergence (uncorrected p-distances) observed among all
taxa was 0.3808 between the Ciona clade and P. nigra.
58
L. E. VANDEPAS ET AL.
Table 2
Specimen collection locations and GenBank accession numbers
Species
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
philippinensis
philippinensis
philippinensis
philippinensis
philippinensis
philippinensis
philippinensis
philippinensis
philippinensis
philippinensis
philippinensis
philippinensis
philippinensis
fumigata
fumigata
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
Phallusia
nigra
nigra
nigra
nigra
nigra
nigra
nigra
nigra
philippinensis
philippinensis
philippinensis
fumigata
Collection location
Gene: Cytochrome oxidase
Red Sea, Israel
Red Sea, Israel
Red Sea, Israel
Red Sea, Israel
Rio de Janeiro, Brazil
Rio de Janeiro, Brazil
Rio de Janeiro, Brazil
Rio de Janeiro, Brazil
Bocas del Toro, Panama
Bocas del Toro, Panama
Bocas del Toro, Panama
Bocas del Toro, Panama
Bocas del Toro, Panama
Florida, United States
Florida, United States
Florida, United States
Singapore
Singapore
Singapore
Okinawa, Japan
Okinawa, Japan
Okinawa, Japan
Okinawa, Japan
Okinawa, Japan
Okinawa, Japan
Okinawa, Japan
Okinawa, Japan
Okinawa, Japan
Okinawa, Japan
Okinawa, Japan
Greece
Greece
Gene: 18SrDNA
Red Sea, Israel
Red Sea, Israel
Red Sea, Israel
Rio de Janeiro, Brazil
Rio de Janeiro, Brazil
Bocas del Toro, Panama
Florida, United States
Singapore
Singapore
Okinawa, Japan
Okinawa, Japan
Greece
Genetic distances between each Phallusia species ranged
from 0.2653 between P. nigra and P. philippinensis to
0.3288 between P. philippinensis and the clade that includes
P. mammillata (Table 3). There was little variation within
cyt-B for P. nigra (0.0053), whereas P. philippinensis
had the highest within-species variation in the Phallusia
(0.0941).
The phylogenetic tree of relationships using 18S ribosomal subunit sequences shows P. nigra from the western
Collection site
GenBank accession
B
Kisoski Marina, Eilat
Kisoski Marina, Eilat
Kisoski Marina, Eilat
Kisoski Marina, Eilat
Cabo Frio
Cabo Frio
Cabo Frio
Cabo Frio
Marina Bocas
Marina Bocas
Marina Bocas
Town
Town
Indian River Lagoon
Cape Canaveral, FL
Indian River Lagoon
St. John Island
Padang Buoy
Padang Buoy
Okinawajima
Okinawajima
Okinawajima
Okinawajima
Okinawajima
Okinawajima
Okinawajima
Okinawajima
Toya Fishery Port
Toya Fishery Port
Toya Fishery Port
Thermaikos Gulf
Thermaikos Gulf
KJ875967
KJ875968
KJ875969
KJ875970
KF302051
KF302052
KF302053
KF302054
KF302058
KF302059
KF302060
KF302061
KF302062
KF302055
KF302056
KF302057
KF302063
KF302038
KF302039
KF302043
KF302044
KF302045
KF302046
KF302047
KF302048
KF302049
KF302050
KF302040
KF302041
KF302042
KF302064
KF302065
Kisoski Marina, Eilat
Kisoski Marina, Eilat
Kisoski Marina, Eilat
Cabo Frio
Cabo Frio
Town
Indian River Lagoon
St. John Island
Padang Buoy
Okinawajima
Okinawajima
Thermaikos Gulf
KJ875971
KJ875972
KJ875973
KF268455
KF268456
KF268458
KF268457
KF268459
KF268460
KF268462
KF268461
KF268454
Atlantic and P. philippinensis from Okinawa as a polytomy
with two Phallusia samples from GenBank from India and
the Mediterranean coast of Israel, while P. philippinensis
from Singapore clusters with P. fumigata in the tree (appendix Fig. A1). We believe that the lack of informative
sites in the 18S gene sequences of the available plebobranchs (166 out of 1715 characters) is the reason that the
relationships within the Phallusia in the 18S tree differ from
those in the cyt-B tree (220 parsimony-informative sites out
59
BIOGEOGRAPHY OF PHALLUSIA NIGRA
Table 3
Pairwise genetic distances (p-distances) between and within phlebobranch clades for cytochrome oxidase B
Within-clade
Ascidiella aspersa
Phallusia spp.
Phallusia fumigata
Phallusia philippinensis
Phallusia nigra
Ciona int &
sav*
Ascidiella
aspersa
Phallusia
spp.
Phallusia
fumigata
Phallusia
philippinensis
Phallusia
nigra
0.2414
0.3399
0.3799
0.3576
0.3733
0.3808
N/A
0.0172
0.0181
0.0941
0.0053
0.3190
0.3112
0.3094
0.3344
0.2755
0.3288
0.3045
0.3004
0.3106
0.2653
* Stands for Ciona intestinalis and Ciona savigny.
of 419 characters). We analyzed concatenated sequences
using both genes with the same prior probabilities and
models of Bayesian inference. The concatenated sequences
recovered the relationships between taxa that are wellsupported in the cyt-B tree, and the monophyly of P. philippinensis was restored (data not shown). We conclude that
the relationships between the three black Phallusia species
shown in the cyt-B tree are the best phylogenetic reconstruction hypothesis available with our data.
Geographical distribution
An investigation of the reported distribution of the three
species revealed that although P. nigra has been reported
worldwide, P. philippinensis has been found only in the
Indo-Pacific, and P. fumigata is a European species (Fig.
3A). Figure 3B shows the distribution of specimens that
were sequenced for this study, with their identification confirmed by rigorous morphological or genetic analyses. Note
the co-occurrence of P. nigra and P. philippinensis in Singapore (Lee et al., 2013). All other populations formerly
identified as P. nigra in the Indo-Pacific aside from those in
Singapore are actually P. philippinensis, and the specimens
from Greece are P. fumigata. We also report the first confirmed occurrence of P. philippinensis in Australia, where it
was found in a marina in Magnetic Island, Queensland.
characterize because morphological plasticity within a species is not unusual (Olson, 1986; Marks, 1996; Tarjuelo et
al., 2004; Lopez-Legentil et al., 2005; Hirabayashi et al.,
2006). Additionally, studies analyzing mitochondrial markers and other molecular methods have revealed cryptic
speciation in a number of well-known species (Tarjuelo et
al., 2001; Caputi et al., 2007; Hirose et al., 2009; Bock et
al., 2012; Pérez-Portela et al., 2013).
Using a combination of morphological characters and
molecular data, we show that the putatively cosmopolitan
phlebobranch ascidian Phallusia nigra is not as widespread
as previously thought and that reports of this species in
Greece, Japan, Taiwan, and Hawaii are likely to be incorrect. Morphology and the genetic markers showed that West
Atlantic and Red Sea animals belong to the same species,
and since Phallusia nigra is the only Phallusia species
Discussion
The detection of introduced species is not a trivial quest
and may be hampered by the lack of historical surveys in a
region to the date of arrival of a new species. Poor taxonomy has been recognized as a primary source of the nonrecognition of the introduced status of a species (Chapman
and Carlton, 1991). In some cases, isolated populations of a
widespread species are described as different “native” species; in others, similar species are named as one cosmopolitan invasive species (examples in Carlton, 2009). Ascidians
are a prevalent group of invaders in both tropical and
temperate marine habitats (Lambert, 2007; Pineda et al.,
2011), but invasions by this group are often difficult to
Figure 3. Geographic distribution of Phallusia nigra (black circles), P.
fumigata (gray squares), and P. philippinensis (white diamonds) (A) according to historical literature and (B) according to our results. Note that
most of the Pacific specimens are P. philippinensis rather than P. nigra,
which was found only in Singapore. All of our Atlantic samples are P.
nigra, as identified by morphology and molecular data. We had two
samples that had been identified as P. nigra from Greece, but genotyped as
P. fumigata.
60
L. E. VANDEPAS ET AL.
listed in the Red Sea (Shenkar, 2012) (type locality), there
is no doubt in the identification of Atlantic samples.
Given morphological distinctions and amounts of genetic
variance between Phallusia clades (between 0.2755 and
0.3288), we are confident that the three dark Phallusia
included in our study represent different species. Pairwise
distances have been used to analyze differences between
and within mitochondrial gene sequences to distinguish
ascidian species or confirm that individuals from multiple
sampling localities represent the same species (Nydam and
Harrison, 2010; Smith et al., 2012). Within-species variation of the dark Phallusia was relatively low (p-distances:
0.0053 for P. nigra, 0.0181 for P. fumigata, and 0.0941 for
P. philippinensis). It is interesting to note that P. nigra
specimens have the lowest p-distances between individuals
but the broadest geographical range of the dark Phallusia
(Red Sea, West Atlantic, and Singapore).
Although the original description of P. nigra from the
Red Sea (type locality) is very simple, a few characters
permit its identification: the brilliant black tunic, smooth
and without incrustations; the pattern of left body musculature; and the position of the atrial siphon in relation to the
intestinal loop (Savigny, 1816: 163, pl. II, fig 2; pl. IX, fig
1). Further, Monniot (1972) compared P. nigra specimens
from Bermuda and Suez Canal and found the only difference to be a lobed anus rim in the Suez samples, while the
Bermuda P. nigra had a smooth anus rim. The anus was
found to be lobed in P. nigra from both Panama and Brazil,
which is more similar to the characteristics of P. nigra from
the Suez Canal.
We report that although P. philippinensis is found exclusively in the Pacific, its geographical range may be increasing via human vectors. It was described from the Philippines, and in the same study Millar (1975) comments that
samples from Arafura Sea (Tokioka, 1952) and Singapore
resembled his specimens slightly. Kott (1985) did not agree
and created the species P. millari that accommodated both
Arafura and Singapore specimens. In 1997 this species was
collected again outside the Philippines, this time in Palau on
a boat hull (Monniot and Monniot, 2001). The first report in
Japan was by Hirose (1999) of animals collected in Ginowan Port Marina, Okinawa Island (as P. nigra in that
study). Previous monographs on ascidian fauna of Japan did
not mention any Phallusia species (Tokioka, 1963; Nishikawa, 1991). In Hawaii the first evidence of the presence
of a black ascidian is a picture taken in Pearl Harbor in the
1930s (Carlton and Eldredge, 2009). Abbott et al. (1997)
did not explicitly categorize the black Phallusia as introduced or invasive to the Hawaiian Islands, though others
have (De Felice et al., 2001). Recently (2011) P. philippinensis was collected from a pier in Magnetic Island, Australia. The species had already been listed by Kott (2005) in
the Great Barrier Reef (Queensland) as a junior synonym of
P. arabica, but her description of P. arabica shows many
differences between those species, mainly in the color of the
animal, muscular pattern, presence of a rectum dilation, and
a very lobed anus. Thus, it seems that the synonymy does
not hold and this is the first report of P. philippinensis in
Australia. Evidence accumulated up to this point (lack of
previous reports of this animal in well-studied areas and the
prominent presence of the species in marinas and on piers)
suggests that P. philippinensis is an introduced species in
most of its current known Pacific range (Hawaii, Palau,
Japan, and Australia).
The first report of P. nigra in the Mediterranean was by
Pérès (1958) for the Israeli coast, and the species seems to
have slowly spread toward the north since then. Recently
Izquierdo-Muñoz et al. (2009) reviewed the reports of introduced ascidians in the Mediterranean and concluded that
P. nigra occurred only in Israel, Lebanon, and Turkey.
Kondilatos et al. (2010) report the presence of P. nigra in
Rhodes Island, Greece, but they did not describe the specimens in sufficient detail for us to confirm this report. The
picture provided by Kondilatos et al. is more similar to P.
nigra than to P. fumigata, but the perils of identifying these
species by photographs are obvious. We did not obtain any
samples from the Mediterranean that were P. nigra; instead,
the samples that we sequenced from Greece were P. fumigata, although they were sent to us labeled as P. nigra,
which demonstrates the difficulty of identifying these darkly
pigmented Phallusia using external features (e.g., coloration). A study similar to what we have done in the Pacific
should be undertaken in the Mediterranean since P. nigra
seems to be slowly spreading from the initial establishment
in the Israeli coast. The single “P. nigra” cytochrome oxidase B sequence in GenBank (which is unpublished) is from
India and groups in our molecular trees with P. mammillata,
suggesting that this sequenced taxa may be another case of
mistaken ascidian identity.
The conspicuous dark tunic of these three darkly pigmented Phallusia species has likely induced researchers to
identify populations of P. philippinensis and P. fumigata as
P. nigra, because it is the most commonly known of the
three. Several studies discussing the occurrence of P. nigra
in the Pacific have used Abbott et al. (1997) as a taxonomic
guide. But the pattern of the body musculature, the position
of the siphons on their figure 11, and their comments that
juveniles and adults in shade lose the dark color clearly
show that they have misidentified the species. Hirose (1999)
and Hirose et al. (2001) also followed the description in
Abbott et al. (1997) to identify specimens and incurred the
same error. Of the darkly pigmented Phallusia, only P.
philippinensis adults change color when moved from shade
to light, wherein they become darker (Hirose, 1999). Juvenile individuals of P. nigra (less than 1.5 cm) are light gray
but rapidly acquire the characteristic black pigment and
never lose it (Van Name, 1945; RMR, pers. obs.).
61
BIOGEOGRAPHY OF PHALLUSIA NIGRA
At this point, we are unable to ascertain the native range
of either P. nigra or P. philippinensis. The fact that P. nigra
is found extensively throughout the western Atlantic Ocean
favors this region as its hypothetical native range, although
it was first described from the Red Sea. Considering the Red
Sea as its native region would indicate either a massive
recent Atlantic invasion without the colonization of most
Mediterranean coasts, or that this species had a much wider
distribution in the past with present locally extinct populations in the East Atlantic and Mediterranean. The fact that
most known populations of P. philippinensis can be recognized as introduced favors the Philippines as its hypothetical
native range. The more restricted geographical range of P.
fumigata indicates that this species is native to Europe,
though the disjunctive distribution between Atlantic and
Mediterranean populations suggests possible human regional transport (e.g., Turon et al., 2003). These hypotheses
should be further tested with population genetics on a global
scale (Rius et al., 2008; Pineda et al., 2011).
Previous to this paper there were no published genetic
resources for P. philippinensis and very few sequences (if
any) for P. nigra. P. philippinensis has also not previously
been included in a published phylogenetic tree. The three
darkly pigmented species (P. nigra, P. fumigata, P. philippinensis) form a clade that is a sister group to P. mammillata, which has a bumpy white tunic and occurs in more
temperate waters. Whatever the source of the dark pigment
found in the tunic (see Hirose, 1999), we believe that the
dark appearance of P. fumigata and P. philippinensis has led
to their misidentification as P. nigra in the Mediterranean
and in the Pacific, respectively. Our results suggest that both
P. nigra and P. philippinensis are transportable by human
vectors and should be monitored for new introductions in
the Pacific. Previous reports of P. nigra should be reviewed
to confirm the identification of the species. Genetic resources have been shown to be essential for confirmation of
provisional morphological identification (Darling and
Blum, 2007), and the sequence data from this study can
assist future identification efforts of the dark Phallusia
species.
Acknowledgments
This manuscript is dedicated to the memory of Charley
Lambert, who spent many years working on ascidians and
inspired many others to do so. The authors thank Xavier
Turon and Gretchen Lambert for many relevant discussions
about ascidian taxonomy and for references on Phallusia
fumigata. We also thank Gretchen Lambert for the collection and donation of P. nigra from the Eilat, Israel, gathered
by Noa Shenkar and the participants of an ascidian workshop. The workshop and Gretchen Lambert’s trip was sponsored by the Israeli Taxonomy Initiative. We thank Mari
Carmen Pineda for the collection and donation of specimens
(and 18S sequences) found at Magnetic Island, Australia;
Dr. Sébastien Darras at Université Pierre et Marie Curie for
photos of living Phallusia fumigata; and Dr. Chryssanthi at
Antoniadou, Aristotle University of Thessaloniki, for donation of Phallusia fumigata tissue samples. This collaboration was facilitated when the authors met at the Smithsonian
Tropical Research Institute in Bocas del Toro, Panama, in
2011 to teach in the NSF: PASI: Advanced Tunicate Biology: Integrating Modern and Traditional Techniques for the
Study of Ascidians. The course was funded by a National
Science Foundation (NSF) grant (OISE-1034665), to Director Rachel Collin. We thank the government of Panama for
permits for ascidian samples discussed in this manuscript.
This material is based in part upon work supported by the
National Science Foundation under Cooperative Agreement
No. DBI-0939454. This research was also supported by an
NSF grant (DEB 0816892) to BJS; NSF Graduate Research
Fellowship (DGE1256082) to LEV; “International Research
Hub Project” of University of the Ryukyus to EH; CNPq–
National Counsel of Technological and Scientific Development grant (304768/2010-3) to RMR; and a Master of
Science scholarship from CAPES—Coordenação de Aperfeiçoamento de Pessoal de Nı́vel Superior to LMO.
Literature Cited
Abbott, D. P., A. T. Newberry, and K. M. Morris. 1997. Reef and
Shore Fauna of Hawaii. Special Publications Bernice Pauahi Bishop
Museum Press, Honolulu, HI.
Abdul Jaffar Ali, H., and V. Sivakumar. 2007. Occurrence and distribution of ascidians in Viazhinjam Bay (southwest coast of India). J.
Exp. Mar. Biol. Ecol. 342: 189 –190.
Abdul Jaffar Ali, H., V. Sivakumar, and M. Tamilselvi. 2009. Distribution of Alien and Cryptogenic Ascidians along the Southern Coasts
of Indian Peninsula. World J. Fish. Mar. Sci. 1: 305–312.
Bock, D. G., H. J. MacIsaac, and M. E. Cristescu. 2012. Multilocus
genetic analyses differentiate between widespread and spatially restricted cryptic species in a model ascidian. Proc. R. Soc. Lond. B Biol.
Sci. 279: 2377–2385.
Bonnet, N., and R. Rocha. 2011. The Ascidiidae (Ascidiacea: Tunicata)
of Coastal Brazil. Zool. Stud. 50: 809 – 825.
Caputi, L., N. Andreakis, F. Mastrototaro, P. Cirino, M. Vassillo, and
P. Sordino. 2007. Cryptic speciation in a model invertebrate chordate. Proc. Natl. Acad. Sci. USA 104: 9364 –9369.
Carlton, J. T. 2009. Deep invasion ecology and the assembly of communities in historical time. Chapter 2, pp. 13–55 in Biological Invasions in Marine Ecosystems, G. Rilov and J. A. Crooks, eds. Ecological
Studies 204, Springer-Verlag, Berlin.
Carlton, J. T., and L. G. Eldredge. 2009. Marine Bioinvasions of
Hawai’i. Bishop Museum Press, Honolulu, HI.
Carman, M. R., S. G. Bullard, R. M. Rocha, G. Lambert, J. A.
Dijkstra, J. J. Roper, A. M. Goodwin, M. M. Carman, and E. M.
Vail. 2011. Ascidians at the Pacific and Atlantic entrances to the
Panama Canal. Aquat. Invasions 6: 371–380.
Chapman, J. W., and J. T. Carlton. 1991. A test of criteria for introduced species: the global invasion by the isopod Synidotea laevidorsalis (Miers, 1881) J. Crustac. Biol. 11: 386 – 400.
Çinar, M. E., M. Bilecenoglu, B. Öztürk, and A. Can. 2006. New
record of alien species on the Levantine coast of Turkey. Aquat.
Invasions 1: 84 –90.
62
L. E. VANDEPAS ET AL.
Darling, J. A., and M. J. Blum. 2007. DNA-based methods for monitoring invasive species: a review and prospectus. Biol. Invasions 9:
751–765.
De Felice, R. C., L. G. Eldredge, and J. T. Carlton. 2001. Nonindigenous invertebrates. Pp. B1–B60 in Guidebook to the Introduced Marine Species in Hawaiian Waters, L. G. Eldredge and C. Smith, eds.
Bishop Museum Press, Honolulu, HI.
Dupont, L., F. Viar, M. J. Dowell, C. Wood, and J. D. D. Bishop. 2009.
Fine- and regional-scale genetic structure of the exotic ascidian Styela
clava (Tunicata) in southwest England, 50 years after its introduction.
Mol. Ecol. 18: 442– 453.
Galil, B. S. 2007. Seeing red: alien species along the Mediterranean coast
of Israel. Aquat. Invasions 2: 281–312.
Harant, H., and P. Vernieres. 1933. Tuniciers. Faune de France 27: 1–93.
Hirabayashi, S., F. Kasai, M. M. Watanabe, and E. Hirose. 2006.
Contents of ultraviolet-absorbing substances in two color morphs of the
photosymbiotic ascidian Didemnum molle. Hydrobiologia 571: 419 –
422.
Hirose, E. 1999. Pigmentation and acid storage in the tunic: protective
functions of the tunic cells in the tropical ascidian Phallusia nigra.
Invertebr. Biol. 118: 414 – 422.
Hirose, E., H. Yamashiro, and Y. Mori. 2001. Properties of tunic acid
in the ascidian Phallusia nigra (Ascidiidae, Phlebobranchia). Zool. Sci.
(Tokyo) 18: 309 –314.
Hirose, M., S. Yokobori, and E. Hirose. 2009. Potential speciation of
morphotypes in the photosymbiotic ascidian Didemnum molle in the
Ryukyu Archipelago, Japan. Coral Reefs 28: 119 –126.
Iannelli, F., F. Griggio, G. Pesole, and C. Gissi. 2007a. The mitochondrial genome of Phallusia mammillata and Phallusia fumigata (Tunicata, Ascidiacea): high genome plasticity at intra-genus level. BMC
Evol. Biol. 7: 155.
Iannelli, F., G. Pesole, P. Sordino, and C. Gissi. 2007b. Mitogenomics
reveals two cryptic species in Ciona intestinalis. Trends Genet. 23:
419 – 422.
Izquierdo-Muñoz, A., M. Diaz-Valdes, and A. A. Ramos-Espla. 2009.
Recent non-indigenous ascidians in the Mediterranean Sea. Aquat.
Invasions 4: 59 – 64.
Katoh, K., and D. Standly. 2013. MAFFT multiple sequence alignment
software version 7: improvements in performance and usability. Mol.
Biol. Evol. 30: 772–780.
Kondilatos, G., M. Corsini-Foka, and M. A. Pancucci-Papadopoulou.
2010. Occurrence of the first non-indigenous ascidian Phallusia
nigra Savigny, 1816 (Tunicata: Ascidiacea) in Greek waters. Aquat.
Invasions 5: 181–184.
Kott, P. 1985. The Australian Ascidiacea. Part 1: Phlebobranchia and
Stolidobranchia. Mem. Queensl. Mus. 23: 1– 439.
Kott, P. 2005. Catalogue of Tunicata in Australian Waters [CDROM].
Available from Australian Biological Resources Study, PO Box 787,
Canberra, ACT 2601, Australia. P. 301 in Canberra: Australian Biological Resources Study.
Lambert, G. 2002. Nonindigenous ascidians in tropical waters. Pac. Sci.
56: 291–298.
Lambert, G. 2003. Marine biodiversity in Guam: the Ascidiacea. Micronesica 35/36: 584 –593.
Lambert, G. 2007. Invasive sea squirts: a growing global problem. J.
Exp. Mar. Biol. Ecol. 342: 3– 4.
Lee, S. S. C., S. L. M. Teo, and G. Lambert. 2013. New records of
solitary ascidians on artificial structures in Singapore waters. Mar.
Biodivers. Rec. 6: e93.
Lejeusne, C., D. G. T. Bock, T. W. Therriault, H. J. MacIsaac, and
M. E. Cristescu. 2011. Comparative phylogeography of two colonial
ascidians reveals contrasting invasion histories in North America. Biol.
Invasions 13: 635– 650.
López-Legentil, S., and X. Turon. 2006. Population genetics, phylo-
geography and speciation of Cystodytes (Ascidiacea) in the western
Mediterranean Sea. Biol. J. Linn. Soc. 8: 203–214.
Lopez-Legentil, S., R. Dieckmann, N. Bontemps-Subielos, X. Turon,
and B. Banaigs. 2005. Quantative variation of alkaloids in color
morphs of Cystodytes (Ascidiacea). Biochem. Syst. Ecol. 33: 1107–
1119.
Marks, J. A. 1996. Three sibling species of didemnid ascidians from
northern Norway: Didemnum albidum (Verrill, 1871), Didemnum polare (Hartmeyer, 1903), and Didemnum romssae sp.nov. Can. J. Zool.
74: 357–379.
Mendiola, J., H. S. Hernández, Idalia, L. Rojas, A. Otero, A. Ramı́rez,
M. de los Angeles Chávez, J. A. Payrol, and A. Hernández. 2006.
Antimalarial activity from three ascidians: an exploration of different
marine invertebrate phyla. Trans. R. Soc. Trop. Med. Hyg. 100: 909 –
916.
Michaelson, W. 1919. Ascidiae Ptychobranchiae und Diktyobranchiae
des Roten Meeres. Denkschriften Akademie Wissenschaften in Wien
95: 1–20.
Millar, R. H. 1965. Ascidians from the tropical coast of west Africa. Atl.
Rep. 8: 247–255.
Millar, R. H. 1975. Ascidians from the Indo-West-Pacific region in the
Zoological Museum, Copenhagen (Tunicata, Ascidiacea) Steenstrupia
3: 205–336.
Monniot, C. 1972. Ascidies phlébobranches des Bermudes. Bull. Mus.
Nat. Hist. Natur. 3e ser. 61: 939 –948.
Monniot, C., and F. Monniot. 1997. Records of ascidians from Bahrain,
Arabian Gulf with three new species. J. Nat. Hist. 31: 1623–1643.
Monniot, F., and C. Monniot. 2001. Ascidians from the tropical western Pacific. Zoosystema 23: 201–383.
Nishikawa, T. 1991. The ascidians of the Japan Sea II. Publ. Seto Mar.
Biol. Lab. 35: 25–170.
Nishikawa, T., I. Oohara, K. Saitoh, Y. Shigenobu, N. Hasegawa, M.
Kanamori, K. Baba, X. Turon, and J. D. Bishop. 2014. Molecular
and morphological discrimination between an invasive ascidian, Ascidiella aspersa, and its congener A. scabra (Urochordata: Ascidiacea).
Zool. Sci. (Tokyo) 31: 180 –185.
Nydam, M. L., and R. G. Harrison. 2010. Polymorphism and divergence within the ascidian genus Ciona. Mol. Phylogenet. Evol. 56:
718 –726.
Olson, R. R. 1986. Photoadaptations of the Caribbean colonial ascidiancyanophyte symbiosis Trididemnum solidum. Biol. Bull. 170: 62–74.
Pérès, J. 1958. Ascidies recoltées sur les côtes Méditerranéennes
d’Israel. Bull. Res. Counc. Isr. 7B: 143–150.
Pérez-Portela, R., and X. Turon. 2008. Cryptic divergence and strong
population structure in the colonial invertebrate Pycnoclavella communis (Ascidiacea) inferred from molecular data. Zoology 111: 163–178.
Pérez-Portela, R., V. Arranz, M. Rius, and X. Turon. 2013. Cryptic
speciation of global spread? The case of a cosmopolitan marine invertebrate with limited dispersal capabilities. Sci. Rep. 3: Article No. 3197.
Pineda, M., S. Lopez-Legentil, and X. Turon. 2011. The whereabouts
of an ancient wanderer: global phylogeography of the solitary ascidian
Styela plicata. PLoS One 6: e25495.
Rambaut, A. 2009. FigTree ver.1.3.1. [Online]. Available: http://tree.
bio.ed.ac.uk/software/figtree/ [2014, December 24].
Rius, M., M. Pascual, and X. Turon. 2008. Phylogeography of the
widespread marine invader Microcosmus squamiger (Ascidiacea) reveals high genetic diversity of introduced populations and non-independent colonizations. Divers. Distrib. 14: 818 – 828.
Rocha, R., N. Bonnet, M. Baptista, and F. Beltramin. 2012. Introduced and native Phlebobranch and Stolidobranch solitary ascidians
(Tunicata: Ascidiacea) around Salvador, Bahia, Brazil. Zoologia 29:
39 –53.
Rocha, R. M., S. B. Faria, and T. R. Moreno. 2005. Ascidians from
Bocas del Toro, Panamá. I. Biodiversity. Caribb. J. Sci. 41: 600 – 612.
BIOGEOGRAPHY OF PHALLUSIA NIGRA
Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574.
Savigny, J. C. 1816. Memoires sur les animaux sans vertebres. G.
Dufour, Paris, France.
Schlick-Steiner, B. C., B. Seifert, C. Stauffer, E. Christian, R. H. Crozier,
and F. M. Steiner. 2007. Without morphology, cryptic species stay in
taxonomic crypsis following discovery Trends Ecol. Evol. 22: 391–
392.
Shenkar, N. 2012. Ascidian (Chordata, Ascidiacea) diversity in the Red
Sea. Mar. Biodivers. 42: 459 – 469.
Shenkar, N., and B. J. Swalla. 2011. Global diversity of Ascidiacea.
PLoS One 6: e20657.
Shenkar, N., Y. Zeldman, and Y. Loya. 2008. Ascidian recruitment
patterns on an artificial reef in Eilat (Red Sea). Biofouling 24: 119 –128.
Smith, K. F., L. Stefaniak, Y. Saito, C. E. C. Gemmell, S. C. Cary, and
A. E. Fidler. 2012. Increased inter-colony fusion rates are associated
with reduced COI haplotype diversity in an invasive colonial ascidian
Didemnum vexillum. PLoS One 7: e30473.
Stefaniak, L., G. Lambert, A. Gittenberger, H. Zhang, and S. Lin.
2009. Genetic conspecificity of the worldwide populations of Didemnum vexillum Kott, 2002. Aquat. Invasions 4: 29 – 44.
Strayer, D. L., V. T. Eviner, J. M. Jeschke, and M. L. Pace. 2011.
Understanding the long-term effects of species invasions. Trends Ecol.
Evol. 21: 645– 651.
Subba Rao, D. V. 2005. Comprehensive review of the records of the
biota of the Indian Seas and introduction of nonindigenous species.
Aquat. Conserv. Mar. Freshw. Ecosyst. 15: 117–146.
Swalla, B. J., C. B. Cameron, L. S. Corley, and J. R. Garey. 2000.
63
Urochordates are monophyletic within the deuterostomes. Syst. Biol.
49: 52– 64.
Swofford, D. L. 2002. PAUP*: Phylogenetic Analysis Using Parsimony
(*and Other Methods). Sinauer Associates, Sunderland, MA.
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S.
Kumar. 2011. MEGA5: Molecular Evolutionary Genetics Analysis
using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28: 2731–2739.
Tarjuelo, I., D. Posada, K. A. Crandall, M. Pascual, and X. Turon.
2001. Cryptic species of Clavelina (Ascidiacea) in two different
habitats: harbours and rocky littoral zones in the northwestern Mediterranean. Mar. Biol. 139: 455– 462.
Tarjuelo, I., D. Posada, K. A. Crandall, M. Pascual, and X. Turon.
2004. Phylogeography and speciation of colour morphs in the colonial ascidian Pseudodistoma crucigaster. Mol. Ecol. 13: 3125–3136.
Tokioka, T. 1952. Ascidians collected by Messrs. Renzi Wada and Seizl
Wada from the pearl-oyster bed in the Arafura Sea in 1940. Publ. Seto
Mar. Biol. Lab. 2: 90 –141.
Tokioka, T. 1963. Contributions to Japanese ascidian fauna. XX. The
outline of Japanese ascidian fauna as compared with that of the Pacific
coasts of North America. Publ. Seto Mar. Biol. Lab. 11: 131–155.
Turon, X., I. Tarjuelo, S. Duran, and M. Pascual. 2003. Characterising invasion processes with genetic data: an Atlantic clade of Clavelina
lepadiformis (Ascidiacea) introduced into Mediterranean harbours. Hydrobiologia 503: 29 –35.
Van Name, W. G. 1945. The North and South American Ascidians, Vol.
84, Bulletin of the American Museum of Natural History. American
Museum of Natural History, New York.
64
L. E. VANDEPAS ET AL.
Appendix
Figure A1. Bayesian phylogenetic tree for 18S ribosomal DNA. There were few informative characters for
this gene (166 out of 1715 characters) and a lack of resolution within the phlebobranchs, which is why some
relationships within the Phallusia conflict with what was shown in the cytochrome oxidase B tree (Fig. 2).