From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Overexpression of HOXB4 Enhances the Hematopoietic Potential of
Embryonic Stem Cells Differentiated In Vitro
By Cheryl D. Helgason, Guy Sauvageau, H. Jeffrey Lawrence, Corey Largman, and R. Keith Humphries
Little is known about molecular
the
mechanisms controlling
primitive hematopoietic stem cells, especially during embryogenesis. Homeobox genes encode a family of transcription factors that have gained increasing attention as master
regulators of developmental processes and recently have
been implicated in the differentiation and proliferation of
hematopoietic cells. Several Hox homeobox genes are now
known t o be differentially expressed in various subpopulations of human hematopoietic cells and one such gene,
HOXB4, has recently been shown t o positively determine
the proliferative potential
of primitive murine bone marrow
cells, including cells with long-term repopulatingability. To
determine if this gene might influence hematopoiesisat the
earliest stages of development, embryonic stem (ES) cells
were geneticallymodified by retroviral gene transfer t o overexpress HOXR4and the effect on theirin vitro differentiation
was examined. HOX84 overexpression significantly increased the number of progenitors of mixed erythroidlmy-
eloid colonies anddefinitive, but notprimitive, erythroid colonies derived from embryoidbodies (EBs) at various stages
after induction of differentiation. There appeared t o be no
significant effect on thegeneration of granulocyticor monocytic progenitors, nor on the efficiency of EB formation or
growth rate. Analysis of mRNA from EBs derived from
HOXWtransduced ES cells on different days of primary differentiation showed a significant increase in adult P-globin
expression, with no detectable effect on GATA-1 or embryonic globin (pH-1). Thus, HOXB4 enhances the erythropoietic, and possiblymore primitive, hematopoietic differentiaES cells. Theseresults provide newevidence
tive potential of
implicating Hox genes in the control of very early stages in
the development ofthe hematopoietic system andhighlight
the utilityof the ES model for gaining insights into the molecular genetic regulation of differentiation and proliferation
events.
0 7996 by The American Society of Hematology.
T
and B cluster are expressed in distinct patterns related to the
functional capacities of the cell.'."' HOXBl is of particular
interest in this regard. The highest levels of expression were
found in the most primitive subpopulations of human hematopoietic cells, whereassignificantly lower levels of the transcript were detected in more mature committedprogenitors."
Studies withantisenseoligonucleotideshaveindicatedthe
importance of this gene, along with other B-cluster genes,
in the differentiation and proliferation of various clonogenic
cells from primitive populations of human BM cells."' Similarly, studies with murine BM transduced with a HOXB4
retrovirus showed enhanced proliferation of hematopoietic
cells, including cells with long-term repopulating ability."
Despite this recent progress in elucidating the importance o f
Hox genes in adult hematopoiesis, the role of these genes
in theontogeny of thehematopoieticsystemhasreceived
little attention.
As in the adult hematopoieticsystem, HOXBl is of interest
from adevelopmentalpoint of view. In situ hybridization
studies with murine embryos revealed expression in derivatives ofwhich
ultimately
the gives
rise
to
cells of the hematopoietic system and HOXBl mRNA has
also been observedin the fetal liver.'* These expressionstudies suggest thatafunctionmayexist
for this gene in the
development and differentiation of the hematopoieticsystem. However, it is difficult to evaluate the significance of
these observations in vivo becauseof the scarcity of the cells
of interest.
Embryonicstem (ES) cellsare totipotent cells derived
from the inner cell mass of the developing blastocyst. They
canbe maintained in vitro forextended periods, andcan
be genetically manipulated, without loss of their potential.
Importantly, ES cells can differentiate in vitro into embryoid
bodies (EBs) containinga variety of cell types,including
cells of thehematopoieticsystem'"'"
and thus providea
powerful model to study the processes involved in the establishment and differentiation of the hematopoietic system. A
second advantageof this system is that it permits the evaluation of gene function without concern for fetal lethality as
HE MOLECULAR mechanismsregulating the development and differentiation of the hematopoietic system
are not clearly understood. It is believed that a combination
of internal and external signals coordinately interact to induce self-renewal ordifferentiation of a pluripotent hematopoietic stem cell (HSC). Although little is known about the
genes involved in these processes, transcription factors are
likely to be essential regulators. The mammalian Hox family
of homeobox genes encode transcription factors that show
a strictly regulated pattern of expression during embryonic
and fetal development suggestive that,as for theHOM-C
genes in Drosophila, they are involved in controllingcell
fate.'-4
A role for the Hox genesin regulating adult bone marrow
(BM)hematopoiesisisbecoming
apparent.Expression of
genes from the A, B, and C clusters has been detected in a
variety of hematopoietic cell lines, as well as in a number
of leukemias.'" Recent studies with purified populations of
human CD34' BM cells showed that genes of both the A
From the Terry Fox Laboratory, British Columbia Cancer
Agency; the Department of Medicine, Universiry of British Colunbia, Vancouver, BC, Canada; and the Department of Veterans Affairs Medical Center and University of California, the Department
of Medicine, Sun Francisco.
Submitted June 20, 1995; accepted November 13, 1995.
Supported by the National Cancer Institute of Canadn (R.K.H.)
with funds from the Canadian Cancer Society and the Veterans
Affairs Research Service ( C L . and H.J.L.). C.D.H. is the recipient
of a Medical Research Council of Canada Postdoctoral Fellowship
and G.S. is U recipient of a Medical Research Council of Canada
Clinician Scientist Award.
Address reprint requests to R. Keith Humphries, MD, PhD, T e r q
Fox Laboratory, 601 W 10th Ave, Vancouver, BC, Canada V52 lL3.
The publicationcosts of this article were defrayed in part by page
charge payment. This article must therefore he hereby mnrked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1996 by The American Society of Hematology.
0006-4971/96/8707-0030$3.00/0
2740
Blood, Vol 87, No 7 (April 1). 1996: pp 2740-2749
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HOX64 ENHANCESESHEMATOPOIESIS
IN VITRO
exemplified by recent studies on the effect of "knocking
out" the vav proto-oncogene." Although the in vitro differentiation of ES cells could be used to identify extrinsic factors that regulate hematopoietic development, more success
has been achieved using this sytem to examine the roles of
various transcription factors, including rbtn2," GATA- l ,l9
and GATA-2,20in hematopoiesis.
To gain further insight into the possible roles of Hox genes
in developmental hematopoiesis, we turned to the ES model
and examined the effect of engineered overexpression of
HOXB4 in ES cells by retroviral transduction. We demonstrate marked enhancement in the generation of definitive
erythroid andmixed colony progenitors with no obvious
effect on the plating efficiency or growth of the ES-derived
embryoid bodies, and thus provide new evidence implicating
Hox genes in the control of very early stages of hematopoietic development.
MATERIALS AND METHODS
Cell culture. CCE ES cells (kindly provided byDr G. Keller,
National Jewish Center, Denver, CO) and EFC-1" ES cells (kindly
provided byDr A.G. Smith, Edinburgh Centre for Genomic Research, Edinburgh, UK) were maintained on gelatinized dishes in
Dulbecco's modified essential medium (DMEM) supplemented with
10%selected fetal calf serum (FCS), 4 mmoVL glutamine, 2X nonessential amino acids, 0.1 mmol/L 2-mercaptoethanol (Sigma Chemical CO,St Louis MO), and leukemia inhibitory factor (LIF) supplied
as a supernatant (prepared attheTerryFox
Lab) from Cos cells
transfecred with an LIF expression vector. Unless otherwise stated,
all reagents for cell culture and in vitro differentiation of ES cells
were purchased from StemCell Technologies Inc ([STI], Vancouver,
BC, Canada).
The ecotropic retroviral packaging cell line GPE + 86 was maintained in HXM medium consisting ofDMEM supplemented with
10% heat-inactivated (55°C for 30 minutes) newborncalf serum
(GIBCO-BRL Canada, Burlington, Ontario), 15 pg/mL hypoxanthine (Sigma), 250 pg/mL xanthine (Sigma), and 25 pg/mL mycophenolic acid (Sigma). Viral-producing cells were cultured in HXM
medium containing 1 mg/mL of the neomycin analog G418 (Sigma).
Unless otherwise specified, all cell culture was performed in humidified incubators at 37°C with a mixture of 5% CO2 in air.
In vitro differentiution of ES cefls and assay for hematopoieric
progenitors in developing embryoid bodies. The methods used for
the differentiation of ES cells and the quantitation of progenitors
within the EBs were essentially as described by Keller et al.'4 ES
cells used in these experiments were maintained in culture for less
than 15 passages. Forty-eight hours before differentiation, cells were
passaged at low density (5 X IO4 cells per 25-cm2 flask) in Iscove's
modified essential medium (IMDM) supplemented as described
above. Cells were obtained with 0.25% Trypsin-l mmol/LEDTA
(GIBCO-BRL), washed with IMDM containing 5% FCS, and were
suspended at 4 to 5 X IO3 cells/mL.
Methylcellulose for differentiation consisted of 0.8% cu-methylcellulose supplemented with 1% bovine serum albumin (BSA), 15%
selected FCS, 2.5 X
molL 2-mercaptoethanol (Sigma), 160
ng/mL Steel Factor (SF) supplied as a Cos-cell-derived supernatant,
and IMDM to volume. In certain experiments (see Fig 3), ES cells
were differentiated in 0.9% Iscove's methylcellulose supplemented
with 15% selected FCS, 450 pmoVL monothioglycerol (Sigma), 40
ng/mL SF supplied as a Cos-cell-derived supernatant, and IMDM
to volume. ES cells were added to the methylcellulose to yield a
final density of 300 to 500 cells/mL and 1.O-mL aliquots were distributed into 35-mm Petri-style dishes (STI). Cultures were fed at day
2741
8 or 10 of differentiation by layering 0.5 mL of 0.4% methylcellulose
containing recombinant human erythropoietin (Epo; 3 U/mL), SF
(Cos-supematant; 160 ng/mL), and either pokeweed mitogen-stimulated murine spleen cell conditioned medium (SCCM; 2%) or 30
ng/mL IL-3 plus 30 ng/mL IL-6 (both supplied as Cos cell supernatants) onto each dish. Primary plating efficiency was determined by
calculating the percentage of ES cells which formed EB (ie, number
ofEB formed divided by number ofES plated multiplied by 100
equals the percent plating efficiency).
At various stages of the primary differentiation EBs were procured
for replating in secondary methylcellulose cultures to detect hematopoietic progenitors. Before day 10, EBs were obtained, pelleted, and
treated with Trypsin-EDTA for approximately 2 minutes. EBs were
disrupted by passage through a 21-gauge needle and the cells were
pelleted and counted. After day 10, the isolated EBs were incubated
at37°C for 60 to 90 minutes in a solution of 0.25% collagenase
(Sigma) in phosphate-buffered saline (PBS) supplemented with 20%
FCS. Single-cell suspensions were prepared as described above. The
number of cells per culture was determined by dividing the total
cell yield by the number of primary differentiation cultures procured.
Cells were plated in either 0.8% a-methylcellulose (ST1 M3230)
or 0.9% Iscove's methylcellulose (ST1 M4100) supplemented with
3 U/mL Epo, 2% SCCM, 160 ng/mL SF, and IMDM. In some
experiments SCCM was replaced by combinations of cytokines supplied as supernatant from transfected Cos cells (Terry Fox Laboratories). Hematopoietic colonies were scored microscopically after
10 to 14 days using standard criteria." In some experiments isolated
colonies were plucked and centrifuged onto slides for cytological
analysis.
Retrovirul infection of ES cells. Retroviruses were constructed
using the MSCV 2.1 retroviral vectorz3(kindly provided byDr R.
Hawley, Sunnybrook Research Institute, Toronto, Ontario, Canada).
The human HOXB4 cDNA encompassing the entire coding region
(kindly provided in a plasmid by E. Boncinelli, Ospedale S. Faffaele,
Milan, Italy) was isolated and cloned into theXba 1 site directly
upstream of the pgk-neo' cassette by blunt-end ligation using standard
Stable polyclonal retroviral producer lines were
generated by calcium phosphate transfer of DNA (10 pg per construct) into GPE + 86 cells followed by selection with 1 rng/mL
G418 (GIBCO-BRL). The viral titers of the GPE + 86-pgk-neo'
and GPE + 86-HOXB4-pgk-neo' producer cells were determined by
transfer of G418 resistance toNIH 3T3 cellsz5 to be 3 to 5 X
IO6 colony-forming units (CFU)/mL and 3 to 5 X IO5 CFU/mL,
respectively.
Confluent plates of viral producers were incubated for 24 hours
in DMEM-10% FCS supplemented as for the ES cells, without LIF.
supernatants were collected, filtered through a 22-pm filter (Millipore, Bedford, MA), and supplemented with LIF and 2 pg/mL polybrene" before addition to the ES Cells.
Freshly passaged ES cells were resuspended at 5 X IO4 cells in
5 mL viral supernatant per 25-cm2 gelatinized flask and were incubated as usual with 1 or 2 changes of the viral supernatant over 24
hours. Adherent cells were rinsed with PBS and fresh medium was
added for a further 24-hour culture period. At 48 hours postinfection
ES cells were obtained and transferred to fresh flasks with 0.8 mg/
mL G418 (GIBCO-BRL). Polyclonal populations of G418-resistant
cells were expanded for further study. In all cases a mock-infected
(polybrene only) control was maintained.
To generate sublines from virally infected and parental cell lines,
25 or 50 cells were placed into individual gelatinized wells of a 96well plate. When colonies of ES cells were visible, cells were obtained and expanded as described above.
RNA extraction, cDNA synthesis, and polymerase chain reaction
(PCR) ampl$cation. Single-cell suspensions were derived from
parental, neo-transduced, or HOXBI-transduced ES cells at various
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HELGASON ET AL
2742
stages of the primary differentiation. In addition, pools of erythroid
(eight colonies) and GM or GEMM (four colonies) colonies were
plucked after 8 days in methycellulose. RNA extraction and cDNA
synthesis for each of these sample types were performed as described
previously.“9
PCR conditions (pH, magnesium, and KC1 concentrations. gene
32 protein) were optimized for first-strand cDNA synthesis. This
procedure has been shown to quantitatively preserve the differences
between frequent and rare transcripts over a wide range for cell
~
numbers ranging from 1,OOO to 1 0 . cells.‘‘
Southern blot ana/vsis. High-molecular-weight genomic DNA
was isolated from undifferentiated ES cells by standard procedures”
to determine the clonality of retrovirally infected ES cells. The DNA
was digested with either Ssr I, which cuts once in the viral LTRs to
release the proviral genome, or EcoRI, which cuts once in the proviral genome to release fragments unique to the integration site. The
digested DNA was separated on a 1% agarose geland passively
transferred onto an ionic nylon membrane (Zeta-probe; Bio-Rad.
Mississauga, Ontario, Canada). Similarly, IO-yL aliquots ofthe
PCR-amplified cDNA were electrophoresed and transferred.
Probes were labeled with ”P-dCTP (3,OOO Cilmmol: Amersham,
Oakville. Ontario, Canada) by random priming and were purified
on Sephadex-G50 columns (Pharrnacia Biotech, Uppsala, Sweden)
before use. Blots were hybridized for 20 hours at 65°C in 4.4X SSC
(SSC: 3 molL sodium chloride, 0.3 molL tri-sodium citrate), 7.5%
formamide, 0.75% sodium dodecyl sulfate (SDS), 1.5 mmol/L
EDTA, 0.75% skim milk powder. 370 ygImL salmon sperm DNA.
and 7.5% dextran sulfate. Membranes were washed twice at65°C
for 30 minutes each in 0.3X SSC, 0.1% SDS, and I mgImL sodium
pyrophosphate. To reprobe blots, they were stripped in a l % SDS
solution at 95°C for 20 to 30 minutes and tested for the absence of
a signal by overnight exposure toKodak X-OMAT XARSfilm
(Eastman Kodak. Rochester, NY).
Probes usedin these studies include the following: the HOXR4
full-length cDNA; an Xho IISal I fragment ofthe neo resistance
gene derived from pMC1Neo”; a 295-bp Sau3A-Acc I fragment of
&major globin encompassing the first exon and intron (provided by
P. LeBoulch, Massachusetts Institute of Technology, Boston); and
a 1.8-kb cDNA fragment of GATA-I isolated from the pXM-GATA1 expression vector (provided by S. Orkin, Howard Hughes Medical
Institute, Boston, MA). A 269-bp fragment of embryonic globin
(pH-I) to be used as a probe was PCR-amplified from the genomic
DNA of undifferentiated ES cells using the 5‘ primer-S’TTGTTACAGCTCCTGGGCAA3’ and the 3’ primer-S’CCCCAAAAAGTCAATGTTATTAAG3’. Similarly, a 98-bp cDNA fragment of HoxhR
was PCR-amplified using the 5’ primer-S’CCCAGCAGTAAATGCGAGCAG3’ andthe
3’ primer-5’AGCCTACTTCTTGTCACCCTT3 ’.
RNase protection. Total cellular RNA was isolated from undifferentiated ES cell populations using the TRIzol reagent (GIBCOI
BRL) and manufacturer’s instructions.
A template for RNase protection was prepared by subcloning a
256-nucleotide EcoRI-Apa I fragment of HOXR4 cDNA into a bluescript vector. The RNase protection assay was performed using standard techniques.” A control probe, protecting a 150-nucleotide fragment of mouse 0-actin. was used to ensure that equivalent amounts
of RNA were utilized for each sample.
RESULTS
Overexpression qf HOXB4 enhances the hematopoietic
diferenriation of CCE ES cells. To determine if Hox genes
might be regulators of hematopoiesis during ontogeny, undifferentiated CCE ES cells were transduced with either a
HOXB4 or a Neo (control) retrovirus by supernatant infec-
e
m
0
Q)
S
x
0
X
a
z
a
+
Actin
Fig l. Expression of HOXB4 from the retroviral LTR. Total RNA
was isolated from undifferentiated parental, neo-transduced. and
HOXBQtransducedCCE ES cells. RNase protection assays were performed using a HOX84 probe to demonstrate transcription from the
retroviral LTR. An actin probe was used to confirm the presence of
equivalent amounts of RNA in each sample.
tion. Figure I demonstrates expression of the HOXR4 message from the retroviral insert in undifferentiated ES cells.
Although there did not appear to be endogenous expression
of this gene in undifferentiated cells, the more sensitive RTPCR technique (detailed in Fig 4) suggests thatverylow
levels may be present at day 4 and day 8.
Parental cells and retrovirally transduced cells, selected
for G418 resistance, were differentiated in vitro as described.
No significant differences in the ability to form EBs in the
primary differentiation were detected among the three groups
yielding plating efficiencies of 3 . 0 % -+ 3.8% for parental,
46.1% -+ 1 5 8 % for Neo-transduced, and 32.6% 5 S.096 for
HOXB4-transduced cells (mean 2 SEM of four determinations). In addition, HOXB4 overexpression did not alter the
growth kinetics (number of cells per EB; not shown) or total
number of cells generated in these cultures (Fig 2). Thus,
HOXB4 altered neither the primary plating efficiency nor the
overall yield of cells during the primary differentiation.
Replating of these cells in conditions to detect hematopoietic progenitors showedthat for parental,neo-transduced,
and HOXB4-transduced cells the appearance of various hematopoietic progenitors followed a time course similar to
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HOXB4 ENHANCES ES HEMATOPOIESIS IN VITRO
2743
l
Fig 2. HOX64overexpressiondoes not change
the cell yield from primary dflercwrtiation cultures.
Equivalentnumbers (500) ofparental,neo-transduced, or HOX64-transduced CCEES cells were dfferentiated in methylcellulose for 8 to 20 days. No
significant differences in the number of EBs formed
were detected among
the three groups. At each time
point EBs were obtained and cell yields were determined for parental (-4, Neo-transduced (- -), and
cultures.Valuesare
the
HOXWtrensduced I-)
mean f SEM of four separate determinations.
8
14
that observed by others using the CCE cell line. However,
a pronounced influence of HOXB4 overexpression was seen
on the numbers of erythroid colony-forming (CFC-E) and
mixed-lineage (granulocyte/erythroidmacrophage/megakaryocyte; CFC-GEMM) progenitors detected (Fig 3). As
shown in two representative experiments (n = 6), there was
no obvious effect on the number of primitive (large, nucleated cells in small c~lonies'~)
erythroid progenitors detected
(day 7 or day 10). However, overexpression of HOXB4 increased the number of definitive erythroid colonies observed
at all time points examined between days 12 and 20 of the
CFC-E
CFC-GM
10
12
16
18
20
Days oi Plimsry Dllhnnliation
primary differentiation. There was also a marked increase in
the number of CFC-GEMM detected in HOXB4-transduced
cultures compared with either Neo-transduced or parental
controls. In contrast, overexpression of HOXB4 did not significantly affect the number of CFC-GM observed. Overall,
there was a slight increase in the total number of hematopoietic CFC throughout the primary differentiation.
The increase in definitive, but not primitive, erythropoiesis
was confirmed by quantitating each type of erythroid colony
at day 10 and day 12 when the increase was first observed.
On both days there was no significant difference in the num-
CFC-GEMM
Total CFC
Days of Primary Differentiation
Fig 3. HOXB4 overexpression enhances the hematopoietic differentiation of CCE ES cells. Equivalent numbers of parental (-4,Nso-transCCEES cells were differentiated in methylcellulose for various periods oftime. EBs were obtained
duced (- -1, or HOXBQtransduced (-1
in the presence of3 U/mL Epo and160 ng/mL SF supplemented
and single-cell suspensions were
plated in secondary methylcellulose cultures
with 30 ng/mL interleukin-3 (IL-3) plus 30 ng/mL IL-6. Results from two representative experiments (total of six) are shown.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HELGASON ET AL
2744
A
day 0
day 4
day 8
"
"
-
day 1 2
day 18
B
PE
PNB4PNEMPNB4PN84PNB4
day 12
day 8
dE
N B4 B4 B4
HOXB4
GM GEMM
B4 B4 B4
.~...
Hoxb8
HOD4
pHlglobin
PH1-globin
blobin
@globin
GATA-1
Actin
Fig 4. Expression of various genes in EBs isolated on different days of primary differentiation. Total RNA was isolated from either 50,000
cells derived from parental (P), neo-transduced(NI, or HOXWtransduced ( 8 4 ) CC€ EBs at various stages ofthe primary differentiation (A) or
from pools of eight erythroid or fourG M or GEMM colonies (B). Sampleswere reverse transcribedand PCR-amplifiedto generate representative
total cDNA populationswhich were electrophoresed and blotted. The resultant Southern blots were hybridized to probes for HOXB4, Hoxb8,
pH-1 globin, adult P-globin, GATA-1, and actin as described.
ber of primitive erythroid colonies detected in neo- or
HOXB4-transduced cultures (376 ? I 15 v 493 ? 156; mean
? SEM of four determinations). In contrast, HOXB4-transduced cells gave rise to 1,534 2 245 definitive erythroid
colonies per culture on day 12 compared with 290 t 44 per
culture arising from neo-transduced cells. A similar, though
less pronounced, difference was also observed on day IO.
The identity of the colonies scored as primitive or definitive
was confirmed by plucking and pooling individual colonies
to examine globin expression patterns. These experiments
confirmed that the primitive erythroid colonies expressed
primarily pH-I globin, whereas colonies scored as definitive
erythroid expressed primarily adult &globin (Fig 4B).
Table 1 summarizes the results from six experiments comparing the ratios of progenitors detected in HOXBCtransduced cultures to those initiated with parental or Neo-transduced cells in the various experimental conditions after 14
days or 16 days of primary differentiation. Conditions for
the detection of hematopoietic progenitors were varied
throughout the course of the study to optimize the system and
to confirm the specificity of the HOXB4 effect. Regardless of
whether a defined cytokine cocktail or SCCM was used for
the detection of hematopoietic progenitors similar magnitudes of difference were observed between HOXB4-trans-
duced and control cells. However, greater numbers of progenitors were observed for all groups in the former plating
condition, especially in the CFC-E and total CFC compartments. For example, at day 14 the number of erythroid progenitors detected ranged from 316 to 1,840 per culture in
the parental cell line. The range was 138 to 1,030 on day
16. Similar magnitudes of variationwere observed in all
progenitor types on both days regardless of whether parental,
neo-transduced, or HOXB4-transduced cells were used. Ratios compared to parental controls were calculated within
individual experiments to enable comparison. This analysis
showed a twofold to threefold increase in CFC-E atboth
day 14 ( P S .05) and day 16 ( P = .05). CFC-GEMM were
increased sixfold above controls in HOXB4-transduced cells
at both time points ( P S .05 at day 14 and P S . 0 1 at day
16 compared with Neo-transduced cells). Overexpression of
HOXB4 increased total numbers of hematopoietic CFC twofold ( P = .05 on day 14 and P s . 0 5 on day 16 compared
with Neo-transduced cells), with no significant differences
in the numbers of CFC-GM detected.
Cytospin analysis was performed on colonies derived from
day 14 primary differentiation cultures of Neo-transduced and
HOXB4-transduced CCE ES cells to confirm colony identification bawd on in situ scoring. Analysis of 46 randomly plucked
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HOXB4 ENHANCES ES HEMATOPOIESIS IN VITRO
2745
Table 1. Increased Numbersof CFC-E and CFC-GEMM Are Detecteda t Days 14 and 16 of Primary Differentiationin Cultures initiatedWith
HOXBQTransduced ES Cells
Progenitors Relative to Parental ES
Grouo
CFC-E
CFC-GM
CFC-GEMM
Total CFC
Day 14
Neo-transduced
HOXB4transduced
0.96 -C 0.11
2.19 i 0.37'
0.93 t 0.12
1.32 f 0.42
1.09 i 0.22
5.94 t 1.74*
0.90 f 0.13
1.95 +- 0.34'
Day 16
Neo-transduced
HOXB4transduced
0.89 2 0.13
3.48 -C 0.70*
0.85 i 0.10
1.05 i 0.12
0.93 i 0.20
6.56 -C 0.72t
0.84 i 0.13
1.88 ? 0.22*
Equivalent numbers of parental, Neo-transduced, or HOXB4transduced CCE ES cells were differentiated in m (n = 4) orIscove's (n = 2)
methylcellulose for 14 or 16 days. EBs were obtained and single-cell suspensions were plated in secondary methylcellulose cultures in the
presence of 3 U/mL Epo and 160 ng/mL SF supplemented with either 2% SCCM (n = 2) or 30 ng/mL IL-3 plus 30 ng/mL IL-6 (n = 4) to detect
hematopoietic progenitors. Values presented are the ratio of progenitors, compared with parental, detected in Neo-transduced or HOXB4
transduced cultures. Statistical analysis to compare populations was performed using a Student's t-test.
P S .05, t P S ,001 compared with Neo-transduced ratios.
colonies derived from HOXB4-transdud cells showed that 27
(59%) were mixedgranulocyte/erythroid/mmphage/megakaryocyte (GEMM), 12 (26%) were megakaryocyte-*id
or eryh i d , and 7 (15%) were pure granulocyte/macrophage (GM).
In contrast,only 7 of 22colonies(32%)arisingfrom
Nee
transduced cells were multilineage (GEMM), while
9% (2 of
22) were erythroid or erythroid-megakaryocyte and the remainder (13 of 22; 59%) were GM. Thus, this examination showed
that both cultures contained a variety ofhematopietic cells and
confirmed the enhanced number of erythroid and multilineage
colonies observed in HOXB4-transduced cultures. No cells with
abnormal morphology were detected in the HOXB4 cultures.
Total cellular RNA was isolated at various stages of the
primary differentiation from EBs derived from parental,
Neo-transduced, and HOXB4-transduced ES cells. After reverse transcription and PCR-amplification, the total cDNA
samples were analyzed by Southern blot analysis. Results of
a representative hybridization (n = 2) withavariety
of
probes are presented in Fig 4A.
HOXB4 expression was detectable at very low levels in
the EBs at day 4 and day 8 of differentiation. As expected,
higher levels of HOXB4 were detected in the HOXB4-transduced population at all times. Interestingly, there was an
apparent upregulation of expression at later time points
(compare day 8 levels with day 12; Fig 4A), possibly because
of increased transcription from the viral LTR in differentiated cells. We examined levels of HOXB4 expression from
the viral LTR in various colony types by plucking colonies,
isolating RNA, and generating cDNA. As shown in Fig 4B,
expression levels were very high in colonies scored as definitive erythroid, GM, and GEMM. Although somewhat lower
levels were detectable in primitive erythroid colonies, these
levels were still markedly higher than endogenous HOXB4
levels, which were virtually undetectable.
Adult @-globinexpression was first observed at day 8 of
the primary differentiation, with levels increasing greatly
between day 8 and day 12. A pronounced enhancement of
expression was observed in the HOXB4-transduced cells.
More impressively, this difference was still readily apparent
at day 18. Thus, there wasa correlation between the in-
creased @-globinexpression in the primary cultures and the
enhancement of erythropoiesis observed after replating of
the HOXB4-transduced CCE cell line. In contrast, overexpression of HOXB4 had little or no effect on the levels of
embryonic @H-l globin, GATA-1, or Hoxb8, a gene 5' to
Hoxb4, detected in the differentiating EBs.
Hematopoietic progenitors of the EFC-I ES cell line are
increased by overexpression of HOXB4. To r d e out that
the results obtained with the CCE ES cells were cell-line
specific, similar studies were performed with EFC-1 ES cells
transduced with either a HOXB4 or a Neoretrovirus. Quantitative examination of the hematopoietic differentiation of
this line showed a timecourse which resembled that of CCE.
Similar to the observation with the CCE cell lines, HOXB4
overexpression altered neither the plating efficiency (25.4%
? 2.6%,16.6% t 1.5%, and24.5% t 3.3% for parental,
neo-transduced, and HOXB4-transduced cells, respectively;
mean 2 SEM for three separate determinations) nor the cell
yield (for example, day 14 of primary differentiation cell
yields were [ X 10'1: parental, 11.8 2 1.2; Neo-transduced,
9.6 2 1.0; and HOXB.l-transduced,11.7 ? 0.3; mean ?
SEM for three separate determinations).
EBs derived fromtheparentalandtransducedEFC-Icell
lines were dismpted at day
14 ofprimarydifferentiationand
cells were plated for detection of progenitors. As observed with
the CCE ES cells, HOXB4-transduced EFC-l cells gave rise to
anincreasednumberofdefinitiveerythroid
CM3 andCFCGEMM leading to anincrease in the total number of hematopoietic precursors detected (Fig 5A). No significant differences in
the number of CFC-GM were observed among the three lines.
Five sublines were generated from each of the three populations to assess whether the observations might be attributed
to clonal variations within the EFC-1 cell line. Selection of
unique populations was confirmed by Southern blot analysis
to examine retroviral integration sites (Fig 6). RNase protection was used to verify expression of HOXB4 from the viral
LTR in each of the sublines (Fig 7).
All sublines were differentiated in a manner similar to the
polyclonal populations and the number of hematopoietic CFC
present at day 14 was examined by replating in secondary meth-
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HELGASON ET AL
2746
A
Fig 5. Overexpression of
HOXB4 enhances thehematopoietic
differentiation
of
the
EFC-l ES cell line. Polyclonal
populations of parental (01,neolanil56
I
Total CFC
7
m
Subline
ylcellulosecultures(Fig5B).
As for the CCE cellline,the
enhancement of hematopoiesis appearedto be restricted to CFCE and CFC-GEMM with a fivefold increase in the number of
erythroid progenitors ( 1,296 t 155 v 250 2 3 1;P 5 .OO1;mean
2 SEM of five sublines) and a %fold increase in the number
of CFC-GEMM (161 2 36 v 3.1 2 2.2; P S .05; mean t SEM
of five sublines) detected in the HOXB4-transduced cell lines
compared with the neo-transduced cell lines. There was no significant effecton granulocyte-macrophage progenitor (CFC-GM)
numbers. Overall there wasa marked increasein the total number
of hematopoietic CFC detected.
DISCUSSION
There is increasing evidence that Hox genes are involved
in regulating the maintenance andor differentiation events
duced (El) EFC-1 EScells (500 per
culture)weredifferentiated
in
methylcellulose t o give rise t o
EBs that were obtained at day
14. Single-cell suspensions were
plated insecondary methylcellulose cultures in the presence of
3 UlmL Epo, 160 nglmL SF, and
2% SCCM t o detect hematopoietic progenitors (A). Results are
expressed as the mean t SEM
of duplicatedishes in two experiments. Sublines were generated fromeach of the polyclonal
populations and each of these
sublines (five per group) was differentiated in the same manner
as thepolyclonal populations.
CFC-erythroid, CFC-GM,
CFCGEMM, and total CFC (B) were
detected byplating single-cell
suspensions derived fromday 14
EBs in methylcellulose supplemented as described forthe
polyclonal
population.
Results
are expressed as the mean t
SEM for duplicate dishes in two
independent experiments. The
values above each set of sublines are the mean? SEM for the
five sublines. Significance was
determined using the two-tailed
Student's t-test: * P S .001; * * P
S .02; ***P S .005.
within the hematopoietic system. Of particular interest is
HOXB4, which is expressed in the mesoderm and fetal liver
at stages that correlate with hematopoietic development and
differentiation during embryogenesis. In the adult hematopoietic system, HOXB4 is expressed in the more primitive
subpopulations of human CD34' BM cells and its expression
is downregulated in more mature subpopulations? Studies
with murine BM transduced with a HOXB4 retrovirus suggest that this gene enhances the proliferative potentialof
hematopoietic cells, including the self-renewal capacity of
HSCs, in vivo." Interestingly, there was no apparent effect
on differentiative processes and overexpression did not lead
to leukemogenesis. In light of these provocative findings
with adult BM, we examined the role of HOXB4 on the
earliest stages of development and differentiation of the he-
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HOXB4 ENHANCESESHEMATOPOIESIS
IN VITRO
2747
Fig 6. Southern blot analysis of retroviral integration into the EFC-1 subline. EFC-1 ES cells were infected with a retrovirus containinga neo' gene with
or without theHOXB4 cDNA.Infected cells were selected in the presence of G418 and DNA was isolated
from parental, neo-transduced, and HOX84-transduced undifferentiated ES cells. The DNA was cutso
as t o release either the provirus (Sst I digest) or t o
cut once within the viral genome t o show sites of
viral integration (EcORI digest). Blots were probed
with a single-copy gene, the erythropoietinreceptor,
t o normalize DNA levels in each lane (internal).
21kh
-
3.9 kb
-
27kb
-
2.O kh
-
Internal
-
matopoietic system by inducing overexpression in ES cell
lines.
Under the culture conditions used in these studies, both
the CCE and the EFC-I ES cells differentiated efficiently to
give rise to hematopoietic progenitors detectable as early as
day 8. In accordance with previous studie~'~.''.'~
the earliest
progenitors detected gave rise to colonies with the morphology typical of the primitive erythroid lineage (small colonies
of large, nucleated cells). Throughout the time course of
differentiation of both cell lines there was a gradual switch
from primitive to definitive erythropoiesis. This switch corresponded with the appearance of myeloid progenitors (CFCGM and CFC-GEMM). Mast cell progenitors (included
within the CFC-GM determinations) were predominant at
the latest time points examined (days 18 to 20). The numbers
of definitive erythroid and myeloid progenitors detected were
similar to those reported We
by
detected fewer
primitive erythroid precursors, possibly because of the use
of FCS rather than plasma-derived serum in the secondary
methylcellulose cultures.
Overexpression ofHOXB4
significantly enhanced the
number of hematopoietic progenitors detected atvarious
times in the ES differentiation cultures. However, in sharp
contrast to its effects in adult BM. HOXU4 expression elicited selective enhancement of specific pools within the ES
cell hematopoietic compartment. Although there was no apparent influence on the primitive (yolk-sac like) erythroid
progenitors, this lack of effect might be attributed to comparatively low levels of HOXU4 expression from the viral LTR
in this cell population. However, because the level of engineered expression was considerably higher than endogenous
expression (compare day 8 primitive erythroid of neo-transduced and HOXB4-transduced, Fig 4B) it seems likely that
HOXB4 does notinfluence erythropoiesis at this stage of
differentiation. In contrast, the numberof definitive erythroid
(CFC-E) and myeloiderythroid (CFC-GEMM) progenitors
was significantly increased. The relative lack of effect on
CFC-GM progenitors suggests that the most significant consequence of constitutive HOXB4 expression is the enhanced
proliferation of a common pluripotent precursorthat has
differentiated from the pure myeloidpathwaytoward the
erythroid lineage.
neo-transduced
HOXB4-transduced
parental
M
1
2
3
4
S
P
5.8
1
2
3
4
5
P
1
2
3
4
S
HOXB4
-
Actin
Fig 7. RNase protection detects HOXB4expression from theviral LTR in EFC-1 ES cells. Total RNA
was
isolated
from
undifferentiated
parental, neotransduced, and HOXB4transduced EFC-1ES cells.
RNase protection assays were carried out using a
HOXB4 probe or an actin probe as described for
Fig 1.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HELGASON ET AL
2748
Our observation that the erythroid lineage is most significantly enhancedmight reflect therelative developmental stages of the populations examined. In contrast
to the adult BM-derived populations used previously, it
has been suggested that ES-derived hematopoietic progenitors are equivalent in properties to yolk-sac or early
fetal liver population^.^",^' Because transcription factors
are thought to functionin a coordinated mannerto generate a cascade of events leading to phenotypic changes
in the cells of interest,” it may only be the ES-derived
definitive erythroid andmultilineageprogenitorsthat
possess the accessory molecules required
for a phenotypicresponse to H O X B 4 overexpression. The lack of
effect on CFC-GMsuggests that these progenitors do
not express the necessary cofactors required to induce a
proliferative or differentiative response. Alternatively,
differences between the in vivo environment and that of
isolated stem cells may be reflected by changes in either
cell-surface molecules or responsiveness to external
stimuli that influence the capacity of a cell for proliferation in a specific lineage. It may be possible to use these
differences between the progenitors to elucidate the molecular events involved in the H O X B 4 response. However, further clarification of this point awaits the identification and isolation of the hematopoietic stem cell(s)
generated in ES differentiation cultures.
Studies of genes expressed in differentiating EBs correlate
with the observation of enhanced erythropoiesis in HOXB4transduced ES cells. Expression of the erythroid-specific
gene adult /?-globin was dramatically increased in HOXB4transduced cells, raising the possibility that HOXB4 is involved its transcription. Although this may be a direct effect,
it is also possible that HOXB4 alters the transcription of
other factors, including other Hox genes, involved in controlling /?-globin expression. Despite the fact that few cellular
targets of Hox genes have been identified,’3 there is ample
evidence to suggest that cross-regulation amongst the various
proteins may be important for their
Preliminary
results of expression levels in EB suggest that overexpression of HOXB4 does not influence the low level of expression of the more 5‘ gene Hoxb8 at any time during the
differentiation time course (Fig 4A). Despite this observation, the effect of altered HOXB4 expression on the transcription of other Hox genes in relevant cell populations is certainly one avenue that must be explored when it becomes
possible to isolate pure hematopoietic populations from differentiated EB.
We have determined that constitutive HOXB4 expression
in ES cells leads to enhanced proliferation of erythroid and
mixed erythroid/myeloid progenitors without a reduction in
granulocyte/macrophage progenitor yield. These findings
suggest a predominantly proliferative effect of HOXB4 rather
than one impacting on lineage commitment as observed previously for adult BM. However, differences in both the stage
and lineage-specificity of the effects observed in the two
systems suggest that the in vitro differentiation of ES cells
may provide a system to study the role of Hox proteins in
blood development as well as a means for elucidating, at the
molecular level, some of the mechanisms by which this family of regulatory proteins influence hematopoiesis.
ACKNOWLEDGMENT
The authors thank Patty Rosten and
technical assistance.
Chris R. Simms tor expert
REFERENCES
I . Graham A, Papalopulu N, Krumlauf R: The murine and drosophila homeobox gene complexes have common features of organization and expression. Cell 57:367, 1989
2. McGinnis W,KrumlaufR:Homeobox
genes andaxial patterning. Cell 68:283, 1992
3 . Kenyon C: If birdscanfly,why
can’t we? Homeotic genes
and evolution. Cell 78: 175, 1994
4. Krumlauf R: Hox genes in vertebrate development. Cell
78:191, 1994
5. Lawrence HJ, Largman C: Homeobox genes in normal hematopoiesis and leukemia. Blood 80:2445, 1992
6. Lawrence HJ, Stage KM, Mathews CHE, Detmer K, Scibienski
R, MacKenzie M, Migliaccio E, Boncinelli E, Largman C: Expression of Hox C homeobox genes in lymphoid cells. CellGrowth
Different 4:665, 1993
7. Petrini M, Quaranta MT, Testa U, Samoggia P, Tritarelli E,
Care A, Cianetti L, Valtieri M, Barletta C, Peschle C: Expression
of selected human HOX-2 genes in BIT acute lymphoid leukemia
and interleukin-2/interleukin-I P-stimulated natural killer lymphocytes. Blood 80:185, 1992
8. Lawrence HJ, Sauvageau G, Ahmadi N, Lopez AR, LeBeau
MM, Link M, Humphries K, Largman C: Stage- and lineage-specific
expression of the HOXAIO homeobox gene in normal and leukemic
hematopoietic cells. Exp Hematol 23:1160, 1995
9. Sauvageau G, Lansdorp PM, Eaves CJ, Hogge DE, Dragowski
WH, Reid DS, Largman C, Lawrence HJ, Humphries, RK: Differential expression of homeobox genes in functionally distinct CD34’
subpopulations of humanbonemarrow cells. Proc NatlAcad Sci
USA 91:12223, 1994
10. Giampaolo A, Sterpetti P, Bulgarini D, Samoggia P, Pelosi
E, Valteri M, Peschle C:Key functional role and lineage-specific
expression of selected HOXB genes in purified hematopoietic progenitor differentiation. Blood 84:3637, 1994
1 1. Sauvageau G, Thorsteinsdottir U, Eaves CJ, Lawrence HJ,
Largman C, Lansdorp PM, Humphries RK: Overexpression of
HOXBl in hematopoietic cells causes the selective expansion of
more primitive populations in vitro and in vivo. Genes Dev 9:1753,
1995
12. Graham A, Papalopulu N, Lorimer J, McVey JH, Tuddenham
EGD, Krumlauf R: Characterization of a murine homeobox gene,
HOX-2.6,related to drosophila deformed gene. Genes Dev 2:1424,
1988
13. Holland PWH, Hogan BLM: Expression of homeo box genes
during mouse development: A review. Genes Dev 2:773, 1988
14. Keller G, Kennedy M, Papayannopoulou T, Wiles MV: Hematopoietic commitment during embryonic stem cell differentiation
in culture. Mol Cell Biol 13:473, 1993
15. Schmitt RM, Bruyns E, Snodgrass HR: Hematopoietic development of embryonic stem cells in vitro: Cytokine and receptor gene
expression. Genes Dev 5:728, 1991
16. Wiles MV: Embryonic stem cell differentiation in vitro, in
Wassarman PM, DePamphilis ML (eds): Methods in Enzymology,
v01 225. San Diego, CA, Academic, 1993, p 900
17. Zmuidzinas A, Fisher K-D, Lira SA, Forrester L, Bryant S.
Bernstein A, Barbacid M: The vav proto-oncogene is required early
in embryogenesis but not for hematopoietic development in vitro.
EMBO J 14:1, 1995
18. Warren AJ, Colledge WH, Carlton MBL, Evans MJ, Smith
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HOXB4 ENHANCES ES HEMATOPOIESIS IN VITRO
2749
AJH, Rabbitts TH: The oncogenic cysteine-rich LIM domain protein
rbtn2 is essential for erythroid development. Cell 78:45, 1994
19. Weiss MJ, Keller G, Orkin SH: Novel insights into erythroid
development revealed through in vitro differentiation of GATA-1embryonic stem cells. Genes Dev 8:1184, 1994
20. Tsai F-Y, Keller G, Kuo FC, Weiss M, Chen J, Rosenblatt
M, Alt F W , Orkin SH:An early haematopoietic defect in mice
lacking the transcription factor GATA-2. Nature 371:221, 1994
21. Nichols J, Evans EP, Smith AG: Establishment of germ-line
competent embryonic stem (ES) cells using differentiation inhibiting
activity. Development 110:1341, 1990
22. Humphries RK, Eaves AC, Eaves CJ: Self-renewal of hemopoietic stem cells during mixed colony formation in vitro. Proc Natl
Acad Sci USA 78:3629, 1981
23. Hawley RG, Fong AZC, Bums BF, Hawley TS: Transplantable myeloproliferative disease induced in mice by an interleukin-6
retrovirus. J Exp Med 176:1149, 1992
24. Davis L, Kuehl M, Battey J: Subcloning fragments into plasmid vectors and plasmid construction, in Davis LG, Kuehl
Battey JF (eds): Basic Methods in Molecular Biology. Norwalk, C T ,
Appleton and Lange, 1994, p 277
25. Cone RB, Mulligan RC: High efficiency gene transfer into
mammalian cells: Generation of helper-free recombinant retrovirus
with broad mammalian host range. Proc Natl Acad Sci USA 81:6349,
1984
26. Lovell-Badge RH: Introduction of DNA into embryonic stem
cells, in Robertson El (ed): Teratocarcinomas and Embryonic Stem
Cells: A Practical Approach. Oxford, UK, IRL, 1987, p 153
27. Davis L, Kuehl M, Battey J: Preparation of genomic DNA, in
Davis LG, Kuehl WM. Battey JF (eds): Basic Methods in Molecular
Biology. Norwalk, CT, Appleton and Lange, 1994, p 305
28. Thomas KR, Cappechi MR: Site-directed mutagenesis by
WM.
gene targeting in mouse embryo-derived stem cells. Cell 51503,
1987
29. Davis L, Kuehl M, Battey J: Preparation and analysis of RNA
from eukaryotic cells, in Davis LG, Kuehl WM, Battey JF (4s):
Basic Methods in Molecular Biology, Norwalk, CT, Appleton and
Lange, 1994, p 319
30. Chen U: Careful maintenance of undifferentiated mouse embryonic stem cells, in Compans RW, Cooper M, Koprowski H,
McConnell I, Melchers F, Nussenweig V, Oldstone M, Olsnes S ,
Potter M, Saedler H, Vogt PK, Wagner H, Wilson I (4s): Current
Topics in Microbiology and Immunology, v01 177. Berlin, Germany,
Springer-Verlag, 1992, p 3
3 1. Burkert U, von Ruden T, Wagner E F Early fetal development
from in vitro differentiated embryonic stem cells. New Biologist
3:698, 1991
32. Orkin SH: Transcription factors and hematopoietic development. J Biol Chem 270:4955, 1995
33. Edelman GM, Jones FS: Outside and downstream of the homeobox. J Biol Chem 268:20683, 1993
34. Zappavigna V, Renucci A, Izpisua-Belmonte J-C, Urier G,
Peschle C, Duboule D: HOX4 genes encode transcription factors
with potential auto- and cross-regulatory capacities. EMBO J
104177, 1991
35. Popper1 H, Featherstone MS: An autoregulatory element of
the murine Hox-4.2 gene. EMBO J 11:3673, 1992
36. Capovilla M, Brandt M, Botas J: Direct regulation of decapentaplegic by ultrabithorax and its role in drosophila midgut morphogenesis. Cell 76:461, 1994
37. Zappavigna V, Sartori D, Mavilio F: Specificity of HOX
protein function dependsonDNA-protein and protein-protein
interactions, both mediated by the homeo domain. Genes
Dev
8:732,1994
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1996 87: 2740-2749
Overexpression of HOXB4 enhances the hematopoietic potential of
embryonic stem cells differentiated in vitro
CD Helgason, G Sauvageau, HJ Lawrence, C Largman and RK Humphries
Updated information and services can be found at:
http://www.bloodjournal.org/content/87/7/2740.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.