MAJOR ARTICLE
The virB Operon Is Essential for Lethality of
Brucella microti in the Balb/c Murine Model
of Infection
Nabil Hanna,1,2,3 Maria Pilar Jiménez de Bagüés,4 Safia Ouahrani-Bettache,1,2,3 Zoubida El Yakhlifi,1,2,3
Stephan Köhler,1,2,3 and Alessandra Occhialini1,2,3
1Université
Montpellier I, Centre d'études d'agents Pathogènes et Biotechnologies pour la Santé (CPBS); 2CNRS, UMR 5236, CPBS, F-34965;
Montpellier II, CPBS, F-34095, Montpellier, France; and 4Unidad de Sanidad Animal, Centro de Investigación y Tecnologa Agroalimentaria,
Gobierno de Aragón, 50059 Zaragoza, Spain
3Université
In murine infections, Brucella microti exhibits an atypical and highly pathogenic behavior resulting in
a mortality of 82%. In this study, the possible involvement of the virB type IV secretion system, a key virulence
factor of Brucella sp., in this lethal phenotype was investigated.
As previously described for B. suis, expression of the virB operon of B. microti was induced in acid minimal
medium, partially mimicking intracellular environment. Early neutralization of cellular compartments
abolished intracellular replication of B. microti, showing that acidity of the Brucella-containing vacuole is an
essential trigger. A DvirB mutant of B. microti exhibited strong attenuation in murine and human macrophages
in vitro. Interestingly, infection with this mutant was not lethal in Balb/c mice and lacked the typical
intrasplenic peak at 3 days post-infection, hence demonstrating that lethality of B. microti in murine infection
absolutely requires a functional virB operon.
Brucellae are gram-negative, facultative intracellular
coccobacilli, pathogenic for a variety of mammals
among which ruminants and humans. These bacteria
are the etiological agents of brucellosis, a major zoonotic
disease characterized by a worldwide distribution.
Brucellosis results in sterility and abortion in animals
and in ‘‘Malta fever’’ in humans, an undulant fever associated with severe fatigue that, if untreated, can develop into a chronic infection with severe complications
including endocarditis, osteoarthritis, and neurological
damage [1].
Received 22 September 2010; accepted 17 November 2010.
Potential conflicts of interest: none reported.
Reprints or correspondence: Alessandra Occhialini, PhD, CPBS, UMR 5236, 1919
Route de Mende 34293 Cedex 5, Montpellier, France (alessandra.occhialini@
cpbs.cnrs.fr).
The Journal of Infectious Diseases 2011;203:1129–35
Ó The Author 2011. Published by Oxford University Press on behalf of the Infectious
Diseases Society of America. All rights reserved. For Permissions, please e-mail:
[email protected]
1537-6613/2011/2038-0001$15.00
DOI: 10.1093/infdis/jiq163
The recent isolation of the new Brucella species
Brucella microti from the common vole [2, 3], red fox
[4], and soil [5] in Central Europe raises the problem of
an eventual reemergence of brucellosis in Europe. To
date, the potential pathogenicity of this fast-growing
Brucella species for livestock and humans remains
unknown. In a recent work, we have shown that
B. microti is able to replicate inside human and murine
macrophage-like cells at least as well as the other
Brucella species pathogenic for humans [6]. In contrast
to all other Brucella species, B. microti exhibits a high
pathogenic potential in experimental murine infections
[3, 6]. Indeed, injection of a standard dose of bacteria
into mice (105 colony-forming units [CFUs]), results in
death of 82% of the animals within 4 days, followed
by rapid clearing of the bacteria from the mice that
survived.
As in other gram-negative pathogenic bacterial genera
(Agrobacterium, Bordetella, Helicobacter, and Legionella),
the Type IV Secretion System (T4SS) encoded by the
virB operon is a key virulence factor of Brucella spp [7,
8]. The T4SS are multi-proteic complexes involved in
B. microti Infection is virB-dependent
d
JID 2011:203 (15 April)
d
1129
translocation of nucleic acids and/or effector proteins across the
bacterial cell envelope [7]. In cultured host cells and in murine
models of infection, the virB operon is essential for intracellular
survival and multiplication of B. suis [8] B. abortus [9], and
B. melitensis [10].
The aim of this work was to investigate the possible role of the
virB operon of B. microti in the establishment of macrophage
infections and in the lethal outcome of murine infections. Thus,
the expression of the virB operon of the sequenced strain of
B. microti CCM 4915 was first analyzed in various media and
compared with expression of virB in B. suis 1330. The behavior
of a virB mutant of B. microti was then compared with that of the
wild-type and of a complemented mutant in cellular and murine
models of infection.
MATERIALS AND METHODS
Bacterial Strains and Media
The two Brucella reference strains used were B. microti CCM
4915 and B. suis 1330. Escherichia coli DH5a (Invitrogen) were
used for cloning and plasmid production. Brucella and E. coli
strains were grown in Tryptic Soy (TS) and Luria Bertani broth
(Invitrogen), respectively. When necessary, kanamycin and
ampicillin were added to a final concentration of 50 lg/mL. The
Gerhardt Minimal Medium (GMM) adjusted to pH 4.5 and
pH 7 was used for expression studies and survival assays [11].
Preparation of Nucleic Acids and Determination of in Vitro
Expression of virB
Genomic DNA used as template in polymerase chain reaction
(PCR) was isolated from overnight cultures in TS broth. For
RNA extraction, 1 mL of overnight cultures were centrifuged,
washed twice with phosphate-buffered saline, resuspended in
4 mL of GMM at pH 4.5 or pH 7.0, and incubated for 10
minutes and for 3 h, at both pH values. RNA was extracted using
the Qiagen RNeasy kit and treated with DNase I (Ambion).
Complementary DNA was produced using a 6-mer random
primers mix, as described earlier [12], and quantitative RT-PCR
was performed using the Light Cycler 480 (Roche). Primers in
virB8 (BRA0062/BMI_II64) were selected to study the expression of the virB operon. Gene BR1035/BMI_I1038, encoding
a hypothetical protein constitutively expressed at acid and
neutral pH, was used to normalize expression values for virB8
(N. Hanna et al., unpublished results).
Construction of virB Mutants of B. suis and B. microti
The mutants were obtained by replacing an internal portion of
the target gene by a kanamycin resistance gene inserted in the
opposite direction to its coding sequence. In order to delete the
promoter region and part of the virB1 gene (P1virB) of the virB
operon of B. suis and B. microti, a 1752-bp fragment covering
part of the transglycosylase gene (BR0070), upstream of the virB
1130
d
JID 2011:203 (15 April)
d
Hanna et al.
operon, and including the P1virB as well as the entire virB1 gene,
was amplified by PCR from the genomic DNA of each strain
with primers BR0070-For and virB1-Rev (Sigma Genosys)
(Table 1). The PCR fragment was inserted into the pGEM-T easy
vector (Promega). The resulting plasmid was digested by BssHII
to delete a DNA fragment including the P1virB- and the 5’-region
of virB1, and treated with T4-DNA-polymerase. The deleted
fragment was replaced by the kanamycin resistance gene, excised
from plasmid pUC4K using HincII. To generate virB operon
mutants, the resulting plasmid (non-replicative in Brucella) was
introduced into B. suis and B. microti by electroporation. To
select for allelic exchange mutants, the KanR colonies were
checked for sensitivity to ampicillin. Homologous exchange in
KanR/AmpS clones was validated by PCR (Table 1). Similarly,
a second mutant was created by replacing a DraI/AgeI fragment
containing the P1virB-region, the virB1 gene and the promoter 2
(P2virB)-region with the kanamycin cassette. The complemented
DvirB strain was obtained by integration of the suicide vector
pUC18 (Promega) carrying the complete virB operon controlled
by its own promoter. A 12-kbp DNA fragment, containing
the virB operon region (from virB1 to virB12) with its own
promoter regions, was amplified by PCR using the long-extend
and high-fidelity Platinum Taq polymerase (Invitrogen) with
virB-op_SacI-For and virB-op_XbaI-Rev primers (Table 1).
DvirB1 mutants containing the plasmid with the functional virB
operon integrated into the chromosome were selected on the
base of their KanR and AmpR phenotype.
Macrophage Infection Experiments with Brucella Strains
Experiments were performed as described previously using
murine J774A.1 macrophage-like cells at a multiplicity of
infection (MOI) of 20 bacteria per cell [13]. All experiments
were performed at least 3 times in triplicate. For the neutralization experiments, 30 mM NH4Cl was added at 90 min after
the beginning of infection with B. suis and B. microti, as
Table 1. Oligonucleotides Used In This Study
Oligonucleotide
Sequence (5’- 3’)a
BR0070-For
virB1-Rev
CTGAAGCGCTATAACAATGC
TTGTGTTAGAGCGCATCCTG
virB2-Rev
TTACCTAAGCAGGTAAGAGGC
virB-op_SacI-For CGCGAGCTCTAGCTGAAATCCAGGCGTTGAGATC
virB-op_XbaI-RevGCTCTAGATTATGGCAGCCTAGAGCATTTCCAG
KanaR For
GGATTCAGTCGTCACTCATGG
KanaR Rev
CCATGAGTGACGACTGAATCC
virB8-qRT-For
TGACGAAGCGTTGAACTGGGA
virB8-qRT-Rev GTAGCTGACACTCTTCTCGTC
BR1035-qRT-For TCTTCTACGACATGCCAAAGC
BR1035-qRT-RevAAAGCCCGGTTTCTTTCATCG
NOTE. a Restriction sites are underlined, and nonhomologous regions are
indicated by bold type.
described earlier [14]. Infected but untreated cells were analyzed
in parallel.
Infection of Balb/c Mice with B. microti Strains
Established and approved animal-experimentation guidelines
were followed in mouse experiments. All animals were females,
8–9 weeks-old (Charles River Laboratories). Bacterial suspensions were prepared as described elsewhere [15]. In a first experiment, 3 groups of 10 Balb/c mice were infected
intraperitoneally (i.p.) with 105 CFUs of the wild-type, the
DP1virB-DvirB1 mutant and the complemented strains of B.
microti, respectively. The mortality of each group was observed
until 14 days post-infection. In a second set of experiments, 104
CFUs of wild-type and DvirB mutant were injected i.p. into 2
groups of Balb/c (18 animals per group). Six infected mice per
strain were sacrificed on days 2, 3, and 7, respectively. Blood and
spleens were collected aseptically from mice upon euthanasia by
CO2 asphyxiation. Spleens were harvested, weighed, homogenized, serially diluted, and plated onto TS agar for viable counts
of Brucella. Level of bacteremia was also determined by plating
serial dilutions of whole EDTA-treated blood. Statistical analysis
of the results was carried out as previously reported [6].
RESULTS
Figure 1. Time-dependent effect of the neutralization by NH4Cl of
cellular compartment of murine J774 macrophage-like cells on
intracellular survival of B. microti CCM4915 and B. suis 1330. During
the course of infection, macrophages infected by B. microti (filled circle)
or B. suis (filled triangle) remained untreated, or were treated with 30 mM
NH4Cl at 90 minutes after the beginning of infection by B. microti
(open circle) or B. suis (open triangle). The number of colony forming
units (CFUs) was determined by plating serial dilutions on TS agar plates
and incubation at 37°C for 2 or 3 days for B. microti and B. suis,
respectively. The experiments were performed 3 times in triplicate each.
Data are presented as mean values 6 standard deviation of one
experiment.
Early Neutralization of Vacuolar pH by Ammonium Chloride
Inhibits Replication of B. microti in J774 Macrophages
It has been shown that the early acidification is essential for
survival of B. suis within the macrophage [14]; one possible
explanation being the observation that the expression of the
essential virulence factor VirB is induced at acid pH in this
pathogen [16]. To compare the intracellular behavior of B.
microti and B. suis after neutralization of intracellular compartments at 90 minutes post-infection, parallel infection experiments were performed and the multiplication of bacteria
was monitored over a period of 48 h. For both strains, intracellular replication was inhibited at 24 and 48 h post-infection
in cells treated with ammonium chloride, as opposed to infection of untreated cells (Figure 1). These results showed that,
as for B. suis, the early acidification of the Brucella-containing
vacuole was absolutely required for the intracellular multiplication of B. microti.
The Expression of virB of B. microti is Acid-inducible in Minimal
Medium
Similar to what has been observed for B. suis, the virB genes of
B. microti are strongly induced in acidified GMM (pH 4.5) after
3 h of incubation, as shown for virB8 (Figure 2). The same
results were obtained for expression of virB1 and virB4 (data not
shown). With B. suis, B. microti is therefore the second Brucella
species whose virB operon is inducible by nutrient stress at
pH 4.5 [18].
The DvirB Mutant of B. microti is Attenuated in the Macrophage
Host Cell
To explore the role of VirB of B. microti in cellular and murine
models of infection, two virB operon mutant strains were
obtained: the first mutant by replacement of the P1virB promoter
region and the 5#-fragment of virB1 by a kanamycin resistance
cassette, the second by replacement of the chromosomal
fragment containing the P1virB, virB1 [19] and P2virB promoter
region located between virB1 and virB2 [20, 21]. In parallel, the
same approach was used to construct the two virB-mutants of B.
suis as controls. The resulting recombinant plasmids were
named pKDP1virB-DvirB1 and pKDP1virB-DvirB1-DP2virB. The
successful inactivation of the operon by insertion of the kanamycin resistance gene in the opposite direction of the virB genes
was verified by PCR amplification of the region containing the
kanamycin resistance gene, followed by DNA-sequencing. The
DvirB mutants were complemented with a single copy of the
intact virB-operon by co-integration of the suicide plasmid
pUC18 carrying the complete virB operon controlled by its
native promoter into the inactivated chromosomal virB region.
There were no detectable differences in the growth rates of the
wild-type, the DvirB mutant and the complemented strain in TS
medium (not shown).
In J774 murine macrophage-like cells, the DvirB mutants of
B. microti and B. suis were both attenuated. At 48 h post-infection,
B. microti Infection is virB-dependent
d
JID 2011:203 (15 April)
d
1131
7
20
6
18
Brucella / well (log10 CFUs)
Relative transcription GMM4/GMM7
22
16
14
12
10
8
6
4
5
4
3
2
1
2
0
0
B. suis
B. microti
2
7
24
48
Time post infection (hours)
Figure 2. Relative transcription levels of virB8 in B. suis (BRA0062) and
in B. microti (BMII_64) in Gerhardt minimal medium pH 4.5 (GMM4.5)
versus Gerhardt minimal medium pH 7.0 (GMM7). Brucella strains were
incubated for 10 minutes (open bars) or for 3 h (hatched bars) in GMM4.5
and in GMM7. Relative virB8-transcription levels in acid versus neutral
minimal medium were determined by the method of relative fold change
as described previously [17]. The 2-DDCt values correspond to the ratio of
the amount of virB8 transcription product (target) in GMM4.5 (test
samples) normalized to the endogenous reference, over the normalized
amount of virB8 transcription product in GMM7 (control samples).
Relative fold change (GMM4.5/GMM7) 5 2-DDCt, where DCt (Target
gene) 5 Ct (Target gene)-Ct (Reference gene) and DDCt (Target gene) 5
DCt (GMM4.5)-DCt (GMM7). The target and the reference genes were
virB8 and BR1035/BMI_I1038, respectively.
a 103 - 104-fold reduction in the number of viable intracellular
bacteria of the mutant strains was observed, as compared with
the respective wild-type strains (Figure 3). In contrast, the
complemented DvirB strain of B. microti was characterized by
a wild-type-like phenotype, restoring its capacity of intracellular
replication. Very similar results were obtained in infection
experiments with human THP1 macrophage-like cells and using
the virB mutant deleted in P1virB-virB1 or simultaneously in
P1virB-virB1 and the P2virB promoter region (not shown).
The virB Operon of B. microti Is Essential for Infection and Death
of Balb/c Mice
Recently, we demonstrated that the intra-peritoneal injection of
105 CFU of B. microti causes the death of 82 % of the Balb/c mice
within four days of infection [6]. To investigate the eventual role
of the virB operon in the lethal outcome of a B. microti infection,
the susceptibility of Balb/c mice infected with the DP1virBDvirB1 strain was compared with that observed following infection by the wild-type or the complemented strain. At 15 days
post-infection, 100% (10 out of 10) of the mice infected with the
DvirB strain had survived to infection without any noticeable
symptoms following the intra-peritoneal injection of 105 CFU of
the bacteria. In contrast, 80% (8 out of 10) and 70% (7 out of
10) of the mice infected with the wild-type or the complemented
strain, respectively, died as a consequence of infection.
1132
d
JID 2011:203 (15 April)
d
Hanna et al.
Figure 3. Intracellular multiplication of B. microti CCM4915 wild-type
(filled circle), DP1virB2DvirB1 (open circle), and DP1virB2DvirB1
complemented strain (filled square) in murine J774 macrophage-like
cells. The complemented strain was obtained by integration of the suicide
plasmid pCU18 carrying the complete virB operon controlled by its
own promoter. The intracellular behaviour of B. suis 1330 is shown in
parallel for the wild-type (filled triangle) and the DP1virB2DvirB1 mutant
(open triangle). The experiments were performed 3 times in triplicate
each. Data are presented as mean values 6 standard deviation of one
experiment.
A comparison of the infection kinetics with sub-lethal doses
(104 CFU) of the B. microti wild-type versus the virB mutant
strain indicated approximately 50-100-fold lower numbers of
viable virB mutants in the blood and spleen of the mice at 2 and
3 days post-injection. The wild-type strain obviously succeeded
in a significantly better colonization of these tissues than the
mutant defective in the T4SS. In the blood, despite a significantly higher load of wild-type B. microti, kinetics of both
strains were similar over the experimentation period of 7 days,
including clearing at day 7 (Figure 4A). In the spleen, the
number of B. microti wild-type bacteria was 60-fold higher than
that of the virB mutant during the initial phase of infection,
despite a statistically non-significant increase of the latter at
3 days post-infection (Figure 4B). Between days 3 and 7, however, the elimination rate of the wild-type was significantly
higher than that of the mutant strain. This observation was in
agreement with the significant increase of the spleen weight over
the same period of time in mice infected with the wild-type
strain, indicating the specific setup of an inflammatory response
resulting in this enhanced elimination (Figure 4C).
DISCUSSION
Brucellosis is considered as a reemerging though neglected
zoonosis, as human disease due to the classical species persists
and expands in endemic areas, and emerges in other regions,
Figure 4. Growth and survival of B. microti CCM4915 wild-type (filled circle), and DP1 virB2D virB1 (filled triangle) in blood (A) and in spleens
(B) of Balb/c mice, following i.p. inoculation of 104 bacteria. The number of viable bacteria was determined at 2, 3, and 7 days post infection. Spleen
weights have been determined in parallel (C). Six mice were killed per strain and time point, and values represent means 6 SD.
such as the Balkans, Bulgaria, and South Korea. Four new
species have been described in the past few years: Brucella ceti,
Brucella pinnipedialis, B. microti, and Brucella inopinata [22].
While the pathogenicity of some of the new Brucella species
for livestock and humans is unknown, we showed recently that
B. microti exhibits a high pathogenic potential in cellular and
murine models of infection: (1) it multiplies faster in culture
media and in macrophage cells than any other species of
Brucella; (2) it shows a higher resistance to acid pH than B. suis
1330; (3) unlike all other Brucella species studied, it kills 82% of
Balb/c or CD1 and C57BL/6 mice at 4-7 days after the i.-p.
injection of a bacterial dose of 105 or 106 CFU, respectively [6].
The specific mechanisms and molecular determinants linked to
intramacrophagic multiplication of this new species and to lethality in murine models of infection are, however, yet unknown. In previous experiments on a sample of 8 ICR mice
(5 females, 3 males), a death rate of 50% has been reported [3].
Dead animals revealed intense bacteremia, enlarged lymph nodes, and a peritoneal exudates. Infective doses and modes of
injection were, however, different between both reports.
In a first approach to the understanding of the strategies set up
by B. microti as compared with those known from other Brucella
species, notably B. suis, we investigated 2 key aspects of
intracellular virulence: the role of an eventual acid pH in the
early Brucella-containing vacuole and of the T4SS VirB, encoded
in the B. microti genome [23]. Experiments of early neutralization of intracellular compartments clearly demonstrated that
acid pH of the immediate B. microti-environment was an essential trigger for intracellular replication of the pathogen, as
previously described in B. suis [14]. This new species therefore
apparently adopted mechanisms similar to those described in
other brucellae, pathogenic for humans, with respect to
adaptation to the host cell. Interestingly, and in contrast to
B. suis, B. microti is able to actively grow at a pH as low as 4.5
(A. Occhialini et al., unpublished data). This property may give
an additional advantage to B. microti, allowing growth to start
rapidly following phagocytosis by macrophage-like cells (this
paper and [6]).
The T4SS encoded by the virB operon is the most-studied and
best-characterized virulence factor of Brucella. T4SS are multicomponent protein structures used by many gram-negative
bacterial pathogens of animals (Bordetella pertussis, Helicobacter
pylori, Legionella pneumophila) and plants (Agrobacterium tumefaciens) for the translocation of protein and/or DNA effectors
into eukaryotic host cells [7]. Brucella species require a T4SS for
intracellular survival and persistent infection: virB mutants of B.
B. microti Infection is virB-dependent
d
JID 2011:203 (15 April)
d
1133
abortus, B. melitensis and B. suis, affected in the synthesis of the
T4SS apparatus and in its insertion into the bacterial envelope,
loose their ability to multiply in mammalian cells [8, 9, 10, 24] or
in infected mice [25, 26]. The sequences of the virB operon of B.
microti and of B. suis 1330 are almost identical [23]. In fact, their
comparative sequence analysis via BLASTP shows that 6 out of
12 proteins (VirB1, 3, 6, 7, 8, and 9) are absolutely identical,
3 proteins contain 1–3 replacements each by similar amino acids
(VirB2, 4, 5) and the remaining 3 (VirB10, 11, 12) are characterized by 1 amino acidic replacement each. To date, the only
described effectors of the T4SS of B. abortus and B. suis are VceA
and VceC, identified using a CyaA-reporter system [20]. The
corresponding genes are coregulated with the virB genes via
VjbR [19, 20, 21]. While the sequences encoding these proteins
are present in the genomes of all sequenced Brucella strains including B. microti, their biological functions are unknown.
In B. abortus and B. suis, 3 transcriptional regulators have
been described to activate virB expression: IHF, the integration
host factor [27], HutC, the transcriptional repressor of the
histidine utilization genes [28], and VjbR, the LuxR-family
Quorum sensing regulator [19, 20, 21]. The 345-bp DNA sequence in the B. microti genome upstream of virB1, and the
intergenic region between virB1 and virB2, known as the 2
promoter regions of the virB operon, are absolutely identical to
the corresponding regions in the genomes of B. abortus and B.
suis 1330. The specific and conserved DNA binding sites previously identified for the 3 virB regulators mentioned above
[19, 20, 27, 28] are thus also present in B. microti. Therefore, our
experimental results are in agreement with those expected, based
on DNA sequence comparison.
Here, we have shown that the virB operon of B. microti was
essential for the intracellular replication of B. microti. Interestingly, a virB mutant of B. microti behaved as the wild-type
strain until 7 h post-infection, starting intracellular replication
due to its capacity to grow at low pH. This short period of growth
most likely corresponds to the lag-phase prior to the formation of
the replicative niche for the wild-type, or the occurrence of
phagosome-lysosome fusion for the mutant strain [29].
An important aspect of this work was to determine whether
the intracellular replication of B. microti observed within macrophage host cells was an essential prerequisite for the lethal
outcome of B. microti infection in the murine model. Having
evidenced the crucial role of a functional VirB system in intramacrophagic replication of B. microti, the isogenic DP1virB2
DvirB1 mutant was used to study this aspect. We confirmed that
the capacity of intramacrophagic replication was indispensable
for a lethal effect of B. microti on Balb/c mice at an infection dose
of 105 CFUs injected i.p. Under sublethal experimental conditions, mice infected with the virB mutant were characterized
by 50–100-fold lower bacterial loads in the blood and in the
spleen than mice infected with the wild-type strain. A combination of intramacrophagic growth of the wild-type, coupled to
1134
d
JID 2011:203 (15 April)
d
Hanna et al.
extracellular growth in the blood or the spleen tissues following
macrophage lysis may explain this observation. The wild-type
strain, however, was eliminated more rapidly from the spleen
than the virB mutant, indicating the setup of an inflammatory
reaction in mice infected with the wild-type strain, possibly due
to the higher bacterial load following initial intramurine multiplication. The slower elimination of B. suis mutant strains from
Balb/c mice was also reported previously [18, 30]. The observed
lethal phenotype may therefore be the consequence of increased
replication leading to increased lysis of infected macrophages
and high loads of circulating bacteria, rapidly overwhelming the
host immune system, or resulting directly in septic shock.
Another important conclusion from this work is the observation that the well-studied secretion system VirB, known to be
central in virulence also of other Brucella species pathogenic for
humans, could be used as a model virulence factor to confirm
the usefulness of the lethal phenotype in mice as an unambiguous criterion for B. microti virulence. This phenotype
gives a new dimension to the classical murine model of infection
and will be undoubtedly of great value in future identifications
of B. microti virulence factors in vivo: potential virulence genes
may be easily identified as such a few days only after murine
infection, without the necessity to perform comparative enumeration of intrasplenic bacteria.
Despite the higher growth rate and the lethal phenotype of
B. microti in infected mice, its genome sequence is almost
identical to that of B. suis 1330, with near-perfect colinearity of
chromosomes and an overall sequence identity of 99.84% in
aligned regions [23]. Slight differences in the chromosome sequences (point mutations, deletions, and insertions of a few
nucleotides) may be responsible for the presence of yet unidentified specific virulence determinants or for an altered gene
expression, and may explain the atypical behavior of B. microti
in cellular and murine models of infection. The data presented
in this work indicated that several characteristic properties
linked to virulence, such as acid pH as a triggering signal and the
presence of a functional VirB system, were conserved in this
species. Future work will therefore focus on a better understanding of increased acid resistance and enhanced growth
rate of B. microti. Although infection of mice by B. microti is not
characterized by the persistence typical for some classical Brucella species leading to chronicity of brucellosis [31], a potential
risk for humans or livestock during an eventual acute infection
with high doses of this bacterium cannot be excluded. Moreover,
it would be interesting to compare the behavior of B. microti in
cellular and murine models of infection with that of the new,
also fast-growing species Brucella inopinata, isolated only from
a few human cases yet [32, 33].
Funding
This work was supported by 2008 PEPS and 2010-2012 PICS programs
from the Centre National de la Recherche Scientifique (CNRS), and by
grant 2006-0070 INIA RTA from Spain. This study was conducted during
the two years of CNRS delegation granted to AO. NH was supported by
a PhD grant from the Lebanese CNRS.
Acknowledgments
We thank Philippe Clair (Plateforme Quantitative PCR, IFR 122,
University of Montpellier II) for technical assistance in qRT-PCR and
Virginie Lafont for helpful discussion. We also thank Holger C. Scholz for
providing access to preliminary B. microti sequence data.
References
1. Franco MP, Mulder M, Gilman RH, Smits HL. Human brucellosis.
Lancet Infect Dis 2007; 7:775–86.
2. Scholz HC, Hubalek Z, Sedlacek I, et al. Brucella microti sp. nov.,
isolated from the common vole Microtus arvalis. Int J Syst Evol
Microbiol 2008; 58:375–82.
3. Hubalek Z, Scholz HC, Sedlacek I, Melzer F, Sanogo YO, Nesvadbova J.
Brucellosis of the common vole (Microtus arvalis). Vector Borne
Zoonotic Dis 2007; 7:679–87.
4. Scholz HC, Hofer E, Vergnaud G, et al. Isolation of Brucella microti
from mandibular lymph nodes of red foxes, Vulpes vulpes, in lower
Austria. Vector Borne Zoonotic Dis 2009; 9:153–6.
5. Scholz HC, Hubalek Z, Nesvadbova J, et al. Isolation of Brucella microti
from soil. Emerg Infect Dis 2008; 14:1316–7.
6. Jimenez de Bagues MP, Ouahrani-Bettache S, Quintana JF, et al. The
new species Brucella microti replicates in macrophages and causes death
in murine models of infection. J Infect Dis 2010; 202:3–10.
7. Cascales E, Christie PJ. The versatile bacterial type IV secretion systems.
Nat Rev Microbiol 2003; 1:137–49.
8. O’Callaghan D, Cazevieille C, Allardet-Servent A, et al. A homologue of
the Agrobacterium tumefaciens VirB and Bordetella pertussis Ptl type IV
secretion systems is essential for intracellular survival of Brucella suis.
Mol Microbiol 1999; 33:1210–20.
9. Sieira R, Comerci DJ, Sanchez DO, Ugalde RA. A homologue of
an operon required for DNA transfer in Agrobacterium is required in
Brucella abortus for virulence and intracellular multiplication. J Bacteriol
2000; 182:4849–55.
10. Lestrate P, Dricot A, Delrue RM, et al. Attenuated signature-tagged
mutagenesis mutants of Brucella melitensis identified during the acute
phase of infection in mice. Infect Immun 2003; 71:7053–60.
11. Dozot M, Boigegrain RA, Delrue RM, et al. The stringent response
mediator Rsh is required for Brucella melitensis and Brucella suis virulence, and for expression of the type IV secretion system virB. Cell
Microbiol 2006; 8:1791–802.
12. Occhialini A, Cunnac S, Reymond N, Genin S, Boucher C. Genomewide analysis of gene expression in Ralstonia solanacearum reveals that
the hrpB gene acts as a regulatory switch controlling multiple virulence
pathways. Mol Plant Microbe Interact 2005; 18:938–49.
13. Burkhardt S, Jimenez de Bagues MP, Liautard JP, Köhler S. Analysis of
the behavior of eryC mutants of Brucella suis attenuated in macrophages. Infect Immun 2005; 73:6782–90.
14. Porte F, Liautard JP, Köhler S. Early acidification of phagosomes
containing Brucella suis is essential for intracellular survival in murine
macrophages. Infect Immun 1999; 67:4041–7.
15. Jimenez de Bagues MP, Marin CM, Barberan M, Blasco JM. Evaluation
of vaccines and of antigen therapy in a mouse model for Brucella ovis.
Vaccine 1993; 11:61–6.
16. Boschiroli ML, Ouahrani-Bettache S, Foulongne V, et al. The Brucella
suis virB operon is induced intracellularly in macrophages. Proc Natl
Acad Sci U S A 2002; 99:1544–9.
17. Wang Y, Chen Z, Qiao F, et al. Comparative proteomics analyses reveal
the virB of B. melitensis affects expression of intracellular survival related proteins. PLoS One 2009; 4:e5368.
18. Rouot B, Alvarez-Martinez MT, Marius C, et al. Production of the
type IV secretion system differs among Brucella species as revealed
with VirB5- and VirB8-specific antisera. Infect Immun 2003;
71:1075–82.
19. Arocena GM, Sieira R, Comerci DJ, Ugalde RA. Identification of the
quorum-sensing target DNA sequence and N-Acyl homoserine lactone
responsiveness of the Brucella abortus virB promoter. J Bacteriol 2010;
192:3434–40.
20. de Jong MF, Sun YH, den Hartigh AB, van Dijl JM, Tsolis RM. Identification of VceA and VceC, two members of the VjbR regulon that are
translocated into macrophages by the Brucella type IV secretion system.
Mol Microbiol 2008; 70:1378–96.
21. Uzureau S, Lemaire J, Delaive E, et al. Global analysis of quorum
sensing targets in the intracellular pathogen Brucella melitensis 16 M. J
Proteome Res 2010; 9:3200–17.
22. Pappas G. The changing Brucella ecology: novel reservoirs, new threats.
Int J Antimicrob Agents 2010; 36(Suppl. 1):S8–11.
23. Audic S, Lescot M, Claverie JM, Scholz HC. Brucella microti: the genome
sequence of an emerging pathogen. BMC Genomics 2009; 10:352.
24. Köhler S, Foulongne V, Ouahrani-Bettache S, et al. The analysis of the
intramacrophagic virulome of Brucella suis deciphers the environment
encountered by the pathogen inside the macrophage host cell. Proc
Natl Acad Sci U S A 2002; 99:15711–6.
25. Hong PC, Tsolis RM, Ficht TA. Identification of genes required for
chronic persistence of Brucella abortus in mice. Infect Immun 2000;
68:4102–7.
26. Roux CM, Rolan HG, Santos RL, et al. Brucella requires a functional
Type IV secretion system to elicit innate immune responses in mice.
Cell Microbiol 2007; 9:1851–69.
27. Sieira R, Comerci DJ, Pietrasanta LI, Ugalde RA. Integration host
factor is involved in transcriptional regulation of the Brucella abortus
virB operon. Mol Microbiol 2004; 54:808–22.
28. Sieira R, Arocena GM, Bukata L, Comerci DJ, Ugalde RA.
Metabolic control of virulence genes in Brucella abortus: HutC
coordinates virB expression and the histidine utilization
pathway by direct binding to both promoters. J Bacteriol 2010;
192:217–24.
29. Comerci DJ, Martinez-Lorenzo MJ, Sieira R, Gorvel JP, Ugalde RA.
Essential role of the VirB machinery in the maturation of the Brucella
abortus-containing vacuole. Cell Microbiol 2001; 3:159–68.
30. Ekaza E, Guilloteau L, Teyssier J, Liautard JP, Köhler S. Functional
analysis of the ClpATPase ClpA of Brucella suis, and persistence
of a knockout mutant in BALB/c mice. Microbiology 2000; 146:
1605–16.
31. Morris JG Jr., Southwick FS. Brucella, voles, and emerging pathogens.
J Infect Dis 2010; 202:1–2.
32. Scholz HC, Nöckler K, Göllner C, et al. Brucella inopinata sp. nov.,
isolated from a breast implant infection. Int J Syst Evol Microbiol 2010;
60:801–8.
33. Tiller RV, Gee JE, Lonsway DR, et al. Identification of an
unusual Brucella strain (BO2) from a lung biopsy in a 52 year-old
patient with chronic destructive pneumonia. BMC Microbiol 2010;
10:23.
B. microti Infection is virB-dependent
d
JID 2011:203 (15 April)
d
1135