Platelet-Derived Growth Factor Receptor-␤ Constitutive
Activity Promotes Angiogenesis In Vivo and In Vitro
Peetra U. Magnusson, Camilla Looman, Aive Åhgren, Yan Wu,
Lena Claesson-Welsh, Rainer L. Heuchel
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Objective—Knockout studies have demonstrated crucial roles for the platelet-derived growth factor-B and its cognate
receptor, platelet-derived growth factor receptor-␤ (PDGFR-␤), in blood vessel maturation, that is, the coverage of
newly formed vessels with mural cells/pericytes. This study describes the consequences of a constitutively activating
mutation of the PDGFR-␤ (PdgfrbD849V) introduced into embryonic stem cells with respect to vasculogenesis/
angiogenesis in vitro and in vivo.
Methods and Results—Embryonic stem cells were induced to either form teratomas in vivo or embryoid bodies, an in vitro
model for mouse embryogenesis. Western blotting studies on embryoid bodies showed that expression of a single allele
of the mutant Pdgfrb led to increased levels of PDGFR-␤ tyrosine phosphorylation and augmented downstream signal
transduction. This was accompanied by enhanced vascular development, followed by exaggerated angiogenic sprouting
with abundant pericyte coating as shown by immunohistochemistry/immunofluorescence. PdgfrbD849V/⫹ embryoid bodies
were characterized by increased expression of vascular endothelial growth factor (VEGF)-A and VEGF receptor-2;
neutralizing antibodies against VEGF-A/VEGF receptor-2 blocked vasculogenesis and angiogenesis in mutant embryoid
bodies. Moreover, PdgfrbD849V/⫹ embryonic stem cell– derived teratomas in nude mice were more densely vascularized
than wild-type teratomas.
Conclusion—Increased PDGFR-␤ kinase activity is associated with elevated expression of VEGF-A and VEGF
receptor-2, acting directly on endothelial cells and resulting in increased vessel formation. (Arterioscler Thromb Vasc
Biol. 2007;27:2142-2149.)
Key Words: PDGF 䡲 PDGF receptor 䡲 signal transduction 䡲 embryonic stem cells 䡲 endothelial cells
䡲 vasculogenesis 䡲 angiogenesis
P
latelet-derived growth factor (PDGF) describes a heparinbinding, heterodimerizing or homodimerizing family of
polypeptide growth factors denoted A, B, C, and D with a broad
range of target cells, notably mesoderm-derived cells, such as
pericytes, glia cells, and mesangial cells (reviewed in References
1 and 2). The PDGF isoforms bind to 2 distinct class III receptor
tyrosine kinases, PDGF receptor (PDGFR)-␣ and -␤, which
display a nonoverlapping expression pattern (reviewed in Reference 3). Binding of dimeric ligand leads to autophosphorylation of the receptors on tyrosine residues. This, in turn, allows
the docking and activation of several downstream signaling
molecules, the net signaling outcome of which dictates the
cellular response. For example, the binding of Grb2/Sos results
in proliferation by activating the Ras/extracellular signalregulated kinase (Erk)1/2 pathway, whereas the binding of
phosphatidylinositol 3-kinase activates actin cytoskeletal rearrangements (migration and contraction), mainly via the small
GTPase Rac, as well as antiapoptotic signaling via the serine/
threonine kinase Akt (reviewed in Reference 1). Recently,
mutations of a conserved aspartic acid residue in the activation
loop of a number of class III receptor tyrosine kinases leading to
ligand-independent receptor activation have been observed in
several human tumors (for a review, see Reference 4 and
references in Reference 5). In gastrointestinal stromal tumors,
for example, mutation of the aspartic acid residue at amino acid
position 842 for valine was detected in the highly homologous
Pdgfra.6 With the initial goal to generate an oncogenic mouse
model based on hyperactive PDGFR-␤ signaling, we introduced
the corresponding mutation (D849V) into the Pdgfrb. Embryonic stem (ES) cells carrying this mutation, however, did not
even generate viable chimeric offspring, indicating a dominant
lethal phenotype and the possibility that constitutive activation
of the PDGFR-␤ was incompatible with ES cell pluripotency.
Pdgfb and Pdgfrb knockout experiments have pointed
toward a critical role for PDGF signaling in the establishment
of functional blood vessels by recruiting stabilizing mural
Original received December 15, 2006; final version accepted July 13, 2007.
From the Department of Genetics and Pathology, Rudbeck Laboratory (P.U.M., L.C.-W.), and Ludwig Institute for Cancer Research (C.L., A.A.,
R.L.H.), Uppsala University, Uppsala, Sweden; Department of Experimental Therapeutics (Y.W.), ImClone Systems Incorporated, New York, NY.
P.U.M. and C.L. contributed equally to this work.
Correspondence to Rainer L. Heuchel, Ludwig Institute for Cancer Research, Uppsala University, BMC, Box 595, 751 24 Uppsala, Sweden. E-mail
[email protected]
© 2007 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol. is available at http://atvb.ahajournals.org
2142
DOI: 10.1161/01.ATV.0000282198.60701.94
Magnusson et al
Constitutive PDGFR-␤ Kinase Activity in Stem Cells
2143
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
cells to the developing blood vessel (reviewed in Reference
7). However, the role of PDGF/PDGFR-␤ during early
vascular development has remained unexplored. In the
mouse, vascular development ensues around embryonic day
7.5 by the establishment of blood islands in the yolk sac.
These structures contain common hematopoietic/endothelial
precursor cells. The endothelial precursors differentiate
through a process, denoted “vasculogenesis,” resulting in the
formation of a primitive vascular plexus that is subsequently
pruned and reorganized through angiogenesis.8 These and
slightly later stages of vascular development are faithfully
mimicked in aggregates of differentiating stem cells called
embryoid bodies.9,10 Both vasculogensis and angiogenesis
require the function of vascular endothelial growth factor
(VEGF)-A and its receptors VEGF receptor (VEGFR)-1 and
-2 in vivo and in vitro (reviewed in Reference 11). Gene
inactivation of Vegfa as well as Vegfr2 leads to a halt in
vascular development and embryonic death. A similar requirement for intact VEGF-A/VEGFR-2 function has been
demonstrated in differentiating embryoid bodies.9,12,13 In the
present study, we show that ES cells carrying a single allele
of the constitutive active D849V PDGFR-␤ are biased toward
increased vessel development in vitro and in vivo.
Methods
Knock-In of D849V Into ES Cells
For detailed information on the construction of the targeting vector
containing the codon exchange for amino acid 849 from aspartic acid
to valine and the generation of targeted ES cells, please see the
Supplemental Data online at http://atvb.ahajournals.org.
ES Cell Culture and Analyses
ES cells were cultured on mitomycin-C–treated feeders in the
presence of leukemia inhibitory factor. Differentiation was induced
by removal of leukemia inhibitory factor and aggregation of cells in
hanging drops. Embryoid bodies were flushed down on day 4 and
used for continued culture on glass slides or in collagen gels,
followed by immunohistochemical or immunofluorescent staining.
For detailed description of methodology, please refer to the Supplemental Data.
Generation and Analysis of Teratomas
Vasculogenic and angiogenic properties of wild-type and mutant ES
cells were examined after teratoma formation of ES cells in nude
mice. Animal handling was performed with ethical permission
approved by the Uppsala University Board of Animal Experimentation. For further details, please refer to the Supplemental Data.
Results
Introduction of a Gain of Function Mutation Into
Pdgfrb by Gene Targeting
A gain-of-function mutation was introduced into the activation loop of the Pdgfrb by changing the highly conserved
aspartic acid at amino acid position 849 for valine (D849V)
using the targeting vector depicted in Figure 1. The linearized
targeting construct was electroporated into GS-1 ES cells.
Correctly recombined clones were identified, and the presence of the point mutation was confirmed by DNA sequencing of PCR-amplified genomic DNA (data not shown).
Two independent PdgfrbD849V/⫹ ES cell clones (D/V-1 and
D/V-2) were used for repeated blastocyst injections. In total,
Figure 1. Characterization of the D849V PDGFR-␤ in differentiated ES cells. A, The intron/exon structure of the mouse Pdgfrb
is schematically represented before (A⬘) and after (C⬘) homologous recombination using the targeting vector depicted in B⬘.
*D849V point mutation in exon 17. B, PDGFR-␤ protein levels
and extent of phosphorylation at tyrosine 856 determined from a
wild-type (Wt) and 2 PdgfrbD849V/⫹ clones (D/V-1 and D/V-2) in
the absence (Basal) or presence of 50 ng/mL of PDGF-BB for
10 minutes before lysis. Values above lanes indicate the specific
phosphorylation of the PDGFR-␤ (pPDGFR-␤/PDGFR-␤). ␤-Actin
was used as a loading control. C, Analyses of Erk1/2 phosphorylation levels in wild-type and mutant embryoid bodies (D/V-1
and D/V-2) under basal or stimulated conditions as in B. The
data in B and C are representative for 1 of at least 4 individually
performed experiments.
345 blastocysts injected with either of the 2 mutant ES cell
lines (290 D/V-1 or 55 D/V-2) were transferred into foster
mothers without generating viable coat chimeras (data not
shown). A correctly targeted (neo cassette in the correct
position) but otherwise wild-type ES cell clone from the same
electroporation as the 2 mutant clones was injected in parallel
and resulted in germline transmission at high frequency. This
proved the high quality of the original ES cell line and
indicated that introduction of the activating D849V mutation
into 1 Pdgfrb allele alone was incompatible with embryonic
development.
The D849V Mutation Confers Increased PDGFR-␤
Kinase Activity In Vitro
Because the PdgfrbD849V/⫹ ES cells did not generate viable
coat chimeras, we decided to use the well-established in vitro
2144
Arterioscler Thromb Vasc Biol.
October 2007
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
differentiation of ES cells into embryoid bodies for further
studies (reviewed in Reference 14 and Jakobsson et al.). This
system elegantly allows the investigation of otherwise lethal
mutations with respect to early embryonic development and
biochemical consequences.
First, the expression of PDGFR-␤ protein, as well as the
receptor activity, estimated by the extent of tyrosine autophosphorylation, was compared between the mutant and
wild-type ES cell clones. For this purpose, ES cells were
aggregated in the absence of leukemia inhibitory factor to
create embryoid bodies that were cultured for 8 days before
analysis. Under basal conditions, there was a 4- to 5-fold
increase in the level of tyrosine-phosphorylated PDGFR-␤ in
the mutant embryoid bodies (Figure 1B). Both mutant and
wild-type embryoid bodies retained responsiveness to exogenous short-term stimulation with PDGF-BB as demonstrated
by a further increase in receptor phosphorylation (Figure 1B).
To test whether the ligand-independent activity of the
D849V receptor affected the basal activity level (ie, in the
absence of exogenous growth factor) of known downstream
targets, we analyzed the phosphorylation status of Erk1/2. As
shown in Figure 1C, Erk1/2 phosphorylation was increased
by 2-fold in the PdgfrbD849V/⫹ embryoid bodies compared with
wild-type embryoid bodies. Moreover, mutant embryoid bodies responded to exogenous PDGF-BB with a further increase
in phosphorylation of Erk1/2, the final levels of which were
similar to those of the PDGF-BB-treated wild-type embryoid
bodies. A similar although weaker tendency was also seen for
Akt, with slightly increased basal phosphorylation in the
mutant embryoid bodies and a further increase in response to
PGDF-BB (data not shown). Collectively, these data demonstrated that the D849V mutation of the PDGFR-␤ conferred
increased kinase activity and enhanced downstream signal
transduction in the absence of exogenous ligand in differentiating mouse ES cells.
Increased PDGFR-␤ Kinase Activity Is Coupled
With Increased Vascularization of
Embryoid Bodies
To examine the influence of increased PDGFR-␤ kinase
activity on vascular development, embryoid body cultures
were kept under basal conditions, or supplemented with the
exogenous growth factors VEGF-A or PDGF-BB, as indicated, for 8 days. Interestingly, staining for expression of the
vascular marker CD31 identified abundant vessel formation
in the mutant clones even in the absence of exogenous growth
factors (basal; Figure 2A). In contrast, the wild-type embryoid bodies lacked clear vessel structures and contained only
poorly developed central blood islands, as one would expect
in the absence of vasculogenic/angiogenic growth factors.
The quantification of the length of vessel structures and
vessel area in wild-type and PdgfrbD849V/⫹ (D/V-1 and D/V-2)
embryoid bodies under basal and growth factor–induced
conditions (Figure 2B and 2C) indicated that the mutant ES
cell clones were characterized by a very high inherent
vasculogenic activity, which could not be further increased by
PDGF-BB stimulation. Moreover, whereas addition of VEGF
increased the vessel area nearly 4-fold in wild-type embryoid
bodies, there was no further increase recorded for the D/V-1
and -2 mutant embryoid bodies compared with respective
basal. Vessel length increased 3-fold with the VEGF addition
to wild-type embryoid bodies; there was also a slight further
increase in the mutant embryoid bodies. These data demonstrated that expression of only 1 copy of the D849V receptor
was sufficient to initiate vascular development and formation
of vessels in this in vitro differentiation system.
Differentiating PdgfrbD849V/ⴙ Embryoid Bodies Are
Characterized by Increased Expression of
VEGF-A, VEGFR-2, and RGS5
To find a molecular explanation for the increased vasculogenesis and angiogenesis conferred by the D849V receptor,
the expression levels of the hematopoietic markers CD41 and
Tal-1, the vascular/endothelial markers CD31, VEGFR-2,
VE-cadherin, and VEGF-A, as well as the mural cell markers
RGS5, ␣-SMA, and PDGFR-␤, were analyzed. A striking
consequence of the PDGFR-␤ mutation was the increase in
Vegfa and Rgs5 transcript levels (Figure 3A). Moreover, the
mRNA levels of Tal-1 and Cd41 were markedly decreased in
differentiating PdgfrbD849V/⫹ ES cells. In contrast, introduction
of the D849V Pdgfrb did not affect the transcript levels of
Cd31, VE-cadherin, Vegfr2, ␣-SMA, and the Pdgfrb itself.
These data indicated that the production of endogenous
VEGF-A and RGS5 were increased as a result of the
activating mutation of the PDGFR-␤ and, furthermore, that
the mutation also affected mesodermal differentiation as
judged from the decrease in Tal-1 and CD41 transcript levels.
The expression of a number of receptors, including
VEGFR-2, have been found to be positively regulated by its
corresponding ligand.15,16 We, therefore, analyzed the expression of VEGFR-2 in lysates from wild-type and PdgfrbD849V/⫹
embryoid bodies at day 8. The relative protein levels of
VEGFR-2 were slightly increased in the PdgfrbD849V/⫹ embryoid bodies, whereas the relative protein levels of VE-cadherin
were unchanged (Figure 3B). Furthermore, VEGFR-2 protein
expression may be stabilized in a manner dependent on the
presentation of VEGF, which could contribute to the relative
increase in VEGFR-2 expression in PdgfrbD849V/⫹-mutant
cells.17
The elevated expression of the endothelial mitogen
VEGF-A and its cognate receptor VEGFR-2 could be a
plausible mechanism to explain the provascular phenotype of
the PdgfrbD849V/⫹ embryoid bodies. In agreement with this
idea, we found that neutralizing antibodies against VEGF-A
or VEGFR-2 essentially attenuated vascularization of the
PdgfrbD849V/⫹ embryoid bodies (Figure 3C and 3D).
Increased Angiogenic Sprouting and Pericyte
Coating by PdgfrbD849V/ⴙ ES Cells
We and others have previously described that embryoid
bodies cultured in 3D collagen gels respond to exogenous
VEGF-A by forming angiogenic, pericyte-covered sprouts
invading 3D collagen gels.17–19 The extent of sprouting of the
PdgfrbD849V/⫹ embryoid bodies, exemplified by the clone
D/V-1, was ⬇3-fold increased compared with wild-type
embryoid bodies (Figure 4).
Pdgfrb gene inactivation results in decreased pericyte
coating in vivo20,21 and in vitro.22 We, therefore, examined
Magnusson et al
Constitutive PDGFR-␤ Kinase Activity in Stem Cells
2145
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Figure 2. Increased vessel formation in
PdgfrbD849V/⫹ embryoid bodies. A, Embryoid bodies created from wild-type (Wt)
and PdgfrbD849V/⫹ES cell clones (D/V-1
and D/V-2) were stained for expression
of CD31 to visualize endothelial vessel
formation in the absence (Basal) or presence of VEGF-A (30 ng/mL) or PDGF-BB
(20 ng/mL) at day 8. Inserts show details
of vessel structures at a higher magnification. Bars, 100 ␮m. Quantification of
CD31-positive length (B) and area (C) in
wild-type and PdgfrbD849V/⫹ (D/V-1 and
D/V-2) embryoid bodies under basal and
growth factor–induced conditions. All of
the calculated values are set in relation
to wild-type at the respective condition *
and ** indicate significant difference
(P⬍0.005) and (P⬍0.0001), respectively,
between wild-type and D/V-mutant
clones at the corresponding conditions.
sprouts from wild-type and PdgfrbD849V/⫹ embryoid bodies
with a mixture of antibodies directed against 3 different
vascular smooth muscle cell markers (␣-SMA, NG2, and
desmin). Angiogenic sprouts from the PdgfrbD849V/⫹ embryoid
bodies were, to a large extent, associated with mural cells
with a morphology resembling that of pericytes, whereas the
coverage was 2-fold lower in the wild-type embryoid body–
derived sprouts (Figure 5). Thus, the gain-of-function phenotype (enhanced PDGFR-␤ activity correlated with a more
dense pericyte coating) corroborated the previously described
loss-of-function phenotype of Pdgfrb knockout animals (loss
of PDGFR-␤ activity correlated with reduced pericyte
coating).
Teratomas Generated From PdgfrbD849V/ⴙ ES Cells
Display a Significantly Increased Vascularization
The subcutaneous injection of ES cells into nude mice results
in the formation of benign tumors (teratomas) containing
differentiated structures of endodermal, mesodermal, and
ectodermal origin, as expected from such ectopic anatomic
placement of ES cells.23,24 We used this strategy to investigate the influence of the D849V PDGFR-␤ on the differentiation potential of ES cells in a complex in vivo environment.
No qualitative differences between wild-type and PdgfrbD849V/⫹
ES cells, with respect to their differentiation into tissues
derived from the 3 germ layers, were detected (Figure S1).
However, morphometric analysis identified a 2-fold larger
vessel area (vessel area per millimeter squared) in PdgfrbD849V/⫹
ES cell– derived teratomas compared with wild-type ES
cell– derived teratomas (Figure 6).
Discussion
In the present work, we describe the effects of a gain-offunction mutation (D849V) of the PDGFR-␤. ES cells heterozygous for this mutation were unable to develop into
2146
Arterioscler Thromb Vasc Biol.
October 2007
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Figure 3. Transcript and protein levels in embryoid bodies and effects of neutralizing antibodies against VEGF-A and VEGFR-2. A,
mRNA expression profiles of hematopoietic and vascular marker genes assessed by real-time RT-PCR in unstimulated embryoid bodies at day 8 of differentiation. The ratio of test transcript/␤-actin transcript levels from wild-type embryoid bodies was set to 1. B, Quantification of endothelial markers VEGFR-2 and VE-cadherin by immunoblotting. ␤-Catenin was used as internal control for equal protein
loading/quantification. One representative of 4 experiments is shown. C, PdgfrbD849V/⫹ embryoid bodies under basal conditions were
treated with rat IgG control serum or neutralizing antibodies against VEGF-A (␣-VEGF-A) or VEGFR-2 (␣-VEGFR-2) between day 6 and
8 of differentiation. Inserts show details of vessel structures at a higher magnification. Bars, 100 ␮m. D, Quantification of the CD31positive area of control and neutralizing antibody–treated PdgfrbD849V/⫹ embryoid bodies. *Significant difference between control and
VEGF-A/VEGFR-2 neutralization (P⫽0.0042 for VEGF-A and P⬍0.0001 for VEGFR-2).
viable coat chimeras after blastocyst injection, indicating a
dominant lethal effect of the mutant allele. The consequences
of this hyperactive mutation on early embryonic development
are unclear at this moment (Looman et al). In the highly
related Pdgfra, the homologous mutation has recently been
identified in gastrointestinal stromal tumors, where it resulted
in ligand-independent activity of the receptor.6 Interestingly,
this particular mutation was never found as a germline
mutation, indicating that it is probably not compatible with
embryonic development, similar to what we experienced with
the corresponding mutation in the Pdgfrb. It is, thus, conceivable, that the mutation restricts the differentiation potential of
the otherwise pluripotent ES cells. To analyze the effect of
the D849V mutation, we differentiated mutant ES cells into
embryoid bodies, which undergo a program of differentiation
reminiscent of early embryogenesis.
In cell lysates of nonstimulated PdgfrbD849V/⫹ embryoid
bodies, we observed a significantly increased tyrosine phosphorylation of the major autophosphorylation site (Y856)
indicative of increased PDGFR-␤ kinase activity. This property translated into elevated Erk1/2 phosphorylation under
these conditions but not when PDGF-BB–stimulated wildtype and PdgfrbD849V/⫹ embryoid bodies were compared,
emphasizing especially the increased basal activity of the
mutant PDGFR-␤ kinase (Figure 1B and 1C). Similar observations have been made in patient material from gastrointestinal stromal tumors carrying the corresponding D842V
Pdgfra.6 This indicates that the exchange of the conserved
Magnusson et al
Constitutive PDGFR-␤ Kinase Activity in Stem Cells
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Figure 4. Enhanced invasion of angiogenic sprouts in collagen
gel by PdgfrbD849V/⫹ embryoid bodies. Wild-type (Wt) embryoid
bodies (A) cultured in collagen I from day 4 to day 10 in the
presence of VEGF-A showed fewer CD31-positive sprouts (red)
invading the collagen gel compared with PdgfrbD849V/⫹ (D/V-1)
embryoid bodies (B). Right panel shows details of CD31-positive
sprouts at higher magnification. Bars, 100 ␮m. C, Quantification
of CD31-positive sprouts in wild-type and D/V-1 embryoid bodies. *P⫽0.008.
aspartic acid for valine in the activation loop of the kinase
domain transforms both the PDGFR-␣ and the PDGFR-␤ into
ligand-independent tyrosine kinases with augmented downstream signaling. Interestingly, Erk1/2, as well as Akt, which
also showed increased basal phosphorylation in mutant embryoid bodies (data not shown), have both been found to
induce VEGF-A expression in Ras-transformed fibroblasts
and epithelial cells, respectively.25
VEGF-A and its cognate receptor VEGFR-2 are both
essential for vascular development in vivo and in vitro.9,10,26 –28
It was, therefore, surprising that embryoid bodies derived
from PdgfrbD849V/⫹ ES cells developed abundant vascular
plexi in the absence of VEGF-A stimulation, which was
essential for vascularization of wild-type embryoid bodies
(Figure 2).9,22 We identified elevated Vegfa mRNA expression and increased levels of VEGFR-2 protein in mutant
embryoid bodies as candidates to explain the increased
vasculogenic propensity of the PdgfrbD849V/⫹ ES cells (Figure
3A and 3B). This notion was strongly supported by the effects
of neutralizing antibodies against VEGF-A or VEGFR-2,
which dramatically reduced the ability of mutant ES cells to
develop a vascular plexus (Figure 3C and 3D). Interestingly,
blocking VEGFR-2 had a much more complete effect than
blocking VEGF-A. This might be a result of blocking the
2147
Figure 5. Angiogenic sprouts from PdgfrbD849V/⫹ embryoid bodies cultured in collagen I display increased pericyte coverage. A,
Pericytes were visualized using a mixture of antibodies recognizing the pericyte markers ␣-SMA, NG2, and desmin (green).
Endothelial cells appear in red (CD31 staining) and nuclei in blue
(4⬘,6-diamidino-2-phenylindole). Bars, 25 ␮m. B, The amount of
␣-SMA/NG2/desmin-positive cells associated with CD31positive sprouts was significantly increased (*P⬍0.0001) in the
PdgfrbD849V/⫹ embryoid bodies.
effects of several ligands to VEGFR-2, such as VEGF-C and
-D, which, in their processed forms, may bind to VEGFR-2
(reviewed in Reference 11). Furthermore, VEGF-C has been
shown to induce heterodimers between VEGFR-2 and
Figure 6. Teratomas derived from PdgfrbD849V/⫹ ES cells are
characterized by increased vascularization. A, Sections from
PDGFR-␤ wild-type (Wt) and PdgfrbD849V/⫹ (D/V-1) teratomas
were immunostained with antibodies against CD31 to visualize
the blood vessel compartment. B, The total area covered by
vessels and the number of vessels was significantly increased in
PdgfrbD849V/⫹ teratomas (*P⬍0.05 in both cases), whereas the
average vessel perimeter was slightly decreased compared with
wild-type teratomas (*P⬍0.05).
2148
Arterioscler Thromb Vasc Biol.
October 2007
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
VEGFR-3,29 which also would be blocked as a consequence
of VEGFR-2 neutralization. As expected from the increased
VEGF-A/VEGFR-2 expression, we found enhanced angiogenic activity of the mutant ES cells in a 3D collagen assay
for vascular sprouting (Figure 4). Moreover, sprouts from
mutant embryoid bodies were more densely covered by mural
cells/pericytes (Figure 5). In accordance, the transcript level
for Rgs5, a member of the RGS family of GTPase-activating
proteins, was 2-fold increased in mutant embryoid bodies
(Figure 3A). RGS5 has been identified as a marker for
differentiating pericytes, which is dramatically downregulated in pericyte-deficient Pdgfb and Pdgfrb null embryos.30
The increased vasculo/angiogenic activity might, however,
not only be based on the increased production of VEGF-A.
We demonstrated recently that PDGF-BB stimulation of
PDGFR-␤– expressing early hematopoietic/endothelial precursor cells (hemangioblasts) resulted in increased endothelial cell lineage commitment and restricted differentiation of
hematopoietic precursors.22 Using a mouse model with a
similar but weaker and, thus, viable activating mutation in the
Pdgfrb (D849N), we observed increased vascular remodeling
and reduced numbers of CD41-positive hematopoietic cells in
homozygous mutant yolk sacs compared with wild-type yolk
sacs.5,22 We, therefore, suggest that also the ligandindependent activity of the D849V PDGFR-␤ leads to a
developmental shift toward endothelial cell commitment at
the expense of hematopoietic differentiation. This hypothesis
is strongly supported by the fact that expression of D849V
PDGFR-␤ was accompanied by marked decrease in expression of Tal-1 and Cd41 (Figure 3A). Tal-1, a basic helixloop-helix transcription factor expressed in erythroid, myeloid, megakaryocytic, and hematopoietic stem cells, is
critical in embryonic hematopoietic development, and its
gene inactivation leads to developmental arrest at the hemangioblastic stage. CD41 (corresponding with the ␣ subunit of
the ␣IIb␤3 intergrin complex), a putative target gene for Tal-1,
is a classical megacaryocyte/platelet-specific marker.31–33
The PDGFR-␤ has been identified as an important drug
target in tumor therapy because of the fact that PDGF-BB is
secreted by many solid tumors, PDGFR-␤ is expressed on
endothelial cells of certain tumors, and capillaries in most
solid tumors are surrounded by PDGFR-␤ expressing tumor
pericytes (reviewed in Reference 34). To address the consequence of the hyperactive D849V PDGFR-␤ in an embryonic
tumor model, ES cells were grown subcutaneously in nude
mice to create teratomas. We found that teratomas induced by
PdgfrbD849V/⫹ ES cells displayed a significantly increased
vascularization (Figure 6), supporting our in vitro data.
However, in contrast to these, we did not observe increased
pericyte coating of vessels in PdgfrbD849V/⫹ teratomas, nor did
we detect increased Vegfa mRNA levels in PdgfrbD849V/⫹
versus wild-type teratoma tissues (data not shown). The
mechanistic interpretation of increased vascularization in
mutant teratomas is complicated by the fact that vessels in the
tumors are likely of mixed origin (ie, both host and ES cell
derived). In general, teratomas are highly complex structures
made up of many different cell and tissue types compared
with the relatively well-defined in vitro culture system of
embryoid bodies. Interestingly however, we found slightly
increased Cd31, ␣-SMA, and Rgs5 mRNA levels and ⬎5-fold
decreased levels of Cd41 mRNA in PdgfrbD849V/⫹ teratoma
tissues (data not shown). This observation would support the
notion of a narrowly defined developmental shift of early
hematopoietic/endothelial precursor cells toward an endothelial cell lineage commitment without affecting the general
differentiation of the mutant ES cells into other cell lineages
derived from the 3 germ layers (Figure S1).
We, therefore, hypothesize that the increased vasculogenic/
angiogenic activity of the PdgfrbD849V/⫹ ES cells would, depending on the cellular/environmental context, result from increased angiogenic VEGF signaling or increased endothelial
cell commitment because of ligand-independent, constitutive
signaling by the mutant PDGFR-␤.
Acknowledgments
We thank the Uppsala and Umeå Transgenic Facilities for ES cell
electroporation and blastocyst injections/transfers and ImClone for
anti-VEGFR-2 antibodies.
Sources of Funding
This study was supported by funds from the Swedish Cancer Society
(project No. 3820-B04-09XAC) and the Swedish Research Council
(project No. K2005-32X-12552-08A) for L.C.-W. and by Ludwig
Institute for Cancer Research for C.L., A.Å., and R.L.H.
Disclosures
Y.W. is an employee of ImClone Systems Inc.
References
1. Heldin CH, Westermark B. Mechanism of action and in vivo role of
platelet-derived growth factor. Physiol Rev. 1999;79:1283–1316.
2. Fredriksson L, Li H, Eriksson U. The PDGF family: four gene products
form five dimeric isoforms. Cytokine Growth Factor Rev. 2004;15:
197–204.
3. Tallquist M, Kazlauskas A. PDGF signaling in cells and mice. Cytokine
Growth Factor Rev. 2004;15:205–213.
4. Jones AV, Cross NC. Oncogenic derivatives of platelet-derived growth
factor receptors. Cell Mol Life Sci. 2004;61:2912–2923.
5. Chiara F, Goumans MJ, Forsberg H, Ahgren A, Rasola A, Aspenstrom P,
Wernstedt C, Hellberg C, Heldin CH, Heuchel R. A gain of function
mutation in the activation loop of platelet-derived growth factor betareceptor deregulates its kinase activity. J Biol Chem. 2004;279:
42516 – 42527.
6. Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen CJ, Joseph
N, Singer S, Griffith DJ, Haley A, Town A, Demetri GD, Fletcher CD,
Fletcher JA. PDGFRA activating mutations in gastrointestinal stromal
tumors. Science. 2003;299:708 –710.
7. von Tell D, Armulik A, Betsholtz C. Pericytes and vascular stability. Exp
Cell Res. 2006;312:623– 629.
8. Risau W, Flamme I. Vasculogenesis. Annu Rev Cell Dev Biol. 1995;11:
73–91.
9. Magnusson P, Rolny C, Jakobsson L, Wikner C, Wu Y, Hicklin DJ,
Claesson-Welsh L. Deregulation of Flk-1/vascular endothelial growth
factor receptor-2 in fibroblast growth factor receptor-1-deficient vascular
stem cell development. J Cell Sci. 2004;117:1513–1523.
10. Yamashita J, Itoh H, Hirashima M, Ogawa M, Nishikawa S, Yurugi T,
Naito M, Nakao K, Nishikawa S. Flk1-positive cells derived from
embryonic stem cells serve as vascular progenitors. Nature. 2000;408:
92–96.
11. Olsson AK, Dimberg A, Kreuger J, Claesson-Welsh L. VEGF receptor
signalling - in control of vascular function. Nat Rev Mol Cell Biol.
2006;7:359 –371.
12. Nilsson I, Rolny C, Wu Y, Pytowski B, Hicklin D, Alitalo K,
Claesson-Welsh L, Wennstrom S. Vascular endothelial growth factor
receptor-3 in hypoxia-induced vascular development. FASEB J. 2004;18:
1507–1515.
Magnusson et al
Constitutive PDGFR-␤ Kinase Activity in Stem Cells
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
13. Yancopoulos GD, Davis S, Gale NW, Rudge JS, Wiegand SJ, Holash J.
Vascular-specific growth factors and blood vessel formation. Nature.
2000;407:242–248.
14. Rathjen J, Rathjen PD. Mouse ES cells: experimental exploitation of
pluripotent differentiation potential. Curr Opin Genet Dev. 2001;11:
587–594.
15. Kremer C, Breier G, Risau W, Plate KH. Up-regulation of flk-1/vascular
endothelial growth factor receptor 2 by its ligand in a cerebral slice
culture system. Cancer Res. 1997;57:3852–3859.
16. Clark AJ, Ishii S, Richert N, Merlino GT, Pastan I. Epidermal growth
factor regulates the expression of its own receptor. Proc Natl Acad Sci
U S A. 1985;82:8374 – 8378.
17. Jakobsson L, Kreuger J, Holmborn K, Lundin L, Eriksson I, Kjellen L,
Claesson-Welsh L. Heparan sulfate in trans potentiates VEGFR-mediated
angiogenesis. Dev Cell. 2006;10:625– 634.
18. Feraud O, Cao Y, Vittet D. Embryonic stem cell-derived embryoid bodies
development in collagen gels recapitulates sprouting angiogenesis. Lab
Invest. 2001;81:1669 –1681.
19. Magnusson PU, Ronca R, Dell’Era P, Carlstedt P, Jakobsson L, Partanen
J, Dimberg A, Claesson-Welsh L. Fibroblast growth factor receptor-1
expression is required for hematopoietic but not endothelial cell development. Arterioscler Thromb Vasc Biol. 2005;25:944 –949.
20. Hellstrom M, Kalen M, Lindahl P, Abramsson A, Betsholtz C. Role of
PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells
and pericytes during embryonic blood vessel formation in the mouse.
Development. 1999;126:3047–3055.
21. Soriano P. Abnormal kidney development and hematological disorders in
PDGF beta-receptor mutant mice. Genes Dev. 1994;8:1888 –1896.
22. Rolny C, Nilsson I, Magnusson P, Armulik A, Jakobsson L, Wentzel P,
Lindblom P, Norlin J, Betsholtz C, Heuchel R, Welsh M, Claesson-Welsh
L. Platelet-derived growth factor receptor-{beta} promotes early endothelial cell differentiation. Blood. 2006.
23. Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells
from mouse embryos. Nature. 1981;292:154 –156.
24. Martin GR. Isolation of a pluripotent cell line from early mouse embryos
cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl
Acad Sci U S A. 1981;78:7634 –7638.
25. Rak J, Mitsuhashi Y, Sheehan C, Tamir A, Viloria-Petit A, Filmus J,
Mansour SJ, Ahn NG, Kerbel RS. Oncogenes and tumor angiogenesis:
26.
27.
28.
29.
30.
31.
32.
33.
34.
2149
differential modes of vascular endothelial growth factor up-regulation in
ras-transformed epithelial cells and fibroblasts. Cancer Res. 2000;60:
490 – 498.
Carmeliet P, Ferreira V, Breier G, Pollefeyt S, Kieckens L, Gertsenstein
M, Fahrig M, Vandenhoeck A, Harpal K, Eberhardt C, Declercq C,
Pawling J, Moons L, Collen D, Risau W, Nagy A. Abnormal blood vessel
development and lethality in embryos lacking a single VEGF allele.
Nature. 1996;380:435– 439.
Ferrara N, Carver-Moore K, Chen H, Dowd M, Lu L, O’Shea KS,
Powell-Braxton L, Hillan KJ, Moore MW. Heterozygous embryonic
lethality induced by targeted inactivation of the VEGF gene. Nature.
1996;380:439 – 442.
Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, Breitman
ML, Schuh AC. Failure of blood-island formation and vasculogenesis in
Flk-1-deficient mice. Nature. 1995;376:62– 66.
Dixelius J, Makinen T, Wirzenius M, Karkkainen MJ, Wernstedt C,
Alitalo K, Claesson-Welsh L. Ligand-induced vascular endothelial
growth factor receptor-3 (VEGFR-3) heterodimerization with VEGFR-2
in primary lymphatic endothelial cells regulates tyrosine phosphorylation
sites. J Biol Chem. 2003;278:40973– 40979.
Bondjers C, Kalen M, Hellstrom M, Scheidl SJ, Abramsson A, Renner O,
Lindahl P, Cho H, Kehrl J, Betsholtz C. Transcription profiling of platelet-derived growth factor-B-deficient mouse embryos identifies RGS5 as
a novel marker for pericytes and vascular smooth muscle cells. Am J
Pathol. 2003;162:721–729.
Ferkowicz MJ, Starr M, Xie X, Li W, Johnson SA, Shelley WC, Morrison
PR, Yoder MC. CD41 expression defines the onset of primitive and
definitive hematopoiesis in the murine embryo. Development. 2003;130:
4393– 4403.
Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The T
cell leukemia oncoprotein SCL/tal-1 is essential for development of all
hematopoietic lineages. Cell. 1996;86:47–57.
Robb L, Elwood NJ, Elefanty AG, Kontgen F, Li R, Barnett LD, Begley
CG. The scl gene product is required for the generation of all hematopoietic lineages in the adult mouse. EMBO J. 1996;15:4123– 4129.
Ostman A. PDGF receptors-mediators of autocrine tumor growth and
regulators of tumor vasculature and stroma. Cytokine Growth Factor Rev.
2004;15:275–286.
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Platelet-Derived Growth Factor Receptor-β Constitutive Activity Promotes Angiogenesis
In Vivo and In Vitro
Peetra U. Magnusson, Camilla Looman, Aive Åhgren, Yan Wu, Lena Claesson-Welsh and
Rainer L. Heuchel
Arterioscler Thromb Vasc Biol. 2007;27:2142-2149; originally published online July 26, 2007;
doi: 10.1161/01.ATV.0000282198.60701.94
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2007 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/27/10/2142
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2007/09/20/01.ATV.0000282198.60701.94.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Online supplement
Online supplemental Figure 1.
Suppl. Fig. 1 Wild-type and D/V mutant ES cell-derived teratoma display equal tissue
type distributions.
Equal representation of the three germ layers (mesoderm-derived muscle, endodermderived digestive and respiratory tract lining cells and ectoderm-derived nerve and skin
tissue) was observed in wild-type and PdgfrbD849V/+–mutant teratoma indicating that the
developmental pathways giving rise to these somatic tissues are not altered, at least in a
model which does not depend on embryonic survival. Representative HE-stained sections
are shown.
1
Methods
Knock in of D849V in ES cells
The mutation of aspartic acid 849 to valine was introduced into subcloned genomic DNA
by oligonucleotide directed mutagenesis using the QuickChange Kit (Stratagene)
according to the manufacturer’s recommendations. The mutation primers used were as
follows: 5’-GACTTCGGCCTGGCTCGAGtCATTATGAGGGACTCAAACTACA-3’
and 5’-TGTAGTTTGAGTCCCTCATAATGaCTCGAGCCAGGCCGAAGTC-3’ (base
exchange resulting in amino acid mutation indicated in lower case letters). The targeting
vector consisted of a 1.7 kb EcoRV-Spel genomic 5’-fragment, followed by a
PGKneobpA expression cassette flanked by loxP sites, a 5 kb Spel-XhoI genomic 3’fragment containing the point mutated exon-18 and a herpes simples virus thymidine
kinase (HSV-TK) expression cassette in pBluescript SK(+) backbone. The construct was
linearized (NotI) for electroporation into GS-1 ES cells (Genome Systems) and colonies
were selected using G418 and gancyclovir. Homologous recombination events were
screened by PCR, as described
1
, using primers for the neo gene (5’-
TGGCTACCCGTGATATTGCT-3’) and genomic sequence outside the targeting
construct (5’-CCGAAATGTGTACCAGTCTGAAA-3’), resulting in a 3 kb amplification
product for correct integration. Positive ES cell clones were tested by Southern blot, as
described 1, using a 177 bp PCR amplification product corresponding to nucleotides 1957
to 2133 of the mouse Pdgfrb cDNA, which hybridizes to genomic DNA 5’ outside the
targeting construct (5.2 kb wild type allele; 6.9 kb mutant allele). The point mutation was
confirmed by sequencing of a PCR-amplified DNA fragment from targeted ES cells. Two
2
PdgfrbD849V/+ ES cell clones denoted D/V-1 and D/V-2, were selected for further
characterization. These clones were compared with a GS-1 ES cell clone with the neo
cassette in the corresponding locus, but lacking the D849V mutation (denoted wild type).
ES cell culture
ES cells were grown on growth-arrested murine embryonic fibroblast feeder cells in ES
cell medium composed of Dulbecco’s modified Eagle’s medium/glutamax
(Invitrogen/Gibco) supplemented with 15% fetal bovine serum, 25 mM HEPES, 1.2 mM
Na-pyruvate, 19 µM monothioglycerol and 1,000 U/ml recombinant leukemia inhibitory
factor (LIF, Chemicon International Inc.) as described 2. Prior to differentiation, the ES
cells were cultured for 1-2 passages on gelatine-coated tissue culture plastic to remove
feeder cells. Differentiation of embryoid bodies started at day 0 when LIF was withdrawn
from the medium. Growth factors were added as indicated from this point (30 ng/ml
VEGF-A165, PeproTech Inc., or 20 ng/ml PDGF-BB; generous donation from Amgen
Inc.). Formation of embryoid bodies was induced in hanging droplets and on day 4, the
embryoid bodies were flushed down and plated on 8-well glass culture slides (Becton
Dickinson Biosciences/Falcon) or on tissue culture plastic dishes. All analyses were
performed on four or more embryoid bodies at three or more individual occasions, unless
stated otherwise.
Embryoid bodies in 3-dimensional collagen I gels and immunofluorescence staining
Embryoid bodies were cultured as described above. Briefly, on day 0 ES cells were
cultured in hanging droplets in the presence of serum with or without 30 ng/ml VEGF-A
3
(PeproTech Inc.). After 4 days, the embryoid bodies were seeded in groups of
approximately 10 embryoid bodies on a layer of polymerised collagen type I solution
(Ham’s F12 medium (PromoCell GmbH), 5 mM NaOH, 20 mM HEPES, 0,225%
NaHCO3, 1% Glutamax-1 (Invitrogen/Gibco) and 1.5 mg/ml collagen type I (Cohesion
Technologies Inc.). Immediately thereafter, a second layer of collagen solution was added
on top. After the second layer had solidified, medium with or without 30 ng/ml of VEGFA was added and the culture continued for 6 or 8 days. Cultures were fixed in 4 %
paraformaldehyde for 30 minutes and then blocked and permeabilized in 3 % BSA, 0.2 %
Triton X-100 in phosphate buffered saline (PBS). Endothelial cells were stained with a
rat anti-mouse PECAM1/CD31 antibody (Becton Dickinson Biosciences/Falcon) and
pericytes were stained using a mixture of a fluorescein isothiocyanate (FITC)-conjugated
mouse anti-α-SMA antibody (Sigma), a rabbit anti-NG2 chondroitin sulphate
proteoglycan antibody (Chemicon International Inc.) and a mouse anti-desmin antibody
(DAKO). CD31 antibodies were detected using an anti-rat Alexa 568 antibody
(Invitrogen/Molecular Probes) and NG2 and desmin antibodies were detected using antirabbit and anti-mouse Alexa 488 antibodies (both from Invitrogen/Molecular Probes). All
antibodies were diluted in 3 % BSA/PBS and all antibody incubations were carried out at
4 ºC over night. Nuclei were stained by DAPI (1 µg/ml) in PBS. The number of CD31positive sprouts per embryoid body (n = 11 both for wild type and D/V-1 ES cells) and
the number of pericytes (desmin+, α-SMA+ or NG2+ cells) associated with CD31+ sprouts
(n = 14 and 15 sprouts from wild type and mutant embryoid bodies, respectively) were
counted using a Leica DM4000 B/M microscope. P values were calculated using
Student’s t-test, two-sample unequal variance/two-tailed distribution.
4
In all experiments involving embryoid bodies, four embryoid bodies were analyzed per
condition and genotype and repeated at least three times, if not mentioned otherwise.
Western blotting
Cell lysates from embryoid bodies were analyzed by western blotting to examine the
activity and downstream signaling components of wild type and the mutant PDGFR-β.
Embryoid bodies were plated out on day 4 in plastic tissue culture dishes to allow
attachment. After indicated time points of culture in medium without LIF and
exogenously added growth factors, cultures were lysed in 20 mM Tris HCl (pH 7.5), 150
mM NaCl, 10% glycerol, 1% Nonidet P40, 2 mM EDTA, 500 µM Na3VO4, 1% aprotinin,
10 µg/ml leupeptin and 1 mM phenylmethyl sulfonylfluoride. When indicated, growth
factor-treated embryoid bodies were starved for 16 hours in 0.2% fatty-acid free bovine
serum albumin (BSA; Sigma-Aldrich) in ES cell medium without LIF and then
stimulated with PDGF-BB (50 ng/ml) for 10 minutes prior to cell lysis. Cell lysates were
centrifuged for 15 minutes at 4°C and the protein concentration of the supernatant was
measured using the BCA protein detection kit (Pierce Chemicals). Total cell lysates were
separated by reducing SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using 7%
and 12% gels and transferred to Hybond C-Extra nitrocellulose membrane (Amersham
Biosciences). The membranes were blocked in Tris-buffered saline /0.1% Tween 20
containing 3% BSA (TBS/BSA), for 3 hours, and then incubated with one of the
following antisera: rabbit anti-mouse PDGFR-β antibody (sc432; Lot.L060; Santa Cruz
Biotechnology), rabbit anti-mouse p-Akt and Akt (#9271, #9272; Cell Signaling
5
Technology), rabbit anti-mouse p-Erk1/2 and Erk1/2 (#9101; Cell Signaling
Technology), rat anti-mouse VEGFR-2 antibody (Becton Dickinson Biosciences/Falcon),
goat anti-mouse VE-cadherin antibody (R&D Systems) or rabbit anti-human β-catenin
antibody (#9562; Cell Signaling Technology), rabbit anti-β-actin (#A-2066; Sigma) over
night at 4°C. The pPDGFR-β antibody 4 used, was generated against the phosphorylated
form of the major autophosophorylation site3 (Y857 in human, Y856 in the mouse) of the
PDGFR-β. After vigorous washing with TBS and blocking in TBS/BSA, the membrane
was incubated with peroxidase-conjugated anti-rabbit antibody, anti-rat antibody
(Amersham Biosciences) or anti-goat antibody (Santa Cruz Biotechnology).
Immunoreactive bands were visualized using the ECL Western blotting detection
reagents (Amersham Biosciences). For digital data analyses a FUJI CCD camera LAS1000 was used in combination with Advanced Image Data Analyzer (AIDA) software,
Version 3.10.
Immunohistochemistry
Embryoid bodies were fixed in zinc fix (0.1 M Tris HCl, pH 7.5, 3 mM calcium acetate,
23 mM zinc acetate and 37 mM zinc chloride) over night at 4°C. Quenching of
endogenous peroxidase activity was performed by 3% H2O2 in methanol during 30
minutes followed by blocking in TBS/BSA. Samples were incubated with rat anti-mouse
CD31 antibody (Becton Dickinson Biosciences/Falcon) diluted in blocking buffer and
incubated over night at 4°C. The primary antibody incubation was followed by washes
and incubation for one hour at room temperature with secondary biotinylated goat anti-rat
antibody (Vector Laboratories Inc.) diluted in blocking buffer and finally, a 30-minutes
6
incubation with streptavidin-HRP (Vector Laboratories Inc.). Immune reactivity was
visualized by the use of the chromogen substance (AEC kit from Vector Laboratories
Inc.). Slides were mounted with Ultramount aqueous mounting medium (DAKO) and
photographed in a Nikon Eclipse E1000 microscope. Quantification
of the area or length of CD31 staining (n=5 for each ES cell line and condition) was
performed with Easy Image Analysis software (Rainfall). Compensation for background
was performed to avoid quantification of unspecific staining. Statistical analysis was
done by unpaired Student’s t-test using the Stat View computer program.
Real-time RT-PCR analysis
Total RNA was extracted from day 8 wild type, D/V-1 and D/V-2 embryoid bodies.
Contaminating genomic DNA was digested with DNase I (Amersham Biosciences) and 1
µg total RNA was used for first strand cDNA synthesis using oligo dT primer and the
Advantage RT-for-PCR-Kit (Clontech Laboratories, Inc.). Primers used are listed in
Table 1. β-actin was used as endogenous reference and non-reverse transcribed RNA was
used as a negative control. The PCR samples, containing cDNA, primers (0.25 µM final
concentration) and 2x SYBR Green PCR master mix (Applied Biosystems), were run in
triplicate on an ABI Prism 7700 Sequence Detection System instrument (Applied
Biosystems) with an initial 10-minute activation at 95°C, followed by 45 cycles at 95°C
for 15 seconds and 60°C for 1 minute. The threshold cycle (CT) value was calculated for
each sample by the ABI Prism 7700 instrument. Transcript levels were then normalized
against β-actin levels and changes in transcript levels were expressed as relative values.
7
For each gene transcript and genotype single samples were run in triplicate from three
different embryoid body preparations. One such representative result is shown.
Generation and analysis of teratomas and immunofluorecsence staining
1 x 106 of wild type or PdgfrbD849V/+ ES cells diluted in 100 µl PBS were injected
subcutaneously on the dorsal side of female NMRI-nu mice (M&B Animal Models) and
teratomas were grown until they reached a size of approximately 1 cm3 (24 - 46 days).
Acetone-fixed frozen 6 µm sections were used for fluorescent staining for the endothelial
marker CD31. The sections were blocked in 3 % BSA in PBS and incubated with rat antimouse CD31 antibody (Becton Dickinson Biosciences/Falcon) for 1 hour at room
temperature followed by incubation with goat anti-rat Alexa 568 (Molecular Probes),
both diluted in 3 % BSA/PBS. Nuclei were stained by Hoechst 33342 (1 µg/ml) in PBS.
Results were analyzed using a Nikon Eclipse E1000 microscope. For morphometric
analysis, 7 µm sections from paraformaldehyde-fixed, paraffin-embedded teratomas were
used for chromogenic staining for the endothelial marker CD31. Sections were
deparaffinized and pre-treated in 10 mM citrate buffer (pH 6.0) for 2 x 7 minutes at 750
W in a microwave oven for antigen retrieval. Following quenching of tissue peroxidase
activity in 3 % H2O2 in PBS for 10 minutes and blocking in 20 % rabbit serum, the
sections were incubated with goat anti-mouse CD31 antibody (Santa Cruz
Biotechnology) at 4 °C over night. CD31 antibodies were detected using biotinylated
rabbit anti-goat antibodies and visualized by Vectastain ABC-AP kit (Vector
Laboratories). Five wild type and five P d g f r bD849V/+ teratomas were used for
8
morphometric analysis. Images were captured using a Leica DM4000 B/M microscope
equipped with a Leica 40X PH2 objective. The Leica Qwin V3 software was used to
measure the density of blood vessels (average number of vessels/mm2), average blood
vessel perimeter, and total blood vessel area (vessel area/ mm2). The teratomas were
analyzed pattern wise by 19 to 29 microscopy fields covering the total vascularized
section area and an average value was calculated for each tumor. P values were
calculated using Student’s t-test, two-sample unequal variance/two-tailed distribution.
We did not observe any difference in the relative contribution from the three embryonic
germ lineages between wild type and PdgfrbD849V/+ teratomas.
Table 1
Real-time RT-PCR primers
Gene product
Accession No
Sense primer (5’-3’)
Antisense primer (5’-3’)
α−SMA
X13297
CTGACAGAGGCACCACTGAA
AGAGGCATAGAGGGACAGCA
β-actin
XD3765
CACTATTGGCAACGAGCGG
TCCATACCCAAGAAGGAAGGC
CD31
NM_008816
TACTGCAGGCATCGGCAAA
GCATTTCGCACACCTGGAT
CD41
NM_010575
TGGCATGTTTCCAACCAGC
TCCCCGGTAACCATCGAA
PDGFR-β
NM_008809
GTGGTGAACTTCCAATGGACG
GTCTGTCACTGGCTCCACCAG
RGS5
NM_009063
TCATTTCAATCCTGCCCTTC
TGACAGGAGGCATCTGAGTG
Tal-1
NM_011527
GGCAGACAGAGACTGATCCTG
AGAAGCAAACACAGCTTTGGA
VE-cadherin
X83930
AGGACAGCAACTTCACCCTCA
AACTGCCCATACTTGACCGTG
VEGF-A
NM_009505
AAGGAGAGCAGAAGTCCCATGA
CTCAATTGGACGGCAGTAGCT
VEGFR-2
X59397
ACAGACCCGGCCAAACAA
TTCCCCCCTGGAAATCCTC
9
References
1.
Heuchel R, Berg A, Tallquist M, Ahlen K, Reed RK, Rubin K, Claesson-Welsh L,
Heldin CH, Soriano P. Platelet-derived growth factor beta receptor regulates
interstitial fluid homeostasis through phosphatidylinositol-3' kinase signaling.
Proc Natl Acad Sci U S A. 1999;96:11410-11415.
2.
Magnusson P, Rolny C, Jakobsson L, Wikner C, Wu Y, Hicklin DJ, ClaessonWelsh L. Deregulation of Flk-1/vascular endothelial growth factor receptor-2 in
fibroblast growth factor receptor-1-deficient vascular stem cell development. J
Cell Sci. 2004;117:1513-1523.
3.
Kazlauskas A, Cooper JA. Autophosphorylation of the PDGF receptor in the
kinase insert region regulates interactions with cell proteins. Cell. 1989;58:11211133.
4.
Chiara F, Goumans MJ, Forsberg H, Ahgren A, Rasola A, Aspenstrom P,
Wernstedt C, Hellberg C, Heldin CH, Heuchel R. A gain of function mutation in
the activation loop of platelet-derived growth factor beta-receptor deregulates its
kinase activity. J Biol Chem. 2004;279:42516-42527.
10