1032–1037 Nucleic Acids Research, 1998, Vol. 26, No. 4
 1998 Oxford University Press
Mutations in hamster single-strand break repair gene
XRCC1 causing defective DNA repair
M. Richard Shen, Malgorzata Z. Zdzienicka1, Harvey Mohrenweiser, Larry H. Thompson
and Michael P. Thelen*
Biology and Biotechnology Research Program, Lawrence Livermore National Laboratory, PO Box 808, L-452,
Livermore, CA 94550, USA and 1MGC–Department of Radiation Genetics and Chemical Mutagenesis,
Leiden University and J.A.Cohen Institute, Leiden, The Netherlands
Received October 6, 1997; Revised and Accepted December 9, 1997
ABSTRACT
The molecular basis for the DNA repair dysfunction
observed in mutant Chinese hamster ovary cell lines of
X-ray repair cross complementing group 1 (XRCC1) is
unknown and the exact role of the XRCC1 protein
remains unclear. To help clarify the role of the XRCC1
gene we analyzed four mutant cell lines of this
complementation group and a revertant cell line for
XRCC1 protein content and for sequence alterations in
the XRCC1 coding region. Immunoblot analysis of
cellular extracts indicated that each of four mutant
lines was lacking XRCC1 protein, whereas the repairproficient revertant line derived from one of these
mutants contained a normal level of XRCC1. Although
each of these cell lines expressed XRCC1 mRNA, we
found in all cases a distinct point mutation resulting in
crucial alterations in the encoded XRCC1 protein
sequence of 633 amino acids. Two of the mutations
cause non-conservative amino acid changes,
Glu102Lys and Cys390Tyr, at positions that are
invariant among hamster, mouse and human XRCC1
sequences and are located in putative functional
domains. A third debilitating mutation disrupts RNA
splicing, generating multiple transcripts of different
length that contain deletions spanning a region of >100
amino acids in the midsection of the XRCC1 coding
sequence. A fourth mutation results in a termination
codon that shortens the open reading frame to 220
amino acids, however, in the revertant cell line a further
mutation in the same codon, Stop221Leu, permits
translation of a full-length functional variant protein.
These mutational data indicate the importance of the
putative functional regions in XRCC1, such as the
BRCA1 C-terminal (BRCT) domain found in common
with BRCA1 and other DNA repair and cell cycle
checkpoint proteins, and also regions necessary for
interaction with DNA polymerase β and DNA ligase III.
INTRODUCTION
XRCC1 encodes a protein that functions in repair of single-strand
breaks in DNA, presumably through its interactions with DNA
DDBJ/EMBL/GenBank accession no. AF034203
ligase III (Lig III) (1,2) and DNA polymerase β (Pol β) (3,4). The
critical role of XRCC1 in the cellular response to DNA damage
was found when the repair defects of certain mutant Chinese
hamster ovary (CHO) cell lines were corrected by transfection
with the human XRCC1 gene (5), cDNA (6) or with the purified
XRCC1 polypeptide (7). These CHO cell lines, EM7 (8), EM9
(8) and EM-C11 (9), comprise the known members of X-ray
repair cross complementing group 1 (XRCC1). All cells in this
group are characterized by hypersensitivity to (m)ethylation
agents, sensitivity to ionizing radiation, accumulation of singlestrand breaks in DNA after damage and an unusually high
frequency of sister chromatid exchange (SCE) (9,10). These
characteristics appear to be unique among mammalian cell
mutants. EM9 and EM-C11 cells were found to be deficient not
only in XRCC1 protein (11) but also in Lig III (11,12), leading
to the prediction that mutations in XRCC1 might destabilize the
specific association between these two proteins (11).
The probable participation of XRCC1 in base excision repair
(BER) has been demonstrated by its interaction with proteins
known to function in this pathway. In a reconstituted system for
uracil removal using purified proteins, including Pol β and Lig III
(3), addition of XRCC1 inhibited the strand displacement activity
of Pol β, apparently limiting polymerization to 1 nt. However,
these in vitro experiments indicated that XRCC1 was not essential
for repair and no defect was seen in cellular extracts. Another base
excision repair protein, poly(ADP-ribose) polymerase (PARP),
which binds to nicks in DNA (13), may also form a complex with
XRCC1 (4). Although it is not clear from these studies what the
biochemical function of XRCC1 might be, it is apparent that in
the XRCC1 complementation group a critical step is disabled
during repair of some types of base damage. The notion that this
compromised step is close to or coupled with ligation following
repair synthesis is substantiated by the interaction between
XRCC1 and Lig III and by a requirement for XRCC1 for Lig III
stability (1,2,11,14).
The biological function of XRCC1 has also been examined in
mouse. Along with Lig III and Pol β, XRCC1 appears to have a
role in meiosis, as it is most highly expressed in mouse pachytene
spermatocytes (15). It is also essential for development, since
mouse embryos lacking the Xrcc1 gene are unable to survive past
8 days (16). Another indicator of biological function is given by
structural features recently found through sequence comparisons.
*To whom correspondence should be addressed. Tel: +1 510 422 6547; fax: +1 510 422 2282; Email: [email protected]
1033
Nucleic Acids
Acids Research,
Research,1994,
1998,Vol.
Vol.22,
26,No.
No.14
Nucleic
Even though there is no significant overall sequence homology
between mammalian XRCC1 protein and known proteins from
other organisms, a 90 amino acid peptide domain named after the
BRCA1 C-terminus (BRCT) was identified in XRCC1, Lig III
and also in PARP (17,18). The BRCT module appears to be a
feature retained in many DNA damage response and cell cycle
checkpoint proteins (17,18), such as human BRCA1, 53BP1,
Saccharomyces cerevisiae Rad9 and Dpb11 and Schizosaccharomyces pombe rad4(cut5). A similar domain has been located in the
interacting regions of the XRCC4 and DNA ligase IV proteins (19).
Since mutant cell lines of the XRCC1 complementation group
were classified by cellular hybridization studies and have not
been related directly to alterations in the XRCC1 gene, we
examined the status of XRCC1 mRNA, the coding sequence and
protein product. During this study a new mutant cell line was
characterized as a member of this complementation group. The
entire collection of mutant cells were found to contain abnormal
levels of XRCC1 protein, accompanied by point mutations in
XRCC1 that directly affect DNA repair function.
MATERIALS AND METHODS
The origins of CHO lines AA8, CHO9 and their derivatives are
given in Table 1. Cultivation conditions were described previously
(5). The TOR hybridization/selective system described earlier (9)
was used with polyethylene glycol-induced fusion of one doublemarked line (TOR, thioguanine-resistant and ouabain-resistant) to
one unmarked line. A population of hybrids (>100 clones) was
collected from each cross and then used to estimate survival
following EMS exposure and to determine the modal chromosome
number.
Table 1. CHO cell lines used in this study
Cell line origin
(reference)
CHO9
EM-C11
EM-C12
AA8
EM7
EM9
EM9R1
27
9
This study
28
8
8
23
EMS sensitivitya
8×
8×
10×
10×
∼1×b
genomic DNA isolation and protein extracts cells were trypsinized
and washed with 10 mM sodium phosphate, pH 7.4, 150 mM NaCl
(PBS). In the case of genomic DNA isolation pelleted cells from a
T75 rotor at 90% confluency were resuspended in 2 ml digestion
buffer (100 mM NaCl, 10 mM Tris–HCl, pH 8, 25 mM EDTA,
0.5% SDS and 0.1 mg/ml proteinase K) and processed as previously
described (20). For immunoblots cells were resuspended in 0.1 vol.
50 mM Tris–HCl, pH 8, 300 mM NaCl, 1 mM EDTA, 1 mM
dithiothreitol, 10% glycerol and lysed by sonication (3 × 30 s bursts
at half power using a microtip) and cellular debris removed by
centrifugation at 20 000 g. Cell extracts were stored in small
aliquots at –80C and used only once after thawing.
Irradiation
To estimate the sensitivity of the cell lines to X-ray exposure cells
were irradiated in medium at a dose rate of 3 Gy/min (200 kV, 4 mA,
0.78 mm Al). For irradiation with UV light of 254 nm a Philips TUV
germicidal lamp was used with a fluence rate of 0.19 W/m2,
measured with an IL/770 germicidal radiometer.
Survival curves
Cell culture
CHO cell line
1033
Cultures in exponential growth were trypsinized and 300–3000
cells were plated, in duplicate, on 10 cm dishes and left to attach
for 4 h. Cells were then either irradiated or treated with mitomycin
C (MMC) or ethylmethane sulfonate (EMS) for 24 or 1 h
respectively. After chemical treatment the medium was removed
and cells were rinsed twice with PBS. Normal medium was then
added and cells were incubated for 8–10 days. After incubation
dishes were rinsed with NaCl (0.9%), air dried and stained with
methylene blue (0.25%) and visible colonies counted. Each
survival series was carried out at least three times for statistical
evaluation.
Immunodetection
Sensitivity
(reference)
This study, 24
9
This study
5
5
5
23
aBased
on D10 or D37 values of survival curves.
hypersensitivity was extrapolated from the SCE level, which was very
close to the wild-type level, i.e. 98% corrected (26).
bThe
Cell extracts
Total RNA was isolated from cell lines grown in T150 tissue
culture flasks to 80% confluency. After discarding the culture
medium cells were lysed directly in the flask with 5 ml denaturing
solution (4 M guanidinium thiocyanate, 25 mM sodium citrate,
pH 7, 0.1 M β-mercaptoethanol and 0.5% N-lauroylsarcosine)
and processed as previously described (20). Poly(A)+ mRNA was
isolated using the PolyATtract mRNA isolation system according
to the manufacturer’s instructions (Promega, Madison, WI).
Isolated RNA was stored at –80C as an ethanol precipitate. For
Protein extracts from CHO cell lines were separated by SDS–
PAGE and transferred to a polyvinylidene difluoride (PVDF)
membrane using a blotting apparatus (BioRad Inc., Richmond,
CA) at 20 V overnight. Protein molecular mass markers were
detected using the S-tag system from Novagen Inc. (Madison,
WI). XRCC1 protein was detected using a polyclonal antibody
raised in mice against the human XRCC1 polypeptide, obtained by
bacterial overexpression and purified as described previously (11).
The antibody was isolated by protein A affinity chromatography and
further purified using a column containing immobilized S-peptide–
XRCC1 fusion protein (Thelen, unpublished data). After washing
the membrane a secondary anti-mouse IgG labeled with fluorescein
isothiocyanate (FITC)–alkaline phosphatase (BioRad) was applied
and processed for enhanced chemifluorescence using a Storm
Phosphorimager (Molecular Dynamics Inc., Sunnyvale, CA).
The scanned image was quantitated according to the manufacturer’s
instructions using background subtraction for each band representing XRCC1. At least four experiments were performed for each of
the cell extracts.
RT-PCR and sequence determination
Hamster XRCC1 cDNAs were sequenced by a strategy employing
direct sequencing of PCR products generated from cross-species
RT-PCR. The cDNA was amplified in five overlapping segments
to facilitate direct sequencing. Since the nucleotide sequence of
1034 Nucleic Acids Research, 1998, Vol. 26, No. 4
the hamster XRCC1 cDNA was not known, PCR primers
(Table 2) were directed to the most highly conserved regions of
the mouse and human XRCC1 cDNAs and were chosen to match
the mouse sequence. Most of the hamster XRCC1 cDNA coding
sequence could be amplified in four PCR products. Once some
hamster cDNA sequence was available, additional PCR primers
were designed that amplified regions that could not be amplified
previously with primers matching mouse sequences. 5′-RACE
was performed to obtain the nucleotide sequence of the 5′-region
of the XRCC1 cDNA. The 5′-RACE System (Life Technologies,
Rockville, MD) was used according to the manufacturer’s
instructions. The unique PCR primers for 5′-RACE are listed in
Table 2. These unique primers were used along with the provided
anchor primers for the 1 and 2 nested PCR reactions.
Appended to the 5′-end of the PCR primers were DNA sequencing
primer binding sites for the forward or reverse DYEnamic ET
primers (Amersham Life Science, Cleveland, OH).
First strand cDNA substrates for PCR were generated using an
oligo(dT) primer and the Superscript Preamplification kit according
to the manufacturer’s instructions (Life Technologies). The first
strand cDNA reactions were performed on 5 µg total RNA for all
cell lines except for EM9, in which 500 ng poly(A)+ RNA was used.
PCR reactions were performed in a 50 µl volume using a
hot-start format. The final components of the reaction were as
follows: 1× PCR buffer (10 mM Tris–HCl, pH 8.3 at 20C, 1.5 mM
MgCl2, 50 mM KCl), 200 mM each dNTP, 0.5 µM each primer,
1.25 U Taq DNA polymerase (Boehringer Mannheim,
Indianapolis, IN) and 2 µl unpurified first strand cDNA product
or 50 ng genomic DNA. All the reaction components except for Taq
DNA polymerase were combined in a 40 µl volume. The reactions
were then placed in a Perkin Elmer 9600 GeneAmp thermocycler
and subjected to the following thermocycle conditions: initial
denaturation at 94C for 5 min (during which the Taq DNA
polymerase in 10 µl 1× PCR buffer was added to the reaction
mix); 35 cycles of denaturation at 94C for 30 s, primer annealing
at 63C for 45 s and primer extension at 72C for 1 min; a final
incubation at 72C for 7 min. PCR products were then analyzed
in a 2% agarose gel containing 1× TAE buffer.
Prior to DNA sequencing the PCR reactions were digested with
exonuclease I and calf intestinal alkaline phosphatase to remove
excess primers and dNTPs (21). We found that calf intestinal
alkaline phosphatase substituted equally for shrimp alkaline
phosphatase and saw no decrease in sequence quality. The PCR
reactions (5 µl) were added to 5 µl digestion mix (containing
2.5 U exonuclease I and 2.5 U calf intestinal alkaline phosphatase
in 10 mM Tris–HCl, pH 8.3 at 20C, 1.5 mM MgCl2, 50 mM
KCl) and incubated at 37C for 60 min. The enzymatic digestions
were terminated by heating the reaction to 75C for 15 min. The
treated PCR products were diluted 5-fold by addition of 40 µl
10 mM Tris–HCl, pH 8, 0.1 mM EDTA prior to direct use in
sequencing reactions. The DYEnamic direct cycle sequencing kit
with the –40 M13 forward and –28 M13 reverse DYEnamic ET
primers (Amersham Life Science, Cleveland, OH) were used for
sequencing of the PCR products. The sequencing reactions were
set up as per the manufacturer’s instructions. The thermocycle
conditions were as follows: 25 cycles of 95C for 30 s, 50C for
5 s and 72C for 1 min. Following the thermocycle protocol the
A, C, G and T reactions were pooled and ethanol precipitated. The
precipitated products were washed with 70% ethanol and
evaporated to dryness under vacuum. The precipitated sequencing
products were resuspended in 6 µl of the provided formamide
loading dye, heat denatured at 70C for 3 min, quenched on ice
and 2.5 µl were then loaded into a Applied Biosystems 373 stretch
DNA sequencer.
Initial data analysis (lane tracking and base calling) was
performed with the ABI prism DNA sequencing analysis
software. Chromatograms generated by the ABI sequencing
analysis software were then transfered to a Unix workstation and
further analyzed with the Phred, Phrap and Consed programs.
Base calls and quality values were set by Phred, sequences were
assembled with Phrap and the resultant data was displayed with
Consed (documentation is available through http://www.
genome.washington.edu). Point mutations in the hamster XRCC1
cDNA and splice site sequence were identified by comparisons
with the parental cell lines (AA8 or CHO9).
Table 2. Oligodeoxyribonucleotide primers used in RT-PCR
Sequencea
d(F-CCAGGACTCGACCCATTGT)
d(R-ATCCTCCTCTTTCACACGA)
d(F-GACGAGGCGGAGACTCCAT)
d(R-GGCAAAGGCACAGATGAGG)
d(F-GCTCAGTGGCTTCCAGAAC)
d(R-ACGGGTCCTCGCCATTCTC)
d(F-ACACCGAGGATGAACTGAG)
d(R-CTCAGGCCTGGGGCACCAC)
See above
Sourceb
Mouse
Mouse
Hamster
Hamster
Mouse
Mouse
Mouse
Mouse
4.2
Primer
F1s_3.Xr1
R1a_1.Xr1
F2s_2.Xr1
R2a_2.Xr1
F3s_1.Xr1
R3a_1.Xr1
F4s_1.Xr1
R4a_1.Xr1
F4s_1.Xr1
R4a_2.Xr1
F3s_1.Xr1
d(R-CGTGTGCACTCAGGCCTGT)
See above
Mouse
Intron 8
5′-RACE (1)
5′-RACE (2)
R2a_3.Xr1
5rce_a1
5rce_a2
d(R-CCGCAGGCGGTAACAGTCCA)
d(GTCACCAGCACCTCTACGAA)
d(GCTCCTCCTTCTCCAACTGT)
Hamster
Hamster
Hamster
Segment
1
2
3
4.1
aF
and R represent appended sequences of primer binding sites for the forward and reverse sequencing primers respectively.
sequences are derived from this sequence source.
bPrimer
1035
Nucleic Acids
Acids Research,
Research,1994,
1998,Vol.
Vol.22,
26,No.
No.14
Nucleic
Figure 1. Sensitivity of EM-C12 mutant cells to DNA damaging agents. CHO9
and mutant EM-C12 cells were irradiated with either X-rays or 254 nm UV at the
doses indicated or treated with MMC or EMS at the concentrations in culture as
indicated. The values given are the mean of at least three experiments. Standard
deviation from the mean is given as half-vertical bars. ●, CHO9; f, EM-C12.
RESULTS AND DISCUSSION
Mutant CHO cell lines forming the XRCC1 complementation
group
To identify mutations within XRCC1 responsible for the defective
DNA repair seen in CHO mutant cells, we analyzed the
EMS-hypersensitive cell lines in the XRCC1 complementation
group. Previous studies reported isolation of three mutants in this
group (8–10). As summarized in Table 1, the mutants originated
from two different CHO lines, AA8 and CHO9. Line EM9R1, an
EMS-resistant phenotypic revertant of EM9, was derived by UV
mutagenesis and EMS selection (23).
A new EMS-sensitive mutant, EM-C12, was isolated from an
N-ethyl-N-nitrosourea (ENU)-mutagenized population of CHO9
cells on the basis of its hypersensitivity to EMS, by replica plating
as described earlier (24). In the initial screen two clones,
EMC-12a and EM-C12b, were isolated that maintained their
EMS sensitivity for several months of continuous culture. Based
on genetic complementation analyses (results not shown), these
two cell lines were assigned to the EM-C11/EM9 complementation
group. Nucleotide sequence data (see below) determined that
EMC-12a and EM-C12b contained the same mutation and were
apparently subclones of a single mutant, named here EM-C12.
EM-C12 was characterized by cell survival analysis for several
DNA damaging agents (Fig. 1). In comparison with the wild-type
line, EM-C12 cells were only moderately sensitive to irradiation
by UV and X-rays (1.5- and 1.7-fold sensitive at 37% survival
1035
Figure 2. Analysis of XRCC1 protein levels in CHO cell extracts. Cellular
protein (50 µg) from each extract was processed for immunodetection using
affinity-purified polyclonal antibody specific for XRCC1. (A) Composite
fluorescence image from two membranes. Hamster XRCC1 protein was
detected at a position in the gel corresponding to human XRCC1 expressed in
hamster cells (not shown) and with an estimated mass of 80 kDa compared with
standard protein markers. (B) Quantification of XRCC1 protein levels. Signal
intensities for XRCC1 from AA8 and EM9R1 were averaged for three
individual experiments and expressed as the fraction relative to the CHO9
values (relative fluorescence). Standard deviation from the mean is given as
vertical bars. –, the signal for XRCC1 was below the detection threshold (<10%
of the CHO9 sample) in five separate experiments.
respectively) and to exposure with the crosslinking agent MMC
(1.8-fold sensitive). In contrast, these cells were 8-fold more
sensitive to treatment with the alkylating agent EMS than the
parental line, a level of sensitivity similar to mutant lines EM-C11
(9), EM7 and EM9 (5).
Absence of XRCC1 protein in mutant CHO cell extracts
The CHO cell lines listed in Table 1 were examined for the
presence of XRCC1 protein by immunoblot analysis. Previous
immunoblot experiments using a monoclonal antibody found no
full-length protein in EM9 and EM-C11 cell extracts (11). To
increase detection sensitivity and also to observe any truncated
XRCC1 polypeptides (i.e. multiple epitopes), we have produced
a mouse polyclonal antibody specific for XRCC1. Using a high
sensitivity fluorescence detection system we consistently observed
the presence of XRCC1 protein in extracts from the repair-proficient
cell lines, whereas neither full-length nor lower molecular weight
forms of XRCC1 were detected in extracts from the repair-deficient
mutant cells (Fig. 2A). These results are consistent with the
destabilizing effect of mutations in other proteins and, moreover,
confirm the previous report of XRCC1 deficiency in EM9 and
EM-C11 cells (11). Quantification of the fluorescence signal
indicated that the revertant EM9R1 cells contain a level of
XRCC1 protein that is consistent with the wild-type AA8 and
CHO9 cells (Fig. 2B).
1036 Nucleic Acids Research, 1998, Vol. 26, No. 4
Table 3. Mutations in hamster XRCC1
Cell line
EM-C12
EM-C11
EM9
EM9R1
EM7
aHamster
Codon
102
390
221
221
Intron 8
Nucleotide positiona
304
1169
661
662
Base change
GAG→AAG
TGT→TAT
CAG→TAG
TAG→TTG
AG→TG
Type of change
Missense
Missense
Stop
Revertant
Splice acceptor
(Cricetulus griseus) XRCC1 coding sequence, accession no.
AF034203
Identification of mutations in the hamster XRCC1 coding
sequence
To determine whether the phenotype that characterizes these
CHO mutants arises from alterations in the XRCC1 cDNA, we
sequenced the hamster XRCC1 ORF from each cell line by
cross-species RT-PCR. Mutation analysis was simplified by the
fact that CHO lines are hemizygous for XRCC1 (22). As
evidenced by the ability to obtain portions of the XRCC1 cDNA
after reverse transcription of RNA from each cell line, the mutants
are capable of expressing the XRCC1 gene. Sequence analysis
revealed point mutations within the cDNAs of all the cell lines
(Table 3) and these nucleotide changes result in significant
alterations in the encoded amino acid sequence (Fig. 3).
EM-C12 cells contain a GA substitution at nt 304, causing
a GluLys change at residue 102 (E102K) and therefore
altering the charge at that position from negative to positive
(Fig. 3). This Glu residue is strictly conserved in the mammalian
homologs of XRCC1. Since this mutation is in the region of the
XRCC1 protein demonstrated to interact with Pol β (3,4), the
negative charge in the native protein is likely to be crucial for
protein–protein binding; alternatively, the change in charge may
have a deleterious effect on XRCC1 protein folding and therefore
also on protein–protein interactions.
The mutation found in EM-C11 cells, a GA substitution at nt
1169, results in a C390Y amino acid change. The Cys residue
at this position, again strictly conserved in the mammalian
XRCC1 homologs, is also conserved among many of the DNA
repair and cell cycle checkpoint proteins containing the recently
identified BRCT domain (Fig. 3; 17,18). Substitution of a Cys,
one of only six cysteines in XRCC1, could disrupt normal
disulfide formation and result in incorrect protein folding.
Moreover, replacing the sulfhydryl group of Cys with the bulky
hydrophobic group of Tyr could alter protein folding. This is the
first reported amino acid substitution in a BRCT domain that
leads to a loss of DNA repair function, a phenomenon that would
be predicted based on the widespread presence and the degree of
conservation of this domain in DNA damage-responsive proteins
(17,18).
Both BRCT modules are deleted from XRCC1 as a result of a
CT substitution found in EM9 cells. In this case the mutation
at nt 661 introduces a termination codon TAG only one third of
the way into the coding sequence and results in a truncated
polypeptide of 220 residues (Fig. 3). The C-terminal region of
XRCC1, overlapping with the BRCT-b domain, is known to
interact with Lig III (1,2), perhaps through a similar BRCT
module located at the C-terminus of Lig III. XRCC1 protein only
complexes with the longer of two alternatively spliced versions
Figure 3. Amino acid sequence alignment of hamster XRCC1 and mammalian
homologs. Hamster (Cg) deduced amino acid sequence was compared with the
mouse (Mm) and human (Hs) sequences using the ClustalW alignment
program (29) and displayed here to indicate differences among sequences. …,
residues identical with the hamster sequence; larger bold letters, sites of
mutations in CHO cell lines, with the mutations found in each cell line given
below. Annotations above the sequences indicate functional regions as
described in the text. The hamster XRCC1 amino acid sequence is 90%
identical to that of mouse and 84% to that of human.
of Lig III (2), in which the BRCT domain is present, substantiating
the notion that this sequence module in one protein might be
interacting with a similar module in the other. Furthermore, the
BRCT domain also appears to be necessary for an analogous
interaction between DNA ligase IV and XRCC4, a double-strand
break repair protein (19). The critical nature of this sequence
module can be seen by its loss due to a similar mutation,
1853Stop, in the human BRCA1 gene, leading to early onset
breast cancer (25).
In the revertant EM9R1 the mutant TAG originating from the
EM9 cell line is changed to TTG (AT at nt 662), thereby
changing Stop221 to Leu. Although this results in an amino acid
change at a strictly conserved Gln, Q221L, the near normal
SCE level in EM9R1 cells indicates that the mutant protein is
fully functional (26). The amount of XRCC1 protein detected in
EM9R1 was comparable with that in AA8 cells (see Fig. 2B),
1037
Nucleic Acids
Acids Research,
Research,1994,
1998,Vol.
Vol.22,
26,No.
No.14
Nucleic
1037
preparation and immunodetection, to S.Corzett and Dr R.Balhorn
for supplying samples of human XRCC1 protein that were used
as antigen, to B.Bruce for helpful suggestions on DNA sequencing
and to Drs D.Wilson and S.McCutchen-Maloney for critical
comments on the manuscript. This research was performed under
the auspices of the US DOE by LLNL under contract no.
W-7405-ENG-48 and supported by European Union grant
F14PCT90010 to M.Z.
REFERENCES
Figure 4. Aberrantly spliced XRCC1 transcripts in EM7 cells. The mutation in
EM7 is in the splice acceptor site of intron 8 and results in deletion of exon 9
as shown in this schematic. The splice donor site of intron 8 aberrantly joins
with cryptic splice sites within exon 9 and the splice acceptor site of intron 9.
suggesting that Leu221 does not alter the stability of XRCC1 in
vivo.
The final mutation in the XRCC1 complementation group was
identified in genomic DNA from EM7 cells, in the putative splice
site preceding exon 9. The first indication of a splicing
abnormality was observed when multiple cDNA products of
differing lengths were amplified from RNA of EM7. In this case
an AT substitution in the splice acceptor AG of XRCC1 intron
8 results in two different transcripts (EM7a and EM7b) containing
short in-frame deletions in exon 9 and one out-of-frame transcript
(EM7c) from splicing of exon 8 into exon 10 (Fig. 4). These
variants occur as a consequence of faulty RNA processing with
cryptic splice acceptor sequences downstream. Once again, the
mutation affects the BRCT-a module (see Fig. 3), causing
complete loss of the Cys at residue 390 (discussed above) and also
flanking amino acids such as Trp386, the most highly conserved
residue in this domain (17,18).
In conclusion, all of the nucleotide sequence alterations
identified here were found in the XRCC1 ORF. Each of the
mutations results in a severe reduction in the level of XRCC1
protein and in the cellular capacity to repair strand breaks and
certain kinds of base damage (9,10). It is likely that the primary
result of these mutations is to destabilize XRCC1 through
improper protein folding or through disruption of
XRCC1-specific complex formation caused by alteration of
critical contact residues. Complexes that are likely to be affected
are between XRCC1 and Pol β, Lig III and perhaps PARP (see
Fig. 3). Furthermore, disabled interactions between these proteins
could destabilize more than one of the other complex partners, as
appears to be the case where both XRCC1 and Lig III are absent
in cells containing a mutation in XRCC1 (11). Finally, the
mutations in the BRCT-a domain of XRCC1 help to establish the
biological significance of this sequence module.
ACKNOWLEDGEMENTS
The authors are grateful to M.Hwang, K.Brookman and L.Wetselaar
for excellent technical assistance in cell culture, antibody
1 Nash,R.A., Caldecott,K.W., Barnes,D.E. and Lindahl,T. (1997) Biochemistry,
36, 5207–11.
2 Mackey,Z.B., Ramos,W., Levin,D.S., Walter,C.A., McCarrey,J.R. and
Tomkinson,A.E. (1997) Mol. Cell. Biol., 17, 989–998.
3 Kubota,Y., Nash,R.A., Klungland,A., Schar,P., Barnes,D.E. and Lindahl,T.
(1996) EMBO J., 15, 6662–6670.
4 Caldecott,K.W., Aoufouchi,S., Johnson,P. and Shall,S. (1996)
Nucleic Acids Res., 24, 4387–4394.
5 Thompson,L.H., Brookman,K.W., Jones,N.J., Allen,S.A. and Carrano,A.V.
(1990) Mol. Cell. Biol., 10, 6160–6171.
6 Caldecott,K.W., Tucker,J.D. and Thompson,L.H. (1992) Nucleic Acids Res.,
20, 4575–4579.
7 Caldecott,K.W. and Thompson,L.H. (1994) Ann. NY Acad. Sci., 726,
336–339.
8 Thompson,L.H., Rubin,J.S., Cleaver,J.E., Whitmore,G.F. and Brookman,K.
(1980) Somat. Cell Genet., 6, 391–405.
9 Zdzienicka,M.Z., van der Schans,G.P., Natarajan,A.T., Thompson,L.H.,
Neuteboom,I. and Simons,J.W. (1992) Mutagenesis, 7, 265–269.
10 Thompson,L.H., Brookman,K.W., Dillehay,L.E., Carrano,A.V., Mazrimas,J.A.,
Mooney,C.L. and Minkler,J.L. (1982) Mutat. Res., 95, 427–440.
11 Caldecott,K.W., Tucker,J.D., Stanker,L.H. and Thompson,L.H. (1995)
Nucleic Acids Res., 23, 4836–4843.
12 Ljungquist,S., Kenne,K., Olsson,L. and Sandstrom,M. (1994) Mutat. Res.,
314, 177–186.
13 de Murcia,G. and de Murcia,J.M. (1994) Trends Biochem. Sci., 19, 172–176.
14 Caldecott,K.W., McKeown,C.K., Tucker,J.D., Ljungquist,S. and
Thompson,L.H. (1994) Mol. Cell. Biol., 14, 68–76.
15 Walter,C.A., Trolian,D.A., McFarland,M.B., Street,K.A., Gurram,G.R. and
McCarrey,J.R. (1996) Biol. Reprod., 55, 630–635.
16 Tebbs,R.S., Meneses,J.J., Pedersen,R.A., Thompson,L.H. and Cleaver,J.E.
(1996) Environ. Mol. Mutagen., 27 (suppl. 27), 68 (abstract).
17 Bork,P., Hofmann,K., Bucher,P., Neuwald,A.F., Altschul,S.F. and
Koonin,E.V. (1997) FASEB J., 11, 68–76.
18 Callebaut,I. and Mornon,J.P. (1997) FEBS Lett., 400, 25–30.
19 Critchlow,S.E., Bowater,R.P. and Jackson,S.P. (1997) Curr. Biol., 7, 588–598.
20 Ausubel,F.M., Brent,R., Kingston,R.E., Moore,D.D., Seidman,J.G.,
Smith,J.A. and Struhl,K. (eds) (1992) Current Protocols in Molecular
Biology. Green Publishing Associates and Wiley-Interscience, New York, NY.
21 Werle,E., Schneider,C., Renner,M., Volker,M. and Fiehn,W. (1994)
Nucleic Acids Res., 22,4354–4355.
22 Thompson,L.H., Bachinski,L.L., Stallings,R.L., Dolf,G., Weber,C.A.,
Westerveld,A. and Siciliano,M.J. (1989) Genomics, 5, 670–679.
23 Dillehay,L.E., Thompson,L.H., Minkler,J.L. and Carrano,A.V. (1983)
Mutat. Res., 109, 283–296.
24 Zdzienicka,M.Z. and Simons,J.W. (1987) Mutat. Res., 178, 235–244.
25 Friedman,L.S., Ostermeyer,E.A., Szabo,C.S., Dowd,P., Lynch,E.D.,
Rowell,S.E. and King,M.-C. (1994) Nature Genet., 8, 399–404.
26 Carrano,A.V., Minkler,J.L., Dillehay,L.E. and Thompson,L.H. (1986)
Mutat. Res., 162, 233–239.
27 Burki,H.J., Lam,C.K. and Wood,R.D. (1980) Mutat. Res., 69, 347–356.
28 Thompson,L.H., Fong,S. and Brookman,K. (1980) Mutat. Res., 74, 21–36.
29 Thompson,J.D., Higgins,D.G. and Gibson,T.J. (1994) Nucleic Acids Res.,
22, 4673–4680.