Promoters and Plasmid Vectors of Corynebacterium

Promoters and Plasmid Vectors
of Corynebacterium glutamicum
Miroslav Pátek and Jan Nešvera
Contents
1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2 Promoters of Corynebacterium glutamicum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.1 Promoters of Housekeeping Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.2 Promoters Recognized by SigB . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.3 Promoters Recognized by SigH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.4 Promoters Recognized by SigM . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.5 Multiple Promoters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.6 Leaderless Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.7 Discovering Promoters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3 Plasmid Vectors for Corynebacterium glutamicum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.1 Native Plasmids of Corynebacteria Used for Vector Construction . . . . . . . . . . . . . . . . . .
3.2 Cloning Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.3 Promoter-Probe Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.4 Expression Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
4 Concluding Remarks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
52
52
53
58
60
61
62
64
65
66
66
69
73
76
79
79
Abstract The promoters and plasmids of Corynebacterium glutamicum can
be viewed as subjects for genetic examination, tools for studies of gene expression, and a means for the improvement of industrial strains. Various classes of
C. glutamicum promoters, their specific functions in gene expression control, and
methods for their analysis are described in this review. C. glutamicum promoters
recognized by RNA polymerase with a specific sigma factor (SigA, SigB, SigH, or
SigM) were localized and their consensus sequences determined. Experimental
localization of transcriptional start points revealed complex gene expression
M. Pátek (*) • J. Nešvera
Institute of Microbiology, Academy of Sciences of the Czech Republic, v. v. i., Vı́deňská 1083,
14220 Prague 4, Czech Republic
e-mail: [email protected]
H. Yukawa and M. Inui (eds.), Corynebacterium glutamicum,
Microbiology Monographs 23, DOI 10.1007/978-3-642-29857-8_2,
# Springer-Verlag Berlin Heidelberg 2013
51
52
M. Pátek and J. Nešvera
regulation features, such as overlapping multiple promoters. An overview of native
plasmids used for the construction of C. glutamicum vectors and examples of vectors
applied in genetic analysis are provided. In addition to basic cloning vectors, specialpurpose vectors are described. This includes promoter-probe vectors for the analysis
of promoter activity profiles and various regulatory mechanism and expression
vectors, which carry promoters as efficient signals for gene expression.
1 Introduction
The control of transcription initiation is the primary regulatory step of gene expression in bacteria. Promoters are major transcriptional signals and knowing more
about them is essential to understanding the regulatory mechanisms of gene expression in the organism studied. Analyses of general sequence patterns of Corynebacterium glutamicum promoters (Pátek et al. 1996, 2003; Nešvera and Pátek 2008) and
mutational studies of particular C. glutamicum promoters (Vašicová et al. 1999;
H€anssler et al. 2009) contributed to their description and provided sequence
modifications useful for the modulation of gene expression in industrially important
strains (Asakura et al. 2007; Holátko et al. 2009). Determination of the transcriptional start points (TSPs) and consequent localization of the respective promoters of
particular genes facilitated the analysis of transcriptional control by DNA-binding
protein regulators (for review, see Schr€
oder and Tauch 2010). Plasmids and cloning
vectors constructed on the basis of those plasmids are genetic elements that are also
intensively studied and practically used. The structure and genetic characteristics of
several native plasmids isolated from C. glutamicum have been described and some
of them used for the construction of vectors (Kirchner and Tauch 2003). In addition
to cloning vectors, special-purpose vectors have been constructed for both genetic
analysis and practical purposes for C. glutamicum. Promoter-probe vectors are used
for screening promoters and analyzing their functional profiles under various cell
growth conditions. Expression vectors are tools for regulated or enhanced expression of the analyzed genes. Well-described promoters function as construction
elements of these vectors driving transcription of the chosen genes.
2 Promoters of Corynebacterium glutamicum
The search for the promoters and determination of their key DNA sequences began
in parallel with descriptions of the gene organization in C. glutamicum (Peoples
et al. 1988; von der Osten et al. 1989; Marcel et al. 1990) and analyses of gene
expression control mechanisms. The analysis of randomly cloned promoters from
the C. glutamicum genome together with those found mostly in amino acid biosynthesis genes, providing in total 33 promoter sequences, elucidated the basic features
of the supposed promoters of housekeeping genes (Pátek et al. 1996). Determining
Promoters and Plasmid Vectors of Corynebacterium glutamicum
53
the complete genome sequence of C. glutamicum ATCC13032 (Ikeda and
Nakagawa 2003; Kalinowski et al. 2003) and C. glutamicum R (Yukawa et al.
2007) and annotation of genes for seven sigma subunits of RNA polymerase
(RNAP) accelerated the discovery of C. glutamicum promoters recognized by
alternative sigma factors and studies of their role in the cell response to specific
environmental stimuli (Larisch et al. 2007; Nakunst et al. 2007; Ehira et al. 2009).
In this review, classes of promoters recognized by individual sigma subunits of
RNAP, their consensus sequences, specific features of their localizations and
functions, and methods of their analysis are described.
2.1
Promoters of Housekeeping Genes
Promoters are major regulatory signals that bind RNAP and control transcription
initiation. The bacterial RNAP, which has catalytic activity but a nonspecific affinity
to DNA, consists of the subunits a2, b, b0 , and o. In addition to these subunits, the
RNAP holoenzyme contains a dissociable sigma subunit (sigma factor) that is
responsible for the specific recognition of promoter sequences. Bacterial genomes
encode a principal sigma factor which is involved in initiating the transcription
of housekeeping genes and a variable number of alternative sigma factors. Alternative sigma factors direct RNAP to different classes of promoters. C. glutamicum
ATCC13032, as well as C. glutamicum R, encode seven sigma factors: primary SigA
and alternative SigB, SigC, SigD, SigE, SigH, and SigM (Brinkrolf et al. 2007). The
principal sigma factor, SigA, which belongs to Group 1 according to the categorization by Gruber and Gross (2003), is essential for cell viability and is most probably
responsible for the transcription of most of the genes (housekeeping genes). It is
difficult to unequivocally specify which promoters are SigA dependent, since the
sigA gene could not be inactivated. sigA gene expression is relatively high during the
exponential growth phase of C. glutamicum batch cultures and decreases sharply in
the transition phase (Larisch et al. 2007). We may therefore suppose that most
promoters, which are active in the exponential phase, are SigA dependent.
The promoter consensus sequence may be derived from a statistical analysis of the
respective sequences. According to such an analysis of the available C. glutamicum
promoter sequences, which were deduced from the positions of the experimentally
determined TSPs of genes expressed within the exponential phase, the basic structure
of these promoters generally conforms to the pattern of eubacterial promoters
recognized by the primary sigma factor (Fig. 1). The basic structure of a promoter,
recognized by the primary Escherichia coli sigma factor, sigma 70 (encoded by
rpoD), consists of two conserved hexamers centered approximately at positions 35
and 10 relative to the TSP and of the nonspecific spacer of 17 1 nucleotides (nt)
between them. The core hexamer TANAAT of the 10 region had already been
derived from 33 sequences in a study of C. glutamicum promoters (Pátek et al. 1996).
The consensus sequence within the 35 region ttGc/gca, found in 58 promoter
54
Gene
M. Pátek and J. Nešvera
-35
-10
+1
aceE
ACGTCACAGTCTGTAAAAC--AAATCTTCGGTGTTGCGTATCCTTGTTAATA
acn
AAGAACCCCAACTTTCCCGC--CAGAACGCTTGTACTGTTAGGATAATGAAG
adhA
ACTCAACTTTCTATTTTCA--CCTTATTGGGATTTCGCTAGGGTGGACGATG
aecD
GGGCTCCTTCTTAGTAATAGG--TTCGTAGAAAAGTTTACTAGCCTAGAGAG
ald
TAACGGGGGTTCTAGCGC--GGATTGATTTTCGTGAATATGGTGGCTGCTAA
arnA P1
GCTGCTGTGTGAGGTAAA--GCTGCGGACATAGTATGTTCTTTCAGGCTGTG
cg0042
CGGACGCTGAGTTCTGCCA-TTCCTTAATGATAACGGTTATCATTTTCAAA
cg0043
GCGTCAGTAAAAAACTTCAT--TTGAAAATGATAACCGTTATCATTAAGGAA
cg0794
CTTGACTTTATTGAAAACA--ATTTCCATTAAGAAGTGTACACTTGCGTCG
cg0795
TTTGGGAATCATTTTCAA--TAGAGTCGACGCAAGTGTACACTTCTTAATGG
cg2118
AAACATTTGGATATTGACA-AACAAACACATATCAACATAGCGTGTTGTTA
cg2810
GGTCACACTAATGCAATAA--ATTCCTGTCTACAGCGTTACAGTTAATGAAT
cg2911
ATAAGTTTTCATGTTGACA--TCCTTTTTCAATAAGCATTTAATGGCAGGTA
cg3226
TTTTCCACACCCCATTGACA-ATTAAAGGTGACACGCCTTACATTCTTGTG
cg3372 TGTGAATAAAACACCTTCCCC--AAATAGACAGCATGGTCTAGATTAGCTTG
citH
AATGCACCAAACACTTCTGTG--CGTGACACGCGCCACCTTATACTCCCACA
clgR P2 TTGACCATATTGAGTCGCAG--TGACTCAAGTTTCCAGGTAAACTGGGAAC
clpB P2
CGGGTTTACCCTGATGTTT--AAGTGGCAGTCAGTGCTTAAACTTGACTGTG
clpC P1 GCTGAAAAAGTCTGGAAGTT--TTGCCCAATAAGGGCGTTAAAGTGGGTGAA
clpP1 P2 GATAGCGAACAGAGGCGGTT--TCATGGAAATACGCGGGTAGTCTGGTGAC
cysI
GAATCTAATGGTTGGTC-TAGACAGAGCGGTACGTCTAAGTTTGCGGATAG
cysR
ACAAGACCCCTATTAGACA-GCGTTGTCTATGATTGGCTATGGTTTACCTA
divS P1 AACGGTATTGGTGTTCGAAC--GTGTCGTGGCTAAAAGTTAAGATGTGGGCA
divS P2
TAAATCTTCTCTAGACA-ACGTTCGAACGGGGTGCTATAAATCGAACATAG
dnaK P1 GTTGGAACAACTTTGTGGCAT-TTACCGTTGCTATATATGTAAGCTTGAGT
eno
TTTCAACTGATTGCCTCA-TCGAAACAAGATTCGTGCAACAATTGGGTGTA
fba
AGGAGATATCACACGACA-AAAGTTGAGTGATGCAGGCATAATTGGCTATG
fpr2
TAAGCAAAAGTCTTCGCA--TTGTCGCATTTCGCTGCTACGTTTACAGACCA
fruR P1 TCAAACATTTGGATATTGACA-AACAAACACATATCAACATAGCGTGTTGT
fruR P2
TCATGTGTTTTCCGCTCGC--TTTATTTAAGATTTTCCCGCTTTAACCAGCA
ftsZ
TGGAACATTAGCTCACCCT--CAATGGTGACAGTCCGCTAAAGTGGCTGGGT
fum
AGGGGTGGACTCCAGTGTTT--CGCGACAACACAATGAGTAAGCTTGTGACA
gapB
GCAGATACTGGAATCATTAA--CACCTTCCGCTTTGGGCTAATGTTGGGGGG
gdh P2 AAAGCAAGAAGTTGCTCTTTA--GGGCATCCGTAGTTTAAAACTATTAACCG
git1
TTAAATGTGTGCTGGATT-ACAAGAAGAGTATATTGATAGTATGTATCACC
glgA
ATTTCGGTATCGCTGCGC--AACTGTTTTTAGATGGCTAATCTTTGAAATTA
glgC
TTACCCAGCTTTCATGCGG--GATAGTTATTTTGCCTTTATGGTTAAGGGTG
glxR
TAGCCAAATGCACTAACA-TGGTGACCAATTGCATAGTAGAGTGGTCTTTG
glyA
AGTGAACCCATACTTTTATA--TATGGGTATCGGCGGTCTATGCTTGTGGGC
gntK
ACTGTGGCGTAGGTCTTACA-AAATTCCCCAAAAAGAGTTATGATAGTACC
gntP
GGGTATTAAGAAATTTGTGG-CTTAGATCTCAATTTCTGTATAGTTTGATC
gntR2
CTGTCCATTTAACAACCACA--TCGTTACCCCCGAACAGTCTTTTAAAGGCT
gpm
TTTGCCGTATCTCGTGCGC--AGAATTGCTTTTGAGGGAAAGATGGAGGAGA
groES
AGCACCCTCAACAGTTGAGT--GCTGGCACTCTCGGGGGTAGAGTGCCAAAT
groEL2
AAGCTATAAAATCTTGCAC--TCACACCCCTTGAGTGCTAGAAAAGTAGTTA
icd
TGCCACCATAGGCGCCA-GCAATTAGTAGAACACTGTATTCTAGGTAGCTG
ilvD
CTGAAACCTCACATCGTGATA--ACCCTGCGTCACAGCACTAGAGTGTAATA
ilvE P1 AATGGGGCTGACTAGTGTAT--CTGTCAGGTAGCAGGTGTACCTTAAAATCC
ilvN
GCAGACCCTATTCTATGAA--GGACGGTACTCAAATACTAAACTTCGTAACC
ldhA
AACACATGGTCTGACCACAT--TTTCGGACATAATCGGGCATAATTAAAGGT
leuC
TTTGGGCGGGAGGTGACA-TTTATGCCTCTTAATAGCTATACTGTCCCATG
lexA
CTCGAACACTCGTACCA-TTTCCGCAGGAAAACCTGTATGGTTGGAAACTA
Ref.
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(7)
(7)
(7)
(8)
(9)
(7)
(10)
(9)
(11)
(12)
(13)
(12)
(12)
(14)
(9)
(15)
(15)
(16)
(17)
(17)
(14)
(18)
(18)
(19)
(20)
(17)
(21)
(22)
(23)
(23)
(24)
(25)
(26)
(27)
(6)
(17)
(16)
(16)
(20)
(28)
(28)
(28)
(29)
(30)
(15)
Promoters and Plasmid Vectors of Corynebacterium glutamicum
55
ltbR
AGTGAATCCCTTCACCACGT--CTCATTGGGTGAAATGCTAAATTCAAGGTA
(30)
malE
CATTGCGAAATTTTTGTTG-AGCTACATATTTAGCTAGTGTTTTTGTTCCA
(17)
malE1
GGGTCCGATTTCTTTTGAAT---ATGTGGGTTACCTCACTAAGGTGGAAGGAA (22)
mdh
ACCCAAAACTGGTGGCTG--TTCTCTTTTAAGCGGGATAGCATGGGTTCTTA (29)
metB
TTAAAGGTGATAGATTTG--GGCAAAAATGGACAGCTTGGTCTATCATTGCG (4)
(4)
metE
CGCGAACCTTGAAACATC--GTCAGAAGATTGCCGTGCGTCCTAGCCGGG
metF
GTCGAGGTCAAGGTCATGGGC--ATCGAAACTGCTCAAGGAGACGTCCTTCA
(4)
metH
TGCGAATGAAAAGTTCGGG--AATTGTCTAATCCGTACTAAGCTGTCTACAC (4)
(4)
metK
CTAGACCACTGACATTGCAG--TTTTAGACAGCTTGGTCTATATTGGTTTTT
metX
CGCGAGAATGCAAACTAGACT--AGACAGAGCTGTCCATATACACTGTACGA
(4)
(4)
metY P1 TACCGCACAGTCTATTGCAA--TAGACCAAGCTGTTCAGTAGGGTGCATGGG
metY P2
AATTACCCGAGAATAAATT--TATACCGCACAGTCTATTGCAATAGACCA
(4)
mqo
CGTGCTTGTTTATTCA--GCTCGAGGTGGCAGGCGTACACTCTATATTCA (20)
(31)
nagA1 P1 TTAACCTAAATCCGTAGACA--TAAGACATCATACGTCCTATGCTTGC
nagA1 P2
TCAAGTCCGAAGATA---ATTAACCTAAATCCGTAGACATAAGACATCAT(31)
narK
CCCGTTGAAAAACATGCGG--GCGCAGGTCAGAGCTGTTATCTTAGTACTTA (32)
(33)
nucH
AATTGCTCGCCAAGCAGACT---CCGAAAAACACGGGTAATTCATATGGCTT
odhA
AAGGGCCGACCGTATTCTT--GTTGTTGAACAAGGACGTATCATTGAGGACG (20)
pck
ACCTAAAGTTTTAACTA--GTTCTGTATCTGAAAGCTACGCTAGGGGGCG (17)
pfk
TGGGTGATTGTTCCGGCGC--GGGTGTTGTGATGGGTTTAATATGGAAGACA (17)
pgm
TTTTTTGAGTGGGCGGTGA--GGAATTTTTCGCACAGGTATGCTGCATGTCA (17)
phoR
TCACAGTTAGTATTCAGTGGT--GTTGAAGTTCCAGGGTGTTCACTAGTGGG
(33)
pqo
GGCGGGCGAAGCGTGGCA-ACAACTGGAATTTAAGAGCACAATTGAAGTCG (34)
pstS
TAACCAAATTAGCCTGAGT--TAGTCATTTCAAGGTCTTAGGTTTTTAAGTC (33)
ptsH P3
CCCGATGTCTGGTCGGACA---TTGTTTTTGCTTCCGGTAACGTGGCAAAACG (8)
ptsH P2 TTGCTTCCGGTAACGTGGCA-AAACGAACAATGTCTCACTAGACTAAAGTG
(18)
ptsH P1 AACGAACAATGTCTCACTAGA--CTAAAGTGAGATCCACATTAAATCCCCT
(18)
ptsI P3 GATAAGCTGGTGGAATATCA--ACTTGTGACGATGGTCTCAACGTATGAAAT
(8)
ptsI P2 CTCAACGTATGAAATATGGTG--ATCGCTTAACAACACGCTATGTTGATAT
(18)
ptsI P1 CAAATGTTTGAATAGTTGCAC--AACTGTTGATTTTGTGGTGATCTTGAGG
(18)
ptsS
CTTCGCAAAATCCCTTGATC--GGACACAAATAAACAGGTTTAATGTTGTTT
(18)
ramA
CCGCCTCGACTATGTTC-ACCCCCAAAGGGGAAGTACACTGTACCCTTGTC (35)
ramB
TCAGTGCCAAGAGTGGTTA-AGGTGATGGTGATCACGCTATAGTTGCGCCA
(36)
rbsK2
TGAAGCCATAATAACCACC--TTCTACAAAGATCGACGTAGAATGGAATAAC (37)
rbsR
CTGTGACCTAGGCTTGACT-TTCGTGGGGGAGTGGGGATAAGTTCATCTTA
(38)
rpf2
GCGTTTTGGTGATGGAC-GGGGGTAGTTTGTTACCGTATTGTGACTAATTG (24)
sdhC
GAGCGTCCATGACTGGTTA-ATGCCTCGATCTGGGACGTACAGTAACAACG
(20)
seuA
GAATGCTCTCCTTGTTT-CAGATGTTCAACGCTCCATAAAGTAGACCGCAA (39)
ssuD1
CGAAAATAATACTTCTCT-CTAGACGAAGCGGTCTGTTTAAGTATGTGCCA (39)
ssuD2
CTGGTTGAAACCTTTGAGA-TCAATATAGACCGTGTGGTCTACTCGAGGAA
(39)
ssuI
ATGGAAGAAAAACTAGACA-GTTAAGTAGACTGAATGGCCTACTAGGTGCA
(39)
(9)
ssuR
CTTGAATCTAAACTATTCCC--AAATAGACCATACGGTCTAACATGTGTTCA
sucB
TATGACCCGAACACCACA-CATCACAAATTGAATCGGTATCCTTTGGGGTA (20)
sucC
ATCCAATTTTGTTGCAATTTGCAAAGTTTACAGTGTTAGACTTCACAATA (20)
sugR
GGCAACCAAATGAGGCTT-TTGGGCGTTGGACAGTGAGACAATGGGTAAGA (8)
tctC
TCCATCAAGGACTTTTAGG--GATCACGGCAAGCCATTTAATGTAGTCCACA (11)
ugpA
TCAATTAGAAAACACTAAT--CGGACATTTAGGTCACATAACATTTCCGCTC (33)
uriR
TTCCTACCCCTGTTGCCA-ACATCGCCTTGCACGTAATAGGTTAAAACACA (37)
ushA
CTAATGGAAAGCCCCAGCTC-ACCGAATTCTCCATTCGTTTTAATTGCTTC
(33)
vanA
TCACATTTACCCCTTGACA--GTGATTTGAAGCACAAGCAATATATGACCTA (40)
znr
TTTCATTTCCCTCATA-AAAGGTTTATATAGAAGGTAAAATAGCAAGCGTG (7)
Consensus
ttgnca
gnTAnanTng
Fig. 1 Sequences of C. glutamicum housekeeping promoters. DNA sequences of supposed SigAdependent promoters analyzed recently are shown. Experimentally determined TSPs (+1) are given
in bold and underlined, potential 10 and 35 hexamers are shown in bold. Dashes indicate gaps
introduced to align the putative 35 hexamers. Positions in the consensus with a single nucleotide
56
M. Pátek and J. Nešvera
sequences (Nešvera and Pátek 2008), seems to be similar to the E. coli consensus
TTGACA, although the nucleotides were much less conserved.
The selected 103 promoter sequences deduced from the positions of the experimentally determined TSPs are shown in Fig. 1. These sequences, together with 58
promoter sequences reviewed previously (Pátek et al. 2003; Nešvera and Pátek
2008) were used for the analysis aimed at determining the promoter consensus
sequence. The sequences were aligned at the 10 hexamers, which were selected
as the best fits to the consensus sequence TAnaaT (Pátek et al. 1996; Nešvera and
Pátek 2008) at a distance of 4–9 nt upstream of TSP. On the basis of the weakly
conserved 35 consensus ttGc/gca derived from 58 promoter sequences via an
unbiased bioinformatics approach (Pátek et al. 1996; Nešvera and Pátek 2008),
hexamers within the 35 region with a spacer of 17 1 nt (the only exception
being the sucC promoter with a spacer of 19 nt) selected as the best fit were proposed
(Fig. 1). Using the two alignments (at the 35 and 10 hexamers) of the 161
sequences, the occurrence of the nucleotides at each position within the core motifs
was counted. The resulting base distribution at each position (in percentage) of the
35 and 10 hexamer and in its vicinity is shown in the diagram in Fig. 2.
The simplified consensus sequences of the 35 region and the extended 10
region derived from the resulting base occurrence are ttgnca and gnTAnanTng
(capital letters: bases occurring at particular positions in more than 80 % of
sequences; small letters: bases occurring at particular positions in more than
40 % of sequences; core hexamers underlined). The nucleotides within this statistical consensus are mostly weakly conserved (with the exception of T, A, and T at
positions 1, 2, and, 6 of the 10 hexamer). The consensus 35 hexamers could not
be recognized in many C. glutamicum promoters. Such a weak conservation of the
35 sequence was also reported for mycobacterial promoters (Bashyam and Tyagi
1998). The 35 hexamers shown in Fig. 1 should therefore be considered arbitrary
in most cases. The significance of the particular nucleotides within the consensus
sequences for the function of the promoter will need to be confirmed by genetic or
biochemical analysis.
Fig. 1 (continued) occurrence of over 80 % and 40 % are in capital and small letters, respectively.
References: (1) Schreiner et al. 2005; (2) Krug et al. 2005; (3) Arndt and Eikmanns 2007;
(4) Suda et al. 2008; (5) Auchter et al. 2009; (6) Zemanová et al. 2008; (7) Schr€
oder et al. 2010;
(8) Gaigalat et al. 2007; (9) R€
uckert et al. 2008; (10) Georgi et al. 2007; (11) Brocker et al. 2009;
(12) Engels et al. 2004; (13) Ehira et al. 2009; (14) R€
uckert et al. 2005; (15) Jochmann et al. 2009;
(16) Barreiro et al. 2004; (17) Han et al. 2007; (18) Tanaka et al. 2008; (19) Letek et al. 2007; (20)
Han et al. 2008; (21) H€anssler et al. 2009; (22) Okibe et al. 2009; (23) Seibold et al. 2010; (24)
Jungwirth et al. 2008; (25) Schweitzer et al. 2009; (26) Frunzke et al. 2008; (27) Kohl et al. 2008;
(28) Holátko et al. 2009; (29) Inui et al. 2007; (30) Brune et al. 2007; (31) Engels et al. 2008; (32)
Nishimura et al. 2007; (33) Kočan et al. 2006; (34) Schreiner et al. 2006; (35) Cramer and
Eikmanns 2007; (36) Cramer et al. 2007; (37) Brinkrolf et al. 2008; (38) Nentwich et al. 2009;
(39) Koch et al. 2005; (40) Merkens et al. 2005. The sequences from (4), (13), (17), (18), (20), (22),
(29), and (32) are from C. glutamicum R, the others are from C. glutamicum ATCC13032
Promoters and Plasmid Vectors of Corynebacterium glutamicum
57
Fig. 2 Distribution of nucleotides at particular positions in 35 and extended 10 hexamers of
C. glutamicum promoters of housekeeping genes. Capital letters: nucleotides occurring at the
position in more than 80 % of sequences; small letters: nucleotides occurring at the position in
more than 40 % of sequences
Since the structure of promoters and their respective strength and activity profile
evolved to fit a physiological function rather than achieve a high activity, a
statistical consensus sequence does not necessarily represent the pattern of the
strongest promoter. Some nucleotides within the consensus which are not distinctly
conserved, or some additional elements which are present in just some types of
promoters, may still significantly contribute to the activity of the promoter. The
sequences outside the statistical consensus regions (e.g., within the spacer) may
also affect the promoter strength. In E. coli, a TG dimer one base upstream of the
10 hexamer (Burr et al. 2000) and the variable UP element (AT-rich region) just
upstream of the 35 hexamer (Ross et al. 2001) may significantly enhance promoter activity. The TG dimer appears in approximately 20 % of promoters and the
distinct UP elements could be found in approximately 4 % of promoters in E. coli.
The significance of the individual positions within the 10 consensus sequence
of C. glutamicum promoters was documented by site-directed mutagenesis of the
dapA promoter (Vašicová et al. 1999). The sequence of the extended wild-type 10
dapA promoter region is AGGTAACCT, whereas the sequence within the strongest
mutated dapA promoter is TGGTATAAT. A strong promoter was also derived by
making just a single base alteration A ! T resulting in the sequence
TGGTAACCT. This suggests that the TG dimer 1 base upstream of the core 10
hexamer might strongly affect the C. glutamicum promoter activity. Changes to
either of the T residues at positions 1 and 6 of the 10 hexamer resulted in nearly
abolishing the dapA promoter activity, which showed that these positions are very
58
M. Pátek and J. Nešvera
important for the function of the promoter. Changing the G positioned at the second
base downstream of the 10 hexamer, which is also conserved (47 %), resulted in a
sharp drop in dapA promoter activity. Base alterations aimed at constructing
stronger or weaker promoters were also introduced into the C. glutamicum
promoters of the genes ilvA, ilvD, ilvE, leuA (Holátko et al. 2009), and gdh
(Asakura et al. 2007; H€anssler et al. 2009). All sequence modifications confirmed
the motif TATAAT to be the most efficient 10 hexamer. Alterations within the
TG motif 1 base upstream of the 10 hexamer also clearly showed that the presence
of this dimer may markedly enhance promoter strength. Mutations within the 35
hexamer of the gdh promoter showed that the sequences TTGACA and TTGCCA
substantially increase the promoter strength (sevenfold and sixfold, respectively)
compared to the native TGGTCA hexamer (Asakura et al. 2007). The statistical
consensus and results of up- and down-mutations of C. glutamicum promoters
could be combined into a functional consensus TTGA/CCA for the 35 region
and TGnTATAATnG in the extended 10 region. A + T rich sequences could be
found in the 40 to 55 region in a number of C. glutamicum promoters. These
tracts may activate the promoters via DNA bending or functioning as UP elements.
Mutagenesis of the tract of six T residues in the positions 55 to 50 within
the dapA resulted in a fivefold decrease in promoter activity (Vašicová et al. 1999).
However, evidence for the presence of an E. coli-type UP-element in C. glutamicum
promoters has not yet been reported.
In addition to sequences of core promoters, various sequence motifs within
promoters and in adjacent regions operating as binding sites (operators) for protein
regulators may significantly modulate the promoter activity. Functions of these
regulators are described by Tauch (chapter “Regulation of Sugar Uptake, Glycolysis, and the Pentose Phosphate Pathway in Corynebacterium glutamicum”).
2.2
Promoters Recognized by SigB
SigB of C. glutamicum is a nonessential primary-like sigma factor (Group 2), which
was originally thought to be mainly involved in transcription during the transition
phase between the exponential and stationary growth phases (Larisch et al. 2007)
and in response to some environmental stresses (Halgasova et al. 2002; Ehira et al.
2008). However, evidence of the positive regulation of many genes by SigB during
exponential growth has also been presented (Ehira et al. 2008).
The sigA transcript markedly prevails over the sigB transcript during exponential
growth (Oguiza et al. 1997) but the expression of sigA and sigB begins to reverse
when the culture reaches the transition phase (Larisch et al. 2007). Expression of
sigB is also increased in response to acid, salt, ethanol, cold, and heat stresses
(Halgasova et al. 2002), under oxygen deprivation conditions (Ehira et al. 2008),
and during lactic acid adaptation (Jakob et al. 2007) and stringent response
(Brockmann-Gretza and Kalinowski 2006).
Genes controlled by SigB were discovered by the DNA microarray technique in
a global gene expression analysis of the C. glutamicum WT and sigB-deficient
Promoters and Plasmid Vectors of Corynebacterium glutamicum
Gene
cg0096
cgtS10
cg1417
ilvE P2
hmp
cg3330
pfkA
fba
pgk
gapA
pqo
eno
fum
-35
+1
Ref.
AATGCGATGATC-GTCGGAAACTACCTGACTACGCTCGGCCGCCCAAT
AAGCCTGCAGCC-GACGGGATTAAGGCAGCTAACATTGAGACAC
ACGTCGAAAAGC-AATGAATTTAATGCTTTTAACCTGGATTTT
TGACTAGTGTAT-CTGTCAGGTAGCAGGTGTACCTTAAAATCC
ATCATATTAAGG-CCAAATTGCTTGGATCCTGGGATTTATTTAA
ACGTGAAAGGCACCTAAAGCGCATTAACGGTAAAGTGCGAGAGGT
TTGTTCCGGCGC-GGGTGTTGTGATGGGTTTAATATGGAAGACA
TATCACACGACAAAAGTTGAGTGATGCAGGCATAATTGGCTATGG
ACCCCGGGCTAT-TTTGTGTCTTTAATCAATACAATTGAATACCG
GAATCCGCTGCAAAATCTTTGTTTCCCCGCTAAAGTTGGGGAC
CGAAGCGTGGCAACAACTCGAATTGAAGAGCACAATTGAAGTCG
CTGATTGCCTCATCGAAACAAGATTCGTGCAACAATTGGGTGTA
ACTCCAGTGTTT-CGCGACAACACAATGAGTAAGCTTGTGACA
(1)
(1)
(1)
(1)
(1)
(2)
(2)
(2)
(2)
(2)
(2)
(2)
(2)
Consensus
gngncn
-10
59
TAaaaTtga
Fig. 3 Sequences of C. glutamicum SigB-dependent promoters. TSPs (+1) are in bold and
underlined, putative 10 and 35 regions (a spacer of 17 or 18 nucleotides) are highlighted in
bold. Positions in consensus with a single nucleotide occurrence of over 80 % and 40 % are in
capital and small letters, respectively. References: (1) Larisch et al. 2007; (2) Ehira et al. 2009.
The sequences from (1) are from C. glutamicum ATCC13032, the sequences from (2) are from
C. glutamicum R
strains (Larisch et al. 2007; Ehira et al. 2008). These genes, more highly expressed
in the transition phase (only in the presence of SigB) include genes involved in
amino acid metabolism and transport, stress defense mechanisms, membrane processes, and regulatory processes (Larisch et al. 2007). The transcription of genes
involved in glucose consumption (pfkA, fba, tpi, gapA, pgk, eno, ppc, fum, and pqo)
driven by SigB was not only detected under oxygen deprivation conditions but also
during aerobic exponential growth (Ehira et al. 2008).
Several SigB-dependent promoters were localized by determining their respective TSPs. It is apparent from Fig. 3 that the sequences of these promoters contain
10 elements which conform to the consensus of SigA-dependent promoters. The
third and fourth position in the 10 hexamer is not conserved among this set of 13
SigB-dependent promoter sequences, whereas the trimer TGA immediately downstream of the 10 hexamer seems conserved. No apparent conserved motif could be
defined within the 35 regions of these sequences. However, the number of
sequences of these proposed SigB-dependent promoters is still too small to draw
statistically significant conclusions. Inactivation of SigB only partially reduced the
transcription of the identified SigB-dependent promoters (Ehira et al. 2008). The
genes whose expression increased during the transition phase in the WT strain
displayed transcription profiles very similar to those of housekeeping genes in the
SigB-deficient strain (Larisch et al. 2007). Both these results could be explained by
the presence of additional (SigA dependent) promoters upstream of these genes, or
more probably, by an overlapping recognition specificity of SigA and SigB.
We can only speculate that there are some subtle differences in the promoter
sequences, which determine the preferential recognition of these promoters by SigA
60
M. Pátek and J. Nešvera
or SigB. We may conclude that in addition to its function as a back-up sigma factor
under unfavorable conditions of various stresses and slower growth in the transition
phase (Larisch et al. 2007), C. glutamicum SigB may also operate as another
vegetative sigma factor in the exponential growth phase (Ehira et al. 2008).
The sigB gene itself is transcribed from a SigH-dependent promoter (Halgasova
et al. 2001; Ehira et al. 2009), which reflects its function in response to various kinds of
stresses. In M. tuberculosis, regulation of sigB expression is extremely complex
(Rodrigue et al. 2006). A promoter similar to the sigB gene promoter of C. glutamicum
is recognized by as many as three sigma factors (SigH, SigE, and SigL), a second
promoter is SigF dependent and another promoter is thought to be autocontrolled by
SigB. Since SigB in C. glutamicum also controls the expression of some genes during
the exponential growth phase, it is reasonable to suppose that another currently
unknown promoter recognized by SigA or SigB is present in the sigB promoter region.
2.3
Promoters Recognized by SigH
SigH is one of the Group 4 sigma factors, also called the ECF (extracytoplasmic
function) sigma factors. It is a diverse group, which includes nonessential sigma
factors responding to stimuli from the extracytoplasmic environment (Paget and
Helmann 2003). C. glutamicum SigH in particular controls the cell response to heat
and oxidative stress.
Its distinctive role in the induction of the genes involved in heat stress response
was indicated in studies of the genes coding for the ATP-dependent Clp proteases
(Engels et al. 2004) and heat shock proteins and regulators (Barreiro et al. 2004;
Kim et al. 2005; Ehira et al. 2009) in C. glutamicum ATCC13032. SigH most
probably plays an important role in the network regulating the expression of sigma
factor genes and various stress responses, since it is involved in the transcription of
sigB (Ehira et al. 2009) and sigM (Nakunst et al. 2007) and probably in its own
autoregulation (Kim et al. 2005). A number of SigH-dependent promoters were
identified in the analysis of heat shock response by gene expression profiling using
sigH-disrupted and overexpressing strains of C. glutamicum R and mapping the
TSPs (Ehira et al. 2009) (Fig. 4). The same TSPs were found in C. glutamicum
ATCC13032 and C. glutamicum CCM251 for some promoters, although a few
nucleotides within the promoter regions differ in the sequences of these strains.
According to the results of a microarray transcriptome analysis of C. glutamicum
genes and sequence inspection of potential operons, the SigH-regulon is formed by
45 genes that constitute 29 transcriptional units (Ehira et al. 2009). The core
sequences of the 10 and 35 regions (GGAA—17–20 nt—YGTT) of the proposed SigH-dependent promoters are highly conserved (Fig. 4) and are identical to
the promoter motifs of the Mycobacterium tuberculosis and Streptomyces
coelicolor SigH- and SigR-dependent promoters, respectively. The TSP of the
sigM gene, which is apparently controlled by a SigH-dependent promoter, was
also mapped upstream of the sigM gene; however, the 10 and 35 motifs or the
Promoters and Plasmid Vectors of Corynebacterium glutamicum
Gene
-35
61
-10
+1
Ref.
clpP1 P1
clpC P2
clgR P1
dnaK P2
sigB
arnA P2
trxB
trxC
sufR
clpB P1
msrB
cgR_1554
cgR_2964
cgR_1317
cgR_2078
cgR_1297
cgR_0627
cgR_2320
cgR_2183
cgR_2451
GTTTCATGGAAATACGCGGGTAGTCTGGTGACATTGAACCAAA
AAAGTCTGGAAGTTTTGCC---CAATAAGGGCGTTAAAGTGGGT
TAAACTGGGAACAAATTTT--AGGGAAAGGGAGTTGAACCTAAC
TCTAGTGGGAACAACTTTG--TAGCATTCGCCGTTGTCATATA
GCGCTTGGGAACTTTTTGT--GGAAGCAGTCCGTTGAACCTCTTG
TGTGTGAGGTAAAGCTGCG---GACATAGTATGTTCTTTCAGGCTG
AACTGATGGAAGTTTTTCA--AAGTGTCTGACGTTGAAAACGGTG
AATGTCGGGATTCCCCAGG-AGTCCCGTCATTGTTAATTTAGGAG
GGACACGGGAATGGAATTA-GGGAACACTTGTGTTGTCTAAAGGTG
CTTGAGTGGAACATACTCA--ACTCTTTGTGCGTTATAGTATTA
GCTGGATGGAATTTTTCAG--CGCGACCATTGGTTGGGGTCTATTG
GTGTGATGGATTAACGTTA--ACAATAAGTTTGTTACATGGTGTG
CGGGGGGGGAATGGAAAAA--GTACGCTTGGTGTTCATATAGCG
GATTTCGGGAACATGCGGA--TACGCTACGTTGTTGAGATCAATTA
CAAATCGGGAATAGGGGTG--CACACTTCATCGTTGAAAGGAATCA
TAGCTAGGGATTAGCTTTG--TACTTAAACTTGTTGTTTTTAAGTG
ACGCCAGGGAATTTTCCGC-GCCCGCTTCCTTGTTTGAATAAACG
CGGTGGAGGAACTAAAAAA-CTCATCACCGTTGTTGAGATCAAGTG
ATTGATTGGAACAAGAAAG--GTACCCAGTCTGTTGCAAAGGAGG
CACTAATGCAATAAATTCC---TGTCTACAGCGTTACAGTTAATG
(1)
(1)
(1)
(2)
(3)
(4)
(5)
(5)
(5)
(5)
(5)
(5)
(5)
(5)
(5)
(5)
(5)
(5)
(5)
(5)
sigM
sigM
AATCCGTGGTGATTCTGGT--CGATGAGGTTCGTTCCTCA
AGGTGGAATCCGTGGTGATTCTGGTCGATGAGGTTCGTTCCTCA
(6)
(6)
Consensus
C. glutamicum
M. tuberculosis
S. coelicolor
KGGAAta
gGGAAYA
gGGAAT
YGTTgaa
cGTT
GTTg
(7)
(8)
Fig. 4 Sequences of C. glutamicum SigH-dependent promoters. TSPs (+1) are in bold and
underlined, putative 10 and 35 regions (a spacer of 17–20 nucleotides) are highlighted in
bold. Dashes indicate gaps introduced to align the 35 element. Positions in C. glutamicum
consensus with a single nucleotide occurrence of over 80 % and 40 % are in capital and small
letters, respectively. Y ¼ c or t; K ¼ g or t. In both alternatives of the suggested 35 and 10
sequences of the sigM promoter, the length of the spacer between the 35 and 10 regions or the
distance to the TSP seem exceptional and do not fit the other sequences. References: (1) Engels
et al. 2004; (2) Barreiro et al. 2004; Ehira et al. 2009; (3) Halgasova et al. 2001; (4) Zemanová et al.
2008; (5) Ehira et al. 2009; (6) Nakunst et al. 2007. Consensus sequences of M. tuberculosis (7)
Raman et al. 2001 and S. coelicolor (8) Paget et al. 2001 promoters are also shown. The sequences
from (1), (2), (4), and (6) are from C. glutamicum ATCC13032, the sequence from (3) is from
C. glutamicum CCM251 and the sequences from (5) are from C. glutamicum R
spacer length and distance from TSP do not completely fit the proposed consensus
pattern (Nakunst et al. 2007).
2.4
Promoters Recognized by SigM
SigM is an ECF sigma factor (Group 4), which was found to be involved in the
regulation of genes induced by oxidative stress in C. glutamicum (Nakunst et al.
2007). The sigM knock-out strain is more sensitive to disulfide, heat and cold stress.
62
M. Pátek and J. Nešvera
Gene
sufR
trxB
trxB1
trxC
-35
-10
+1
TGGACACGGGAATGGAATTAGGGAACACTTGTGTTGTCTAAAGGTG
CAACTGATGGAAG-TTTTTCAAAGTGTCTGACGTTGAAAACGGTG
CTTGGCCGGGAAT-AACTACAGTCCGCTGAAAGTTGGTCTATATAAG
TGAATGTCGGATTCCCCAGGAGTCCCGTCATTGTTAATTTAGGAG
Consensus
GGAAT
GTTG
Fig. 5 Sequences of C. glutamicum ATCC13032 SigM-dependent promoters. TSPs (+1) are in
bold and underlined, putative 10 and 35 regions (a spacer of 18 or 19 nucleotides) are
highlighted in bold. Dashes indicate gaps introduced to align the 35 elements (Nakunst et al.
2007)
The SigM-dependent promoters were localized upstream of the genes, which were
differentially expressed in wild-type and sigM-deficient strains according to the
microarray transcriptome analysis. The respective genes trxB (thioredoxin reductase), trxB1 (thioredoxin), trxC (thioredoxin), and sufR (transcriptional regulator of
the suf operon) are involved in disulfide stress response. The sequences of their
promoters also contain the 35 and 10 core elements GGAA and GTT with a
spacing of 19 or 20 nt (Fig. 5), which were found in SigH-dependent C. glutamicum
promoters (Fig. 4). Interestingly, the promoters of the genes trxB, trxC, and
sufR were found to be SigH dependent in the C. glutamicum R strain, whereas
identical promoters were defined as SigM dependent, according to the study in
C. glutamicum RES167 (a derivative of C. glutamicum ATCC13032). It is not clear
whether this discrepancy is due to the differing experimental procedures or due to
differences between the strains. The recognition specificity of SigH or SigM may
slightly differ in the two strains. SigH and SigM may also recognize the same
promoters, in dependence on the growth conditions when we consider the very
similar consensus elements of the respective promoters. In several cases, the
transcription driven from a SigH-dependent promoter was still active from the
same TSP in a SigH-deficient strain, although producing weaker signals (Pátek
and Nešvera, unpublished results). This suggests that at least one other sigma factor
has an overlapping specificity. Recognition overlap for some sigma factors was
observed in Bacillus subtilis (Qiu and Helmann 2001), M. tuberculosis (Dainese
et al. 2006), and E. coli (Olvera et al. 2009).
SigE is involved in responses to cell surface stresses (Park et al. 2008b), acid shock
(Jakob et al. 2007), and most likely also heat shock (Barreiro et al. 2009). The functions
of SigC and SigD in C. glutamicum have not yet been reported. The sequences of the
promoters recognized by SigC, SigD, and SigE have not yet been described.
2.5
Multiple Promoters
Two or more signals thought to represent TSPs were observed in analyses of a
number of C. glutamicum genes. These signals may represent real TSPs pertinent to
Promoters and Plasmid Vectors of Corynebacterium glutamicum
63
two or more promoters of the analyzed genes or 50 -ends of the processed mRNA or
may arise as artifacts produced by the particular detection method. The detected
TSPs and the respective promoter sequences should therefore be confirmed by
independent assays and by functional evidence. Two promoters of the gdh gene
with the TSPs 195 nt and 284 nt upstream of the translation initiation codon were
localized (H€anssler et al. 2009). Two promoters of both ptsH and ptsI were also
described in C. glutamicum R (Tanaka et al. 2008), whereas a different single
promoter of each of these genes was found in C. glutamicum ATCC13032 (Gaigalat
et al. 2007). Since the respective sequences are nearly identical, the reason for this
discrepancy might lie in different growth conditions of the cells used for the
determination. In several other C. glutamicum genes, two potential housekeeping
promoters were also proposed (Fig. 1).
In some genes, particularly in those involved in various kinds of stress responses,
two promoters of different classes were found. For example, two TSPs were
mapped for each of the genes clpP, clpC, and clgR, which are activated by heat
shock. Using the SigH-deletion strain, the presence of two different promoters,
most likely recognized by SigA and SigH, respectively, was found in all three genes
(Engels et al. 2004). The transcription of clpP and clpC, initiated by housekeeping
promoters, is activated by the ClgR regulator. Transcription from the other promoter depends on SigH, which is induced by heat shock (Engels et al. 2004). Two
overlapping heat shock-induced promoters were also localized upstream of the
dnaK gene. The P1 promoter is probably recognized by SigA and negatively
controlled by the HspR regulator, whereas the P2 promoter initiating transcription
13 bp upstream of the proximal TSP1 is SigH dependent (Barreiro et al. 2004; Ehira
et al. 2009). Likewise, two promoters of clpB induced by heat shock are regulated
differently. The proximal P1 is SigH dependent and distal P2 (the distance between
TSPs is 74 nt) repressed by HspR is probably SigA dependent (Ehira et al. 2009).
Two TSPs just 2 nt apart were detected upstream of the gene for antisense RNA
ArnA, which is involved in the regulation of gntR2 gene expression under heat
shock conditions. The P1 promoter seems to be SigA dependent, whereas P2 is
SigH dependent according to transcriptional analysis using the SigH deletion strain
(Zemanová et al. 2008). The sufR gene, a part of the suf operon, which is involved in
oxidative stress response, is another example of a gene controlled by two different
sigma factors. Using SigM-deletion mutant of C. glutamicum, the sufR P1 promoter
was found to be SigM dependent, whereas a probably housekeeping distal promoter
P2 initiates transcription 10 nt upstream of TSP1 (Nakunst et al. 2007). A complex
gene expression control mechanism of promoters recognized by different sigma
factors and regulated by different DNA-binding proteins integrates the effects of
various external stimuli and tunes the expression profiles of the genes as required by
environmental and physiological conditions.
In specific cases, the overlapping promoters recognized by different sigma factors
initiate transcription at the same nucleotide. This may hold for some SigA- and
SigB-dependent promoters. The consensus sequences of these two promoter classes
are very similar (or even indistinguishable) and the recognition specificity of SigA and
SigB may overlap. The promoters of several genes involved in glucose metabolism
64
M. Pátek and J. Nešvera
(e.g., gapA, pgk, and pfkA) expressed in the exponential phase are SigB dependent
(Ehira et al. 2008). These promoters might be under the regulation of both SigA and
SigB. Such dual promoters, recognized by sigma 70 and sigma 38, were also found in
E. coli. The genes driven by these promoters are involved in the response to carbon
limitation (Olvera et al. 2009). Another pair of sigma factors with very similar promoter
consensus sequences in C. glutamicum is SigH and SigM (see Sects. 2.3 and 2.4).
SigM-dependent promoters of the genes involved in disulfide stress response (sufR,
trxB, and trxC) were determined in C. glutamicum ATCC12032 (Nakunst et al. 2007).
The same promoters were identified as SigH dependent in the study of C. glutamicum
R (Ehira et al. 2009). Both sigma factors are involved in the heat-shock response in
C. glutamicum ATCC13032 (Nakunst et al. 2007). The recognition pattern of these two
sigma factors may therefore be very similar and some of the transcriptional signals may
function as dual promoters. In M. tuberculosis, the sigB gene promoter was found to be
recognized by RNAP containing either SigE, SigH, or SigL and the TSP is identical in
all cases (Rodrigue et al. 2006). Since transcription from two or more promoters
dependent on different sigma factors and overlapping sigma factor specificity seem
to be common regulatory strategies in bacteria, it is to be expected that more such
examples will be discovered in further studies of C. glutamicum promoters.
2.6
Leaderless Genes
The transcription start points of a growing number of genes in C. glutamicum have
been mapped to the first nucleotide of the translation initiation codon or nearby
upstream. The respective mRNAs thus lack the 50 -untranslated region (UTR or
leader region) and Shine–Dalgarno (SD) sequence, which functions as a recognition
motif for ribosome recruitment. These leaderless transcripts or mRNAs which start
1–2 nt upstream (in parentheses) of the respective initiation codon are coded by the
genes aecD (2), betP (1 or 2), brnF, cgtS10 (2), clgR P1 (2), cysR, dapA, glgA, glgC,
ilvA, ilvB (1) (leader peptide), ilvE P1 (1), leuA (leader peptide) lpdA, lrp ltbR, lysE
(1), pfkA, ramB, ssuD1, ssuD2, ssuI, ssuR, ugpA (1), cg0042, cg0043, cg0527,
cg2782, and cg3327. Leaderless transcripts were found in all three taxonomical
domains (Bacteria, Archaea, and Eukarya) and may therefore be considered to be
remnants of ancestral mRNA originating before domain separation (Kaberdina
et al. 2009). Although these transcripts quite frequently appear in C. glutamicum
genes, their regulatory function in translation initiation is not clear. In E. coli, the
AUG start codon was found to be sufficient to support the high-level translation of
leaderless transcripts, whereas the GUG codon only supported low-level expression
(Moll et al. 2002). However, in C. glutamicum the GUG codon functions as an
initiation codon in several genes with leaderless mRNAs (e.g., brnF, lpdA, and
glgC). Leaderless mRNAs are poorly translated during the exponential growth
phase in E. coli (Moll et al. 2004). A regulatory role has been suggested for
leaderless transcripts in the expression of genes during the stationary growth
phase and under some stress conditions, such as carbon source downshift and
Promoters and Plasmid Vectors of Corynebacterium glutamicum
65
cold shock adaptation (Moll et al. 2004). Connected to this, it is noteworthy to
mention that the promoters of the C. glutamicum genes pfkA and cgtS10 are SigB
dependent, the P1 promoter of clgR is SigH dependent, and the trxC promoter (TSP
6 nt upstream of the initiation codon) is SigM dependent. This intriguing phenomenon clearly deserves further investigation.
2.7
Discovering Promoters
Putative promoter sequences are mostly deduced from experimentally localized
TSPs (50 mRNA ends). TSP may be determined by S1 mapping, the primer
extension technique, or RACE (rapid amplification of cDNA-ends). S1 nuclease
protection mapping was used for this purpose mostly in early genetic studies of
C. glutamicum (von der Osten et al. 1989; Han et al. 1990) and is not a currently
preferred method. Many TSPs in C. glutamicum were found by radioactive
(Pátek et al. 1996; M€
oker et al. 2004) or nonradioactive (Pátek et al. 2003; Barreiro
et al. 2004; Tanaka et al. 2008) primer extension analysis. Several TSPs of a gene
can be detected by this technique in a single experiment. Moreover, specific
transcripts can be indirectly quantified by integrating the electrophoreogram signals
(Barreiro et al. 2004). The RACE technique is also widely used for TSP mapping
(Brune et al. 2007; Ehira et al. 2009). Currently, modified RACE methods, such as
DMTSS (directed mapping of transcription start sites) and the high-throughput
pyrosequencing strategy applied in E. coli (Mendoza-Vargas et al. 2009) may
also be used for the precise detection of TSPs for C. glutamicum. High-throughput
sequencing technologies and the analysis of a large set of transcripts would enable
the construction of a genome-wide promoterome and thus represents a qualitative
step forward in promoter studies (Balwierz et al. 2009).
The computer analysis of DNA sequences presents another possibility for
localizing promoter sequences (Jacques et al. 2006). However, these methods based
only on the presence of 10 and 35 consensus sequences frequently generate
numerous false positives in their promoter predictions. The probable reason for this
failure is that the promoter is not only defined by the two consensus sequences but
also by the flanking DNA regions and not only by the identity of the nucleotides, but
also by the presence of specific physico-chemical and structural characteristics that
are sequence dependent (Lisser and Margalit 1994). A more useful bioinformatics
approach aimed at predicting core promoter sequences in C. glutamicum includes
comparisons with homologous sequences of related bacterial strains or species, such
as C. efficiens and other corynebacteria, whose complete genome sequence is available (Nešvera and Pátek 2008). Although the prediction of promoters from the DNA
sequence is always considered an attractive idea, experimental evidence is usually
necessary for reliable localization of a functional promoter.
Promoter activity profiles and regulatory mechanisms, like induction or repression of promoters, can be analyzed using promoter-probe vectors. These specialpurpose plasmid vectors carry reporter genes for transcriptional fusions with
promoter-active DNA fragments. Plasmid vectors utilized in promoter analyses
66
M. Pátek and J. Nešvera
and also the use of promoters for the overexpression of genes are described in the
following section.
3 Plasmid Vectors for Corynebacterium glutamicum
Since 1984, when small native plasmids were discovered in some strains of aminoacid producing corynebacteria (Miwa et al. 1984; Ozaki et al. 1984; Santamarı́a
et al. 1984) various vectors for gene analysis and manipulation in C. glutamicum
have been constructed. Most of the autonomously replicating vectors for
C. glutamicum are based on small cryptic plasmids pBL1 (Santamarı́a et al.
1984), pCG1 (Ozaki et al. 1984) and pGA1 (Sonnen et al. 1991) from
C. glutamicum or on the minimal replicon of the broad-host-range plasmid pNG2
(Schiller et al. 1980; Radford and Hodgson 1991) from Corynebacterium
diphtheriae. All of these plasmids replicate in rolling circle (RC) mode, which is
typical for the majority of native plasmids of corynebacteria (24 out of 33 plasmids
with determined complete nucleotide sequences). Despite of the fact that
RC-replicating plasmids are generally considered to show higher structural and
segregational instability than those replicating in the theta-type mode, the stable
maintenance of plasmid vectors based on RC-replicating plasmids was found to be
sufficient in C. glutamicum cultures grown under nonselective conditions, most
probably due to the high number of plasmid copies in C. glutamicum cells (Nešvera
et al. 1997). Stably maintained RC-replicating plasmid vectors for corynebacteria
were also obtained by including the cis-acting partition locus of the large plasmid
pBY503 from Corynebacterium stationis (Bernard et al., 2010) into the plasmid
constructs (Kurusu et al. 1991). To avoid the potential negative features of RCreplicating plasmids, the small native plasmid pCASE1 from Corynebacterium
casei replicating in theta-type mode has recently been used for the construction
of a cloning vector, which shows extraordinarily high segregational stability in
C. glutamicum cells grown without selective pressure (Tsuchida et al. 2009).
Plasmid vectors used for the cloning and analysis of C. glutamicum genes have
been listed in the Handbook of Corynebacterium glutamicum (Eggeling and Reyes
2005). Here we present the characteristics of native plasmids used for vector
constructions, examples of cloning vectors and especially of vectors used for the
analysis of promoters (promoter-probe vectors) and for controlled gene expression
(expression vectors) in C. glutamicum.
3.1
Native Plasmids of Corynebacteria Used
for Vector Construction
Bacterial plasmids are grouped into families defined on the basis of molecular
mechanisms of plasmid DNA replication and the degree of amino acid sequence
Promoters and Plasmid Vectors of Corynebacterium glutamicum
67
similarity of plasmid-encoded replication initiator proteins. Native plasmids of
corynebacteria have been classified into previously defined families of plasmids
replicating in RC or theta-type mode (Nešvera and Pátek 2008). The five small
plasmids of corynebacteria replicating in RC mode (pBL1, pCC1, pAG3, pCG2,
and pXZ608) have been included into the pIJ101/pJV1 family, whereas all other
RC-replicating plasmids of corynebacteria (with the exception of plasmid pCR1
from Corynebacterium renale) form the pNG2 family (Tauch et al. 2003; Nešvera
and Pátek 2008). The plasmids of corynebacteria replicating in theta-type mode
have been classified into ColE2-P9 (small plasmids pXZ10142, pCASE1) and
IncW (large plasmids pCRYA4, pLEW279b) families (Nešvera and Pátek 2008).
The RC-replicating plasmids pBL1, pCC1 (pIJ101/pJV1 family), pGA1, pCG1,
and pNG2 (pNG2 family) served as the bases for the construction of most plasmid
vectors used for gene cloning and analysis in C. glutamicum. A cloning vector
based on a theta-replicating plasmid (pCASE1) has also been recently
constructed.
3.1.1
Plasmid pBL1
The small cryptic plasmid pBL1 (4,447 bp) was isolated from C. glutamicum
ATCC 13869 (originally designated as Brevibacterium lactofermentum)
(Santamarı́a et al. 1984). Highly similar (or even identical) plasmids pAM330
(Miwa et al. 1984) pGX1901 (Smith et al. 1986) and pWS101 (Yoshihama et al.
1985) were independently isolated from various strains of C. glutamicum. The copy
number of these plasmids in C. glutamicum cell was estimated to be between
10 and 30 copies per chromosome (Miwa et al. 1984; Santamarı́a et al. 1984).
The observed accumulation of single-strand DNA intermediates of pBL1 in
C. glutamicum cells indicates that pBL1 replicates in RC mode. The 1.8-kb DNA
fragment, sufficient for autonomous replication of pBL1, was found to contain two
ORFs (Fernandez-Gonzalez et al. 1994). The plasmid pBL1 was classified into the
pIJ101/pJV1 family of RC-replicating plasmids (Khan 1997) according to the high
degree of similarity of the deduced amino acid sequence of the gene product of the
larger ORF (rep gene) present on the pBL1 minimal replicon to the replication
initiator proteins (Rep proteins) encoded by the plasmids of this family. It was
found that the constructed C. glutamicum–E. coli shuttle vectors, containing the
whole pBL1 sequence, inhibited growth and caused filamentation of E. coli host
cells. Deletion of the 1.2-kb DNA fragment, located outside the pBL1 minimal
replicon and carrying the orf3 gene, abolished these defects (Goyal et al. 1996).
Therefore, pBL1 DNA lacking the orf3 gene should be used for the construction of
optimized C. glutamicum–E. coli shuttle vectors.
3.1.2
Plasmid pCC1
The small cryptic plasmid pCC1 (4,109 bp) was isolated from C. callunae NRRL
B-2244 (¼ATCC 15991) (Sandoval et al. 1984). The analysis of its complete
68
M. Pátek and J. Nešvera
nucleotide sequence revealed five ORFs. The largest ORF was found to be sufficient for the replication and stable maintenance of pCC1 (Venkova-Canova et al.
2004). The deduced amino acid sequence of its gene product exhibited significant
similarity to that of the Rep proteins of RC plasmids classified into the pIJ101/pJV1
family, especially to the Rep protein of the plasmid pBL1 from C. glutamicum.
According to this data, pCC1 replicates by the RC mechanism. Despite the fact that
related plasmids are frequently incompatible, replicons of pCC1 and pBL1 coding
for similar Rep proteins were found to be compatible in C. glutamicum cells
(Venkova-Canova et al. 2004). Vectors based on plasmids pBL1 and pCC1
can thus serve as useful tools for the development of biplasmid systems in
C. glutamicum.
3.1.3
Plasmid pGA1
The small cryptic plasmid pGA1 (4,823 bp) was isolated from C. glutamicum LP-6
(Sonnen et al. 1991). It was found to be present in approximately 35 copies per
chromosome in the C. glutamicum cell. Analysis of the complete nucleotide
sequence of pGA1 revealed five ORFs in its DNA. Its minimal replicon (1.7 kb)
contains the rep gene coding for an initiator of replication in RC mode (Nešvera
et al. 1997). The deduced amino acid sequence of the pGA1 rep gene product
exhibits a high degree of similarity to the Rep proteins of many other plasmids of
corynebacteria classified into a new group of RC plasmids, designated the pNG2
family (Tauch et al. 2003). Small countertranscribed RNA (ctRNA), encoded by the
region upstream of the pGA1 rep gene, was found to be responsible for the negative
control of plasmid copy number (Venkova-Canova et al. 2003). Plasmid pGA1
contains two genes, per and aes, whose products positively influence stable plasmid
maintenance. Derivatives of pGA1 devoid of the per gene exhibited a significant
decrease in the copy number in C. glutamicum cells and displayed high
segregational instability. Introduction of the per gene in trans into the cells harboring these deletion plasmids markedly increased their copy number and stability.
The per gene product thus positively influences pGA1 plasmid copy number
(Nešvera et al. 1997). The small aes gene, when present in trans, was shown to
increase the segregational stability of pGA1 derivatives carrying the main stability
determinant per. The aes gene product thus acts as an accessory element involved in
the stable maintenance of pGA1 (Venkova et al. 2001). Stable C. glutamicum–
E. coli shuttle vectors containing the pGA1 minimal replicon and its per gene have
been constructed (Kirchner and Tauch 2003).
3.1.4
Plasmid pCG1
The small cryptic plasmid pCG1 (3,069 bp) was isolated from C. glutamicum
ATCC 31808 (Ozaki et al. 1984). Plasmids with identical restriction maps,
designated pHM1519 (Miwa et al. 1984), pSR1 (Yoshihama et al. 1985), and
Promoters and Plasmid Vectors of Corynebacterium glutamicum
69
pCG100 (Trautwetter and Blanco 1991) were independently isolated from other C.
glutamicum strains. It was found that plasmid pCG100 is present in the
C. glutamicum cell in about 30 copies per chromosome. Its 1.9-kb minimal replicon
contains the rep gene coding for a protein highly similar to the Rep proteins of
RC plasmids from corynebacteria classified into the pNG2 family (Trautwetter and
Blanco 1991). The pCG1 homolog of the pGA1 per gene, coding for a positive
regulator of plasmid copy number, was found to complement the deletion of per in
pGA1 (Nešvera et al. 1997). The leader sequence of the pCG1 rep gene is highly
similar (92 % identity) to that of pGA1 coding for regulatory ctRNA (VenkovaCanova et al. 2003). Plasmid pCG1 thus very probably also codes for a ctRNA that
negatively controls plasmid copy number.
3.1.5
Plasmid pNG2
Erythromycin resistance plasmid pNG2 (15.1 kb) from human pathogen
C. diphtheriae S601 was the first plasmid isolated from corynebacteria (Schiller
et al. 1980). It was found that only a 1.8-kb fragment of pNG2 is sufficient for its
replication in various corynebacteria, including C. glutamicum, and even in E. coli
(Radford and Hodgson 1991). This pNG2 minireplicon, designated pEP2, contains
the rep gene coding for the initiator of replication in RC mode (Zhang et al. 1994).
The deduced amino acid sequence of the pNG2 Rep protein was found to be highly
similar to that of the Rep proteins of many plasmids from corynebacteria and pNG2
was designated the type plasmid of a new family of RC-replicating plasmids (Tauch
et al. 2003).
3.1.6
Plasmid pCASE1
The small cryptic plasmid pCASE1 (2,461 bp) was isolated from C. casei JCM
12072. The products of its two genes (repA and repB), indispensable for its
replication in C. glutamicum, are highly similar to proteins involved in the replication of plasmids of the ColE2-P9 family replicating in theta-type mode. The thetatype mode of replication seems to be the reason for the extraordinarily high
segregational stability of the cloning vector pCRD304 containing the minimal
replicon of this plasmid (Tsuchida et al. 2009).
3.2
Cloning Vectors
Plasmid cloning vectors for C. glutamicum include autonomously replicating
C. glutamicum–E. coli shuttle vectors, C. glutamicum vectors for self-cloning,
and vectors for integration into the C. glutamicum chromosome (Table 1).
pCC1
5.2
6.0
3.3
3.1
4.0
pWK0
pBHK18e
pEP2
pCRD304
SalI, XbaI, BamHI, SmaI,
SacI
BamHI, XbaI, SalI PstI,
SphI, EcoRI
pUC18 MCS
EcoRI, BamHI, SalI, PstI
pUC18 MCS
Smr/Spr
Kmr, lacZa
Kmr
Kmr, lacZa
Kmr
pUC18 MCS
pUC19 MCS
BamHI, XbaI, SalI, PstI
pUC19 MCS
pUC18 MCS
Cmr, lacZa
Kmr, lacZa
Kmr
Kmr, lacZa
Kmr, lacZa
Eikmanns et al. (1991a)
Tauch et al. (1998)
Jakoby et al. (1999)
Cadenas et al. (1996)
–
Mobilizable
–
Positive selection of recombinants
(Cms, Kms)
–
–
–
–
Mobilizable
Venkova-Canova et al.
(2004)
Reinscheid et al. (1994)
Tauch et al. (2002a)
Takagi et al. (1986)
Ikeda and Katsumata (1998)
Kirchner and Tauch (2003)
Radford and Hodgson
(1991)
Compatible with RC plasmid replicons Tsuchida et al. (2009)
Low copy number
Low copy number
Compatible with pBL1 and pCG1
replicons
Low copy number
Eikmanns et al. (1991a)
–
Nakata et al. (2004)
Elišáková et al. (2005)
Cremer et al. (1990)
Veselý et al. (2003)
Tauch et al. (2002b)
References
Further characteristics
(b) Autonomously replicating C. glutamicum vectors for self-cloning
pAJ228
7.6
pBL1
Tpr
ClaI, HpaI, XhoI, XmaI
–
PstI, StuI, NheI, SpeI,BclI, –
pCG11
6.9
pCG1
Smr/Spr
ScaI
pSELF2000X 5.8
pGA1
alr
EcoRI, XhoI, BamHI
Growth of Dalr mutant without Dalanine
pCASE1
pNG2
pNG2
pNG2
pBL1
pBL1
pCG1
pCG1
pGA1
4.1
5.4
6.1
5.8
5.7
pCRB1c
pECKA
pJC1
pSRK21
pECK18mob2d
pSCCD1
Table 1 Plasmid cloning vectors for C. glutamicum
Size
C. glutamicum Selectiona
marker(s)
Cloning sites
Vector
(kb)
replicon
(a) Autonomously replicating C. glutamicum/E. coli shuttle vectors
pEK0
6.1
pBL1
Kmr
EcoRI, SacI, KpnI, SmaI,
BamHI, SalI
EcoRI, SacI, KpnI, SmaI
pEC5
7.2
pBL1
Cmr
SalI, HindIII
pUC18 MCS
pEBM2
8.0
pBL1
Kmr, lacZa
5.2
pBL1
Kmr, lacZa
pUC18 MCS
pMJ-Ab
BglII
pULMJ55
8.6
pBL1
Hygr
70
M. Pátek and J. Nešvera
3.0
4.7
3.9
5.0
4.7
5.1
pK18mob2g
pKSAC45
pEM1dppc
pKX15
pA3253
pK-PIM
–
–
–
–
–
–
–
Kmr
Kmr
Kmr
Kmr, lacZa
Kmr, lacZa
Kmr, lacZa
Kmr, lacZa
a
Antibiotic resistance markers: Cmr chloramphenicol,
tetracycline, Tpr trimethoprim
b
The pMJ-A derivative pMJ1, containing Cmr determinant, has been constructed as well (Jakoby et al. 1999)
c
The pCRB1 derivatives pCRB2, pCRB3, and pCRB4 containing Kmr, Gmr, and Spr determinants, respectively, have been constructed as well
(Nakata et al. 2004)
d
The pEC-K18mob2 derivatives pEC-C18mob2, pEC-T18mob2, and pEC-S18mob2, containing Cmr, Tcr, and Smr determinants, respectively, have been
constructed as well (Kirchner and Tauch 2003)
e
The pBHK18 derivatives pBHC18, pBHT18 containing Cmr and Tcr determinants, respectively, and the mobilizable derivatives pBHK18mob2,
pBHC18mob2, and pBHT18mob2 have been constructed as well (Kirchner and Tauch 2003)
f
The pK18mob and pK18mobsacB derivatives pK19mob and pK19mobsacB, containing the pUC19 MCS, have been constructed as well (Sch€afer et al. 1994)
g
The pK18mob2 derivatives pC18mob2 and pT18mob2 containing Cmr and Tcr determinants, respectively, have been constructed as well (Kirchner and
Tauch 2003)
5.3
pSB30
Nakamura et al. (2006)
ts replicon, integration into
chromosome at 34 C
Mobilizable
Schrumpf et al. (1991)
Mobilizable
Sch€afer et al. (1994)
Mobilizable, sacB gene for selection Sch€afer et al. (1994)
of double cross-over events
pUC19 MCS
Mobilizable, sacB gene for selection Ohnishi et al. (2002)
of double cross-over events
pUC18 MCS
Mobilizable
Kirchner and Tauch (2003)
pUC19 MCS
sacB gene for selection of double
Holátko et al. (2009)
cross-over events
pUC19 MCS
Mobilizable, site-specific integration Vašicová et al. (1998)
pUC4-KIXX MCS
Site-specific integration into rrnD
Amador et al. (2000)
pBluescript II SK MCS
Phage F16 site-specific integration
Moreau et al. (1999)
function
SacI, HpaI, BglII, ApaI,
Phage b site-specific integration
Oram et al. (2007)
SacII, NotI
function
Gmr gentamicin, Hygr hygromycin, Kmr kanamycin, Smr streptomycin, Spr spectinomycin, Tcr
(c) Vectors for integration into the C. glutamicum chromosome
HindIII, PstI, BamHI,
pSKFT2
7.0
pBL1
Kmr, lacZa
SmaI, EcoRI
pUC19 MCS
pEM1
3.3
–
Kmr
3.8
–
Kmr, lacZa
pUC18 MCS
pK18mobf
f
pK18mobsacB 5.7
–
Kmr, lacZa
pUC18 MCS
Promoters and Plasmid Vectors of Corynebacterium glutamicum
71
72
M. Pátek and J. Nešvera
Most C. glutamicum–E. coli shuttle vectors contain replicons of native plasmids
from corynebacteria with inserted selectable markers (predominantly antibiotic resistance determinants), joined to E. coli plasmid vectors often containing multiple
cloning sites (MCS) within the lacZa gene fragment, which allows direct selection
of recombinant plasmids (blue/white colonies) in E. coli. Complete plasmid pCG1 or
minimal replicons of plasmids pBL1, pCC1, pNG2, and pCASE1 have been used for
these constructions. The streptomycin/spectinomycin and tetracycline resistance
determinants coming from the large plasmids pCG4 (Katsumata et al. 1984) and
pAG1 (Tauch et al. 2000) from C. glutamicum and trimethoprim resistance determinant coming from the chromosome of a C. glutamicum mutant (Takagi et al. 1986)
have been applied as suitable antibiotic resistance markers. However, antibiotic
resistance markers (kanamycin, chloramphenicol, hygromycin, and gentamicin resistance determinants) coming from other bacteria are still predominantly used for
constructing plasmid vectors for C. glutamicum. The vectors based on plasmid
pGA1 require the presence of the per gene, coding for a positive effector of replication (Nešvera et al. 1997), in addition to the minimal replicon, to ensure the stable
maintenance of the constructed vectors in C. glutamicum cells (Tauch et al. 2002b).
The constructed C. glutamicum–E. coli shuttle vectors are present in C. glutamicum
cells in 10–50 copies per chromosome. Cloning the genes into these multicopy vectors
thus results in an increased synthesis of their products due to higher gene dosage in a
cell, which can be of great practical importance. C. glutamicum strains producing
threonine (Eikmanns et al. 1991b), tryptophan (Matsui et al. 1988), tyrosine (Ito et al.
1990a), and phenylalanine (Ito et al. 1990b) were constructed using this approach.
However, a high dosage of some cloned genes could be detrimental to the
growth of the host cells. Therefore, low copy number vectors based on a
minireplicon of the plasmid pNG2 from C. diphtheriae were also constructed
(Reinscheid et al. 1994; Kirchner and Tauch 2003) and successfully applied in
cloning deregulated genes involved in the biosynthesis of threonine (Reinscheid
et al. 1994).
Industrial applications of genetically modified organisms may require the
absence of heterologous DNA in the constructed recombinant strains. As a result,
self-cloning systems containing only C. glutamicum DNA have been developed.
The plasmid vector pCG11 (Ikeda and Katsumata 1998), consisting of the pCG1
replicon and the streptomycin/spectinomycin resistance determinant from the
native C. glutamicum plasmid pCG4 (Katsumata et al. 1984), is an example of
such a system. The vector pSELF2000X, carrying the alr gene coding for alanine
racemase but lacking any antibiotic resistance gene, represents another self-cloning
vector suitable for gene manipulations in the industrial strains of C. glutamicum.
The presence of pSELF2000X in the C. glutamicum Dalr host strain ensures strong
selection for plasmid harboring cells, since plasmidless cells cannot grow in the
absence of D-alanine in conventional media (Tauch et al. 2002a).
Vectors promoting the integration of cloned fragments into the chromosome
represent another type of plasmid vectors. These vectors are the basic tools used for
disruptions and replacements of genes within the chromosome of C. glutamicum.
They are based, with a single exception, on E. coli plasmid vectors that are
Promoters and Plasmid Vectors of Corynebacterium glutamicum
73
nonreplicating in C. glutamicum. The vector pSFKT2, exhibiting temperaturesensitive replication due to a mutation within the rep gene of the pBL1 replicon,
is the only exception. This vector only replicates in C. glutamicum at 25 C, while at
34 C it can only be maintained in a cell if its integration into the chromosome, via
recombination of the cloned fragment with its chromosomal homologue, was
successful (Nakamura et al. 2006). Most of the integrative vectors for
corynebacteria contain oriT and the mob region of conjugative plasmid RP4 and
can thus be transferred from the E. coli S17-1 strain to C. glutamicum by conjugation, providing the RP4 transfer functions necessary for mobilization (Simon et al.
1983). The higher frequency of conjugation, in comparison with that of
electrotransformation, increases the selection probability of rare integration events.
The mobilizable vector pK18mobsacB, carrying the conditionally lethal sacB
selection marker from B. subtilis (J€ager et al. 1992), has been frequently used for
gene manipulations within the C. glutamicum chromosome (Sch€afer et al. 1994).
Levansucrase encoded by sacB is lethal for C. glutamicum in the presence of
sucrose. Therefore, only those clones in which the rare double cross-over event
occurred (involving the excision of plasmid sequences from the chromosome) can
be selected on sucrose-containing media. The use of suicide vectors containing
the sacB gene for the isolation of insertion sequences and transposons from
C. glutamicum are described by Suzuki (chapter “Amino Acid Production by
Corynebacterium glutamicum”).
In addition to the above-mentioned systems promoting integration into chromosomal regions homologous to those cloned in the plasmids, vectors capable of
integrating into specific sites on the chromosome were constructed. These vectors
contain chromosomal sequences, whose disruptions in the chromosome via homologous recombination have no effect on the viability of recombinant strains. The
Vector pEM1dppc integrating into the noncoding sequence downstream of the ppc
gene coding for phosphoenolpyruvate carboxylase (Vašicová et al. 1998) and the
vector pKX15 integrating into one of several copies of C. glutamicum genes coding
for 16S rRNA (Amador et al. 2000) have been used for site-specific integration into
the chromosome. Integrative plasmid vectors, carrying DNA regions of various
corynephages involved in their site-specific integration, have also been constructed.
The site-specific integration plasmid vectors pA3253, containing the minimal DNA
region required for integrating the temperate corynephage F16 (Moreau et al.
1999), and pKMO3W + mob (and its derivatives pK-AIM and pK-PIM), based
on the b phage of C. diphtheriae (Oram et al. 2007), are examples of such vectors.
3.3
Promoter-Probe Vectors
Reporter systems represent an important tool for isolating and characterizing
promoter regions. Various promoterless reporter genes, coding for easily detectable and quantifiable proteins, were used for the construction of a number of
promoter-probe vectors to test the activity of promoters and their regulation in
C. glutamicum (Table 2). The insertion of promoter-containing DNA fragments
12.0
pCG1
Kmr
Kmr
Kmr
EcoRI-NdeI
pPRE11
pEPR1
7.6
7.3
pCG1
pCG1
KpnI, BamHI, XbaI
SmaI, NsiI, BclI,
XbaI, BamHI,
SmaI, NsiI, BclI,
pRAG5
8.2
pCG1
Kmr
BamHI, XbaI
(b) Vector for integration into the C. glutamicum chromosome
HindIII, SphI, PstI,
pRIM2
5.3
–
Kmr
XbaI, BamHI,
SmaI, KpnI
pEGFP
Eikmanns et al. (1991a)
Eikmanns et al. (1991a)
Vašicová et al. (1998)
Park et al. (2004)
Cadenas et al. (1996)
Cadenas et al. (1991)
Barák et al. (1990)
Zupancic et al. (1995)
Bardonnet and Blanco (1991)
Bardonnet and Blanco (1991)
Adham et al. (2003)
–
–
–
–
–
–
–
–
–
Terminator-probe vector
Replacement of EcoRI-NdeI
fragment (P-kan)
necessary
Replacement of EcoRI-NdeI
fragment (P-kan)
necessary
–
–
–
cat
Vašicová et al. (1998)
rfp reference gene under
Knoppová et al. (2007)
constitutive P45 promoter
Knoppová et al. (2007)
Knoppová et al. (2007)
Letek et al. (2006)
References
Further characteristics
gfpuv
rsgfp
gfpuv
egfp2
Table 2 Promoter-probe vectors and a terminator-probe vector for corynebacteria
Size C. glutamicum Selection
Vector
(kb) replicon
marker(s)
Cloning sites
Reporter
(a) Autonomously replicating vectors
pEKpllacz
9.4
pBL1
Kmr
SalI, BamHI, SmaI, lacZ
KpnI
BamHI, SalI
cat
pEKplCm
7.4
pBL1
Kmr
PstI, SalI, BamHI
cat
pET2
7.5
pBL1
Kmr
KpnI, SacI
SmaI, BamHI, SalI, cat
pSK1Cat
6.3
pCG1
Kmr
PstI, HindIII
BamHI, KpnI, EcoRI amy
pULMJ95
6.9
pBL1
Kmr
pULMJ88
5.9
pBL1
Hygr
BglII
aph (Kmr)
r
BamHI, KpnI, BglII, aph (Kmr)
pJUP05
10.0 pBL1
Cm
EcoRV
aph (Kmr)
pPROBE17
8.0
pBL1
Cmr
r
pUC18 MCS
uidA
pUT3
7.4
pBL1
Km
pUT2
7.4
pBL1
Kmr
pUC18 MCS
uidA
EcoRI-NdeI
melC1,melC2
pEMel-1
13.0 pCG1
Kmr
74
M. Pátek and J. Nešvera
Promoters and Plasmid Vectors of Corynebacterium glutamicum
75
upstream of the reporter genes forms transcriptional fusions, which drive expression of the reporter genes. Construction of an efficient promoter-probe vector also
requires the insertion of transcriptional terminator(s) upstream of the cloning sites
to prevent readthrough from the vector to the reporter gene. The following reporter
genes coding for various enzymes were shown to be active in C. glutamicum: lacZ
coding for E. coli b-galactosidase (Eikmanns et al. 1991a; Nishimura et al. 2008),
cat coding for chloramphenicol acetyltransferase from Tn9 (Eikmanns et al.
1991a; Vašicová et al. 1998), aph coding for aminoglycoside phosphotransferase
from Tn5 (Barák et al. 1990; Cadenas et al. 1991; Zupancic et al. 1995), uidA
coding for E. coli b-glucuronidase (Bardonnet and Blanco 1991), and amy coding
for a-amylase from Streptomyces griseus (Cadenas et al. 1996). The frequently
used promoter-probe vector pET2, carrying the promoterless cat reporter gene
(Vašicová et al. 1998), is shown in Fig. 6a. This vector was used to analyze the
transcriptional regulation of various C. glutamicum genes and operons, e.g., genes
of phosphate (Ishige et al. 2003), acetate (Gerstmeir et al. 2004), and one-carbon
metabolism (Schweitzer et al. 2009), the ATPase operon (Barriuso-Iglesias et al.
2006), the gene coding for alcohol dehydrogenase (Arndt and Eikmanns 2007),
and genes involved in dicarboxylate uptake (Youn et al. 2008). To ensure the
transcriptional fusion of the tested promoter to a reporter gene in a single copy in
the cell, the integrative promoter-probe vector pRIM2 carrying the cat reporter
gene was constructed. It contains the replicon of an E. coli vector nonreplicating in
corynebacteria and a noncoding sequence downstream of the C. glutamicum ppc
gene coding for phosphoenolpyruvate carboxylase, which allows integration of the
vector into the C. glutamicum chromosome via homologous recombination without any detrimental effect on cell growth (Vašicová et al. 1998, 1999).
The pigment melanine from Streptomyces glaucescens (Adham et al. 2003) and
the green fluorescent protein (GFP) from the jellyfish Aequorea victoria are further
reporter proteins easily detectable in C. glutamicum cells. The use of the gfp reporter
gene enables promoter activity to be tested by estimating the fluorescence intensity in
living cells. Promoter-probe vectors carrying the reporter genes coding for various
forms of GFP protein have recently been used for testing promoter activity in C.
glutamicum in vivo (Letek et al. 2006; Knoppová et al. 2007; Jungwirth et al. 2008;
H€anssler et al. 2009). As an example of such vectors, pEPR1 is shown in Fig. 6b. The
vector pRAG5 carrying the reference gene rfp (coding for red fluorescence protein
from the coral Discosoma sp.) under the strong constitutive C. glutamicum promoter,
in addition to the gfpuv reporter gene, was constructed on the basis of pEPR1
(Knoppová et al. 2007). The vector pRAG5 is convenient for normalized
measurements of promoter activities during the growth of bacterial batch cultures,
since estimating the GFP/RFP fluorescence ratio in strains carrying the plasmid
pRAG5 with the tested promoters upstream of gfpuv avoids the influence of plasmid
copy number variations on the promoter activity measurements.
In addition to the promoter-probe vectors for C. glutamicum, the terminatorprobe vector pUT2 for screening transcription termination signals in C. glutamicum
was also constructed. The presence of a transcriptional terminator on the cloned
fragment can be detected by a loss of activity of the uidA reporter gene coding for
b-glucuronidase (Bardonnet and Blanco 1991).
76
M. Pátek and J. Nešvera
Fig. 6 Maps of plasmid vectors for C. glutamicum. (a) C. glutamicum/E. coli shuttle
promoter-probe vector pET2, (b) C. glutamicum/E. coli shuttle promoter-probe vector pEPR1,
(c) C. glutamicum/E. coli shuttle expression vector pVWEx1, (d) C. glutamicum/E. coli shuttle
expression vector pTRCmob. The regions coming from plasmids of corynebacteria (pBL1, pCG1
and pGA1, respectively) are shown as thick black lines. The genes are shown inside the maps as
arrows. aph, kanamycin resistance determinant; catPL, promoterless reporter gene coding for
chloramphenicol acetyltransferase; gfpuvPL, promoterless reporter gene coding for green fluorescent protein; TCE, TCE1 and TCE2, tandems of transcriptional terminators; T1 and T2, transcriptional
terminators; rep, initiator of RC replication; per, positive effector of plasmid replication; lacIq,
lactose repressor; oriT, origin of conjugative transfer; P-tac and P-trc, promoters inducible by
IPTG; RP4-mob, mobilzation region
3.4
Expression Vectors
Overexpression of the cloned genes is often used in detailed studies of gene
function and also serves as a basis for increased synthesis of practically important
Promoters and Plasmid Vectors of Corynebacterium glutamicum
77
gene products. The construction of plasmid vectors ensuring the controlled
expression of the cloned genes from strong regulated promoters is thus of great
importance. Most C. glutamicum–E. coli shuttle expression vectors [e.g., pEKEx1
(Eikmanns et al. 1991a), pXMJ19 (Jakoby et al. 1999), pVWEx1 (Peters-Wendisch
et al. 2001) (Fig. 6c), pCRC200 (Yasuda et al. 2007), pECt (Sato et al. 2008) and
pBB1 (Krause et al. 2010)], as well as the integrative expression vector pXK99E
(Kirchner and Tauch 2003), carry a regulated E. coli promoter (P-lac, P-tac, or
P-trc) inducible by the addition of isopropyl-b-D-thiogalactopyranoside (IPTG),
functioning in C. glutamicum. To ensure tight regulation of these promoters, the
lacIq gene coding for the Lac repressor is also present in most C. glutamicum–
E. coli expression vectors (Table 3), sometimes even under a strong constitutive
C. glutamicum promoter as in the vector pDWX-8 (Xu et al. 2010). The regulated
P-tac promoter is also present in the vector pBKGEXm2 containing the
glutathione-S-transferase fusion cassette. Using this expression vector, the products
of the cloned genes can be isolated as fusion proteins by affinity chromatography
(Srivastava and Deb 2002). The finding that IPTG-induced overexpression of the
pyc gene (pyruvate carboxylase) from P-tac in the vector pVWEx1 increased
glutamate, lysine, and threonine production by the recombinant strain (PetersWendisch et al. 2001) is an example of the practical application of expression
vectors in C. glutamicum.
Expression systems based on the induction of gene expression after the addition
of IPTG are very useful for gene analysis in the laboratory. However, their use on
industrial scale seems to be very limited due to the high cost of the inducing
compound. Regulating gene expression via changes in temperature thus represents
a more suitable alternative. Based on the findings that the PRPL promoter-operatorcI repressor system of bacteriophage l also operates in C. glutamicum, the expression vector pEC901 containing the PRPL promoters and the cI857 gene, coding for a
temperature-sensitive repressor, was constructed and a high level of expression of
the genes cloned under the PRPL promoters was observed after temperature pulses
(40 C) (Tsuchiya and Morinaga 1988). The temperature-sensitive repressor cI857
and l OL1 operator were also used for controlled expression of the genes cloned in
the novel C. glutamicum–E. coli shuttle expression vector pCeHEMG857. This
expression vector also codes for the His-tag and enterokinase moiety, which
enables isolation of the products of the cloned genes as fusion proteins by affinity
chromatography and subsequent elimination of the fusion partner by digestion with
enterokinase (Park et al. 2008a).
In addition to the vectors ensuring regulated expression of the cloned genes, the
vector pTRCmob providing constitutive expression from the P-trc promoter was
constructed on the basis of the pGA1 replicon (Fig. 6d) and used for increased
production of the enzymes involved in the biosynthesis of polyhydroxybutyrate
(Liu et al. 2007). Several special C. glutamicum expression vectors were also
constructed, ensuring a cell surface display of the products of the cloned genes.
These vectors (pCC-porB, pCC-porC, and pCC-porH) contain genes coding for
porin proteins under the strong constitutive P-cspB promoter (Tateno et al. 2009).
The cloned gene is fused with the respective por gene (porB, porC, or porH) and
the fusion protein produced is subsequently displayed on the C. glutamicum cell
pBL1
pCG1
pCG1
pCG1
pCG1
pGA1
pGA1
pNG2
pBKGEXm2 7.3
7.0
8.5
6.5
8.5
7.0
6.4
4.6
pZ8-1
pVWEx1
pSL360
pEC901
pECXK99Ea
pTRCmob
pAPE12
EcoRI, BamHI, SalI, PstI
PstI, SalI, XbaI,
HindIII
BamHI
pTrc99A MCS
EcoRI, SmaI, BamHI, XbaI, SalI, PstI
EcoRI, SalI, BamHI
Kmr
Kmr
Kmr
Kmr
Kmr
pUC19 MCS
EcoRI, SacI, KpnI, XhoI, PstI, SmaI, BamHI,
Xba I, SalI
pUC18 MCS
EcoRI, NheI, SacI, NcoI, NotI, XhoI, KpnI,
BglII, SacII, AflI, Hind III
BamHI, EcoRI, SmaI, SalI, XhoI, NotI
Kmr
Kmr
Kmr
Cmr
Kmr
Cmr
Cmr
P-trc, lacIq
P-trc
P-trc, lacIq
P-trc, lacIq
P-180
PL/PR (l), cI857
P-tac
P-tac, lacIq
P-tac, lacIq
P-tac
P-tac, lacIPF104
IPTG
IPTG
IPTG
40 C
IPTG
IPTG
IPTG
IPTG
IPTG
P-tac, lacIq
P-tac, lacIq
P-lac
Induction
conditions
Promoter,
regulatory gene
Srivastava and Deb
(2002)
Dusch et al. (1999)
Peters-Wendisch
et al. (2001)
Park et al. (2004)
Tsuchiya and
Morinaga (1988)
Kirchner and Tauch
(2003)
Liu et al. (2007)
Guillouet et al.
(1999)
Suzuki et al. (2009)
Xu et al. (2010)
Eikmanns et al.
(1991a)
Jakoby et al. (1999)
Nakata et al. (2004)
References
Kirchner and Tauch
(2003)
a
The pEC-XK99E derivatives pEC-XC99E and pEC-XT99A containing Cmr and Tcr determinants, respectively, have been constructed as well (Kirchner and
Tauch 2003)
b
The pXK99E derivatives pXC99E and pXT99A containing Cmr and Tcr determinants, respectively, have been constructed as well (Kirchner and Tauch 2003)
(b) Vector for integration into the C. glutamicum chromosome
4.4
–
Kmr
pTrc99A MCS
pXK99Eb
pBL1
pBL1
4.3
9.6
pCRA429
pDXW-8
pBL1
pBL1
6.6
5.3
pXMJ19
pCRA1
Table 3 Plasmid expression vectors for corynebacteria
Size C.glutamicum Selection
Vector
(kb) replicon
marker
Cloning sites
(a) Autonomously replicating C. glutamicum/E. coli shuttle vectors
pEKEx1
8.2
pBL1
Kmr
EcoRI, BamHI, SalI, PstI
78
M. Pátek and J. Nešvera
Promoters and Plasmid Vectors of Corynebacterium glutamicum
79
surface via natural porin anchoring. The a-amylase from Streptococcus bovis was
used as a model protein in this system and its activity in the cell fraction of
C. glutamicum was successfully detected (Tateno et al. 2009).
4 Concluding Remarks
Remarkable progress in the number of localized promoters, description of
their structure, and in understanding the mechanisms of their regulation in
C. glutamicum has been achieved in the past few years. Promoters recognized by
RNAP with alternative sigma factors have been discovered and the consensus
sequences of these specific classes of promoters are emerging. Genes transcribed
from multiple promoters dependent on various sigma factors displaying distinctive
regulatory patterns have been studied. Evidence of the cross-regulation of genes
coding for sigma factors provides a basis for the elucidation of a regulatory
network involving sigma factors. The localization of promoters facilitates understanding their complex control mechanisms, including the involvement of several
DNA-binding transcriptional factors in the regulation of a single promoter.
High-throughput sequencing techniques for mapping transcripts should reveal large
numbers of TSPs and thus allow localization of the respective promoters. Promoterprobe plasmid vectors proved to be efficient tools for the analysis of promoter activity
patterns. Efficient and user-friendly inducible C. glutamicum promoters with predictable activity patterns, which can substitute for heterologous promoters in the inducible systems of expression vectors, have not yet been found. Well-defined promoters
and their modified derivatives need to be described so they can be used in regulated or
graded gene expression for both research and practical applications. The use of
specific mutant host strains and plasmid vectors carrying the genes complementing
the mutation would ensure stable maintenance of recombinant plasmids in cell
cultures grown in the absence of positive selection pressure. Genetic manipulations
within the bacterial chromosome using integrative plasmid vectors represent an
alternative for the construction of stable and safe C. glutamicum producing strains
applied for industrial fermentations. Further knowledge of promoter structures and
activity patterns as well as the construction of new plasmid vectors will accelerate
progress in both the analysis of C. glutamicum regulatory networks and their application in industrial amino acid production.
Acknowledgments Work in the authors’ laboratory was supported by grant 204/09/J015 from the
Scientific Council of the Czech Republic.
References
Adham SA, Rodriguez S, Ramos A, Santamaria RI, Gil JA (2003) Improved vectors for transcriptional/translational signal screening in corynebacteria using the melC operon from Streptomyces glaucescens as reporter. Arch Microbiol 180:53–59
Amador E, Martin JF, Castro JM (2000) A Brevibacterium lactofermentum 16S rRNA gene used
as target site for homologous recombination. FEMS Microbiol Lett 185:199–204
80
M. Pátek and J. Nešvera
Arndt A, Eikmanns BJ (2007) The alcohol dehydrogenase gene adhA in Corynebacterium
glutamicum is subject to carbon catabolite repression. J Bacteriol 189:7408–7416
Asakura Y, Kimura E, Usuda Y, Kawahara Y, Matsui K, Osumi T, Nakamatsu T (2007) Altered
metabolic flux due to deletion of odhA causes L-glutamate overproduction in Corynebacterium
glutamicum. Appl Environ Microbiol 73:1308–1319
Auchter M, Arndt A, Eikmanns BJ (2009) Dual transcriptional control of the acetaldehyde
dehydrogenase gene ald of Corynebacterium glutamicum by RamA and RamB. J Biotechnol
140:84–91
Balwierz PJ, Carninci P, Daub CO, Kawai J, Hayashizaki Y, Van Belle W, Beisel C et al (2009)
Methods for analyzing deep sequencing expression data: constructing the human and mouse
promoterome with deepCAGE data. Genome Biol 10:R79
Barák I, Koptides M, Jucovič M, Šišova M, Timko J (1990) Construction of a promoter-probe
shuttle vector for Escherichia coli and brevibacteria. Gene 95:133–135
Bardonnet N, Blanco C (1991) Improved vectors for transcriptional signal screening in
corynebacteria. FEMS Microbiol Lett 68:97–102
Barreiro C, González-Lavado E, Pátek M, Martı́n JF (2004) Transcriptional analysis of the groESgroEL1, groEL2, and dnaK genes in Corynebacterium glutamicum: characterization of heat
shock-induced promoters. J Bacteriol 186:4813–4817
Barreiro C, Nakunst D, Huser AT, de Paz HD, Kalinowski J, Martin JF (2009) Microarray studies
reveal a ‘differential response’ to moderate or severe heat shock of the HrcA- and HspRdependent systems in Corynebacterium glutamicum. Microbiology 155:359–372
Barriuso-Iglesias M, Barreiro C, Flechoso F, Martı́n JF (2006) Transcriptional analysis of the F0F1
ATPase operon of Corynebacterium glutamicum ATCC 13032 reveals strong induction by
alkaline pH. Microbiology 152:11–21
Bashyam MD, Tyagi AK (1998) Identification and analysis of “extended -10” promoters from
mycobacteria. J Bacteriol 180:2568–2573
Bernard KA, Wiebe D, Burdz T, Reimer A, Ng B, Singh C, Schindle S, Pacheco AL (2010)
Assignment of Brevibacterium stationis (ZoBell and Upham 1994) Breed 1953 to the genus
Corynebacterium as Corynebacterium stationis comb. nov. and emended description of the
genus Corynebacterium to include isoates which can alkalinize citrate. Int J Syst Evol
Microbiol 60:874–879
Brinkrolf K, Brune I, Tauch A (2007) The transcriptional regulatory network of the amino acid
producer Corynebacterium glutamicum. J Biotechnol 129:191–211
Brinkrolf K, Pl€oger S, Solle S, Brune I, Nentwich SS, H€
user AT, Kalinowski J et al (2008) The
LacI/GalR family transcriptional regulator UriR negatively controls uridine utilization of
Corynebacterium glutamicum by binding to catabolite-responsive element (cre)-like
sequences. Microbiology 154:1068–1081
Brocker M, Schaffer S, Mack C, Bott M (2009) Citrate utilization by Corynebacterium
glutamicum is controlled by the CitAB two-component system through positive regulation of
the citrate transport genes citH and tctCBA. J Bacteriol 191:3869–3880
Brockmann-Gretza O, Kalinowski J (2006) Global gene expression during stringent response in
Corynebacterium glutamicum in presence and absence of the rel gene encoding (p)ppGpp
synthase. BMC Genomics 7:230
Brune I, Jochmann N, Brinkrolf K, H€
user AT, Gerstmeir R, Eikmanns BJ, Kalinowski J et al
(2007) The IclR-type transcriptional repressor LtbR regulates the expression of leucine and
tryptophan biosynthesis genes in the amino acid producer Corynebacterium glutamicum.
J Bacteriol 189:2720–2733
Burr T, Mitchell J, Kolb A, Minchin S, Busby S (2000) DNA sequence elements located immediately upstream of the -10 hexamer in Escherichia coli promoters: a systematic study. Nucleic
Acids Res 28:1864–1870
Cadenas RF, Martin JF, Gil JA (1991) Construction and characterization of promoter-probe
vectors for Corynebacteria using the kanamycin-resistance reporter gene. Gene 98:117–121
Promoters and Plasmid Vectors of Corynebacterium glutamicum
81
Cadenas RF, Fernandez-Gonzalez C, Martin JF, Gil JA (1996) Construction of new cloning
vectors for Brevibacterium lactofermentum. FEMS Microbiol Lett 137:63–68
Cramer A, Eikmanns BJ (2007) RamA, the transcriptional regulator of acetate metabolism in
Corynebacterium glutamicum, is subject to negative autoregulation. J Mol Microbiol
Biotechnol 12:51–59
Cramer A, Auchter M, Frunzke J, Bott M, Eikmanns BJ (2007) RamB, the transcriptional regulator
of acetate metabolism in Corynebacterium glutamicum, is subject to regulation by RamA and
RamB. J Bacteriol 189:1145–1149
Cremer J, Eggeling L, Sahm H (1990) Cloning the dapAdapB cluster of the lysine-secreting
bacterium Corynebacterium glutamicum. Mol Gen Genet 220:478–480
Dainese E, Rodrigue S, Delogu G, Provvedi R, Laflamme L, Brzezinski R, Fadda G et al (2006)
Posttranslational regulation of Mycobacterium tuberculosis extracytoplasmic-function sigma
factor sL and roles in virulence and in global regulation of gene expression. Infect Immun
74:2457–2461
Dusch N, P€uhler A, Kalinowski J (1999) Expression of the Corynebacterium glutamicum panD
gene encoding L-aspartate-alpha-decarboxylase leads to pantothenate overproduction in
Escherichia coli. Appl Environ Microbiol 65:1530–1539
Eggeling L, Reyes O (2005) Experiments. In: Eggeling L, Bott M (eds) Handbook of Corynebacterium glutamicum. CRC, Boca Raton, FL, pp 535–566
Ehira S, Shirai T, Teramoto H, Inui M, Yukawa H (2008) Group 2 sigma factor SigB of
Corynebacterium glutamicum positively regulates glucose metabolism under conditions of
oxygen deprivation. Appl Environ Microbiol 74:5146–5152
Ehira S, Teramoto H, Inui M, Yukawa H (2009) Regulation of Corynebacterium glutamicum heat
shock response by the extracytoplasmic-function sigma factor SigH and transcriptional
regulators HspR and HrcA. J Bacteriol 191:2964–2972
Eikmanns BJ, Kleinertz E, Liebl W, Sahm H (1991a) A family of Corynebacterium glutamicum/
Escherichia coli shuttle vectors for cloning, controlled gene expression, and promoter probing.
Gene 102:93–98
Eikmanns BJ, Metzger M, Reinscheid D, Kircher M, Sahm H (1991b) Amplification of three
threonine biosynthesis genes in Corynebacterium glutamicum and its influence on carbon flux
in different strains. Appl Microbiol Biotechnol 34:617–622
Elišáková V, Pátek M, Holátko J, Nešvera J, Leyval D, Goergen JL, Delaunay S (2005) Feedbackresistant acetohydroxy acid synthase increases valine production in Corynebacterium
glutamicum. Appl Environ Microbiol 71:207–213
Engels S, Schweitzer JE, Ludwig C, Bott M, Schaffer S (2004) clpC and clpP1P2 gene expression
in Corynebacterium glutamicum is controlled by a regulatory network involving the transcriptional regulators ClgR and HspR as well as the ECF sigma factor sH. Mol Microbiol
52:285–302
Engels V, Georgi T, Wendisch VF (2008) ScrB (Cg2927) is a sucrose-6-phosphate hydrolase
essential for sucrose utilization by Corynebacterium glutamicum. FEMS Microbiol Lett
289:80–89
Fernandez-Gonzalez C, Cadenas RF, Noirot-Gros MF, Martin JF, Gil JA (1994) Characterization
of a region of plasmid pBL1 of Brevibacterium lactofermentum involved in replication via the
rolling circle model. J Bacteriol 176:3154–3161
Frunzke J, Engels V, Hasenbein S, Gatgens C, Bott M (2008) Co-ordinated regulation of gluconate
catabolism and glucose uptake in Corynebacterium glutamicum by two functionally equivalent
transcriptional regulators, GntR1 and GntR2. Mol Microbiol 67:305–322
Gaigalat L, Schl€uter JP, Hartmann M, Mormann S, Tauch A, P€
uhler A, Kalinowski J (2007) The
DeoR-type transcriptional regulator SugR acts as a repressor for genes encoding the phosphoenolpyruvate:sugar phosphotransferase system (PTS) in Corynebacterium glutamicum. BMC
Mol Biol 8:104
Georgi T, Engels V, Wendisch VF (2007) Regulation of L-lactate utilization by the FadR-type
regulator LldR of Corynebacterium glutamicum. J Bacteriol 190(3):963–971
82
M. Pátek and J. Nešvera
Gerstmeir R, Cramer A, Dangel P, Schaffer S, Eikmanns BJ (2004) RamB, a novel transcriptional
regulator of genes involved in acetate metabolism of Corynebacterium glutamicum. J Bacteriol
186:2798–2809
Goyal D, Wachi M, Kijima N, Kobayashi M, Yukawa H, Nagai K (1996) A cryptic plasmid pBL1
from Brevibacterium lactofermentum causes growth inhibition and filamentation in
Escherichia coli. Plasmid 36:62–66
Gruber TM, Gross CA (2003) Multiple sigma subunits and the partitioning of bacterial
transcription space. Annu Rev Microbiol 57:441–466
Guillouet S, Rodal AA, An G, Lessard PA, Sinskey AJ (1999) Expression of the Escherichia coli
catabolic threonine dehydratase in Corynebacterium glutamicum and its effect on isoleucine
production. Appl Environ Microbiol 65:3100–3107
Halgasova N, Bukovska G, Timko J, Kormanec J (2001) Cloning and transcriptional characterization of two sigma factor genes, sigA and sigB, from Brevibacterium flavum. Curr Microbiol
43:249–254
Halgasova N, Bukovska G, Ugorcakova J, Timko J, Kormanec J (2002) The Brevibacterium
flavum sigma factor SigB has a role in the environmental stress response. FEMS Microbiol Lett
216:77–84
Han KS, Archer JA, Sinskey AJ (1990) The molecular structure of the Corynebacterium
glutamicum threonine synthase gene. Mol Microbiol 4:1693–1702
Han SO, Inui M, Yukawa H (2007) Expression of Corynebacterium glutamicum glycolytic genes
varies with carbon source and growth phase. Microbiology 153:2190–2202
Han SO, Inui M, Yukawa H (2008) Effect of carbon source availability and growth phase on
expression of Corynebacterium glutamicum genes involved in the tricarboxylic acid cycle and
glyoxylate bypass. Microbiology 154:3073–3083
H€anssler E, M€uller T, Palumbo K, Patek M, Brocker M, Kr€amer R, Burkovski A (2009) A game
with many players: control of gdh transcription in Corynebacterium glutamicum. J Biotechnol
142:114–122
Holátko J, Elišáková V, Prouza M, Sobotka M, Nešvera J, Pátek M (2009) Metabolic engineering
of the L-valine biosynthesis pathway in Corynebacterium glutamicum using promoter activity
modulation. J Biotechnol 139:203–210
Ikeda M, Katsumata R (1998) A novel system with positive selection for the chromosomal
integration of replicative plasmid DNA in Corynebacterium glutamicum. Microbiology
144:1863–1868
Ikeda M, Nakagawa S (2003) The Corynebacterium glutamicum genome: features and impacts on
biotechnological processes. Appl Microbiol Biotechnol 62:99–109
Inui M, Suda M, Okino S, Nonaka H, Puskas LG, Vertès AA, Yukawa H (2007) Transcriptional
profiling of Corynebacterium glutamicum metabolism during organic acid production under
oxygen deprivation conditions. Microbiology 153:2491–2504
Ishige T, Krause M, Bott M, Wendisch VF, Sahm H (2003) The phosphate starvation stimulon of
Corynebacterium glutamicum determined by DNA microarray analyses. J Bacteriol
185:4519–4529
Ito H, Sato K, Enei H, Hirose Y (1990a) Improvement in microbial production of L-tyrosine by
gene dosage effect of aroL gene encoding shikimate kinase. Agric Biol Chem 54:823–824
Ito H, Sato K, Matsui K, Sano K, Enei H, Hirose Y (1990b) Molecular breeding of a
Brevibacterium lactofermentum L-phenylalanine producer using a cloned prephenate
dehydratase gene. Appl Microbiol Biotechnol 33:190–195
Jacques PE, Rodrigue S, Gaudreau L, Goulet J, Brzezinski R (2006) Detection of prokaryotic
promoters from the genomic distribution of hexanucleotide pairs. BMC Bioinformatics 7:423
J€ager W, Sch€afer A, P€
uhler A, Labes G, Wohlleben W (1992) Expression of the Bacillus subtilis
sacB gene leads to sucrose sensitivity in the gram-positive bacterium Corynebacterium
glutamicum but not in Streptomyces lividans. J Bacteriol 174:5462–5465
Jakob K, Satorhelyi P, Lange C, Wendisch VF, Silakowski B, Scherer S, Neuhaus K (2007) Gene
expression analysis of Corynebacterium glutamicum subjected to long-term lactic acid adaptation. J Bacteriol 189:5582–5590
Promoters and Plasmid Vectors of Corynebacterium glutamicum
83
Jakoby M, Ngouoto-Nkili CE, Burkovski A (1999) Construction and application of new Corynebacterium glutamicum vectors. Biotechnol Tech 13:437–441
Jochmann N, Kurze AK, Czaja LF, Brinkrolf K, Brune I, H€
user AT, Hansmeier N et al (2009)
Genetic makeup of the Corynebacterium glutamicum LexA regulon deduced from comparative
transcriptomics and in vitro DNA band shift assays. Microbiology 155:1459–1477
Jungwirth B, Emer D, Brune I, Hansmeier N, P€
uhler A, Eikmanns BJ, Tauch A (2008) Triple
transcriptional control of the resuscitation promoting factor 2 (rpf2) gene of Corynebacterium
glutamicum by the regulators of acetate metabolism RamA and RamB and the cAMPdependent regulator GlxR. FEMS Microbiol Lett 281:190–197
Kaberdina AC, Szaflarski W, Nierhaus KH, Moll I (2009) An unexpected type of ribosomes
induced by kasugamycin: a look into ancestral times of protein synthesis? Mol Cell
33:227–236
Kalinowski J, Bathe B, Bartels D, Bischoff N, Bott M, Burkovski A, Dusch N et al (2003) The
complete Corynebacterium glutamicum ATCC 13032 genome sequence and its impact on the
production of L-aspartate-derived amino acids and vitamins. J Biotechnol 104:5–25
Katsumata R, Ozaki A, Oka T, Furuya A (1984) Protoplast transformation of glutamate-producing
bacteria with plasmid DNA. J Bacteriol 159:306–311
Khan SA (1997) Rolling-circle replication of bacterial plasmids. Microbiol Mol Biol Rev
61:442–455
Kim TH, Kim HJ, Park JS, Kim Y, Kim P, Lee HS (2005) Functional analysis of sigH expression
in Corynebacterium glutamicum. Biochem Biophys Res Commun 331:1542–1547
Kirchner O, Tauch A (2003) Tools for genetic engineering in the amino acid-producing bacterium
Corynebacterium glutamicum. J Biotechnol 104:287–299
Knoppová M, Phensaijai M, Veselý M, Zemanová M, Nešvera J, Pátek M (2007) Plasmid vectors
for testing in vivo promoter activities in Corynebacterium glutamicum and Rhodococcus
erythropolis. Curr Microbiol 55:234–239
Kočan M, Sch€affer S, Ishige T, Sorger-Herrmann U, Wendisch VF, Bott M (2006) Twocomponent systems of Corynebacterium glutamicum: deletion analysis and involvement of
the PhoS-PhoR system in the phosphate starvation response. J Bacteriol 188:724–732
Koch DJ, R€uckert C, Albersmeier A, H€
user AT, Tauch A, P€
uhler A, Kalinowski J (2005) The
transcriptional regulator SsuR activates expression of the Corynebacterium glutamicum
sulphonate utilization genes in the absence of sulphate. Mol Microbiol 58:480–494
Kohl TA, Baumbach J, Jungwirth B, P€
uhler A, Tauch A (2008) The GlxR regulon of the amino
acid producer Corynebacterium glutamicum: in silico and in vitro detection of DNA binding
sites of a global transcription regulator. J Biotechnol 135:340–350
Krause FS, Henrich A, Blombach B, Kr€amer R, Eikmanns BJ, Seibold GM (2010) Increased
glucose utilization in Corynebacterium glutamicum by use of maltose, and its application for
the improvement of L-valine productivity. Appl Environ Microbiol 76:370–374
Krug A, Wendisch VF, Bott M (2005) Identification of AcnR, a TetR-type repressor of the
aconitase gene acn in Corynebacterium glutamicum. J Biol Chem 280:585–595
Kurusu Y, Satoh Y, Inui M, Kohama K, Kobayashi M, Terasawa M, Yukawa H (1991) Identification of a plasmid partition function in coryneform bacteria. Appl Environ Microbiol
57:759–764
Larisch C, Nakunst D, Huser AT, Tauch A, Kalinowski J (2007) The alternative sigma factor SigB
of Corynebacterium glutamicum modulates global gene expression during transition from
exponential growth to stationary phase. BMC Genomics 8:4
Letek M, Valbuena N, Ramos A, Ordonez E, Gil JA, Mateos LM (2006) Characterization and use
of catabolite-repressed promoters from gluconate genes in Corynebacterium glutamicum.
J Bacteriol 188:409–423
Letek M, Ordonez E, Fiuza M, Honrubia-Marcos P, Vaquera J, Gil JA, Castro D et al (2007)
Characterization of the promoter region of ftsZ from Corynebacterium glutamicum and controlled overexpression of FtsZ. Int Microbiol 10:271–282
84
M. Pátek and J. Nešvera
Lisser S, Margalit H (1994) Determination of common structural features in Escherichia coli
promoters by computer analysis. Eur J Biochem 223:823–830
Liu Q, Ouyang SP, Kim J, Chen GQ (2007) The impact of PHB accumulation on L-glutamate
production by recombinant Corynebacterium glutamicum. J Biotechnol 132:273–279
Marcel T, Archer JA, Mengin-Lecreulx D, Sinskey AJ (1990) Nucleotide sequence and organization of the upstream region of the Corynebacterium glutamicum lysA gene. Mol Microbiol
4:1819–1830
Matsui K, Ishida M, Tsuchiya M, Sano K (1988) Construction of tryptophan-producing recombinant strains of Brevibacterium lactofermentum using the engineered trp operons. Agric Biol
Chem 52:1863–1865
Mendoza-Vargas A, Olvera L, Olvera M, Grande R, Vega-Alvarado L, Taboada B, JimenezJacinto V et al (2009) Genome-wide identification of transcription start sites, promoters and
transcription factor binding sites in E. coli. PLoS One 4:e7526
Merkens H, Beckers G, Wirtz A, Burkovski A (2005) Vanillate metabolism in Corynebacterium
glutamicum. Curr Microbiol 51:59–65
Miwa K, Matsui H, Terabe M, Nakamori S, Sano K, Momose H (1984) Cryptic plasmids in
glutamic acid-producing bacteria. Agric Biol Chem 48:2901–2903
M€oker N, Brocker M, Sch€affer S, Kr€amer R, Morbach S, Bott M (2004) Deletion of the genes
encoding the MtrA-MtrB two-component system of Corynebacterium glutamicum has a strong
influence on cell morphology, antibiotics susceptibility and expression of genes involved in
osmoprotection. Mol Microbiol 54:420–438
Moll I, Grill S, Gualerzi CO, Blasi U (2002) Leaderless mRNAs in bacteria: surprises in ribosomal
recruitment and translational control. Mol Microbiol 43:239–246
Moll I, Hirokawa G, Kiel MC, Kaji A, Blasi U (2004) Translation initiation with 70S ribosomes:
an alternative pathway for leaderless mRNAs. Nucleic Acids Res 32:3354–3363
Moreau S, Blanco C, Trautwetter A (1999) Site-specific integration of corynephage phi16:
construction of an integration vector. Microbiology 145:539–548
Nakamura J, Kanno S, Kimura E, Matsui K, Nakamatsu T, Wachi M (2006) Temperature-sensitive
cloning vector for Corynebacterium glutamicum. Plasmid 56:179–186
Nakata K, Inui M, Kos PB, Vertès AA, Yukawa H (2004) Vectors for genetic engineering of
corynebacteria. In: Saha BC (ed) Fermentation biotechnology. American Chemical Society,
Washington, DC, pp 175–191
Nakunst D, Larisch C, Huser AT, Tauch A, Puhler A, Kalinowski J (2007) The extracytoplasmic
function-type sigma factor SigM of Corynebacterium glutamicum ATCC 13032 is involved in
transcription of disulfide stress-related genes. J Bacteriol 189:4696–4707
Nentwich SS, Brinkrolf K, Gaigalat L, Huser AT, Rey DA, Mohrbach T, Marin K et al (2009)
Characterization of the LacI-type transcriptional repressor RbsR controlling ribose transport in
Corynebacterium glutamicum ATCC 13032. Microbiology 155:150–164
Nešvera J, Pátek M (2008) Plasmids and promoters in corynebacteria and their applications. In:
Burkovski A (ed) Corynebacteria. Genomics and molecular biology. Caister Academic,
Norfolk, pp 113–154
Nešvera J, Pátek M, Hochmannová J, Abrhamová Z, Bečvařová V, Jelı́nková M, Vohradský J
(1997) Plasmid pGA1 from Corynebacterium glutamicum codes for a gene product that
positively influences plasmid copy number. J Bacteriol 179:1525–1532
Nishimura T, Vertès AA, Shinoda Y, Inui M, Yukawa H (2007) Anaerobic growth of Corynebacterium glutamicum using nitrate as a terminal electron acceptor. Appl Microbiol Biotechnol
75:889–897
Nishimura T, Teramoto H, Vertès AA, Inui M, Yukawa H (2008) ArnR, a novel transcriptional
regulator, represses expression of the narKGHJI operon in Corynebacterium glutamicum.
J Bacteriol 190:3264–3273
Oguiza JA, Marcos AT, Martı́n JF (1997) Transcriptional analysis of the sigA and sigB genes of
Brevibacterium lactofermentum. FEMS Microbiol Lett 153:111–117
Promoters and Plasmid Vectors of Corynebacterium glutamicum
85
Ohnishi J, Mitsuhashi S, Hayashi M, Ando S, Yokoi H, Ochiai K, Ikeda M (2002) A novel
methodology employing Corynebacterium glutamicum genome information to generate a new
L-lysine-producing mutant. Appl Microbiol Biotechnol 58:217–223
Okibe N, Suzuki N, Inui M, Yukawa H (2009) Isolation, evaluation and use of two strong, carbon
source-inducible promoters from Corynebacterium glutamicum. Lett Appl Microbiol
50:173–180
Olvera L, Mendoza-Vargas A, Flores N, Olvera M, Sigala JC, Gosset G, Morett E et al (2009)
Transcription analysis of central metabolism genes in Escherichia coli. Possible roles of s38 in
their expression, as a response to carbon limitation. PLoS One 4:e7466
Oram M, Woolston JE, Jacobson AD, Holmes RK, Oram DM (2007) Bacteriophage-based vectors
for site-specific insertion of DNA in the chromosome of Corynebacteria. Gene 391:53–62
Ozaki A, Katsumata R, Oka T, Furuya A (1984) Functional expression of the genes of Escherichia
coli in gram-positive Corynebacterium glutamicum. Mol Gen Genet 196:175–178
Paget MS, Helmann JD (2003) The sigma70 family of sigma factors. Genome Biol 4:203
Paget MS, Molle V, Cohen G, Aharonowitz Y, Buttner MJ (2001) Defining the disulphide stress
response in Streptomyces coelicolor A3(2): identification of the sigmaR regulon. Mol
Microbiol 42:1007–1020
Park SD, Lee SN, Park IH, Choi JS, Jeong WK, Kim Y, Lee HS (2004) Isolation and characterization of transcriptional elements from Corynebacterium glutamicum. J Microbiol Biotechnol
14:789–795
Park JU, Jo JH, Kim YJ, Chung SS, Lee JH, Lee HH (2008a) Construction of heat-inducible
expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda
operator with promoters isolated from C. ammoniagenes. J Microbiol Biotechnol 18:639–647
Park SD, Youn JW, Kim YJ, Lee SM, Kim Y, Lee HS (2008b) Corynebacterium glutamicum sE is
involved in responses to cell surface stresses and its activity is controlled by the anti-s factor
CseE. Microbiology 154:915–923
Pátek M, Eikmanns BJ, Pátek J, Sahm H (1996) Promoters from Corynebacterium glutamicum:
cloning, molecular analysis and search for a consensus motif. Microbiology 142:1297–1309
Pátek M, Nešvera J, Guyonvarch A, Reyes O, Leblon G (2003) Promoters of Corynebacterium
glutamicum. J Biotechnol 104:311–323
Peoples OP, Liebl W, Bodis M, Maeng PJ, Follettie MT, Archer JA, Sinskey AJ (1988) Nucleotide
sequence and fine structural analysis of the Corynebacterium glutamicum hom-thrB operon.
Mol Microbiol 2:63–72
Peters-Wendisch PG, Schiel B, Wendisch VF, Katsoulidis E, M€
ockel B, Sahm H, Eikmanns BJ
(2001) Pyruvate carboxylase is a major bottleneck for glutamate and lysine production by
Corynebacterium glutamicum. J Mol Microbiol Biotechnol 3:295–300
Qiu J, Helmann JD (2001) The -10 region is a key promoter specificity determinant for the Bacillus
subtilis extracytoplasmic-function s factors sX and sW. J Bacteriol 183:1921–1927
Radford AJ, Hodgson AL (1991) Construction and characterization of a MycobacteriumEscherichia coli shuttle vector. Plasmid 25:149–153
Raman S, Song T, Puyang X, Bardarov S, Jacobs WR Jr, Husson RN (2001) The alternative sigma
factor SigH regulates major components of oxidative and heat stress responses in Mycobacterium tuberculosis. J Bacteriol 183:6119–6125
Reinscheid DJ, Kronemeyer W, Eggeling L, Eikmanns BJ, Sahm H (1994) Stable expression of
hom-1-thrB in Corynebacterium glutamicum and its effect on the carbon flux to threonine and
related amino acids. Appl Environ Microbiol 60:126–132
Rodrigue S, Provvedi R, Jacques PE, Gaudreau L, Manganelli R (2006) The sigma factors of
Mycobacterium tuberculosis. FEMS Microbiol Rev 30:926–941
Ross W, Ernst A, Gourse RL (2001) Fine structure of E. coli RNA polymerase-promoter
interactions: alpha subunit binding to the UP element minor groove. Genes Dev 15:491–506
R€uckert C, Koch DJ, Rey DA, Albersmeier A, Mormann S, P€
uhler A, Kalinowski J (2005)
Functional genomics and expression analysis of the Corynebacterium glutamicum fpr2cysIXHDNYZ gene cluster involved in assimilatory sulphate reduction. BMC Genomics 6:121
R€uckert C, Milse J, Albersmeier A, Koch DJ, Puhler A, Kalinowski J (2008) The dual transcriptional regulator CysR in Corynebacterium glutamicum ATCC 13032 controls a subset of genes
86
M. Pátek and J. Nešvera
of the McbR regulon in response to the availability of sulphide acceptor molecules. BMC
Genomics 9:483
Sandoval K, Aguilar A, Paniagua C, Martı́n JF (1984) Isolation and physical characterization of
plasmid pCC1 from Corynebacterium callunae and construction of hybrid derivatives. Appl
Microbiol Biotechnol 19:409–413
Santamarı́a R, Gil JA, Mesas JM, Martı́n JF (1984) Characterization of endogenous plasmid and
development of cloning vectors and a transformation system in Brevibacterium lactofementum.
J Gen Microbiol 130:2237–2246
Sato H, Orishimo K, Shirai T, Hirasawa T, Nagahisa K, Shimizu H, Wachi M (2008) Distinct roles
of two anaplerotic pathways in glutamate production induced by biotin limitation in Corynebacterium glutamicum. J Biosci Bioeng 106:51–58
Sch€afer A, Tauch A, J€ager W, Kalinowski J, Thierbach G, P€
uhler A (1994) Small mobilizable
multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19:
selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene
145:69–73
Schiller J, Groman N, Coyle M (1980) Plasmids in Corynebacterium diphtheriae and diphtheroids
mediating erythromycin resistance. Antimicrob Agents Chemother 18:814–821
Schreiner ME, Fiur D, Holatko J, Patek M, Eikmanns BJ (2005) E1 enzyme of the pyruvate
dehydrogenase complex in Corynebacterium glutamicum: molecular analysis of the gene and
phylogenetic aspects. J Bacteriol 187:6005–6018
Schreiner ME, Riedel C, Holatko J, Patek M, Eikmanns BJ (2006) Pyruvate:quinone oxidoreductase in Corynebacterium glutamicum: molecular analysis of the pqo gene, significance of the
enzyme, and phylogenetic aspects. J Bacteriol 188:1341–1350
Schr€oder J, Tauch A (2010) Transcriptional regulation of gene expression in Corynebacterium
glutamicum: the role of global, master and local regulators in the modular and hierarchical gene
regulatory network. FEMS Microbiol Rev 34:685–737
Schr€oder J, Jochmann N, Rodionov DA, Tauch A (2010) The Zur regulon of Corynebacterium
glutamicum ATCC 13032. BMC Genomics 11:12
Schrumpf B, Schwarzer A, Kalinowski J, P€
uhler A, Eggeling L, Sahm H (1991) A functionally
split pathway for lysine synthesis in Corynebacterium glutamicium. J Bacteriol
173:4510–4516
Schweitzer JE, Stolz M, Diesveld R, Etterich H, Eggeling L (2009) The serine hydroxymethyltransferase gene glyA in Corynebacterium glutamicum is controlled by GlyR. J Biotechnol
139:214–221
Seibold GM, Hagmann CT, Schietzel M, Emer D, Auchter M, Schreiner J, Eikmanns BJ (2010)
The transcriptional regulators RamA and RamB are involved in the regulation of glycogen
synthesis in Corynebacterium glutamicum. Microbiology 156:1256–1263
Simon R, Priefer U, P€
uhler A (1983) A broad host range mobilization system for in vivo genetic
engineering: transposon mutagenesis in gram negative bacteria. Biotechnology 1:784–791
Smith MD, Flickinger JL, Lineberger DW, Schmidt B (1986) Protoplast transformation in
coryneform bacteria and introduction of an alpha-amylase gene from Bacillus
amyloliquefaciens into Brevibacterium lactofermentum. Appl Environ Microbiol 51:634–639
Sonnen H, Thierbach G, Kautz S, Kalinowski J, Schneider J, P€
uhler A, Kutzner HJ (1991)
Characterization of pGA1, a new plasmid from Corynebacterium glutamicum LP-6. Gene
107:69–74
Srivastava P, Deb JK (2002) Construction of fusion vectors of corynebacteria: expression of
glutathione-S-transferase fusion protein in Corynebacterium acetoacidophilum ATCC
21476. FEMS Microbiol Lett 212:209–216
Suda M, Teramoto H, Imamiya T, Inui M, Yukawa H (2008) Transcriptional regulation of
Corynebacterium glutamicum methionine biosynthesis genes in response to methionine supplementation under oxygen deprivation. Appl Microbiol Biotechnol 81:505–513
Promoters and Plasmid Vectors of Corynebacterium glutamicum
87
Suzuki N, Watanabe K, Okibe N, Tsuchida Y, Inui M, Yukawa H (2009) Identification of new
secreted proteins and secretion of heterologous amylase by C. glutamicum. Appl Microbiol
Biotechnol 82:491–500
Takagi H, Morinaga Y, Miwa K, Nakamori S, Sano K (1986) Versatile cloning vectors constructed
with genes indigenous to a glutamic-acid producer, Brevibacterium lactofermentum. Agric
Biol Chem 50:2597–2603
Tanaka Y, Okai N, Teramoto H, Inui M, Yukawa H (2008) Regulation of the expression of
phosphoenolpyruvate: carbohydrate phosphotransferase system (PTS) genes in Corynebacterium glutamicum R. Microbiology 154:264–274
Tateno T, Hatada K, Tanaka T, Fukuda H, Kondo A (2009) Development of novel cell surface
display in Corynebacterium glutamicum using porin. Appl Microbiol Biotechnol 84:733–739
Tauch A, Hermann T, Burkovski A, Kr€amer R, P€
uhler A, Kalinowski J (1998) Isoleucine uptake in
Corynebacterium glutamicum ATCC 13032 is directed by the brnQ gene product. Arch
Microbiol 169:303–312
Tauch A, P€uhler A, Kalinowski J, Thierbach G (2000) TetZ, a new tetracycline resistance
determinant discovered in gram-positive bacteria, shows high homology to gram-negative
regulated efflux systems. Plasmid 44:285–291
Tauch A, G€otker S, P€
uhler A, Kalinowski J, Thierbach G (2002a) The alanine racemase gene alr is
an alternative to antibiotic resistance genes in cloning systems for industrial Corynebacterium
glutamicum strains. J Biotechnol 99:79–91
Tauch A, Kirchner O, L€
offler B, G€
otker S, P€
uhler A, Kalinowski J (2002b) Efficient electrotransformation of Corynebacterium diphtheriae with a mini-replicon derived from the Corynebacterium glutamicum plasmid pGA1. Curr Microbiol 45:362–367
Tauch A, Bischoff N, Brune I, Kalinowski J (2003) Insights into the genetic organization of the
Corynebacterium diphtheriae erythromycin resistance plasmid pNG2 deduced from its complete nucleotide sequence. Plasmid 49:63–74
Trautwetter A, Blanco C (1991) Structural organization of the Corynebacterium glutamicum
plasmid pCG100. J Gen Microbiol 137:2093–2101
Tsuchida Y, Kimura S, Suzuki N, Inui M, Yukawa H (2009) Characterization of a new 2.4-kb
plasmid of Corynebacterium casei and development of stable corynebacterial cloning vector.
Appl Microbiol Biotechnol 81:1107–1115
Tsuchiya M, Morinaga Y (1988) Genetic control systems of Escherichia coli can confer inducible
expression of cloned genes in coryneform bacteria. Biotechnology 6:428–430
Vašicová P, Abrhámová Z, Nešvera J, Pátek M, Sahm H, Eikmanns B (1998) Integrating and
autonomously replicating vectors for analysis of promoters in Corynebacterium glutamicum.
Biotechnol Tech 12:743–746
Vašicová P, Pátek M, Nešvera J, Sahm H, Eikmanns B (1999) Analysis of the Corynebacterium
glutamicum dapA promoter. J Bacteriol 181:6188–6191
Venkova T, Pátek M, Nešvera J (2001) Identification of a novel gene involved in stable maintenance of plasmid pGA1 from Corynebacterium glutamicum. Plasmid 46:153–162
Venkova-Canova T, Pátek M, Nešvera J (2003) Control of rep gene expression in plasmid pGA1
from Corynebacterium glutamicum. J Bacteriol 185:2402–2409
Venkova-Canova T, Pátek M, Nešvera J (2004) Characterization of the cryptic plasmid pCC1 from
Corynebacterium callunae and its use for vector construction. Plasmid 51:54–60
Veselý M, Pátek M, Nešvera J, Čejková A, Masák J, Jirků V (2003) Host-vector system for phenoldegrading Rhodococcus erythropolis based on Corynebacterium plasmids. Appl Microbiol
Biotechnol 61:523–527
von der Osten CH, Barbas CF 3rd, Wong CH, Sinskey AJ (1989) Molecular cloning, nucleotide
sequence and fine-structural analysis of the Corynebacterium glutamicum fda gene: structural
comparison of C. glutamicum fructose-1,6-biphosphate aldolase to class I and class II
aldolases. Mol Microbiol 3:1625–1637
Xu D, Tan Y, Huan X, Hu X, Wang X (2010) Construction of a novel shuttle vector for use in
Brevibacterium flavum, an industrial amino acid producer. J Microbiol Methods 80:86–92
88
M. Pátek and J. Nešvera
Yasuda K, Jojima T, Suda M, Okino S, Inui M, Yukawa H (2007) Analyses of the acetateproducing pathways in Corynebacterium glutamicum under oxygen-deprived conditions. Appl
Microbiol Biotechnol 77:853–860
Yoshihama M, Higashiro K, Rao EA, Akedo M, Shanabruch WG, Follettie MT, Walker GC et al
(1985) Cloning vector system for Corynebacterium glutamicum. J Bacteriol 162:591–597
Youn JW, Jolkver E, Kramer R, Marin K, Wendisch VF (2008) Identification and characterization
of the dicarboxylate uptake system DccT in Corynebacterium glutamicum. J Bacteriol
190:6458–6466
Yukawa H, Omumasaba CA, Nonaka H, Kos P, Okai N, Suzuki N, Suda M et al (2007)
Comparative analysis of the Corynebacterium glutamicum group and complete genome
sequence of strain R. Microbiology 153:1042–1058
Zemanová M, Kadeřábková P, Pátek M, Knoppová M, Šilar R, Nešvera J (2008) Chromosomally
encoded small antisense RNA in Corynebacterium glutamicum. FEMS Microbiol Lett
279:195–201
Zhang Y, Praszkier J, Hodgson A, Pittard AJ (1994) Molecular analysis and characterization of a
broad-host-range plasmid, pEP2. J Bacteriol 176:5718–5728
Zupancic TJ, Kittle JD, Baker BD, Miller CJ, Palmer DT, Asai Y, Inui M et al (1995) Isolation of
promoters from Brevibacterium flavum strain MJ233C and comparison of their gene expression levels in B. flavum and Escherichia coli. FEMS Microbiol Lett 131:121–126
http://www.springer.com/978-3-642-29856-1

Download Report

Promoters and Plasmid Vectors of Corynebacterium

Paperzz.com

Your Paperzz