RESEARCH ARTICLE
Monitoring the rumen pectinolytic bacteria Treponema
saccharophilum using real-time PCR
Jing Liu1, Jia-Kun Wang1, Wen Zhu1, Yi-Yi Pu1, Le-Luo Guan2 & Jian-Xin Liu1
1
Institute of Dairy Science, MoE Key Laboratory of Molecular Animal Nutrition, College of Animal Sciences, Zhejiang University, Hangzhou, China;
and 2Department of Agricultural, Food & Nutritional Science, Faculty of Agricultural, Life & Environmental Sciences, University of Alberta,
Edmonton, AB, Canada
Correspondence: Jian-xin Liu, Institute of
Dairy Science, Zhejiang University, 866
Yuhangtang Road, Hangzhou 310058,
China. Tel.: +86 571 88982097;
fax: +86 571 88982930;
e-mail: [email protected]
Received 1 June 2013; revised 4 November
2013; accepted 4 November 2013. Final
version published online 2 December 2013.
DOI: 10.1111/1574-6941.12246
MICROBIOLOGY ECOLOGY
Editor: Cindy Nakatsu
Keywords
pectin; forage; 16S rRNA gene; Treponema
saccharophilum.
Abstract
Treponema saccharophilum is a pectinolytic bacterium isolated from the bovine
rumen. The abundance of this bacterium has not been well determined, reflecting the lack of a reliable and accurate detection method. To develop a rapid
method for monitoring T. saccharophilum, we performed pyrosequencing of
genomic DNA isolated from rumen microbiota to explore the 16S rRNA gene
sequences of T. saccharophilum candidates. Species-specific primers were
designed based on fifteen sequences of partial 16S rRNA genes generated
through pyrosequencing with 97% or higher similarity with T. saccharophilum
DSM2985 along with sequence from type strain. The relative abundance of
T. saccharophilum was quantified in both in vitro and in vivo rumen systems
with varied pectin-containing forages using real-time PCR. There was a clear
association of T. saccharophilum with alfalfa hay, which contains more pectin
than Chinese wild rye hay or corn stover. The relative abundance of T. saccharophilum was as high as 0.58% in vivo, comparable with the population density
of other common rumen bacteria. It is recognized that T. saccharophilum plays
an important role in pectin digestion in the rumen.
Introduction
Pectin is a structural but nonfibrous carbohydrate (NFC)
present in plant feedstuffs. Pectin and nonstructural carbohydrates are highly digestible and are generally
increased in the diet at the expense of neutral detergent
fiber to meet the energy demand for lactating dairy cows
(NRC, 2001). Alfalfa hay (AH) typically contains 10–15%
and up to 20% pectin in the dry matter (Lagowski et al.,
1958; Mertens, 2002), whereas grass or corn stover (CS)
has pectin contents of < 5% (Waite & Gorrod, 1959;
Mullen et al., 2010). Pectin is rapidly degraded in the
rumen, yielding acetate and propionate as the primary
end products. Therefore, fermentation of pectin does not
cause acidosis and other metabolic problems usually
occurred with starchy diets (Hatfield & Weimer, 1995).
In our previous study, it was observed that dairy cows
fed AH as a primary forage source had higher rumen
microbial protein yields than those fed CS or Chinese
wild rye, and this difference was attributed to the higher
NFC content in AH (Zhu et al., 2013). It is speculated
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
that pectin, the main NFC component in alfalfa (Martin
& Mertens, 2005), might play an important role in
microbial protein synthesis.
Pectin can be degraded by rumen pectinolytic bacteria,
including the most intensively studied species, such as
Butyrivibrio fibrisolvens, Prevotella ruminicola, Lachnospira
multipara (Gradel & Dehority, 1972), Streptococcus bovis
(Ziolecki et al., 1972), and Succinivibrio dextrinosolvens
(Bryant & Small, 1956). Some important ruminal cellulose-digesting bacteria, such as Ruminococcus albus and
Fibrobacter succinogenes, can also degrade pectin through
secreted pectate lyases (Cai et al., 2010). Pectin can also
be degraded by a lesser known species, Treponema saccharophilum (Paster & Canale-Parola, 1985). Monitoring the
population of rumen pectinolytic bacteria could not only
facilitate research on the utilization of feed pectin but
also improve the understanding of pectin with respect to
the rumen micro-ecosystem.
Quantitative PCR has been widely used as a rapid and
sensitive technique to detect specific microorganisms by
targeting DNA using designed specific primer sets and
FEMS Microbiol Ecol 87 (2014) 576–585
Monitoring rumen pectinolytic bacteria
has proven to be a powerful tool for monitoring microbial populations in the complex ruminal ecological environment (Tajima et al., 2001; Klieve et al., 2003;
Denman & McSweeney, 2006). Specific primers targeting
B. fibrisolvens, P. ruminicola, S. bovis, S. dextrinosolvens,
R. albus, and F. succinogenes have been developed in earlier studies (Tajima et al., 2001; Stevenson & Weimer,
2007), but the identification of T. saccharophilum has been
reported in only a few studies. Based on the phylogenetic
analysis of Treponema group-specific 16S rRNA gene
sequences, Bekele et al. (2011) suggested that T. saccharophilum is an infrequent and minor species in the rumen.
As T. saccharophilum has been described as obligate
sugar fermenter with remarkable growth supported by
pectin (Paster & Canale-Parola, 1985), we hypothesized
that the abundance of T. saccharophilum might be highly
correlated with a pectin-rich diet, such as AH. Therefore,
the aim of this study was to develop a rapid quantitative
PCR assay for T. saccharophilum and to examine the possibility of monitoring the T. saccharophilum population
in rumen fermentation systems in vitro and in vivo under
different dietary conditions.
Materials and methods
Pectin extraction from forages
Pectin from AH, Chinese wild rye hay (CW), and CS was
extracted using a chemical method according to Koubala
et al. (2008). Briefly, 4 g of each forage dried at 50 °C
oven for 8 h was treated with 12 mL of 85% ethanol at
70 °C for 20 min, followed by filtration through Whatman No. 1 qualitative filter paper (repeated four times).
The residues were suspended in 160 mL of 0.25% ammonium oxalate solution (pH 4.6, adjusted with oxalic acid)
at 85 °C for 1 h. The slurries were filtered through a
nylon cloth and squeezed to collect as much liquid as
possible. The filtrates were mixed with three volumes of
96% ethanol to precipitate the pectin. Following centrifugation at 14 500 g for 10 min, the precipitate was washed
three times with 100 mL of 70% ethanol and three times
with 50 mL of 96% ethanol and finally oven dried at
50 °C for 24 h.
Ruminal DNA extraction from cows fed
different diets
Rumen fluid samples were collected from twelve primiparous Chinese Holstein cows (552 16.0 kg body weight)
fed three different diets containing a high proportion of
CS, CW, or AH, respectively, according to Zhu et al.
(2013). Briefly, all diets were designed with same ratio of
forage to concentrate (45 : 55, DM basis) but used
FEMS Microbiol Ecol 87 (2014) 576–585
577
different forage sources (%): corn silage 21, CS 19, and
AH 5 (dCS); corn silage 19, CW 21, and AH 5 (dCW);
and corn silage 19, CW 9, and AH 17 (dAH). The cows
were fed each diet for 3 weeks, and the rumen fluid was
collected on the last day of the experimental period using
an oral stomach tube (Shen et al., 2012). C. 200 mL of
rumen fluid from each cow was collected before morning
feeding to avoid the background influx of bacteria with
feed. The samples were stored at 80 °C until the DNA
was extracted. A total of 2 mL of rumen fluid was used
for genomic DNA extraction using the RBB + C method
according to Yu & Morrison (2004), and the extracted
DNA was quantified using the Qubit dsDNA HS Assay
Kit (Invitrogen, Eugene, OR) on a Qubit 2.0 Fluorometer
(Invitrogen, Carlsbad, CA).
Pyrosequencing exploration of Treponema 16S
rRNA gene sequences
Because dCS and dCW had similar pectin contents, only
genomic DNA from cows fed dCS (low pectin) and
dAH (high pectin) was used for PCR amplification and
subsequent pyrosequencing to make a cost-effective
comparison of the effects of pectin on the target species.
The universal bacterial primers 341F and 1073R and the
Treponema group-specific primers g-TrepoF and
BAC926R (Table 1) were used to amplify the target
DNA sequences.
The PCRs were performed in a total volume of 50 lL
containing 10 lL of 59 GoTaq Reaction Buffer with
1.5 mM MgCl2, 0.2 mM dNTP, 1.25 U GoTaq DNA
Polymerase (Promega, Madison, WI), 0.2 lM of each primer and genomic DNA (c. 10 ng). Amplification was performed with an initial denaturation at 94 °C for 5 min,
followed by 35 cycles of 94 °C for 30 s, annealing at the
indicated temperature for the primer pair (Table 1) for
30 s and elongation at 72 °C for 40 s and a final extension step at 72 °C for 5 min. The PCR products were
purified using the Wizard SV Gel and PCR Clean-Up
System (Promega) and subsequently quantified on a
Qubit 2.0 Fluorometer (Invitrogen). The purified PCR
amplicons generated using identical primer sets and treatment conditions were pooled in equimolar amounts for
pyrosequencing. Thus, there were 4 groups of samples:
BAC_454AHG (Bacteria under dAH), BAC_454CSG
(Bacteria under dCS), Trep_454AHG (Treponema under
dAH), and Trep_454CSG (Treponema under dAH). To
individually identify the samples, a barcode sequence of
eight nucleotides unique to each sample was added to the
5′ end of the forward primer. The pooled amplicons were
subjected to pyrosequencing on a Genome Sequencer FLX
Titanium platform (Roche, Nutley, NJ) at Majorbio
Bio-Pharm Technology Co., Ltd, Shanghai, China.
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
J. Liu et al.
578
Table 1. Primers used in this study
Target
Primer sequences
Annealing
temperature
(°C)
Total bacteria
TB-F
CGGCAACGAGCGCAACCC
60
141
105
TB-R
CCATTGTAGCACGTGTGTAGCC
341F
1073R
g-TrepoF
BAC926R
T.bry-F
T.bry-R
T.s-F
T.s-R
CCTACGGGAGGCAGCAG
ACGAGCTGACGACARCCATG
GGCAGCAGCTAAGAATATTCC
CCGTCAATTCCTTTGAGTTT
AGTCGAGCGGTAAGATTG
CAAAGCGTTTCTCTCACT
GGGACAGGGAATGGTCTCGT
CCGTCAATTTCTTTGAGTTTCAC
58
733
ND
64
575
90
57
421
97
60
466
92–99*
Treponema
group
Treponema
bryantii
T. saccharophilum
Product
size (bp)
PCR
efficiency
(%)
Reference
Denman &
McSweeney (2006)
Denman &
McSweeney (2006)
Muyzer et al. (1993)
On et al. (1998)
Bekele et al. (2011)
Watanabe et al. (2001)
Tajima et al. (2001)
Tajima et al. (2001)
This study
This study
ND, not detected.
*Efficiency values varied between pure plasmid DNA and DNA isolated from rumen fluid spiking with plasmid DNA.
The 16S rRNA gene sequences obtained from the 454
Titanium pyrosequencing run were sequentially filtered
with quality control criteria to remove sequences with
sequencing lengths < 150 nt, > 2 mismatches in the forward primer, > 6 homopolymers, or any ambiguous
bases. Sequences assigned to the Treponema genus using
the RDP Classifier (Lan et al., 2012) were further queried
using the BLAST program (Altschul et al., 1990) to obtain
similarity values. The unique sequences showing 97% or
higher similarity with T. saccharophilum DSM2985
(Accession Number NR044745), hereafter referred as candidate sequences, were deposited into the GenBank database under Accession Numbers KF145111 to KF145114.
Design and validation of qPCR primers
The candidate sequences obtained from pyrosequencing
were selected as targets along with the 16S rRNA gene
from the type strain T. saccharophilum DSM2985. T. bryantii NK4A124, T. bryantii DSM 1788T, and five species
(Treponema sp. T, Treponema sp. S, Treponema sp. CA,
Treponema zioleckii KT, and Treponema succinifaciens
DSM 2489) previously reported (Sikorova et al., 2010) to
be closely related to T. saccharophilum were considered
nontarget species. Specific primer pairs were manually
designed and analyzed using OLIGO Primer Analysis Software, version 6.0 (Rychlik & Rhoads, 1989) based on the
alignment of target and nontarget species sequences using
CLUSTALW (Thompson et al., 1994) with forward and
reverse primers targeting positions 482–501 and 925–947
in the T. saccharophilum 16S rRNA gene sequence,
respectively.
The specificity of the primers was tested through PCR
amplification using genomic DNA isolated from pure
cultures of 12 representative rumen bacterial strains,
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
including T. saccharophilum DSM2985, T. bryantii B25,
F. succinogenes S85, R. albus 8, R. flavefaciens Y1, P. ruminicola ATCC19189, S. ruminantium HD4, Megasphaera
elsdenii B159, Eubacterium ruminantium GA195, S. dextrinosolvens 22B, Succinimonas amylolytica DSM2873, and
Ruminobacter amylophilus DSM1361.
After validating the specificity of the primers, the PCR
products amplified with designed primers from total
rumen DNA were cloned and sequenced. Twenty-three
positive clones were randomly selected for Sanger
sequencing at BGI-Shanghai. The similarities of the
obtained sequences to T. saccharophilum were queried
using BLAST (Altschul et al., 1990). Unique sequences were
deposited in the GenBank database with Accession Numbers KF145115 to KF145125. A phylogenetic tree was
constructed to confirm the clone specificity using the
neighbor-joining method (Saitou & Nei, 1987) with the
Kimura two-parameter model (Kimura, 1980) in MEGA
(version 4.0.1; Tamura et al., 2007). The statistical significance of the tree branches was evaluated by bootstrap
analysis (Felsenstein, 1985) with 1000 replicates.
Estimation of the relative abundance of
T. saccharophilum with specific substrates in
vitro
In vitro fermentation was conducted in 180-mL serum
bottles with 90 mL of buffer medium (Theodorou et al.,
1994). A total of 30 bottles were used for 10 treatments
with three replicates each. The following treatments were
used: (1) no substrate added as a blank control, (2)
150 mg pectin (from citrus peel, Fluka – Sigma Aldrich,
Denmark) as a pectin control, (3) 150 mg corn starch
(St) (Aladdin Reagent Company, Shanghai, China) as a
starch control, (4) 600 mg AH, (5) 600 mg CW, (6) CW
FEMS Microbiol Ecol 87 (2014) 576–585
579
Monitoring rumen pectinolytic bacteria
with 150 mg pectin, (7) CW with 150 mg St, (8) 600 mg
CS, (9) CS with 150 mg pectin, and (10) CS with 150 mg
St. The bottles containing substrates and incubation
medium were sealed with butyl rubber stoppers and
aluminum caps and then kept at 39 °C before use.
On the next day following medium preparation, the
rumen contents were collected in the morning before
feeding and filtered according to Lin et al. (2011). Briefly,
representative samples of the total rumen contents
(400 g) were manually collected from three rumen-fistulated Hu sheep before morning feeding. All sheep were
fed a diet containing CW (1000 g day 1), AH
(300 g day 1), and a concentrate mixture (250 g day 1).
The composition (% of dry matter) of the concentrate
included corn (45%), cotton cake (20%), soybean meal
(15%), and wheat bran (15%). The obtained rumen contents were mixed and filtered through four layers of
medicinal gauze (1000 lm pore size) into a flask with
continuous CO2 flushing to maintain anaerobic conditions. The flask containing rumen fluid was maintained
in a 39 °C water bath until further use. Ten milliliters of
filtered rumen fluid was injected through the stopper,
and the bottles were placed in an incubator at 39 °C with
shaking. After incubation for 24 h, 2 mL of the fermentation fluid was sampled for DNA extraction using same
method as described earlier.
Real-time PCR quantification
Genomic DNA of R. albus 8 was amplified with the bacterial universal primer set TB-F and TB-R (Table 1), and
the plasmid containing this amplicon was used as a standard for the estimation of the total bacterial 16S rRNA
gene copy number. Similarly, T. saccharophilum
DSM2985 genomic DNA was amplified using the newly
designed primers, and the cloned product was used as a
T. saccharophilum standard. The T. bryantii B25 genomic
DNA was amplified using Treponema group-specific and
T. bryantii-specific primers (Table 1) to construct respective standard. The respective plasmid DNA standard was
prepared according to Koike et al. (2007). The copy
number of each standard plasmid was calculated based
on the DNA concentration and molecular weight of the
cloned plasmid. For the standard curve, the plasmid DNA
of each respective target was subjected to seven sequential
fivefold dilutions. To examine the amplification efficiencies for each primer pair, the fivefold dilution series of
the plasmid DNA standard was run along with the samples in triplicate. After plotting the Ct value against the
log copy numbers of plasmid DNA from the dilution series, the efficiencies were calculated, and the respective
gene copies in the samples were quantified. The relative
abundance of the target species was obtained after
FEMS Microbiol Ecol 87 (2014) 576–585
normalizing the copy number of the 16S rRNA gene of
target species to that of total bacteria. To verify the accuracy of the developed assay, the amplification efficiencies
were compared between the pure plasmid standard of
T. saccharophilum and the DNA extracted from the
rumen fluid spiked with the same dilution series of plasmid DNA. The comparison was performed on one plate
in a single run.
Quantitative PCR was performed using a 7500 RealTime PCR System (Applied Biosystems, Foster City, CA).
The assays were set up using the FastStart Universal SYBR
Green Master Mix (Roche, Indianapolis, IN). The PCR
mixture contained 10 lL of 2X SYBR Green Master Mix,
1 lL of template DNA (10 ng lL 1), and 0.3 lM each
primer in total volume of 20 lL. The amplification procedure consisted of one cycle of 50 °C for 2 min and
95 °C for 10 min for initial denaturation, followed by 40
cycles of 95 °C for 15 s, and annealing and extension at
60 °C for 1 min. Melting curve analysis was performed
after amplification to verify the specificity of the real-time
PCR.
Statistics
The statistical analysis of the data was performed by oneway ANOVA, with mean separation using Tukey’s studentized range test at a level of significance of 0.05 using the
SAS software package (SAS Institute, 2000).
Results and discussion
Pyrosequencing profile of Treponema-like
sequences
After the barcodes had been trimmed, the average read
length of the candidate sequences retrieved from universal
and Treponema group-specific primers was 538 7
(mean SD) nucleotides. The numbers of 16S rRNA
gene sequences identified as Treponema genus, T. saccharophilum, and T. bryantii are shown in Table 2. Based on
the 97% similarity criterion, a total of 15 T. saccharophilum-like sequences were retrieved in this study (Table 2).
Four of the 15 identified sequences were unique
sequences, which expanded the available data for T. saccharophilum recognition. Prior to this study, only one
16S rRNA gene sequence (accession number HM049827),
with 98% similarity to T. saccharophilum, had been
deposited in the GenBank database. The lack of T. saccharophilum-like 16S rRNA gene sequences in the available databases or published studies has been recognized
in recent papers (Sikorova et al., 2010; Bekele et al.,
2011). One possible explanation is that the Treponema
genus was not well discussed due to its relative low
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
J. Liu et al.
580
Table 2. Number of sequences identified as Treponema members
based on 97% similarity obtained from pyrosequencing with different
primers and under different fiber source diets
Diets
dAH
Target
Treponema
saccharophilum
Treponema
bryantii
Treponema
zioleckii KT
Treponema
group
Total good
quality
sequences
BAC_454
dCS
Trep_454
BAC_454
Trep_454
10
4
0
1
9
56
4
107
0
1
0
4
52
667
38
928
7887
667
7522
928
Treponema group was assigned by RDP classifier with default confidence threshold at 80%.
dAH, TMR containing alfalfa hay as main forage; dCS, TMR containing corn stover as main forage.
abundance. A meta-analysis of available data conducted
by Sikorova et al. (2010) revealed that the Treponema
genus represented < 2.4% of total rumen bacteria.
Next-generation sequencing platforms, such as 454 pyrosequencing, have been recognized as a more reliable
quantitative analysis method than the reproducibilitydubious clone libraries (Acinas et al., 2005). Indeed,
next-generation sequencing has been widely used to comprehensively examine the bacterial diversity in ruminal
environments (Callaway et al., 2010; Lee et al., 2012;
Zened et al., 2013). However, all these studies have
focused on the predominating genus in the rumen under
particular circumstances. In a previous study on clone
library sequencing using Treponema group-specific primers (Bekele et al., 2011), none of 313 clones showed 97%
similarity with T. saccharophilum. However, with the
same primers as used by Bekele et al. (2011) but with different sequencing technology, 5 of 1595 sequences (0.3%)
recovered from Treponema group-specific amplicons
(Trep_454AHG and Trep_454CSG) were assigned to
T. saccharophilum in our present study (Table 2). Interestingly, although as a small proportion (90 of 15409
sequences) of Treponema genus sequences were recovered
from universal bacterial amplicons (BAC_454AHG and
BAC_454CSG), the number of T. saccharophilum-like
sequences (10 out of 90 sequences, 11.1%) was considerably higher than those from Trep_454AHG and
Trep_454CSG (Table 2). The discrepancy between the
proportions of T. saccharophilum-like sequences found in
different primer-associated sequencing sets might reflect
PCR (Polz & Cavanaugh, 1998) or cloning (Morgan
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
et al., 2010) biases. The relatively low number of clones
sequenced by Bekele et al. (2011) may have led to the
exclusion of T. saccharophilum-like sequences. Regardless
of the differences in proportion among different primers,
both primer sets retrieved more T. saccharophilum-like
sequences with a dAH diet than with a dCS diet, suggesting that this specific member of Treponema might be
associated with the digestion of pectin-rich AH.
Validation of the specificity and sensitivity of
the designed primers
Due to low specificity, initial attempts to design T. saccharophilum-specific primers failed. The employment of
candidate sequences generated from pyrosequencing facilitated the identification of more specific regions for primer design. When the designed primer pair was tested
against 12 pure cultures, amplicons were only observed
for the DNA extracted from T. saccharophilum.
Eleven of the 23 positive clones sequenced from ruminal amplicons were unique. Phylogenetic analysis of these
clones revealed two clusters (Fig. 1): Two clones were
closely associated with the type strain, and the remaining
clones were closely associated with the candidate
sequences. The latter cluster, with no cultivable representatives, suggests the existence of subspecies of T. saccharophilum. The phenomenon of a small cluster represented
by the type strain and a large clade dominated by
sequences retrieved from culture-independent analysis is
consistent with the results of the study of Bekele et al.
(2011), who reported that uncultured Treponema were
more abundant than cultured representatives in the
Treponema group.
The plasmid standard curve of the T. saccharophilum
16S rRNA gene was linear from 3.33 9 106 to 213 copies,
which correlated with Ct values ranging from 15 to 31,
with a slope of -3.34 (Fig. 2a). The Ct values for the no
template controls were generally above 33, and the results
in this range were considered negative. Thus, the limit of
quantification of the assay is c. 200 copies of the 16S
rRNA gene per PCR. In the study of Koike et al. (2007),
who evaluated the sensitivity of real-time PCR assays for
11 representative rumen bacteria using the serially diluted
target 16S rRNA gene from respective bacterial species,
the corresponded minimum detection limit for each target is in a range from 10 to 100 copies. Similarly, Koike
et al. (2010) designed PCR primers targeting 16S rRNA
genes of uncultured fiber-associated groups U2 and U3 in
the rumen, and the lowest detection limit for groups U2
and U3 was found to be 100 copies. Thus, compared with
these two studies mentioned earlier, the detection sensitivity in the present study is reasonable and sensitive. The
amplification efficiency of the pure plasmid standard was
FEMS Microbiol Ecol 87 (2014) 576–585
581
Monitoring rumen pectinolytic bacteria
Fig. 1. Phylogenetic analysis of 16S rDNA gene sequences generated by Treponema saccharophilum primer set from total DNA extracted from
rumen content. Eleven sequences of unique clones, eight sequences of known Treponema species, one reported clone sequence (HM049827),
and 4 unique sequences retrieved from pyrosequencing data are included in the tree. Bootstrap values from 1000 replications are shown at
branch points of the tree. The horizontal bars represent nucleotide substitutions per sequence position.
(a)
(b)
Fig. 2. Linearity and detection range of the qPCR using SYBR Green chemistry. (a) Standard curve with amplification efficiency of 99% was
generated from plasmid DNA containing partial 16S rRNA gene of Treponema saccharophilum amplified with T.s-F & R. (b) DNA isolated from
rumen fluid (calculated from the above standard curve to contain 548 copies of T. saccharophilum 16S rRNA gene) spiked with the same plasmid
standard was analyzed, resulting a liner curve with amplification efficiency of 92%. Dots represent the mean values of three analytical replicates,
and bars show the standard deviation.
similar to that of the spiked ruminal DNA (99% vs. 92%;
Fig. 2), indicating that the designed primers specifically
amplified the 16S rRNA gene of T. saccharophilum,
FEMS Microbiol Ecol 87 (2014) 576–585
regardless of the presence of nontarget DNA. With either
standard plasmids or ruminal genomic DNA as the template, the dissociation curve analysis showed a single
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
582
sharp peak with Tm values at 81.5 °C (Supporting Information, Fig. S1), satisfying the essential specificity standard for a SYBR Green assay (Denman & McSweeney,
2006).
Monitoring the relative abundance of
T. saccharophilum under different forages and
carbohydrate sources
To further determine whether the designed primers can
be used to monitor the T. saccharophilum population, we
further characterized the abundance of this species under
pectin-rich and pectin-poor dietary conditions using in
vitro and in vivo rumen systems. The ability of rumenmixed bacterial cultures to ferment pure pectin has been
previously reported (Gradel & Dehority, 1972). An early
in vitro study also revealed that a considerable proportion
of the pectin in alfalfa was digested by mixed cultures
(Dehority et al., 1962). Similar to previous results (Waite
& Gorrod, 1959; Mertens, 2002; Mullen et al., 2010), the
yields of chemical-extracted pectin were 2.8%, 3.7%, and
9.3% for CS, CW, and AH, respectively, indicating a consistently higher pectin content in AH than that in CS or
CW when the same extraction conditions are used.
Our in vitro fermentation experiment was first conducted to validate the practicability of the designed primers for monitoring the abundance of T. saccharophilum
under different pectin contents derived from pure pectin
and forages. The population of T. saccharophilum was significantly higher with an AH diet than with CW or CS
diets (P < 0.05; Fig. 3). When CW and CS were supplemented with pure pectin, an increase in T. saccharophilum
J. Liu et al.
was observed (P < 0.05), suggesting that pectin stimulates the growth of T. saccharophilum. According to
Paster & Canale-Parola (1985), who used pure culture,
T. saccharophilum grows well on starch (2.8 9 108
cell mL 1 yield on 0.2 g 100 mL 1 starch vs. 3.6 9 108
cell mL 1 on 0.2 g 100 mL 1 pectin). However, the
addition of starch did not introduce a higher population
of T. saccharophilum in this study (Fig. 3), in which
mixed cultures of rumen fluid were used. Competition
is a common interaction among ruminal bacteria (Shi
et al., 1997). The different responses of T. saccharophilum to specific carbohydrate substrates observed in pure
and mixed culture environments suggest that the ability
of T. saccharophilum to compete for pectin might be
higher than for starch, but direct evidence is needed to
confirm this hypothesis.
Furthermore, the relative proportions of the 16S rRNA
gene copies for T. saccharophilum, T. bryantii, and the
Treponema genus in the rumen of cows fed different pectin-containing diets were accessed using real-time PCR
(Table 3). The relative abundance of T. saccharophilum in
the rumen of cows fed the dAH diet was higher
(P < 0.05) than those in the rumen of cows fed the dCW
and dCS diets. This finding is consistent with the results
obtained using pyrosequencing techniques, confirming
the hypothesis that there is a positive corelationship
between T. saccharophilum and AH.
The population of the Treponema group or T. bryantii
was not affected by the diets (P > 0.05), with relative
abundances of 2.80% and 0.03% for all diets, respectively,
similar to the previous findings (Bekele et al., 2011). Stevenson & Weimer (2007) observed that E. ruminantium,
Fig. 3. Relative abundance of Treponema
saccharophilum 16S rRNA gene copies (% of
total bacterial 16S rRNA gene) among in vitro
treatments (AH, CW, CS, Pectin, St). a–c Means
with different letters differ (P < 0.05). Bars
show standard error.
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Ecol 87 (2014) 576–585
583
Monitoring rumen pectinolytic bacteria
Table 3. Relative abundance of target gene copies for specific
species (% of total bacterial 16S rRNA gene) in the rumen of dairy
cows fed on corn stover, Chinese wild rye and alfalfa hay as main
forage diet
Diets
Target
dAH
dCS
dCW
SEM
P-value
Treponema
saccharophilum
Treponema
bryantii
Treponema
group
0.582a
0.085b
0.131b
0.099
0.011
0.032a
0.034a
0.029a
0.007
0.927
3.049a
2.885a
2.608a
0.461
0.797
a-b
Means within the same row with different superscripts differ
(P < 0.05).
dAH, TMR containing alfalfa hay as main forage; dCS, TMR containing corn stover as main forage; dCW, TMR containing Chinese wild
rye grass as main forage.
M. elsdenii, Prevotella brevis, R. amylophilus, and S. ruminantium group represented only 0.176%, 0.0005%,
0.135%, 0.223%, and 0.551% of the total bacteria, respectively, in the rumen of dairy cows. Similarly, Bekele et al.
(2010) observed that the relative abundances of R. amylophilus, F. succinogenes, and S. ruminantium were 0.08%,
0.20%, and 0.08% of the total bacteria, respectively, in
the rumen of sheep fed a hay diet. Particularly, B. fibrisolvens, S. bovis, and S. dextrinosolvens species, previously
recognized as pectinolytic bacteria (Bryant & Small, 1956;
Gradel & Dehority, 1972; Ziolecki et al., 1972), have been
reported to represent only 0.024 (Stevenson & Weimer,
2007), 0.020%, and < 0.010% (Bekele et al., 2010) of the
total bacteria present in the rumen, respectively.
Prevotella ruminicola is widely recognized as one of the
most abundant species in the rumen, with a relative
abundance ranging from 0.8% to 1.7% (Stevenson &
Weimer, 2007; Bekele et al., 2010). However, in an early
pure culture-based study, Gradel & Dehority (1972) demonstrated that the ability of the P. ruminicola 23 and
D31d strains to degrade and utilize pectin from two
mature alfalfa sources was considerably lower than those
of B. fibrisolvens, L. multipara, and F. succinogenes. Considering that the quantification methodologies of these
two studies were similar to those used in the present
study (calculation of the abundances of each target as the
fraction out of the total 16S rRNA genes copies number)
and that the amplification efficiencies of the species mentioned above were within a reasonable range from 90% to
100% (Stevenson & Weimer, 2007; Bekele et al., 2010),
the proportion results of species could be compared reasonably among studies. In the current study, the population of T. saccharophilum species, particularly with dAH
(0.58%), might be comparable or even higher than those
of other common rumen bacterial species (Stevenson &
FEMS Microbiol Ecol 87 (2014) 576–585
Weimer, 2007; Bekele et al., 2010), suggesting that T. saccharophilum might play an important role in pectin digestion. Notably, the relative population sizes evaluated in
the present study were based on the fraction of 16S rRNA
genes and could not be directly correlated with cell numbers, as there exists multiple copies of the 16S rRNA gene
within the genome of a given bacterium (Crosby & Criddle, 2003; Case et al., 2007). In addition, the relatively
long persistence of DNA after cell death (Josephson et al.,
1993) could potentially lead to the overestimation of the
abundance of bacterial species or communities in DNAbased quantitative analysis, presenting an obstacle for the
accurate estimation of bacterial populations. However,
the utilization of the DNA-intercalating dye ethidium
monoazide bromide to selectively remove the DNA from
dead cells of environmental bacterial communities might
improve the sensitivity of DNA-based quantification
(Nocker & Camper, 2006).
As a structural heteropolysaccharide in the primary cell
walls of plants, the degradation of pectin also accelerates
cellulose and hemicellulose degradation (Van Soest et al.,
1991). An in vitro study showed a positive interaction
between T. bryantii and F. succinogenes, a cellulolytic bacterium (Stanton & Canale-Parola, 1980). Because both
T. bryantii and T. saccharophilum are members of the
Treponema genus, T. saccharophilum could be implicated
in fiber degradation through interactions with cellulolytic
bacteria. A culture-based study (Ziolecki et al., 1992) of
fructan degradation showed that T. saccharophilum strain
S, isolated from sheep rumen, possessed higher fructanolytic activities than S. bovis, P. ruminicola, S. ruminantium, and T. bryantii, suggesting that T. saccharophilum
might also play a metabolic role in the degradation of
nonstructural carbohydrates. To our knowledge, the present study is the first to evaluate the abundance of T. saccharophilum in the rumen, a species that was previously
underestimated. Additional studies are needed to fully
elucidate the function and ecological importance of this
bacterium. The newly designed primers used in the present study might also be used in further ruminal ecological
studies.
Conclusions
The results obtained in the present study clearly demonstrate that the quantification of T. saccharophilum in vivo
and in vitro is possible by real-time PCR using our newly
designed primers. These results support our hypothesis
concerning the association of T. saccharophilum with AH.
The relatively high proportion of T. saccharophilum in
the rumen might expand our knowledge of the importance of this bacterium in the rumen, especially for pectin
digestion.
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
584
Acknowledgements
This research was supported by the grants from the
National Basic Research Program of China Ministry of
Science and Technology (Grant No. 2011CB100801). The
authors are thankful to Dr Chris McSweeney at CSIRO
Livestock Industries, Australia, for donating the pure
rumen bacterial strains used for this study.
References
Acinas SG, Sarma-Rupavtarm R, Klepac-Ceraj V & Polz MF
(2005) PCR-induced sequence artifacts and bias: insights
from comparison of two 16S rRNA clone libraries
constructed from the same sample. Appl Environ Microbiol
71: 8966–8969.
Altschul SF, Gish W, Miller W, Myers EW & Lipman DJ
(1990) Basic local alignment search tool. J Mol Biol 215:
403–410.
Bekele AZ, Koike S & Kobayashi Y (2010) Genetic diversity
and diet specificity of ruminal Prevotella revealed by
16S rRNA gene-based analysis. FEMS Microbiol Lett 305:
49–57.
Bekele AZ, Koike S & Kobayashi Y (2011) Phylogenetic
diversity and dietary association of rumen Treponema
revealed using group-specific 16S rRNA gene-based analysis.
FEMS Microbiol Lett 316: 51–60.
Bryant MP & Small N (1956) Characteristics of two new
genera of anaerobic curved rods isolated from the rumen of
cattle. J Bacteriol 72: 22–26.
Cai SC, Li JB, Hu FZ, Zhang KG, Luo YM, Janto B, Boissy R,
Ehrlich G & Dong XZ (2010) Cellulosilyticum ruminicola a
newly described rumen bacterium that possesses redundant
fibrolytic-protein-encoding genes and degrades
lignocellulose with multiple carbohydrate-borne fibrolytic
enzymes. Appl Environ Microbiol 76: 3818–3824.
Callaway TR, Dowd SE, Edrington TS, Anderson RC, Krueger
N, Bauer N, Kononoff PL & Nisbet DJ (2010) Evaluation of
bacterial diversity in the rumen and feces of cattle fed
different levels of dried distillers grains plus solubles using
bacterial tag-encoded FLX amplicon pyrosequencing. J Anim
Sci 88: 3977–3983.
Case RJ, Boucher Y, Dahllof I, Holmstrom C, Doolittle WF &
Kjelleberg S (2007) Use of 16S rRNA and rpoB genes as
molecular markers for microbial ecology studies. Appl
Environ Microbiol 73: 278–288.
Crosby LD & Criddle CS (2003) Understanding bias in
microbial community analysis techniques due to rrn operon
copy number heterogeneity. Biotechniques 34: 790–794, 796,
798 passim.
Dehority BA, Johnson RR & Conrad HR (1962) Digestibility
of forage hemicellulose and pectin by rumen bacteria in
vitro and the effect of lignification thereon. J Dairy Sci 50:
1136–1141.
Denman SE & McSweeney CS (2006) Development of a
real-time PCR assay for monitoring anaerobic fungal and
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
J. Liu et al.
cellulolytic bacterial populations within the rumen. FEMS
Microbiol Ecol 58: 572–582.
Felsenstein J (1985) Confidence limits on phylogenies: an
approach using the bootstrap. Evolution 39: 783–791.
Gradel CM & Dehority BA (1972) Fermentation of isolated
pectin and pectin from intact forages by pure cultures of
rumen bacteria. Appl Microbiol 23: 332–340.
Hatfield RD & Weimer PJ (1995) Degradation characteristics
of isolated and in situ cell wall lucerne pectic
polysaccharides by mixed ruminal microbes. J Sci Food Agric
69: 185–196.
Josephson KL, Gerba CP & Pepper IL (1993) Polymerase chain
reaction detection of nonviable bacterial pathogens. Appl
Environ Microbiol 59: 3513–3515.
Kimura M (1980) A simple method for estimating
evolutionary rates of base substitutions through comparative
studies of nucleotide sequences. J Mol Evol 16: 111–120.
Klieve AV, Hennessy D, Ouwerkerk D, Forster RJ, Mackie RI
& Attwood GT (2003) Establishing populations of
Megasphaera elsdenii YE 34 and Butyrivibrio fibrisolvens YE
44 in the rumen of cattle fed high grain diets. J Appl
Microbiol 95: 621–630.
Koike S, Yabuki H & Kobayashi Y (2007) Validation and
application of real-time polymerase chain reaction assays
for representative rumen bacteria. Anim Sci J 78:
135–141.
Koike S, Handa Y, Goto H, Sakai K, Miyagawa E, Matsui H,
Ito S, & Kobayashi Y (2010) Molecular monitoring and
isolation of previously uncultured bacterial strains from the
sheep rumen. Appl Environ Microbiol 76: 1887–1894.
Koubala BB, Kansci G, Mbome LI, Crepeau MJ, Thibault JF &
Ralet MC (2008) Effect of extraction conditions on some
physicochemical characteristics of pectins from “Amelioree”
and “Mango” mango peels. Food Hydrocolloids 22:
1345–1351.
Lagowski JM, Sell HM, Huffman CF & Duncan CW (1958)
The carbohydrates in alfalfa Medicago sativa I. General
composition identification of a nonreducing sugar and
investigation of the pectic substances. Arch Biochem Biophys
76: 306–316.
Lan Y, Wang Q, Cole JR & Rosen GL (2012) Using the RDP
classifier to predict taxonomic novelty and reduce the search
space for finding novel organisms. PLoS One 7: e32491.
Lee HJ, Jung JY, Oh YK, Lee SS, Madsen EL & Jeon CO
(2012) Comparative survey of rumen microbial
communities and metabolites across one caprine and three
bovine groups, using bar-coded pyrosequencing and (1)H
nuclear magnetic resonance spectroscopy. Appl Environ
Microbiol 78: 5983–5993.
Lin B, Wang JH, Lu Y, Liang Q & Liu JX (2011) In vitro
rumen fermentation and methane production are influenced
by active components of essential oils combined with
fumarate. J Anim Physiol Anim Nutr 97: 1–9.
Martin NP & Mertens DR (2005) Reinventing alfalfa for dairy
cattle and novel uses. California Alfalfa and Forage
Symposium, Visalia, CA.
FEMS Microbiol Ecol 87 (2014) 576–585
585
Monitoring rumen pectinolytic bacteria
Mertens DR (2002) Nutritional implications of fiber and
carbohydrate characteristics of corn silage and alfalfa hay.
California Anim Nutr Conf, Fresno, CA.
Morgan JL, Darling AE & Eisen JA (2010) Metagenomic
sequencing of an in vitro-simulated microbial community.
PLoS One 5: e10209.
Mullen CA, Boateng AA, Goldberg NM, Lima IM, Laird DA &
Hicks KB (2010) Bio-oil and bio-char production from corn
cobs and stover by fast pyrolysis. Biomass Bioenergy 34:
67–74.
Muyzer G, De Waal EC & Uitterlinden AG (1993) Profiling of
complex microbial populations by denaturing gradient gel
electrophoresis analysis of polymerase chain
reaction-amplified genes coding for 16S rRNA. Appl Environ
Microbiol 59: 695–700.
National Research Council (2001) Nutrient Requirement of
Dairy Cattle, seventh revised edn. National Academy Press,
Washington, D.C.
Nocker A & Camper AK (2006) Selective removal of DNA
from dead cells of mixed bacterial communities by use of
ethidium monoazide. Appl Environ Microbiol 72:
1997–2004.
On SL, Atabay HI, Corry JE, Harrington CS & Vandamme P
(1998) Emended description of Campylobacter sputorum
and revision of its infrasubspecific (biovar) divisions,
including C. sputorum biovar paraureolyticus, a
urease-producing variant from cattle and humans. Int J Syst
Bacteriol 48 Pt 1: 195–206.
Paster BJ & Canale-Parola E (1985) Treponema saccharophilum
sp. nov., a large pectinolytic spirochete from the bovine
rumen. Appl Environ Microbiol 50: 212–219.
Polz MF & Cavanaugh CM (1998) Bias in template-to-product
ratios in multitemplate PCR. Appl Environ Microbiol 64:
3724–3730.
Rychlik W & Rhoads RE (1989) A computer program for
choosing optimal oligonucleotides for filter hybridization,
sequencing and in vitro amplification of DNA. Nucleic Acids
Res 17: 8543–8551.
Saitou N & Nei M (1987) The neighbor-joining method: a
new method for reconstructing phylogenetic trees. Mol Biol
Evol 4: 406–425.
SAS Institute (2000) SAS User’s Guide: Statistics. Version 8.01.
SAS Inst. Inc., Cary, NC.
Shen JS, Chai Z, Song LJ, Liu JX & Wu YM (2012) Insertion
depth of oral stomach tubes may affect the fermentation
parameters of ruminal fluid collected in dairy cows. J Dairy
Sci 95: 5978–5984.
Shi Y, Odt CL & Weimer PJ (1997) Competition for cellulose
among three predominant ruminal cellulolytic bacteria
under substrate-excess and substrate-limited conditions.
Appl Environ Microbiol 63: 734–742.
Sikorova L, Piknova M, Javorsky P, Guczynska W,
Kasperowicz A, Michalowski T & Pristas P (2010)
Variability of treponemes in the rumen of ruminants. Folia
Microbiol (Praha) 55: 376–378.
FEMS Microbiol Ecol 87 (2014) 576–585
Stanton TB & Canale-Parola E (1980) Treponema bryantii sp.
nov., a rumen spirochete that interacts with cellulolytic
bacteria. Arch Microbiol 127: 145–156.
Stevenson DM & Weimer PJ (2007) Dominance of Prevotella
and low abundance of classical ruminal bacterial species in
the bovine rumen revealed by relative quantification
real-time PCR. Appl Microbiol Biotechnol 75: 165–174.
Tajima K, Aminov RI, Nagamine T, Matsui H, Nakamura M
& Benno Y (2001) Diet-dependent shifts in the bacterial
population of the rumen revealed with real-time PCR. Appl
Environ Microbiol 67: 2766–2774.
Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4:
Molecular Evolutionary Genetics Analysis (MEGA) software
version 4.0. Mol Biol Evol 24: 1596–1599.
Theodorou MK, Williamsa BA, Dhanoaa MS, McAllana AB &
Franceb J (1994) A simple gas production method using a
pressure transducer to determine the fermentation kinetics
of ruminant feeds. Anim Feed Sci Technol 48: 185–197.
Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res 22:
4673–4680.
Van Soest PJ, Robertson JB & Lewis BA (1991) Symposium:
carbohydrate methodology metabolism and nutritional
implications in dairy cattle. J Dairy Sci 74: 3583–3597.
Waite R & Gorrod ARN (1959) The comprehensive analysis of
grasses. J Sci Food Agric 10: 317–326.
Yu Z & Morrison M (2004) Improved extraction of
PCR-quality community DNA from digesta and fecal
samples. Biotechniques 36: 808–812.
Zened A, Combes S, Cauquil L, Mariette J, Klopp C, Bouchez
O, Troegeler-Meynadier A & Enjalbert F (2013) Microbial
ecology of the rumen evaluated by 454 GS FLX
pyrosequencing is affected by starch and oil
supplementation of diets. FEMS Microbiol Ecol 83: 504–514.
Zhu W, Fu Y, Wang B, Wang C, Ye JA, Wu YM & Liu JX
(2013) Effects of dietary forage sources on rumen microbial
protein synthesis and milk performance in early lactating
dairy cows. J Dairy Sci 96: 1727–1734.
Ziolecki A, Tomerska H & Wojciechowicz M (1972)
Pectinolytic activity of rumen streptococci. Acta Microbiol
Pol A 4: 183–187.
Ziolecki A, Guczynska W & Wojciechowicz M (1992) Some
rumen bacteria degrading fructan. Lett Appl Microbiol 15:
244–247.
Supporting Information
Additional Supporting Information may be found in the
online version of this article:
Fig. S1. Dissociation analysis of primers specificity with
genomic DNA of rumen fluid as template.
ª 2013 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved