768 Vol. 8, 768 –774, March 2002
Clinical Cancer Research
Profound Dihydropyrimidine Dehydrogenase Deficiency Resulting
from a Novel Compound Heterozygote Genotype1
Martin R. Johnson, Kangsheng Wang, and
Robert B. Diasio2
Department of Pharmacology and Toxicology and Comprehensive
Cancer Center, University of Alabama at Birmingham, Birmingham,
Alabama 35294
ABSTRACT
A familial approach was used to elucidate the genetic
determinants of profound and partial dihydropyrimidine
dehydrogenase (DPD; EC 1.3.1.2) deficiency in an Alabama
family. In 1988, our laboratory diagnosed profound DPD
deficiency in a breast cancer patient with grade IV toxicity
after cyclophosphamide/methotrexate/5-fluorouracil chemotherapy (R. B. Diasio et al., J. Clin. Investig., 81: 47–51,
1988). We now report the genetic analysis of archived
genomic DNA that reveals that the proband was a compound heterozygote for two different mutations, one in each
allele: (a) a G to A mutation in the GT 5ⴕ splicing recognition
sequence of intron 14, which results in a 165-bp deletion
(corresponding to exon 14) in the DPD mRNA (DPYD*2A);
and (b) a T1679G mutation (now designated DPYD*13),
which results in a I560S substitution. Sequence analysis
revealed segregation of both mutations with the son and the
daughter each inheriting one mutation. Phenotype analysis
(DPD enzyme activity) confirmed that both children were
partially DPD deficient. Plasma uracil and DPD mRNA
levels were found to be within normal limits in both children. We conclude that profound DPD deficiency in the
proband resulted from a combination of two mutations (one
mutation in each allele) and that heterozygosity for either
mutation results in partial DPD deficiency. Lastly, we identified two variant alleles reported previously as being associated with DPD enzyme deficiency [T85C resulting in a
C29R substitution (DPYD*9A) and A496G (M166V) in a
family member with normal DPD enzyme activity]. These
data suggest that both variant alleles are unrelated to DPD
deficiency and emphasize the need to perform detailed familial genotypic and phenotypic analysis while characterizing this pharmacogenetic syndrome.
Received 10/12/01; revised 12/12/01; accepted 12/20/01.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
1
Supported by USPHS Grant CA 62164.
2
To whom requests for reprints should be addressed, at Department of
Pharmacology and Toxicology, Volker Hall, Box 600, University of
Alabama at Birmingham, Birmingham, AL 35294. Phone: (205) 9344578; Fax: (205) 975-5650; E-mail: [email protected].
INTRODUCTION
The antimetabolite 5-FU3 has been in clinical use for ⬃45
years and has evolved as an important agent in the treatment of
a large spectrum of tumors, including gastrointestinal, breast,
and head and neck (1). Over the past 20 years, the pyrimidine
catabolic pathway, in particular the first enzymatic step involving DPD, has been recognized as critical in determining the
ultimate metabolism and, in turn, the pharmacology of 5-FU (2).
Although the antitumor action (and host toxicity) of 5-FU depends on anabolism of the drug to cytotoxic nucleotides, studies
from our laboratory have shown that 80 –90% of an administered dose of 5-FU is rapidly converted into biologically inactive metabolites through the catabolic pathway (3). Increased
DPD activity (with corresponding increased catabolism of
5-FU) has been correlated with resistance to 5-FU (4, 5). Conversely, decreased DPD activity (with corresponding decreased
catabolism of 5-FU) has been shown to increase 5-FU half-life,
thus increasing the amount of drug available for the anabolic
(cytotoxic) pathway (6). Taken together, these data suggest that
the variability of DPD activity in the normal population may
account for observed differences in the pharmacokinetics and
oral bioavailability of 5-FU (7).
The importance of DPD in 5-FU toxicity has been illustrated
by patients with DPD enzyme deficiency. After administration of
standard doses of 5-FU, these patients develop profound toxicity
including mucositis, granulocytopenia, neuropathy, and (in some
cases) death (8 –11). In 1988, our laboratory reported one of the
first profoundly DPD-deficient patients who developed grade IV
toxicity after CMF chemotherapy (8). The familial pedigree of this
patient revealed that the proband’s son and daughter were partially
DPD deficient (8). Later population studies in breast cancer patients
have demonstrated that ⬃5% are DPD deficient, with enzyme
activity below the 95th percentile of a control population (12).
Since being identified as a pharmacogenetic disorder, there
has been a steady increase each year in the number of case
reports of DPD deficiency with severe toxicity secondary to
treatment with 5-FU (13, 14). These reports, combined with the
recent introduction of new generation fluoropyrimidine-based
chemotherapy agents (e.g., capecitabine) have resulted in continued research to understand the molecular basis of DPD deficiency with the purification and characterization of the human
protein (15), cloning and characterization of the DPYD gene
(16) and the promoter (17), and the identification of 19 variant
alleles in DPD-deficient patients (18 –20).
This report describes the first compound heterozygote genotype in a profoundly DPD-deficient patient with segregation of
mutations among immediate family members. The mutations
3
The abbreviations used are: 5-FU, 5-fluorouracil; DPD, dihydropyrimidine dehydrogenase; CMF, cyclophosphamide/methotrexate/5-FU;
PBM, peripheral blood mononuclear.
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2002 American Association for Cancer
Research.
Clinical Cancer Research 769
responsible for profound DPD deficiency in this patient and
partial DPD deficiency in the proband’s two children are identified, and the pattern of inheritance is elucidated. This comprehensive familial approach which uses both phenotype and genotype analysis should be used in future studies to determine
which mutations in the DPYD gene result in DPD deficiency.
MATERIALS AND METHODS
Proband and Immediate Family Members. In 1988, a
previously healthy 40-year-old white female began treatment for
infiltrating ductal carcinoma with a left-modified radical mastectomy and adjuvant CMF chemotherapy. The complete toxicity
profile was described previously in detail (8). Briefly, 11 days after
the first cycle of CMF chemotherapy, the patient was found to be
neutropenic (white blood count of 1,400 with 1% neutrophils and
1% bands). Twenty six days after cycle 1, the second cycle was
administered at reduced doses. Fourteen days later, the patient
returned to the clinic with a white blood count of 1,300. The patient
received the third cycle on schedule but at further reduced doses.
Fourteen days later, the patient was hospitalized with fever, neutropenia, and a 2-day history of ataxia. The patient continued to
deteriorate neurologically over the next 7 days, eventually becoming completely unresponsive. Over the succeeding 2 months, she
regained all function and demonstrated no neurological deficits.
Approximately 1 year later, the patient died from progression of
disease. Although the cDNA and the structure of the human DPYD
gene was not known in 1988, genomic DNA was prepared from the
proband’s PBM cells for future analysis.
Phenotypic analysis revealed that the proband was profoundly DPD deficient (no detectable enzyme activity). Pharmacokinetic analysis of the proband demonstrated altered 5-FU
metabolism characterized by prolonged half-life (150 versus 13
min for normal controls) and decreased clearance (70 versus 594
ml/min/m2 for normal controls; Ref. 8). Phenotypic analysis of
the proband’s children revealed that both her son and daughter
were partially DPD deficient. Both children were otherwise
healthy without any characteristic phenotype.
Determination of DPD Activity. DPD enzyme activity
was originally determined in the proband, her father, two children, and available extended family members from PBM cells as
described (8). In the present study, DPD enzyme activity was
reevaluated in the PBM cells of the available surviving family
members (the proband’s husband, two children, and three grandchildren) and controls using a recently described semiautomated
radioassay for DPD enzyme activity (21). Both the proband and
her father (tested in 1988) have died since publication of the
original study. The proband’s nephew (identified as partially
DPD deficient in 1988) was unavailable for participation in this
study. Plasma uracil concentrations were also measured (in
surviving family members and controls where DPD enzyme
activity was obtained) as described previously (8, 9).
Quantitation of DPD mRNA. The theoretical basis and
validation of quantitating DPD mRNA using the ABI PRISM
7700 Sequence Detection System (Applied Biosystems, Foster
City, CA) is described in detail elsewhere (22). Briefly, total
RNA was isolated from PBM cells of the proband’s husband,
two children, and three grandchildren, along with controls using
RNAzol (Biotecx, Houston, TX), following the manufacturer’s
instructions. Total RNA was diluted to a final concentration of
5 ng/␮l in water containing 12.5 ␮g/ml total yeast RNA as a
carrier. All samples were stored at ⫺70°C until analysis. Final
DPD forward, reverse, and probe concentrations were 100, 200,
and 100 nM, respectively. Thermal cycling conditions were 30
min at 48°C, followed by 10 min at 95°C and 40 cycles of 15 s
at 95°C and 1 min at 60°C. The absolute standard curve method
was used to determine the copy number of DPD mRNA (22).
Genotypic Analysis. In the present study, genomic DNA
from the proband’s husband, two children, and three grandchildren was prepared from PBM cells using the Easy-DNA kit
(Invitrogen, San Diego, CA), following the manufacturer’s instructions. Archived genomic DNA obtained from the proband
in 1988 was maintained at ⫺70°C until analysis. All 23 exons
along with the flanking intronic regions of the DPYD gene were
PCR amplified under conditions similar to those described previously by our laboratory (9). Amplification of exon 1 (along
with 427 bp of the promoter region of the DPYD gene) was
carried out with 1% DMSO (17). The primers used to amplify
each exon are listed in Table 1. After amplification, PCR products were resolved on 2% agarose gels and purified using a
Qiaquick Gel Extraction kit (Qiagen, Valencia, CA) according
to the manufacturer’s instructions. Samples were sequenced on
an ABI 310 automated DNA sequencer using the dideoxynucleotide chain termination method (Applied Biosystems, Foster
City, CA). Sequence reactions were repeated three times in each
direction (using the same primers that were used to amplify each
specific PCR amplicon) and analyzed using MacVector 4.1
sequence analysis software (IBI, New Haven, CT).
RESULTS
DPD Enzyme Activity in Proband and Immediate Family Members. Although the proband could not be retested for
DPD enzyme activity, several separate determinations in the
original study demonstrated no detectable enzyme activity in the
PBM cells (8). In the present study, we examined the DPD
enzyme activity in the proband’s husband, two children, and
three grandchildren. These data are summarized in Fig. 1 and
Table 2. The proband’s husband (II-6) demonstrated DPD enzyme activity within the normal range. However, both the
daughter (III-6) and son (III-7) demonstrated partial DPD deficiency, as reported originally (8). The proband’s three grandchildren (IV-1, IV-2, and IV-3), along with seven unrelated
controls, demonstrated normal DPD enzyme activity (Fig. 1 and
Table 2). The proband’s father (I-1) and nephew (III-2) are
illustrated as partially DPD deficient in Fig. 1. These data were
obtained from the original examination of this family (8) because the proband’s father is now deceased and the nephew was
unavailable for participation in this study.
Plasma Uracil Levels. Examination of the proband’s
plasma in 1988 demonstrated elevated (1500 ng/ml) uracil levels (8). In the present study, the plasma uracil levels in the
proband’s husband (II-6), two children (III-6 and III-7), and
three grandchildren (IV-1, IV-2, and IV-3) were examined and
found to be in the normal range (Table 2).
Quantitation of DPD mRNA. DPD mRNA levels were
quantitated by real-time quantitative PCR in the PBM cells of
the proband’s husband (II-6), two children (III-6 and III-7), and
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2002 American Association for Cancer
Research.
770 DPD Deficiency Secondary to Compound Heterozygote Genotype
Table 1
Exon
a
1
2
3
4
5b
6
7b
8
b
9b
b
10
11b
b
12
13
14
15b
b
16
17b
b
18
19b
b
20
21b
b
22
23
a
b
Oligonuclotides used to amplify genomic DNA
DPD primers
5⬘ Primer sequence 3⬘
Amplicon (bp)
Forward 124
Reverse 130
Forward 125
Reverse 131
Forward 127
Reverse 133
Forward 126
Reverse 132
Forward 132
Reverse 138
Forward 130
Reverse 135
Forward 133
Reverse 139
Forward 134
Reverse 140
Forward 135
Reverse 141
Forward 136
Reverse 142
Forward 137
Reverse 143
Forward 138
Reverse 144
Forward 128
Reverse 134
Forward 115
Reverse 92
Forward 139
Reverse 145
Forward 140
Reverse 146
Forward 141
Reverse 147
Forward 142
Reverse 148
Forward 143
Reverse 149
Forward 144
Reverse 150
Forward 145
Reverse 151
Forward 146
Reverse 152
Forward 147
Reverse 39
ACTTGGTGGATGGATGGAGGAACATCTAC
TCCTGAAATCTCTTCCGAAGTAAACAG
GTTTAAACAAATGCCAACATATTTCC
TGTACTTTAATACCTTATTTCTAAGTG
TTCTCAGGATCTTAGAGAATTAAGC
TCTCTCCACTGACAAATTAATACC
ACACGGACTCTGAATGAGTATAAGG
CCACAGATAATAGAGAACGAAGATC
GTTTGTCGTAATTTGGCTG
ATTTGTGCATGGTGATGG
CGGGCTGGTAAAACAAGAATTCG
TATTGCTTCAAGCCACCTGCAAA
GTCCTCATGCATATCTTGTGTG
GCTACATCAGGCAGAAGC
GCCCCACATCGTGCTATGAACA
CCAGAATGACTGCCTTCAGAC
CCCTCCTCCTGCTAATG
CTCAGCAGCACATTGTTC
GAGAGTGACACTTCATCCTGG
GGAGTTGTACACCAACAG
ACTGGTAACTGAAACTCAG
CTAGCTTTCAGGGAATTG
TTCCTGTATGTGAGGTGTA
GAAGCACTTATCCATTGG
GATGTAATATGAAACCAAGTATTGG
ACGATAGACATTTCTATATGACTTC
GTGAGAAGGACCTCATAAAATATTGTC
GAATTGGATGTTTAAATAAACATTCACCAAC
TATCTTTGTGTACAACTGGA
TGTGAAATCCAAGGGACC
AACGGTGAAAGCCTATTGG
TAGTAACTATCCATACGGGGG
CACGTCTCCAGCTTTGCTGTTG
CGGGCAACTGATTCAAGTCAAG
TGGGATGTGAGGGGGTGAATG
TTCAGCAACCTCCAAGAAAGCCA
TGTCCAGTGACGCTGTCATCAC
CATTGCATTTGTGAGATGGAG
GAGAAGTGAATTTGTTTGGAG
CACAGACCCATCATATGGCTG
TCTGACCTAACATGCTTC
CCAGTAAAGTAGGCATAC
GAGCTTGCTAAGTAATTCAGTGG
AGAGCAATATGTGGCACC
GGGGACAATGATGACCTATGTGG
ATTAGTTGCTATAATCATGAAGG
832
270
264
242
284
485
360
459
278
342
442
453
296
342
391
223
238
246
300
424
230
291
1091
Shestopal et al. (17).
van Kuilenburg et al. (23).
three grandchildren (IV-1, IV-2, and IV-3) and are summarized
in Table 2. No archived RNA was available from the proband
(II-5) or her father (I-1). DPD mRNA levels were also quantitated in the PBM cells of seven unrelated control individuals
(Table 2) with normal DPD enzyme activity. DPD enzyme
activity correlated (R2 ⫽ 0.98) with mRNA levels in family
members with normal enzyme activity but not in the partially
DPD-deficient children (III-6 and II-7; Fig. 2).
Genomic DNA Analysis. Because only archived
genomic DNA was available from the proband, DPYD genespecific primers (located in bordering intronic regions and listed
in Table 1) were used to amplify the 23 exons (along with
intron/exon splice junctions) in the proband’s DPYD gene. Sequence analysis of purified PCR amplicons showed that the
proband contained two heterozygote mutations: (a) a G to A
mutation in the GT 5⬘ splicing recognition sequence of intron
14, which results in a 165-bp deletion (corresponding to exon
14) in the DPD mRNA (DPYD*2A); and (b) a T1679G mutation
(designated DPYD*13), which results in a I560S substitution.
These data are summarized in the family’s pedigree (Fig. 1) and
in Table 2. There were no other mutations or polymorphisms
detected in the proband’s DPYD gene.
The proband’s husband (II-6, and father to both children)
demonstrated neither the DPYD*13 nor DPYD*2A mutation in
his DPYD gene. However, complete sequence analysis of the
father revealed that he was a heterozygote for both the T85C
(C29R, DPYD*9A) and the A496G (M166V) mutations (as
shown in Fig. 1 and Table 2).
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2002 American Association for Cancer
Research.
Clinical Cancer Research 771
Fig. 1 Pedigree of a family demonstrating both profound and partial DPD deficiency. Fully shaded symbols (F) represent complete (profound) DPD
deficiency. Half-shaded symbols (N, n) indicate partial DPD deficiency. Unshaded symbols (E, 䡺) indicate normal DPD activity. Hatched symbols
( , ) represent individuals not tested. Deceased family members are designated by a diagonal line in the symbol. The genotype for each family
member tested is listed below each symbol. Consanguinous marriage is shown by the double line in the proband’s (II-5, indicated by a solid arrow)
parents (I-1 and I-2). Phenotypic data for the proband’s parents (I-1 and I-2), brother (II-4), niece and nephew (III-1 and III-2) were extrapolated from
Diasio et al. (8).
Table 2
Subject
II-5 proband
b
Phenotypic and genotypic analysis of proband, family members, and controls
DPD activity
(nmol/min/mg)a
b
Undetectable
Plasma uracil
(ng/ml)
b
1500
DPD mRNA
(copies/ng RNA)
c
Not determined
II-6 husband
0.18
⬍50
1.3 ⫾ 0.10
III-6 daughter
0.01
⬍50
1.9 ⫾ 0.20
III-7 son
0.06
⬍50
2.3 ⫾ 0.33
0.25
0.24
0.21
0.18 ⫾ 0.03
⬍50
⬍50
⬍50
⬍50
2.6 ⫾ 0.31
2.5 ⫾ 0.18
2.0 ⫾ 0.06
1.87 ⫾ 0.58
IV-1 grandson
IV-2 grandson
IV-3 granddaughter
Controls (n ⫽ 7; ⫾SD)
a
b
c
Heterozygote
genotype
Intron 14 GIA
(DPYDⴱ2A)
T1679G
(DPYDⴱ13)
T85C
(DPYDⴱ9A)
A496G
T1679G
(DPYDⴱ13)
A496G
Intron 14 GIA
(DPYDⴱ2A)
A496G
A496G
A496G
Not determined
Effect of genotype
Deletion of exon 14
1560S
C29R
M166V
1560S
M166V
Deletion of exon 14
M166V
M166V
M166V
Normal DPD enzyme activity ranges from 0.11 to 0.75 in 99% of the normal population (7).
DPD enzyme activity and uracil levels were determined in a previous study prior to death (8).
Archived total RNA was not available for analysis.
Sequence analysis of the proband’s two children revealed a
segregation of mutations, with the daughter (III-6) demonstrating a heterozygote DPYD*13 T1679G (I560S) genotype and the
son (III-7) demonstrating a heterozygote DPYD*2A (intron 14
G1A) genotype. The proband’s daughter (III-6) also demonstrated a heterozygote A496G (M166V) mutation. All three of
the proband’s grandchildren (IV-1, IV-2, and IV-3) demonstrated a heterozygote genotype for the A496G (M166V) mutation (as summarized in Fig. 1 and Table 2). The locations of
the mutations (within the DPYD gene) characterized in this
study are shown in Fig. 3.
DISCUSSION
In the present study, we describe the genotypic characterization of one the first known profoundly DPD-deficient cancer
patients. Surviving family members were analyzed to elucidate
the pattern of inheritance and to determine the role of each
mutation in DPD deficiency. Several earlier studies of DPDdeficient patients have reported homozygote mutations resulting
in complete DPD deficiency (9, 11, 19, 20, 23, 24); however,
this is the first report of a compound heterozygote genotype with
segregation of mutations among immediate family members.
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2002 American Association for Cancer
Research.
772 DPD Deficiency Secondary to Compound Heterozygote Genotype
Fig. 2 Correlation between DPD enzyme activity and mRNA levels.
DPD mRNA level (X axis) was plotted against the DPD enzyme activity
(Y axis) and demonstrates a linear correlation coefficient of 0.986 in four
family members [proband’s husband (II-6) and three grandchildren
(IV-1, IV-2, and IV-3)] with normal enzyme activity (F). However,
although both partially DPD-deficient family members (III-6 and III-7)
demonstrate normal DPD mRNA levels, these levels do not correlate
with enzyme activity (䡺).
These analyses demonstrate a codominant pattern of inheritance
for this pharmacogenetic disease. In addition, two previously
reported DPD mutations [T85C (C29R, DPYD*9A) and A496G
(M166V)] thought previously to result in DPD deficiency (19,
23, 24) are shown in this study to have no functional significance to DPD activity.
To determine the molecular basis for DPD deficiency in the
proband, archived genomic DNA (isolated from the patient’s
PBM cells in 1988) was used as a template, and all 23 exons
(including the intron/exon junctions) were PCR amplified. Primers in the flanking introns were designed based on data from the
characterization of the human DPYD gene (16), promoter (17),
and recent studies examining variant DPYD alleles (25). Complete sequence analysis revealed two heterozygous mutations in
the proband: (a) a G to A mutation in the GT 5⬘ splicing
recognition sequence of intron 14 (DPYD*2A); and (b) a
T1679G mutation (now designated DPYD*13), which results in
a nonconserved I560S substitution. Complete sequence analysis
demonstrated that these alleles represent the only sequence
differences in this DPD-deficient patient. The DPYD*2A mutation remains the most characterized and frequently observed
allele associated with DPD enzyme deficiency (9, 11, 25).
However, the DPYD*13 missense mutation has been reported in
only one other patient with reduced DPD enzyme activity (26).
The proband’s husband (and father to both partially DPDdeficient children) demonstrated neither the DPYD*2A nor the
DPYD*13 mutation in his DPYD gene (as shown in Table 2).
However, complete sequence analysis of the father revealed that
he was heterozygote for both the DPYD*9A and the A496G
(M166V) mutations. Both of these mutations have been reported
previously to be associated with DPD deficiency (19, 23, 24).
However, the father demonstrated normal DPD activity. Although the frequency of these alleles in the general population
remains to be determined, their identification in an individual
with normal enzyme activity suggests that both are nonfunctional polymorphisms. This conclusion is supported by a recently published study demonstrating normal DPD enzyme activity in individuals with the DPYD*9A polymorphism (26) and
by the identification of the A496G (M166V) genotype in the
proband’s three grandchildren with normal DPD enzyme activity (Fig. 1). These results (combined with the autosomal
codominant pattern of inheritance demonstrated in the proband
and her children, see below) confirm that neither of these
mutations alters DPD enzyme activity.
Sequence analysis of the proband’s two children demonstrated segregation of both mutations (DPYD*2A and
DPYD*13) identified in the proband. The son demonstrated a
heterozygote DPYD*2A genotype whereas the daughter demonstrated a heterozygote DPYD*13 genotype. This unique segregation of mutations revealed that the proband was a compound
heterozygote containing one variant allele on each DPYD gene.
Furthermore, this genotype allowed the independent assessment
of the effect of each mutation on DPD enzyme activity. As
shown in Table 2, both children demonstrated partial DPD
deficiency, thus demonstrating that both forms of the DPYD
gene were expressed and that this pharmacogenetic syndrome
follows a codominant pattern of inheritance, not autosomal
recessive as originally thought (8).
The molecular basis for DPD deficiency is best understood
in the DPYD*2A mutation. A previous study by our laboratory
demonstrated that a homozygote DPYD*2A genotype results in
a 165-bp deletion (corresponding to exon 14) in the DPD
mRNA (9). Western blot analysis demonstrated that the aberrant
DPD mRNA was translated into a nonfunctional polyubiquitinated DPD protein. Thus, enhanced proteolysis provides a hypothetical mechanism for loss of DPD catalytic activity, similar
to what has been reported with human thiopurine S-methyltransferase deficiency (27). In contrast, the DPYD*13 mutation results in a single nonconserved I560S substitution. Although this
substitution does not occur in any recognized functional domain,
amino acids located in regions critical for enzyme structure
and/or catalytic function would be expected to be conserved
across species. A recent report examining the conservation of
the DPD enzyme demonstrates that the I560 position is 100%
conserved across all five mammalian species (human, mouse,
rat, bovine, and pig) examined (28) and suggests that this
position is important in maintaining DPD enzyme activity.
The phenotypic characterization of this family demonstrating partial DPD deficiency together with a known genotype
prompted us to examine other types of analysis (plasma uracil
and DPD mRNA levels) that may, in the future, be used to
identify DPD deficiency before treatment with 5-FU. Analysis
of the partially DPD-deficient individuals (the proband’s daughter and son) showed plasma uracil levels in the normal range
(⬍50 ng/ml; Table 2). Elevated uracil levels were detected only
in the proband, who demonstrated profound (no detectable enzyme activity) DPD deficiency. These analyses suggest that
only profoundly, not partially, DPD-deficient individuals have
elevated plasma uracil levels. This is particularly important
because a recent study reports that most DPD-deficient patients
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2002 American Association for Cancer
Research.
Clinical Cancer Research 773
Fig. 3 Location of mutations
within the DPYD gene. A schematic map of the human DPD
gene (with exons 1 to 23 represented by solid numbered
boxes) is shown with the locations of the mutations characterized in this study. A heterozygote genotype for the
DPYD*2A or DPYD*13 mutations was shown to result in decreased DPD enzyme activity.
in a population of patients who demonstrated unanticipated
toxicity secondary to treatment with 5-FU are partially deficient
(31% partial versus 12% profound deficiency; Ref. 10). These
data illustrate the potential limitations of determining plasma
uracil levels for the identification and characterization of partially DPD-deficient patients.
In addition to uracil levels, DPD mRNA levels were also
evaluated (Fig. 2 and Table 2). DPD mRNA levels quantitated
from the proband’s husband and three grandchildren (individuals in the family having normal DPD activity) correlated with
enzyme activity (Fig. 2). These data agree with previous studies
from our laboratory demonstrating a linear relationship between
DPD mRNA and activity levels (22). The partially DPD-deficient family members (III-6 and III-7) also demonstrated DPD
mRNA levels in the normal range, suggesting that neither mutation (DPYD*2A nor DPYD*13) affects DPD mRNA levels.
This is not particularly surprising because neither mutation
would directly interfere with RNA transcription, nor do they
occur in regions known to affect RNA stability (29). Although
several recent pharmacogenomic studies have used DPD mRNA
as a surrogate marker for DPD enzyme activity to predict 5-FU
efficacy (30, 31), the present studies suggest that quantitation of
DPD mRNA cannot be used to identify DPD-deficient patients
with this genotype. Taken collectively, these data indicate that
phenotypic analysis of DPD enzyme activity remains the most
reliable method for the identification and characterization of this
pharmacogenetic syndrome.
In summary, comparative phenotypic and genotypic analysis of this family has allowed us to conclude that: (a) a new
compound heterozygote genotype resulting in profound DPD
deficiency has been identified; (b) DPD deficiency exhibits an
autosomal codominant pattern of inheritance, not autosomal
recessive as thought originally; (c) two mutations reported previously to be associated with DPD deficiency [T85C (C29R,
DPYD*9A) and A496G (M166V)] have no functional significance on DPD enzyme activity. Further analysis suggests that
neither uracil nor DPD mRNA levels can be used to predict
partial DPD deficiency for the mutations examined in this study.
This approach demonstrates the usefulness of familial genotypic
and phenotypic analyses to determine the functional significance DPYD mutations.
REFERENCES
1. Grem, J. L. Fluoropyrimidines. In: B. A. Chabner and D. L. Longo
(eds.), Cancer Chemotherapy and Biotherapy, Ed. 2, pp. 149 –197.
Philadelphia: Lippincott-Raven, 1996.
2. Diasio, R. B., and Harris, B. E. Clinical pharmacology of 5-fluorouracil. Clin. Pharm., 16: 215–237, 1989.
3. Heggie, G. C., Sommadossi, J. P., Cross, D. S., Huster, W. J., and
Diasio, R. B. Clinical pharmacokinetics of 5-fluorouracil and its metabolites in plasma, urine, and bile. Cancer Res., 47: 2203–2206, 1987.
4. Diasio, R. B., and Johnson, M. R. Dihydropyrimidine dehydrogenase
(DPD). Its role in 5-FU clinical toxicity and tumor resistance. Clin.
Cancer Res., 5: 2672–2673, 1999.
5. Milano, G., and McLeod, H. L. Can dihydropyrimidine dehydrogenase impact 5-fluorouracil-based treatment? Eur. J. Cancer, 36: 37– 42,
2000.
6. Baker, S. D., Diasio, R. B., O’Reilly, S., Lucas, V. S., Khor, S. P.,
Sartorius, S. E., Donehower, R. C., Grochow, L. B., Spector, T.,
Hohneker, J. A., and Rowinsky, E. K. Phase I and pharmacologic study
of oral fluorouracil on a chronic daily schedule in combination with the
dihydropyrimidine dehydrogenase inactivator eniluracil. J. Clin. Oncol.,
4: 915–926, 2000.
7. Lu, Z., Zhang, R., and Diasio, R. B. Dihydropyrimidine dehydrogenase activity in human peripheral blood mononuclear cells and liver:
population characteristics, newly identified patients, and clinical implication in 5-fluorouracil chemotherapy. Cancer Res., 53: 5433–5438,
1993.
8. Diasio, R. B., Beavers, T. L., and Carpenter, J. T. Familial deficiency
of dihydropyrimidine dehydrogenase. Biochemical basis for familial
pyrimidinemia and severe 5-fluorouracil-induced toxicity. J. Clin. Investig., 81: 47–51, 1988.
9. Johnson, M. R., Hageboutros, A., Wang, K., High, L., Smith, J. B.,
and Diasio, R. B. Life-threatening toxicity in a dihydropyrimidine
dehydrogenase-deficient patient following treatment with topical 5fluorouracil. Clin. Cancer Res., 5: 2006 –2011, 1999.
10. Johnson, M. R., and Diasio, R. Importance of dihydropyrimidine
dehydrogenase(DPD) deficiency in patients exhibiting toxicity following treatment with 5-fluorouracil. Adv. Enzyme Regul., 41: 151–157,
2001.
11. Wei, X., McLeod, H. D., McMurrough, J., Gonzalez, F. J., and
Salguero, P. F. Molecular basis of the human dihydropyrimidine dehydrogenase deficiency and 5-fluorouracil toxicity. J. Clin. Investig., 98:
610 – 615, 1996.
12. Lu, Z., Zhang, R., Carpenter, J., and Diasio, R. B. Decreased
dihydropyrimidine dehydrogenase activity in a population of patients
with breast cancer—implication for 5-fluorouracil-based chemotherapy.
Clin. Cancer Res., 4: 325–329, 1998.
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2002 American Association for Cancer
Research.
774 DPD Deficiency Secondary to Compound Heterozygote Genotype
13. Morrison, G. B., Bastian, A., Dela-Rosa, T., Diasio, R. B., and
Takimoto, C. H. Dihydropyrimidine dehydrogenase deficiency: a pharmacogenetic defect causing severe adverse reactions to 5-fluorouracilbased chemotherapy. Oncol. Nursing Forum, 24: 83– 88, 1997.
14. van Kuilenburg, A. B., Haasjes, J., Richel, D. J., Zoetekouw, L.,
Van, Lenthe, H., De Abreu, R. A., Maring, J. G., Vreken, P., van
Gennip, A. H. Clinical implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-fluorouracil-associated
toxicity: identification of new mutations in the DPD gene. Clin. Cancer
Res., 12: 4705– 4712, 2000.
15. Lu, Z., Zhang, R., and Diasio, R. B. Purification and characterization of dihydropyrimidine dehydrogenase from human liver. J. Biol.
Chem., 267: 17102–17109, 1992.
16. Johnson, M. R., Wang, K., Tillmanns, S., Albin, N., and Diasio,
R. B. Structural organization of the human dihydropyrimidine dehydrogenase gene. Cancer Res., 57: 1660 –1663, 1997.
17. Shestopol, S. A., Johnson, M. R., and Diasio, R. B. Molecular
cloning and characterization of the human dihydropyrimidine dehydrogenase promoter. Biochim. Biophys. Acta, 1494: 162–169, 2000.
18. McLeod, H. L., Collie-Duguid, E. S., Vreken, P., Johnson, M. R.,
Wei, X., Sapone, A., Diasio, R. B., Fernandez-Salguero, P., van Kuilenberg, A. B., van Gennip, A. H., and Gonzalez, F. J. Nomenclature for
human DPYD alleles. Pharmacogenetics, 6: 455– 459, 1998.
19. Vreken, P., Van Kuilenburg, A., Meinsma, R., and van Gennip, A.
Identification of novel point mutations in the dihydropyrimidine dehydrogenase gene. J. Inher. Metab. Dis., 20: 335–338, 1997.
20. Vreken, P., Van Kuilenburg, A., Meinsma, R., and Van Gennip, A.
Dihydropyrimidine dehydrogenase (DPD) deficiency: identification and
expression of missense mutations C29R, R886H and R235W. Hum.
Genet., 101: 333–338, 1997.
21. Johnson, M. R., Yan, J., Shao, L., Albin, N., and Diasio, R. B.
Semi-automated radioassay for determination of dihydropyrimidine dehydrogenase (DPD) activity. Screening cancer patients for DPD deficiency, a condition associated with 5-fluorouracil toxicity. J. Chromatogr. B, 696: 183–191, 1997.
22. Johnson, M. R., Wang, K., Smith, J. B., Heslin, M. J., and Diasio,
R. B. Quantitation of dihydropyrimidine dehydrogenase expression by
real-time reverse transcription polymerase chain reaction. Anal. Biochem., 278: 175–184, 2000.
23. van Kuilenburg, A. B., Haasjes, J., Richel, D. J., Zoetekouw, L.,
Van Lenthe, H., De Abreu, R. A., Maring, J. G., Vreken, P., and van
Gennip, A. H. Clinical implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-fluorouracil-associated
toxicity: identification of new mutations in the DPD gene. Clin. Cancer
Res., 12: 4705– 4012, 2000.
24. Ridge, S. A., Sludden, J., Brown, O., Robertson, L., Wei, X.,
Sapone, A., Fernandez-Salguero, P. M., Gonzalez, F. J., Vreken, P., van
Kuilenburg, A. B., van Gennip, A. H., and McLeod, H. L. Dihydropyrimidine dehydrogenase pharmacogenetics in Caucasian subjects. Br. J.
Clin. Pharmacol., 2: 151–156, 1998.
25. van Kuilenburg, A. B., Muller, E. W., Haasjes, J., Meinsma, R.,
Zoetekouw, L., Waterham, H. R., Baas, F., Richel, D. J., van Gennip,
A. H. Lethal outcome of a patient with a complete dihydropyrimidine
dehydrogenase (DPD) deficiency after administration of 5-fluorouracil:
frequency of the common IVS14⫹1G⬎A mutation causing DPD deficiency. Clin. Cancer Res., 5: 1149 –1153, 2001.
26. Collie-Duguid, E. S., Etienne, M. C., Milano, G., and McLeod,
H. L. Known variant DPYD alleles do not explain DPD deficiency in
cancer patients. Pharmacogenetics, 10: 217–223, 2000.
27. Tai, H. L., Fessing, M. Y., Bonten, F. J., Yanishevsky, Y., d’Azzo,
A., Krynetski, E. Y., and Evans, W. E. Enhanced proteosomal degradation of mutant human thiopurine S-methyltransferase (TPMT) in
mammalian cells: mechanism for TPMT protein deficiency inherited by
TPMT*2, TPMT*3A, TPMT*3B or TPMT*3C. Pharmacogenetics, 9:
641– 650, 1999.
28. Mattison, L. K., Johnson, M. R., and Diasio, R. B. A comparative
analysis of translated dihydropyrimidine dehydrogenase (DPD) cDNA:
conservation of functional domains and relevance to genetic polymorphisms. Pharmacogenetics, in press, 2002.
29. Goswami, P., Sheren, J., Albee, L., Parsian, A., Sim, J., Ridnour, L.,
and Higashikubo, R. Cell cycle-coupled variation in topoisomerase II␣
mRNA is regulated by the 3⬘-untranslated region. Possible role of
redox-sensitive protein binding in mRNA accumulation. J. Biol. Chem.,
275: 38384 –38392, 2000.
30. Salonga, D., Danenberg, K. D., Johnson, M., Metzger, R., Groshen,
S., Tsao-Wei, D. D., Lenz, H. J., Leichma, C. G., Leichman, L., Diasio,
R. B., and Danenberg, P. V. Colorectal tumors responding to 5-fluorouracil have low gene expression levels of dihydropyrimidine dehydrogenase, thymidylate synthase, and thymidine phosphorylase. Clin. Cancer Res., 4: 1322–1327, 2000.
31. Takenoue, T., Kitayama, J., Takei, Y., Umetani, N., Matsuda, K.,
Nita, M. E., Hatano, K., Tsuruo, T., and Nagawa, H. Characterization of
dihydropyrimidine dehydrogenase on immunohistochemistry in colon
carcinoma and correlation between immunohistochemical score and
protein level or messenger RNA expression. Ann. Oncol., 3: 273–279,
2000.
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2002 American Association for Cancer
Research.
Profound Dihydropyrimidine Dehydrogenase Deficiency
Resulting from a Novel Compound Heterozygote Genotype
Martin R. Johnson, Kangsheng Wang and Robert B. Diasio
Clin Cancer Res 2002;8:768-774.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://clincancerres.aacrjournals.org/content/8/3/768
This article cites 25 articles, 9 of which you can access for free at:
http://clincancerres.aacrjournals.org/content/8/3/768.full#ref-list-1
This article has been cited by 17 HighWire-hosted articles. Access the articles at:
http://clincancerres.aacrjournals.org/content/8/3/768.full#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2002 American Association for Cancer
Research.