Extensive Functional Pleiotropy of REVOLUTA
Substantiated through Forward Genetics1[W][OPEN]
Ilga Porth 2, Jaroslav Klápšt
e 2, Athena D. McKown 2, Jonathan La Mantia 2, Richard C. Hamelin,
Oleksandr Skyba, Faride Unda, Michael C. Friedmann, Quentin C.B. Cronk, Jürgen Ehlting,
Robert D. Guy, Shawn D. Mansfield, Yousry A. El-Kassaby, and Carl J. Douglas*
Department of Wood Science (I.P., O.S., F.U., S.D.M.), Department of Forest and Conservation Sciences
(I.P., J.K., A.D.M., J.L.M., R.C.H., R.D.G., Y.A.E.-K.), and Department of Botany (M.C.F., Q.C.B.C., C.J.D.),
University of British Columbia, Vancouver, British Columbia, Canada BC V6T 1Z4; Department of Dendrology
and Forest Tree Breeding, Faculty of Forestry and Wood Sciences, Czech University of Life Sciences, Prague
165 21, Czech Republic (J.K.); and Department of Biology and Centre for Forest Biology, University of Victoria,
Victoria, British Columbia, Canada V8W 3N5 (J.E.)
In plants, genes may sustain extensive pleiotropic functional properties by individually affecting multiple, distinct traits. We
discuss results from three genome-wide association studies of approximately 400 natural poplar (Populus trichocarpa) accessions
phenotyped for 60 ecological/biomass, wood quality, and rust fungus resistance traits. Single-nucleotide polymorphisms (SNPs)
in the poplar ortholog of the class III homeodomain-leucine zipper transcription factor gene REVOLUTA (PtREV) were
significantly associated with three specific traits. Based on SNP associations with fungal resistance, leaf drop, and cellulose
content, the PtREV gene contains three potential regulatory sites within noncoding regions at the gene’s 39 end, where
alternative splicing and messenger RNA processing actively occur. The polymorphisms in this region associated with leaf
abscission and cellulose content are suggested to represent more recent variants, whereas the SNP associated with leaf rust
resistance may be more ancient, consistent with REV’s primary role in auxin signaling and its functional evolution in supporting
fundamental processes of vascular plant development.
The spectrum of genetic control underlying the expression of phenotypic characteristics ranges from
epistasis (governed by interactions of multiple genes) to
pleiotropy (i.e. single genes or mutations affecting
multiple unrelated traits). Phenotypic traits, albeit subjectively defined, typically outnumber genes by orders
of magnitude in complex organisms, supporting the
presence of pleiotropy (Wagner and Zhang, 2011).
Knowledge about the molecular basis of pleiotropy is
important for our understanding of evolvability (i.e. the
capacity of an organism for adaptive evolution; Wang
et al., 2010; Wagner and Zhang, 2011; Hill and Zhang,
2012a). Hodgkin (1998) defined seven types of pleiotropy depending on different underlying molecular
mechanisms, including alternative splicing as a source
1
This work was supported by the Genome British Columbia Applied Genomics Innovation Program (grant no. 103BIO) and the Genome Canada Large-Scale Applied Research Project (grant no. 168BIO)
to R.C.H., Q.C.B.C., J.E., R.D.G., S.D.M., Y.A.E.-K., and C.J.D.
2
These authors contributed equally to the article.
* Address correspondence to [email protected].
The author responsible for distribution of materials integral to the
findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is:
Carl J. Douglas ([email protected]).
[W]
The online version of this article contains Web-only data.
[OPEN]
Articles can be viewed online without a subscription.
www.plantphysiol.org/cgi/doi/10.1104/pp.113.228783
548
of functional pleiotropy at a gene locus. Ongoing debate
centers on whether pleiotropy is limited and modular
(Wagner and Zhang, 2011) or is widespread, which
would support the hypothesis of universal pleiotropy
(Hill and Zhang, 2012a), and whether higher pleiotropy
constrains or facilitates the evolution of organismal
complexity (Wagner and Zhang, 2011; Hill and Zhang,
2012b). However, current measurements may not satisfactorily disclose the pleiotropic level for a given
polymorphism (Wagner and Zhang, 2012). Studies of
mutant phenotypes often overestimate gene pleiotropy
(Wagner and Zhang, 2011) and thus do not reflect the
effects of naturally occurring mutations, which are of
particular interest to our understanding of normal gene
function (Hodgkin, 1998). Quantitative trait locus data
may also overestimate pleiotropy due to the large
linkage intervals in pedigree studies of quantitative trait
loci (Gardner and Latta, 2007). Quantitative trait nucleotide (QTN) functional variants can provide important insights into the genetics of evolution (Streisfeld
and Rausher, 2011; Rockman, 2012), but only largeeffect QTNs are typically accessible (Rockman, 2012).
Thus, causal variants may not be the commonly
detected QTNs; instead, such variants may be present
in multiple, largely small-effect genes that, therefore,
likely remain undetected (Rockman, 2012). Although
generally less studied than exonic variants, mutational
events within introns, untranslated regions (UTRs),
and/or untranscribed gene regulatory regions could be
Plant PhysiologyÒ, February 2014, Vol. 164, pp. 548–554, www.plantphysiol.org Ó 2013 American Society of Plant Biologists. All Rights Reserved.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
REVOLUTA Pleiotropy in Natural Populations
key drivers of evolution (Lynch and Katju, 2004). This
noncoding DNA is enriched with functional sequences
that can arise spontaneously (Rockman, 2012).
The class III homeodomain leucine zipper (HD ZIP)
gene REVOLUTA (REV) is involved in auxin-mediated
adaxial-abaxial patterning of plant leaves in general
and patterning of secondary vascular tissues in woody
species in particular (Emery et al., 2003; Robischon
et al., 2011) and represents an interesting example of
how phenotypic variation can be mediated through
interference with microRNA (miRNA) binding rather
than nonsynonymous mutations in the coding sequence (Emery et al., 2003; Ong and Wickneswari,
2012). Here, we discuss specific results obtained from
genotype-phenotype association studies in poplar
(Populus trichocarpa; La Mantia et al., 2013; Porth et al.,
2013a; A.D. McKown, unpublished data), a tree species
of significant ecological, economic, and scientific importance (Tuskan et al., 2006; Geraldes et al., 2013),
that highlight putative pleiotropic properties of REV.
RESULTS AND DISCUSSION
We conducted genome-wide association studies
(GWAS) that employed approximately 400 phenotyped and genotyped natural poplar accessions grown
in common gardens to elucidate the genetic architecture of wood quality as well as ecophysiological,
phenological, biomass, and rust fungus resistance trait
variation in three separate studies (La Mantia et al.,
2013; Porth et al., 2013a; A.D. McKown, unpublished
data). In total, we examined single-nucleotide polymorphism (SNP) polymorphisms in over 3,500 broadbased candidate genes using an Illumina 34K SNP
genotyping array (Geraldes et al., 2013). The SNP
discovery panel for the array (Geraldes et al., 2013)
involved 20 accessions from the Pacific Northwest for
mRNA sequencing (Geraldes et al., 2011) and 16 accessions taken from the southern distribution range of
poplar for whole-genome sequencing (Slavov et al.,
2012). Phenotypic trait variation was investigated for
approximately 60 quantitative characteristics (La Mantia
et al., 2013; McKown et al., 2013; Porth et al., 2013b). All
three studies employed the generalized linear mixedmodel approach to correct for any genetic structure
present in the population. The optimal model was selected on a trait-by-trait basis using the Bayesian information criterion (Yu et al., 2006).
Among many SNP-trait associations, these studies
revealed genetic associations of wood cellulose content
and leaf phenology traits with SNPs in noncoding regions of distinct splice variants of the poplar REV gene
Potri.009G014500 (PtREV; Fig. 1; Table I), consistent
with fundamental functions for REV in regulating the
architecture of leaf and vascular systems (Zhong et al.,
1997; Zhong and Ye, 1999; Otsuga et al., 2001; Emery
et al., 2003; Robischon et al., 2011; Stirnberg et al., 2012).
An additional putatively functional polymorphism
common to all splice variants of REV is associated with
Melampsora spp. rust fungus resistance (Fig. 1; Table I),
suggesting the involvement of REV with this trait also
and providing a striking example of the extensive
pleiotropic properties that plant genes can sustain.
The wood association study also identified, among
others, SNP associations within various auxin-related
genes related to variation in fiber properties, including
fiber length. Fiber development is tightly linked to the
action of the phytohormone auxin (indole acetic acid)
in vascular tissue formation (Schuetz et al., 2013;
Ursache et al., 2013), as auxin signaling regulates molecular master switches during the initiation of fiber
development (Gorshkova et al., 2012). Since indole
acetic acid plays a role in regulating cambium, xylem,
and fiber development as well as fiber secondary cell
wall thickening and lignification (Gorshkova et al.,
2012; Schuetz et al., 2013), the candidate SNPs within
auxin-related genes identified in our study are potentially important in the upstream regulation of plant
xylem and fiber formation. In particular, REV (synonymous with INTERFASCICULAR FBERLESS1 and
AMPHIVASAL VASCULAR BUNDLES1 [AVB1]), encoding one of five Arabidopsis (Arabidopsis thaliana)
class III HD ZIP transcription factors, regulates meristem function, polarity of lateral organs, vascular architecture and development, and interfascicular fiber
differentiation in Arabidopsis and other angiosperms
(Zhong et al., 1999; Zhong and Ye, 1999; Ratcliffe et al.,
2000, Emery et al., 2003; Zhong and Ye, 2004). In
poplar, the REV ortholog PtREV influences cambium
initiation and patterning of woody stems (Robischon
et al., 2011; Hu et al., 2012). REV is part of a complex
regulatory system involving auxin, KANADI (KAN1)
transcription factors, and miRNA (Emery et al., 2003;
Ilegems et al., 2010; Brandt et al., 2012; Schuetz et al.,
2013). The direct targets of regulation involve several
transcription factors, some of which are regulated antagonistically to support the antagonistic influence by
REV and KAN1 on a suite of gene promoters (Reinhart
et al., 2013). REV mutants are highly pleiotropic across
different species. In Arabidopsis, REV mutants exhibit
differences compared with the wild type in thicker
inflorescence stems with less lignified interfascicular cells, reduced stem strength, reduced number of
branches (defect in paraclade growth) and fewer stem
leaves, enlarged and downwardly curled (i.e. revolute)
cauline leaves, a change in leaf color to dark green, and
delayed leaf senescence (Talbert et al., 1995; Zhong
et al., 1997), while the semidominant REV avb1 mutant
exhibits aberrant cauline branches and leaves, abnormal floral tissues, and amphivasal instead of collateral
vascular bundles (Emery et al., 2003; Zhong and Ye,
2004). In poplar, gain-of-function REV mutants show
severe anatomical phenotypes related to leaf architecture, reduced internode length, callus formation on the
stem surface, abnormal cambial growth, and cambial
polarity defects correlated with the positions of leaves
and axillary buds (Robischon et al., 2011). These consistent observations of phenotypic aberrations among
REV gain-of-function mutants across different plant
Plant Physiol. Vol. 164, 2014
549
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Porth et al.
Figure 1. PtREV gene structure, LD plot, and SNP locations. The gene structures for splice variants/transcriptional variants of REV
(Phytozome version 3) are presented schematically as exon (black boxes), intron (lines), UTR (gray boxes), and noncoding (dots) at
the bottom. Locations of 27 genotyped SNPs are shown as asterisks above the gene models; the solid lines connect to the genetic
associations of tag SNPs within the specific splice variants with Melampsora spp. rust fungus resistance (SNP20), leaf drop (SNP21),
and percentage of a-cellulose content (SNP24); dashed lines indicate SNPs with no significant association with phenotype. The LD
relationships of the SNPs are shown at the top and are color coded to show the extent of LD between genotyped SNPs. r2, Squared
correlation coefficient. Principal component analysis was used to adjust for population structure in the analyses of wood traits and
leaf rust resistance (La Mantia et al., 2013; Porth et al., 2013a); the “area under the disease curve” resistance measure was adjusted
for date of bud set prior to association analysis (La Mantia et al., 2013); Q matrix population structure correction was applied for
phenology traits that covary with latitudinal population structure (A.D. McKown, unpublished data).
species (Talbert et al., 1995; Emery et al., 2003; Magnani
and Barton, 2011; Robischon et al., 2011) suggest that
the functionality of wild-type REV is indeed (1) pleiotropic and (2) a major hub gene (i.e. a key regulatory
gene) regulating plant morphogenesis. Thus, it is anticipated that wild-type REV controls both stem and
leaf growth (Talbert et al., 1995), and recently, it was
also suggested that REV controls light-mediated elongation growth (Brandt et al., 2012).
In contrast to mutant phenotypes generated by loss
of function or overexpression, forward genetics studies
such as GWAS have the potential to elucidate normal
gene functions by correlating differences in the observed natural phenotypic variation with the natural
allelic variations. Our data from wild accessions of
poplar support REV function in secondary growth
and xylem development in poplar based on the genetic association between SNP24 in PtREV and wood
a-cellulose content. This indicates a possible regulatory function for REV in coordinating cellulose
biosynthesis during the differentiation of cells with
secondary cell wall such as vessels and fibers, a process about which little is known (Ambavaram et al.,
2011). Our poplar GWAS also revealed associations
between an SNP in REV and natural variation in date
of leaf abscission (SNP21; A.D. McKown, unpublished
data). Together, these results suggest a putative auxinmeditated mechanism. In addition to vascular differentiation, auxin regulates leaf senescence and abscission
(Ellis et al., 2005). Furthermore, an additional function for REV in stress and pathogen resistance was
revealed in our studies by the association of SNP20
550
Plant Physiol. Vol. 164, 2014
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
REVOLUTA Pleiotropy in Natural Populations
Table I. Features of 27 SNPs in PtREV (Potri.009G014500) genotyped in an association population
Tag SNP (Geraldes et al., 2013)a
Location
scaffold_9_2556002
scaffold_9_2556257
scaffold_9_2556661
scaffold_9_2556664
scaffold_9_2556886
scaffold_9_2556960
scaffold_9_2557200
scaffold_9_2557957
scaffold_9_2558943
scaffold_9_2559321
scaffold_9_2559505
scaffold_9_2560010
scaffold_9_2560210
scaffold_9_2560374
scaffold_9_2560840
scaffold_9_2561340
scaffold_9_2562685
scaffold_9_2562888
scaffold_9_2562964
scaffold_9_2563210
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
Splice
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
variants
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
to
to
to
to
to
to
to
to
to
to
to
to
to
to
to
to
to
to
to
to
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
4
scaffold_9_2563600
scaffold_9_2563682
scaffold_9_2563761
scaffold_9_2563977
scaffold_9_2564040
scaffold_9_2564643
scaffold_9_2565072
Splice variants 2 to 4
39 flanking
39 flanking
39 flanking
39 flanking
39 flanking
39 flanking
Location Feature
HE b
FSTb
MAF
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
Intron
0.504193
0.504857
0.428818
0.226606
0.453198
0.504843
0.504844
0.262775
0.395116
0.11118
0.504236
0.504859
0.263309
0.504283
0.44196
0.45543
0.458848
0.183453
0.470355
0.511584
0.036061
0.033881
0.028909
0.008931
0.036915
0.033775
0.033773
0.010365
0.027997
0.008393
0.037609
0.033876
0.010729
0.036495
0.037899
0.030888
0.037309
20.00455
0.040831
0.08915
0.47691
0.49884
0.31235
0.12587
0.34642
0.49769
0.49769
0.16051
0.27252
0.06134
0.47564
0.49883
0.16088
0.47801
0.31597
0.35082
0.35267
0.10233
0.37153
0.48956
Exon, 39 UTR
Intergenic
Intergenic
Intergenic
Intergenic
Intergenic
Intergenic
0.24597
0.502272
0.193176
0.272897
0.352358
0.4637
0.331155
0.116677
0.040688
20.00458
0.020284
0.006295
0.010006
0.001465
0.13741
0.46846
0.10855
0.16051
0.23248
0.36706
0.20882
Detected Associations
Melampsora 3
columbiana resistancec
Leaf dropd
Percentage a-cellulosee
a
b
SNPs in boldface did not conform to Hardy-Weinberg equilibrium.
HE (expected heterozygosity) and FST (fixation index) were calculated
using Fdist2 implemented in the LOSITAN software package (Antao et al., 2008) on the basis of 433 poplar individuals and subgrouping according to
c
climatic variables (I. Porth, unpublished data).
Area under the disease curve resistance measure adjusted for date of bud set (La Mantia et al.,
d
e
An adaptive phenology trait (McKown et al., 2013; A.D. McKown, unpublished data).
Percentage of relative a-cellulose content in
2013).
dry wood (Porth et al., 2013a, 2013b).
in REV with resistance to the poplar rust fungus
Melampsora 3 columbiana (La Mantia et al., 2013),
which causes yellow leaf rust and represents a serious
pest to commercial poplar plantations. We reliably
inferred haplotypes for the second alternative splice
variant in 435 unrelated individuals with complete
genotype data. We identified one “recessive” haplotype, AGACGTTGTAAAACGCCTAAA (based on the
21 genotyped SNPs for variant 2; Fig. 1), related to
leaf rust susceptibility. This haplotype is prevalent
in poplar accessions from the northern extent of the
species’ range that set bud early compared with
southern populations. Weaker selection pressure from
the pathogen in more northerly located populations
than southerly populations (Chandrashekar and
Heather, 1980) is likely responsible for the maintenance of these sensitive alleles within the population.
A proposed mechanism of resistance could be mediated through the suppression of axillary bud outgrowth by auxin and repressed leaf growth (Stirnberg
et al., 2012), as REV function is implicated in polar
auxin transport (Zhong and Ye, 1999). Auxin may also
regulate defense signaling via cross talk with the GA3
negative regulators of the DELLA protein family.
Proper polar auxin transport is necessary for degradation of DELLA and derepression of growth (Fu and
Harberd, 2003). DELLA loss-of-function Arabidopsis
mutants have primed salicylic acid with earlier, more
robust expression of pathogenesis-related PR1 and
PR2 genes (Navarro et al., 2008), yet for poplar (and
Salicaceae spp. in general), a different mechanism may
apply, as these plant systems can sustain constitutively
high amounts of salicylic acid (Xue et al., 2013). Furthermore, AUXIN F-BOX genes positively regulate
auxin signaling and are up-regulated in incompatible
(resistant) poplar-leaf rust interactions (J. La Mantia,
unpublished data). The observation that REV regulates
genes encoding auxin biosynthetic genes (Brandt et al.,
2012) helps to explain the nature of its pleiotropy, as
this gene seems to regulate multiple fundamental plant
developmental processes, such as basic plant organ
patterning, all of which are tightly linked to auxin
signaling (Otsuga et al., 2001; Emery et al., 2003; Ellis
et al., 2005; Ilegems et al., 2010; Robischon et al., 2011;
Brandt et al., 2012; Schuetz et al., 2013; Ursache et al.,
2013).
How did REV obtain its pleiotropic functionality as
evidenced by the association of REV variants with
Plant Physiol. Vol. 164, 2014
551
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Porth et al.
variation in multiple diverse traits? Class III HD ZIP
genes, such as REV, that contain a steroidogenic acute
regulatory protein-related lipid transfer (START) domain are plant specific and conserved across plants
(Schrick et al., 2004). In animal systems, proteins containing the START domain, a protein module of about
210 amino acid residues that binds lipids such as sterols, show an overlap between developmental and
disease-related gene functions. In mammals, besides
being important for lipid metabolism and fertility,
START domain proteins are also involved in atherosclerosis, autoimmune disease, and cancer and, therefore, are suggested targets for drug development
against such diseases (Soccio and Breslow, 2003; Clark,
2012).
Class III HD ZIP genes predate the evolution of vascular plants (Prigge et al., 2005). REV represents the
most recent class III HD ZIP in land plants (Magnani
and Barton, 2011). The initial ancestral role for class III
HD ZIP genes may have been auxin signaling (Prigge
et al., 2005). New functions appear to have been acquired in parallel with the development of major bodyplan innovations (Floyd et al., 2006). As suggested
elsewhere (Hu et al., 2012), these functions were retained
with relatively low divergence under purifying selection. PtREV exhibits a distinctive gene structure with
four alternative transcriptional variants of its gene sequence, with the shortest transcriptional variant (2,568
bp) devoid of the 39 UTR sequence (Fig. 1; Supplemental
Table S1). This transcriptional variant is prevalent in
xylem (based on RNA-Seq expression profiling; Geraldes
et al., 2011; Bao et al., 2013). It is noteworthy that all
detected phenotype-genotype associations are represented by distinct SNPs (Geraldes et al., 2013) that are
all localized toward the 39 end of the gene, where alternative splicing and alternative transcript processing
occur (Fig. 1; Table I; Supplemental Table S1).
Interestingly, SNP21 (leaf drop association) is localized in the 39 UTR present only in splice variants 2 to 4,
suggesting that this polymorphism might affect
mRNA stability. SNP24 (associated with cellulose
content) is located in the 39 nontranscribed flanking
regions of all gene variants (and SNP21 is downstream
of the 39 UTR of variant 1) and, therefore, could be in a
regulatory region affecting transcription of the gene.
Thus, both SNPs may affect PtREV gene expression,
with important potential consequences on REV function and the traits it affects (Kuersten and Goodwin,
2003). Among 27 genotyped SNPs in REV, 41% did not
conform to Hardy-Weinberg equilibrium, including all
SNPs genetically associated with the studied phenotypes (Table I). However, none of these polymorphisms
were identified within the miRNA target region, which
represents a protein-coding sequence important for
maintaining normal REV gene function (Emery et al.,
2003; Zhong and Ye, 2004; Floyd et al., 2006; Robischon
et al., 2011).
Overall, the investigated SNPs within REV exhibited little to moderate genetic differentiation in the
populations studied, when climate-related population
grouping was employed, with the exception of the
SNP associated with variation in the timing of leaf
abscission; this SNP (SNP21) is thus a candidate for an
adaptive QTN to different local climate regimes (see
fixation index values in Table I). In brief, we used
distinct climate partitions to identify adaptive traits
due to population differentiation of quantitative traits
based on local climate of origin. The estimated population differentiation values for leaf drop and rust resistance traits (both traits were also validated over
time; La Mantia et al., 2013; A.D. McKown, unpublished
data) deviated from neutral expectations (I. Porth,
unpublished data). Then, we used the same subgroup
partitioning to determine such QTNs associated with
adaptive traits that also identified as fixation index
outliers. The SNP within REV associated with leaf drop
is suggested to be adaptive to different temperature
regimes. However, we note here that the selection pressure driven by climate represents only one aspect of
adaptive evolution in poplar; phenology traits, in particular, are strongly adapted to latitudinal origins, while
soil composition (aridity and moisture) also contribute
to plant adaptation.
Comparing the three associated SNPs, the polymorphism associated with Melampsora spp. resistance
is found in relatively high linkage disequilibrium (LD)
with several SNPs throughout the REV gene region.
This increased LD might be due to diversifying selection evident for this SNP along the north-south geographic cline of the poplar distribution (A. Geraldes,
unpublished data). In contrast, the leaf abscission- and
cellulose-associated SNPs are not in LD with any other
SNP within the REV gene region and may have
evolved at different rates based on the observed recombination patterns (Fig. 1; Table I). The LD pattern
across the REV gene is likely incomplete due to a
possible ascertainment bias (rare SNPs in the population and/or nongenotyped SNPs), which is related to
the employed SNP discovery panel for the genotyping
platform. Unfortunately, we cannot confidently use
this LD information to make inferences about the age
of the mutations, although minor allele frequencies
(MAFs) hint at the relative ages of mutations. In this
context, the MAF for variants associated with leaf abscission and cellulose were much lower than the MAF
for the rust resistance SNP (Table I). This is consistent
with an initial role for REV in auxin signaling and
subsequent functional evolution in supporting fundamental processes of vascular plant development
(Prigge et al., 2005), and it is particularly consistent
with auxin as a regulator in plant defense with effects
on plant growth and development (Kazan and Manners,
2009). The complex regulatory network governing REV
expression and the potentially profound effects of its
misexpression in poplar (Robischon et al., 2011; Schuetz
et al., 2013) suggest that pleiotropic phenotypic variability associated with SNPs in REV 39 noncoding regions may be related to variation in the splice variants
through four transcript levels that are conditioned by
regulatory SNPs.
552
Plant Physiol. Vol. 164, 2014
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
REVOLUTA Pleiotropy in Natural Populations
It is interesting that no SNPs were detected in exons
(Table I). This could indicate low allelic frequency of
exonic SNPs in the population (with allele frequencies
lower than 5%), probably due to purifying selection.
This is specifically suggested for the miRNA-targeted
protein-coding sequence that is important for maintaining normal REV gene function. There is evidence
from REV gain-of-function experiments by Magnani
and Barton (2011) that the C terminus of REV (specifically, the Per-ARNT-Sim-like MEKHLA domain at the
C terminus) is particularly important in regulating
REV activity, in a mechanism that is sequence independent but involves steric masking of the Leu zipper
domain such that homodimerization is prevented and
REV cannot function as a transcription activator.
MEKHLA, therefore, is considered a negative regulator in the normal function of REV (Magnani and
Barton, 2011).
We detected several other examples of pleiotropy
in poplar (A.D. McKown, unpublished data; I. Porth,
unpublished data). This involves pleiotropy within trait
categories (phenology, ecophysiology, or growth/biomass)
and, importantly, also across these field trait categories
(A.D. McKown, unpublished data). In addition, three
association genetics studies (Porth et al., 2013a; La
Mantia et al., 2013; A.D. McKown, unpublished data)
revealed pleiotropy across completely different phenotypic traits (wood properties, phenology, and leaf
rust resistance), of which the apparent pleiotropic
functions of REV were the most striking example.
REV has been intensively studied in Arabidopsis
using reverse genetics functional approaches, in
which this transcription factor was identified as an
important regulator of multiple aspects of plant development. These data support our findings from
GWAS in poplar that underscore the functional integration of plant developmental traits related to
the molecular mechanisms governing cellulose fiber
production (secondary growth) and leaf life span.
Another example of considerable pleiotropy in forest
trees involved the recent discovery of several genomic regions in spruce (Picea spp.) associated with
growth and herbivory resistance traits (Porth et al.,
2012).
The association of distinct SNP variants in the
PtREV gene with phenotypic variation in several diverse traits underscores the importance of the REV
transcription factor in regulating the expression of
different developmental processes and provides a
striking example of a pleiotropic gene with variants
that impact these traits. Alternative splicing that generates different protein isoforms and gene expressionlevel variation may both facilitate pleiotropic gene
functions. PtREV variants associated with variation
in distinct traits are located in the last intron at the
39 end, the 39 UTR, and the untranscribed downstream
region. Thus, functional pleiotropy of the PtREV gene
in modulating extensive phenotypic variability may
be best explained by gene expression and/or mRNA
processing.
Supplemental Data
The following materials are available in the online version of this article.
Supplemental Table S1. Sequences of PtREV alternative splice variants
(Phytozome version 3).
Received September 17, 2013; accepted December 2, 2013; published December
5, 2013.
LITERATURE CITED
Ambavaram MM, Krishnan A, Trijatmiko KR, Pereira A (2011) Coordinated activation of cellulose and repression of lignin biosynthesis
pathways in rice. Plant Physiol 155: 916–931
Antao T, Lopes A, Lopes RJ, Beja-Pereira A, Luikart G (2008) LOSITAN: a
workbench to detect molecular adaptation based on a Fst-outlier
method. BMC Bioinformatics 9: 323
Bao H, Li E, Mansfield SD, Cronk QC, El-Kassaby YA, Douglas CJ (2013)
The developing xylem transcriptome and genome-wide analysis of alternative splicing in Populus trichocarpa (black cottonwood) populations.
BMC Genomics 14: 359
Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C,
Ott F, Schmid M, Greb T, Schwarz M, et al (2012) Genome-wide
binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses. Plant J 72: 31–42
Chandrashekar M, Heather WA (1980) Temperature sensitivity of reactions of Populus spp. to races of Melampsora larici-populina. Phytopathology 71: 421–424
Clark BJ (2012) The mammalian START domain protein family in lipid
transport in health and disease. J Endocrinol 212: 257–275
Ellis CM, Nagpal P, Young JC, Hagen G, Guilfoyle TJ, Reed JW (2005)
AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana.
Development 132: 4563–4574
Emery JF, Floyd SK, Alvarez J, Eshed Y, Hawker NP, Izhaki A, Baum SF,
Bowman JL (2003) Radial patterning of Arabidopsis shoots by class III
HD-ZIP and KANADI genes. Curr Biol 13: 1768–1774
Floyd SK, Zalewski CS, Bowman JL (2006) Evolution of class III
homeodomain-leucine zipper genes in streptophytes. Genetics 173:
373–388
Fu XD, Harberd NP (2003) Auxin promotes Arabidopsis root growth by
modulating gibberellin response. Nature 421: 740–743
Gardner KM, Latta RG (2007) Shared quantitative trait loci underlying
the genetic correlation between continuous traits. Mol Ecol 16: 4195–
4209
Geraldes A, Difazio SP, Slavov GT, Ranjan P, Muchero W, Hannemann J,
Gunter LE, Wymore AM, Grassa CJ, Farzaneh N, et al (2013) A 34K
SNP genotyping array for Populus trichocarpa: design, application to
the study of natural populations and transferability to other Populus
species. Mol Ecol Resour 13: 306–323
Geraldes A, Pang J, Thiessen N, Cezard T, Moore R, Zhao Y, Tam A,
Wang S, Friedmann M, Birol I, et al (2011) SNP discovery in black
cottonwood (Populus trichocarpa) by population transcriptome resequencing. Mol Ecol Resour (Suppl 1) 11: 81–92
Gorshkova T, Brutch N, Chabbert B, Deyholos M, Hayashi T, Lev-Yadun
S, Mellerowicz EJ, Morvan C, Neutelings G, Pilate G (2012) Plant fiber
formation: state of the art, recent and expected progress, and open
questions. Crit Rev Plant Sci 31: 201–228
Hill WG, Zhang XS (2012a) On the pleiotropic structure of the genotypephenotype map and the evolvability of complex organisms. Genetics
190: 1131–1137
Hill WG, Zhang XS (2012b) Assessing pleiotropy and its evolutionary
consequences: pleiotropy is not necessarily limited, nor need it hinder
the evolution of complexity. Nat Rev Genet 13: 296
Hodgkin J (1998) Seven types of pleiotropy. Int J Dev Biol 42: 501–505
Hu R, Chi X, Chai G, Kong Y, He G, Wang X, Shi D, Zhang D, Zhou G
(2012) Genome-wide identification, evolutionary expansion, and expression profile of homeodomain-leucine zipper gene family in poplar
(Populus trichocarpa). PLoS ONE 7: e31149
Ilegems M, Douet V, Meylan-Bettex M, Uyttewaal M, Brand L, Bowman
JL, Stieger PA (2010) Interplay of auxin, KANADI and class III HD-ZIP
Plant Physiol. Vol. 164, 2014
553
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.
Porth et al.
transcription factors in vascular tissue formation. Development 137:
975–984
Kazan K, Manners JM (2009) Linking development to defense: auxin in
plant-pathogen interactions. Trends Plant Sci 14: 373–382
Kuersten S, Goodwin EB (2003) The power of the 39 UTR: translational
control and development. Nat Rev Genet 4: 626–637
La Mantia J, Klápšt
e J, El-Kassaby YA, Azam S, Guy RD, Douglas CJ,
Mansfield SD, Hamelin R (2013) Association analysis identifies Melampsora 3
columbiana poplar leaf rust resistance SNPs. PLoS ONE 8: e78423
Lynch M, Katju V (2004) The altered evolutionary trajectories of gene
duplicates. Trends Genet 20: 544–549
Magnani E, Barton MK (2011) A per-ARNT-sim-like sensor domain
uniquely regulates the activity of the homeodomain leucine zipper
transcription factor REVOLUTA in Arabidopsis. Plant Cell 23: 567–582
McKown AD, Guy RD, Azam MS, Drewes EC, Quamme LK (2013) Seasonality and phenology alter functional leaf traits. Oecologia 172: 653–
665
Navarro L, Bari R, Achard P, Lisón P, Nemri A, Harberd NP, Jones JD
(2008) DELLAs control plant immune responses by modulating the
balance of jasmonic acid and salicylic acid signaling. Curr Biol 18: 650–
655
Ong SS, Wickneswari R (2012) Characterization of microRNAs expressed
during secondary wall biosynthesis in Acacia mangium. PLoS ONE 7:
e49662
Otsuga D, DeGuzman B, Prigge MJ, Drews GN, Clark SE (2001) REVOLUTA regulates meristem initiation at lateral positions. Plant J 25: 223–
236
Porth I, Klápšt
e J, Skyba O, Hannemann J, McKown AD, Guy RD,
DiFazio S, Muchero W, Ranjan P, Tuskan GA, et al (2013a) Genomewide association mapping for wood characteristics in Populus identifies
an array of candidate single nucleotide polymorphisms. New Phytol
200: 710–726
Porth I, Klápšt
e J, Skyba O, Lai BS, Geraldes A, Muchero W, Tuskan GA,
Douglas CJ, El-Kassaby YA, Mansfield SD (2013b) Populus trichocarpa
cell wall chemistry and ultrastructure trait variation, genetic control and
genetic correlations. New Phytol 197: 777–790
Porth I, White R, Jaquish B, Alfaro R, Ritland C, Ritland K (2012) Genetical genomics identifies the genetic architecture for growth and
weevil resistance in spruce. PLoS ONE 7: e44397
Prigge MJ, Otsuga D, Alonso JM, Ecker JR, Drews GN, Clark SE (2005)
Class III homeodomain-leucine zipper gene family members have
overlapping, antagonistic, and distinct roles in Arabidopsis development.
Plant Cell 17: 61–76
Ratcliffe OJ, Riechmann JL, Zhang JZ (2000) INTERFASCICULAR FIBERLESS1
is the same gene as REVOLUTA. Plant Cell 12: 315–317
Reinhart BJ, Liu T, Newell NR, Magnani E, Huang T, Kerstetter R,
Michaels S, Barton MK (2013) Establishing a framework for the ad/
abaxial regulatory network of Arabidopsis: ascertaining targets of class
III HOMEODOMAIN LEUCINE ZIPPER and KANADI regulation. Plant
Cell 25: 3228–3249
Robischon M, Du J, Miura E, Groover A (2011) The Populus class III HD
ZIP, popREVOLUTA, influences cambium initiation and patterning of
woody stems. Plant Physiol 155: 1214–1225
Rockman MV (2012) The QTN program and the alleles that matter for
evolution: all that’s gold does not glitter. Evolution 66: 1–17
Schrick K, Nguyen D, Karlowski WM, Mayer KF (2004) START lipid/
sterol-binding domains are amplified in plants and are predominantly associated with homeodomain transcription factors. Genome
Biol 5: R41
Schuetz M, Smith R, Ellis B (2013) Xylem tissue specification, patterning,
and differentiation mechanisms. J Exp Bot 64: 11–31
Slavov GT, DiFazio SP, Martin J, Schackwitz W, Muchero W, RodgersMelnick E, Lipphardt MF, Pennacchio CP, Hellsten U, Pennacchio LA,
et al (2012) Genome resequencing reveals multiscale geographic structure and extensive linkage disequilibrium in the forest tree Populus
trichocarpa. New Phytol 196: 713–725
Soccio RE, Breslow JL (2003) StAR-related lipid transfer (START) proteins:
mediators of intracellular lipid metabolism. J Biol Chem 278: 22183–22186
Stirnberg P, Zhao S, Williamson L, Ward S, Leyser O (2012) FHY3 promotes shoot branching and stress tolerance in Arabidopsis in an AXR1dependent manner. Plant J 71: 907–920
Streisfeld MA, Rausher MD (2011) Population genetics, pleiotropy, and
the preferential fixation of mutations during adaptive evolution. Evolution 65: 629–642
Talbert PB, Adler HT, Parks DW, Comai L (1995) The REVOLUTA gene is
necessary for apical meristem development and for limiting cell divisions in the leaves and stems of Arabidopsis thaliana. Development 121:
2723–2735
Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U,
Putnam N, Ralph S, Rombauts S, Salamov A, et al (2006) The genome
of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313:
1596–1604
Ursache R, Nieminen K, Helariutta Y (2013) Genetic and hormonal regulation of cambial development. Physiol Plant 147: 36–45
Wagner GP, Zhang J (2011) The pleiotropic structure of the genotypephenotype map: the evolvability of complex organisms. Nat Rev
Genet 12: 204–213
Wagner GP, Zhang J (2012) Universal pleiotropy is not a valid null hypothesis: reply to Hill and Zhang. Nat Rev Genet 13: 296
Wang Z, Liao B-Y, Zhang J (2010) Genomic patterns of pleiotropy and the
evolution of complexity. Proc Natl Acad Sci USA 107: 18034–18039
Xue LJ, Guo W, Yuan Y, Anino EO, Nyamdari B, Wilson MC, Frost CJ,
Chen HY, Babst BA, Harding SA, et al (2013) Constitutively elevated
salicylic acid levels alter photosynthesis and oxidative state but not
growth in transgenic Populus. Plant Cell 25: 2714–2730
Yu J, Pressoir G, Briggs WH, Vroh Bi I, Yamasaki M, Doebley JF,
McMullen MD, Gaut BS, Nielsen DM, Holland JB, et al (2006) A
unified mixed-model method for association mapping that accounts for
multiple levels of relatedness. Nat Genet 38: 203–208
Zhong R, Taylor JJ, Ye ZH (1997) Disruption of interfascicular fiber differentiation in an Arabidopsis mutant. Plant Cell 9: 2159–2170
Zhong R, Taylor JJ, Ye ZH (1999) Transformation of the collateral vascular
bundles into amphivasal vascular bundles in an Arabidopsis mutant.
Plant Physiol 120: 53–64
Zhong R, Ye ZH (1999) IFL1, a gene regulating interfascicular fiber differentiation in Arabidopsis, encodes a homeodomain-leucine zipper
protein. Plant Cell 11: 2139–2152
Zhong R, Ye ZH (2004) Amphivasal vascular bundle 1, a gain-of-function
mutation of the IFL1/REV gene, is associated with alterations in the
polarity of leaves, stems and carpels. Plant Cell Physiol 45: 369–385
554
Plant Physiol. Vol. 164, 2014
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2014 American Society of Plant Biologists. All rights reserved.