Plant Cell Physiol. 38(9): 1060-1068 (1997)
J S P P ® 1997
Isolation and Characterization of Matrix Associated Region DNA Fragments
in Rice (Oryza sativa L.)
Koji Nomura 1 , Wataru Saito 1 , Kimiyo Ono 2 , Hiromitsu Moriyama3, Seiko Takahashi4, Masayasu
Inoue 4 and Kiyoshi Masuda 5
1
2
3
4
3
Institute of Agriculture and Forestry, University of Tsukuba, Tsukuba, Ibaraki, 305 Japan
Institute of Biological Science, University of Tsukuba, Tsukuba, Ibaraki, 305 Japan
Faculty of Agriculture, Tokyo University of Agriculture and Technology, Fuchu, Tokyo, 183 Japan
Division of Cell Biology, Akita Prefectural College of Agriculture, Ohgata, Akita, 010-04 Japan
Department of Horticultural Science, Faculty of Agriculture, Hokkaido University. Sapporo, 060 Japan
To investigate the interactions between chromosomal
DNA and nuclear matrices in higher plants, matrix associated regions (MARs) of rice (Oryza sativa L.) DNAs were
cloned. First, we prepared nuclear matrices from isolated
nuclei by digesting them with EcoRl and then extracting
with 2 M NaCl. About 6% of the total DNA remained in
the nuclear matrices after this digestion and extraction.
The residual DNA fragments in the nuclear matrices were
cloned. Some of the cloned DNA fragments showed binding to certain nuclear proteins. One of the MAR fragments
contained sequences related to known consensus motifs
and a hairpin loop structure. A method is presented for isolation of matrix associated region (MAR) DNAs from
plant cells.
Key words: Cell culture — Matrix associated region —
Nuclei — Nuclear matrices — Rice — Oryza sativa L.
The function and structure of nuclei needs to be
studied for better understanding of eukaryotic cells. In
animal cells, the morphology of the nucleus is mainly sustained by a framework of filamentous proteins, which
associate with the nucleoplasmic surface of the inner nuclear membrane. The framework of nuclei, called the nuclear
matrix (Berezney and Coffey 1974), can be prepared by
removing the membranes and extracting the chromatin
components from the isolated nuclei. The main component
of an animal nuclear matrix is the lamina, which is a
meshwork of intermediate filaments of lamins, and which
is known to line the nuclear membrane (Gerace et al. 1978,
Aebi et al. 1986). The nuclear matrix not only provides
structural support for the nucleus, but is also involved in
the functions of eukaryotic cells. Proteins able to bind with
DNA are present in the nuclear matrix (von Kries et al.
1991). It is known that a small percentage of chromosomal
Abbreviations: BSA, bovine serum albumin; DAPI, 4',6'-diamidino-2-phenylindole; DTT, dithiothreitol; LIS, lithium 3,5-diiodosalicylate; MAR, matrix associated region; PMSF, phenylmethylsulfonyl fluoride.
DNA is left undigested in nuclear matrices even after the extraction of chromatin from isolated nuclei (Vogelstein et
al. 1980). This residual DNA is called the matrix associated
region (MAR) (Cockerill and Garrard 1986) or scaffold attachment region (Mirkovitch et al. 1984, Gasser and Laemmli 1986). MARs are known to fold chromosomes within
nuclei (Mirkovitch et al. 1988). They have been reported to
increase the transcription level of a flanking gene in transgenic cells (Stief et al. 1989, Phi-Van et al. 1990) and to increase DNA replication (Mullenders et al. 1983, McCready
and Cook 1984). Thus, MARs play important roles in expression, replication, and repair of eukaryotic genes. The
importance of MARs is also recognized in plant cells
(Spiker and Thompson 1996). The autonomous replicating
sequence (ARS) of yeast is known to associate with plant
nuclei, and this ARS increases the expression of the /?-glucuronidase cassette when it is conjugated to the gene in transgenic tobacco cells (Allen et al. 1993). Position effects were
also reduced when reporter genes which had been flanked
with a MAR from the chicken lysozyme gene domain
(Phi-Van and Straling 1988) was introduced in tobacco
(Mlynarova et al. 1994). Using the chicken lysozyme MAR,
Mlynorova et al. (1995) showed that interactions between
the MAR and the promoter used in the experiment may interfere with the MAR as a domain boundary. It is necessary
to examine many kinds of MARs to understand the interactions between promoters and MARs, and it is desirable to
have MARs from plant chromosomes.
Investigation of the nuclear matrices of higher plant
cells has suggested that some proteins constituting the nuclear matrix differ between plants and animals; lamins are
the major proteins of nuclear matrices in animal cells,
whereas nuclear matrices from plant cells consist of a complex mixture of many polypeptides (Berezney and Coffey
1974, Masuda et al. 1993). Moreover, lamins have molecular masses of 60 to 70 kDa, whereas polypeptides with molecular masses of 90 to 100 kDa are often observed as abundant proteins in nuclear matrix preparations from plant
material (Scofield et al. 1992, Masuda et al. 1993). Beven et
al. (1991) applied an autoimmune serum directed against
human lamins A and C to proteins from carrot nuclear
matrix. The serum recognized a polypeptide which had a
1060
Isolation of rice matrix associated region DNA
higher molecular mass than human lamins. Previously, we
prepared monoclonal antibodies against the most abundant protein in carrot nuclear matrices. These monoclonal antibodies did not react with animal nuclear matrices
(Masuda et al. 1993). Therefore, it seems that there may be
differences in the DNA-protein interactions in plant and
animal nuclear matrices. To understand the interaction between chromosomal DNA and the nuclear matrix in higher
plants, it is necessary to acquire as much information
about isolated MAR fragments as possible. The first report on plant MARs was by Hall, Jr. et al. (1991). They
identified MAR activities in DNA fragments flanking the
coding regions of tobacco root-specific genes. Such an approach helps to reveal the control mechanisms in gene expression, but they do not reveal the sequences of the DNA
fragments from the nuclear matrices or the nature of the
proteins which bound to the MAR fragments. It is also
necessary to identify MARs without restricting the adjacent coding regions.
In a previous work, we established a simple method
for preparing pure nuclear matrices from nuclei isolated from somatic embryos of carrot (Daucus carota L.)
(Masuda et al. 1993). In that work, we found that 3.6% of
genomic DNA remains in the residual nuclear matrix fraction even after digestion with DNase I and extraction of
chromatin components with a high NaCl concentration. Although the nature of the residual DNA was not investigated in the previous work, these DNA fragments seemed to
belong to the group of MARs of chromatin DNA which are
bound to certain domains in the nuclear matrix. In the
present work, we isolated MARs in rice {Oryza sativa L.)
chromosomes. We collected undigested residual DNA fragments from prepared nuclear matrices and cloned them.
Some of the cloned DNA fragments showed a specific ability to bind with certain proteins of the nuclear matrix,
indicating that they had MAR activity. The nucleotide sequence of one of the MAR fragments revealed that the fragment possibly has a small hairpin loop together with motifs
similar to those in animal MARs. Using the method described here, it is also possible to isolate new DNA binding
proteins from the nuclear matrices.
Materials and Methods
Plant materials and culture method—Rice (Oryza sativa L.
cv. Blue Bonnet) cell suspensions were initiated from an embryo
of imbibed seed and were subcultured by transferring 9 ml of the
cell suspension every 8 days to 90 ml of RMS medium (Masuda et
al. 1989) containing 10~6 M 2,4-D. Cells were cultured in 300 ml
Erlenmeyer flasks on a rotary shaker (100 rpm, r=25 mm) at 25°C
in the dark.
Isolation of nuclei—Rice nuclei were isolated according to
the method described by Masuda et al. (1991), with minor modifications in the buffers and centrifugation conditions.
About 10 ml (packed cell volume) of rice cells at 7 days after
inoculation were macerated by gently shaking at 25°C for 1 h with
1061
25 ml of an enzyme solution containing 2% Cellulase ONOZUKA
RS (Yakult Honsha, Tokyo, Japan), 1% Macerozyme R-10
(Yakult Honsha, Tokyo, Japan), 0.2% Pectolyase Y-23 (Seishin
Pharmaceutical, Nagareyama, Japan), 0.6 M sorbitol, 5 mM MES
(pH 5.8) and CPW medium (10 mM CaCl2, 1 mM MgSO4, 1 mM
KNO3, 960 /iM KI, 200/iM KH2PO4, 0.1 ftM CuSO4) (Freason et
al. 1973). Cells were then rinsed five times with CPW medium containing 0.6 M sorbitol and 5 mM MES (pH 5.8). The following
procedures were performed at 0-4°C unless otherwise stated, and
the purity of nuclei was checked using a phase contrast microscope. Cells were suspended in 25 ml of grinding medium (GMC)
consisted of 30% glycerol, 400 mM sucrose, 20 mM MES (pH
5.8), 10 mM KC1, 10 mM CaCl2, and 0.2 mM phenylmethylsulfonyl fluoride (PMSF), homogenized using a Potter-Elverjhan homogenizer driven by a motor, and then centrifuged at 2,500 x g
for 20 min. The pellet was resuspended in 25 ml GMC containing
0.4% Triton X-100 (GMC/0.4T) and homogenized by a motordriven Teflon homogenizer. After centrifugation of the homogenate at 5,000 x g for 20 min, the pellet was again resuspended in
25 ml of GMC/0.4T and homogenized by a Teflon homogenizer.
The suspension of crude nuclei was sieved through a stainless steel
screen with apertures of 22/jm. The nuclei were further fractionated by discontinuous density gradient centrifugation. We put
10 ml of 48% Percoll, 400 mM sucrose, 30% glycerol, 20 mM
MES (pH 5.8), 10 mM KC1, 10 mM CaCl2 and 0.2% Triton X-100
(48PMC/0.2T) in 50 ml centrifuge tubes and then added 10 ml of
buffer of the same composition, except that the Percoll concentration was reduced to 32% (32PMC/0.2T). The crude suspension of
nuclei was loaded on top of the discontinuous Percoll gradient
and centrifuged at 10,000 x g for 60 min with a swing rotor. Nuclei
were recovered from the interphase between 48PMC/0.2T and
32PMC/0.2T. The nuclei were resuspended using a Teflon homogenizer and diluted with 0.5 volume of GMC/0.4T. They were further purified by sieving through a nylon screen of 15 /im aperture
and centrifuged. again under the same conditions. To remove the
Percoll, the nuclei were diluted with GMC and centrifuged at
5,000xg for 20 min, 3,500xg for 15 min, and then 3,000xg for
10 min. One ml of a packed cell volume of rice cells yielded 7 x 107
nuclei. The purified nuclei were suspended in 2 to 4 ml of 50%
glycerol, 20 mM MES (pH 5.8), 10 mM KC1, and 10 mM CaCl2,
and stored at -80°C.
Preparation of nuclear matrix—To prepare nuclear matrices,
the stored nuclei were thawed and collected by centrifuging at
3,000xg for 15 min at 0°C. They were rinsed twice with GMC
and then with 50 mM MES (pH 7.0), 50 mM NaCl, 5 mM MgCl2,
and 1 mM dithiothreitol (DTT), centrifuged at 3,000xg for 15
min at 0°C, and digested by £coRI (600 U for 10* nuclei) in the
same buffer at 37°C for 1 h with gentle agitation. After centrifugation at 3,000xg for 15 min, the supernatant was discarded, and
the nuclei were suspended in 10% glycerol, 50 mM MES (pH 5.8),
5 mM MgCl2 and 1 mM PMSF (MGPM I) and digested with 20
HSmr' RNase A (Type III-A, Sigma, U.S.A.) at 16°C for 30
min. They were washed by centrifugation with 10% glycerol, 50
mM MES (pH 5.8), 0.2 mM MgCl2, and 1 mM PMSF (MGPM
II). The digested nuclei were resuspended in 10% glycerol, 50 mM
MES (pH5.8), l m M PMSF, 2 mM EDTA, 0.5 mM spermidine (Sigma, U.S.A.) and 0.15 mM spermine (Sigma, U.S.A.)
(MGEPP) and pelleted by centrifugation. They were resuspended
in the same buffer, and an equal volume of MGEPP containing 2
M NaCl was gently added to the suspension. After centrifugation,
the pellet was extracted once again with MGEPP containing 2 M
NaCl, and residual nuclear matrices were pelleted by centrifugation.
1062
Isolation of rice matrix associated region DNA
and 0.2% (w/v) Tween 20. As a control experiment, labeled DNA
Preparation of nuclear halos—Nuclear halos were prepared
fragments without nuclear matrix proteins were prepared. A comaccording to the procedure of Mirkovitch et al. (1984). The stored
petition assay with 125 fold unlabeled DNA fragments was also
nuclei were thawed and suspended in 3.75 mM Tris-HCl (pH 7.5),
done. The DNA-protein mixture was separated by a native 8%
20 mM KC1, 0.5 mM CuSO4, 0.05 mM spermine, 0.125 mM sperpolyacrylamide gel in 22.25 mM TrisHCl pH 8.0, 0.5 mM H3BO3,
midine, 1% thiodiglycol, and 0.01% digitonin and centrifuged at
and 0.5 mM EDTA at 80 V for 4 h. After electrophoresis, the
1,000 xg for 5 min at 0°C. The pellet was resuspended in 5mM
DNA-protein complexes were transferred onto a nylon memHEPES (pH 7.4), 2 mM KC1, 0.25 mM spermidine, 2 mM EDTA,
brane, and labeled DNA was visualized by incubating the
and 0.1% digitonin and incubated at 30°C for 5 min before
membrane with 0.25 mM disodium 3-(4-methoxyspirol{l,2-dioxelithium 3,5-diiodosalicylate (LIS) was added to a final concentratane-3,2'-(5'-chloro) tricyclo [3.3.1.1.3.7] decan}-4-yl) phenyl
tion of 25 mM and mixed gently. After incubation at 30°C for 15
phosphate.
min, nuclear halos were recovered by four extractions with 20 mM
Tris-HCl (pH7.5), 20 mM KC1, 70 mM NaCl, 10 mM MgCl2,
DNA binding assay on blotted proteins—DNA-protein bind0.05 mM spermine, 0.125 mM spermidine, 0.01% digitonin, and
ing was also analyzed on blotted membranes. Proteins of rice
nuclei and nuclear matrices were transferred onto a nitrocellulose
0.2 mM PMSF, using centrifugation at l,300xg for 5 min at
membrane (No. 85, Schleicher & Scuell, Germany) by electroblotroom temperature.
ting (Towbin et al. 1979). The membrane was blocked with a buffCloning of residual DNA fragments from nuclear matrices—
er containing 10 mM HEPES-NaOH (pH 7.4), 40 mM NaCl, 1
Nuclear matrices prepared using EcoRl were suspended in 50 mM
mM EDTA, 0.25% (w/v) bovine serum albumin (BSA), 60 mM suTris-HCl (pH7.6), 10 mM EDTA, and 1% SDS and extracted
crose, and 0.1/jgmT 1 poly(dI-dC)poly(dI-dC) (Pharmacia Biowith an equal volume of phenol. After centrifugation, the aquetech,
Sweden) as a competitor. Blocking was done at room temperous phase was extracted again with an equal volume of chloroature for 1-3 h with gentle shaking. The DNA fragments were
form. DNA fragments were precipitated from the aqueous phase
labeled at their 3' end using DIG 3' end-labeling kit (Boehringer
by adding ethanol. An agarose gel electrophoresis was carried out
Mannheim, Germany) according to the standard protocol infor fractionation of DNA fragments. The fragments ranging bedicated in the instructions. Labeled DNA ( 2 0 0 n g m r ' ) was aptween 300 and 4,000 bp were recovered from the gel and cloned
plied to a blotted membrane in 10 mM HEPES-NaOH (pH 7.4),
into the £coRI site of pUC 18.
40 mM NaCl, 1 mM EDTA, 0.25% (w/v) BSA, 60 mM sucrose,
Electrophoresis of nuclear proteins—Nuclear matrices preand 0.1 //g ml"' poly(dI-dC)poly(dI-dC) and incubated in plastic
pared using EcoKl and 2 M NaCl were suspended in MGPM I.
bags at 37°C overnight with gentle shaking. Excess probe was
For complete digestion of nucleic acids, they were digested with
removed by three washes with the blocking buffer. Detection of
1
1
50 jig ml" DNase I (Sigma, U.S.A.) and 20/igmT RNase A
the probes was according to the standard procedure of the kit.
(Sigma, U.S.A.) at 37°C for 1 h and washed with MGPM I. For
The membranes were incubated for 30 min with 75 mU ml" 1 Fab
SDS-PAGE, nuclei and nuclear matrices were dissolved in a samfragment of anti-digoxigenin antibody conjugated to alkaline
ple buffer containing 2% (w/v) SDS, 80 mM Tris-HCl (pH 6.8),
phosphatase in 100 mM maleic acid (pH 7.5) and 150 mM NaCl
10% (v/v) glycerol, and 5% (v/v) 2-mercaptoethanol. Fifty fig pro(pH 7.5) containing 1% (w/v) blocking reagent. The membrane
teins from nuclei and nuclear matrices were applied to each lane
was rinsed twice with 100 mM maleic acid (pH 7.5), 150 mM
and separated by 12.5% SDS-PAGE according to the method of
NaCl, and 0.3% (v/v) Tween 20 for 15 min and then equilibrated
Laemmli (1970). Proteins were stained by Coomassie brilliant blue
in 100 mM Tris HC1 (pH 9.5), 100 mM NaCl, and 50 mM MgCl2.
R-250.
The activity of alkaline phosphatase was visualized by incubation
Southern hybridization—Chromosomal DNA extracted from
with 0.25 mM disodium 3-(4-methoxyspirol{l,2-dioxetane-3,2'isolated nuclei was digested with .EcoRI. DNA fragments which ex(5'-chloro)tricyclo[3.3.1.1.3.7]decan}-4-yl)phenyl phosphate. The
isted in nuclear matrices were recovered as described above. DNA
membrane was then sealed in a plastic bag and exposed to X-ray
released during the preparation of nuclear matrices was collected
film for 60 min. As control experiments, non-specific DNA-profrom supernatant by ethanol precipitation. These three kinds of
tein binding was detected using ultrasonically sheared Escherichia
DNA samples were prepared from same number of nuclei. They
coli genomic DNA at 1,000 ng ml" 1 .
were each separated by a 0.7% agarose gel electrophoresis and
Nucleotide sequencing—Nucleotide sequences were analyzed
then transferred to a nylon membrane. The transferred DNAs
were hybridized with cloned MARs labeled using DIG High Prime . using an automatic sequencer (Model 373A, Applied Biosystems,
U.S.A.). The sequence was analyzed using the GENETEYX proLabeling and Detection Kit. The hybridized fragments were
gram (Software Development Co. Ltd., Japan).
visualized by chemiluminescence using disodium 3-(4-methoxyMicroscopy—Nuclei and nuclear matrices were observed
spirol{ 1,2-dioxetane-3,2'-(5'-chloro)tricyclo[3.3.1.1.3.7]decan}-4under a microscope equipped with phase contrast and epifluoresyl)phenyl phosphate.
cence optics (DMRB, Leica, Wetzlar, Germany). For observation
Gel mobility shift assay—The DNA fragments cloned in
of nuclei with 4',6-diamidino-2-phenylindole (DAPI), epifluorespUC18 were excised from the vector and recovered after separacence
with an excitation filter of 340-380 nm, a dichroic mirror of
tion by gel electrophoresis. A gel mobility shift assay was done us400 nm, and an emission filter of 430 nm were used.
ing DIG gel shift kit (Boehringer Mannheim, Germany). DNA
fragments were labeled and mixed with proteins prepared from
rice nuclear matrices according to the standard conditions deResults
scribed in the instructions with the kit. Proteins of nuclear matrices prepared as described in 'Electrophoresis' were dissolved
Preparation of rice nuclear matrices and nuclear halos
in 20 mM HEPES, pH 7.6, 30 mM KC1, 1 mM EDTA, 10 mM —Rice nuclei and nuclear matrices were more fragile than
(NH4)2SO4, 1 mM DTT, and 0.2% (w/v) Tween 20. Thirty fmol
DNA fragments labeled at their 3' end was incubated with 50 n% those prepared from carrot cells, which we used in our previous studies (Masuda et al. 1991, 1993). Excess forces,
proteins of rice nuclear matrices in 20//I of 20 mM HEPES, pH
7.6, 30 mM KC1, 1 mM EDTA, 10 mM (NH^SO,, 1 mM DTT, such as high speed centrifugation or vigorous pipetting dur-
Isolation of rice matrix associated region DNA
ing the preparation, destroyed the morphology of the intact nuclei. Therefore, while we prepared nuclei and nuclear matrices of rice according to the method established for
isolating those structures from carrot somatic embryos, we
had to centrifuge below 8,000 xg using density gradient
centrifugation with Percoll. For conservation of MAR fragments in nuclear matrices, the effects of endogenous DNase
had to be avoided during the preparation of nuclei from
cells. Therefore, we used the calcium ion instead of magnesium one, which is usually added to buffers to maintain the morphology of the nuclei. CaCl2 at 10 mM was as
effective as MgCl2 at maintaining the morphology of rice
nuclei (Fig. la, d).
Usually, DNase I is used to digest chromosomal DNA
when nuclear matrices are isolated from plant and animal
materials; however, the morphology of rice nuclei was
destroyed when they were directly treated the nuclei with
DNase I or other stronger nucleases. Therefore, we digested the chromosomal DNA gently with a restriction en-
1063
zyme. EcoRl digested chromosomal DNA without apparent distortion of nuclei. Microscopic observations
revealed that DNase I or stronger nucleases did not destroy
the morphology of the nuclear matrices once the chromosomal DNAs of nuclei had been fragmented by a restriction
enzyme (data not shown). Nuclear matrices prepared using
a restriction enzyme showed shapes and sizes similar to the
original nuclei when observed under a phase contrast microscope; however, almost no fluorescence was observed after
DAPI staining, indicating that most of the DNA was
digested (Fig. lb, e).
Nuclear halos were obtained according to the conventional method used in animal cells. After extraction of
histones with lithium 3,5-diiodosalicylate (LIS), halos
larger than the original nuclei were observed under phase
contrast optics (Fig. lc). When they were stained with
DAPI, intense fluorescence was observed, but the contour
of the extracted nuclei was dim, indicating that their DNAs
were not packed in definite structures (Fig. If).
Fig. 1 Isolated nuclei, nuclear matrices, and nuclear halos of rice cells. Isolated nuclei (a and d), nuclear matrices (b and e), and nuclear halos (c and f) were stained with 4',6-diamidino-2-phenylindole (DAPI). The same fields were examined using phase-contrast optics (a
to c) or epifluorescence optics (d to f). Bars indicate 10/im.
1064
Isolation of rice matrix associated region DNA
Proteins and residual DNAs in nuclear matrices—
Figure 2 shows the SDS-PAGE profile of proteins prepared
from isolated nuclei and nuclear matrices. Since we applied
the same amount of protein in each lane, polypeptides existing in the nuclear matrices showed a higher intensity.
Rice nuclear matrices were composed of many polypeptides distributed within the molecular-mass range from 14
kDa to 120 kDa (Fig. 2 lane 2). However, major components of isolated nuclei which had molecular masses
smaller than 17.7 kDa (Fig. 2 lane 1) were not observed in
nuclear matrices.
We compared the DNA contents of prepared nuclear
matrices with isolated nuclei. DNAs were extracted from
nuclear matrices;and isolated nuclei, and the DNA contents
of individual nuclear matrices and nuclei were calculated.
Even though almost no fluorescence was observed in nuclear matrices by DAPI staining under microscopic observation (Fig. le), about 6.2% of the nuclear DNA remained in
the nuclear matrix fraction after digestion with EcoRl and
extraction with 2 M NaCl. Nuclear halos were also digested
with a restriction enzyme. Although we expected to obtain
nuclear matrices by digestion of DNAs of nuclear halos, we
did not obtain morphologically intact ones from nuclear
halos digested with nucleases. When the nuclear halos were
digested with a restriction enzyme, Haelll, discrete individual nuclei were destroyed and formed a fused pellet.
However, it was possible to obtain DNA fragments from
the pellet.
The residual DNAs were extracted from both nuclear
matrices and from the pellet of Haelll digested halos
by standard methods. The length of the DNA fragments
which were prepared from nuclear matrices with EcoRl
ranged between 300 and 10,000 bp. When the nuclear halos
were digested with Haelll, the resulting fragments varied
from 300 to 4,000 bp.
The residual DNA fragments in nuclear matrices were
recovered, and those of 300 to 4,000 bp were fractionated
by a gel electrophoresis. The fractionated DNA fragments
were cloned for further analysis. Among the clones, we
selected two, clones NB-1 and NB-2, which were short in
their sequences. The lengths of NB-land NB-2 were approximately 360 and 1,030 bp, respectively.
Southern hybridization of cloned DNA with genomic
DNA—Southern hybridization analysis was performed to
confirm the origin of cloned DNA fragments. Genomic
DNA of isolated nuclei and residual DNA in nuclear matrices were extracted. Released DNA fragments were also
recovered from the soluble fraction after EcoRl digestion
of nuclei. Genomic DNA was digested by EcoRl. These
three DNA preparations were subjected to gel electrophoresis and blotted onto nylon membranes. They were probed
by the cloned DNA fragments which were excised from the
plasmid and labeled by DIG High Prime Labeling Kit.
These cloned DNAs, which we designated NB-1 and NB-2,
hybridized to restriction fragments of total genomic DNA
(Fig. 3 lanes 1 and 4), and residual DNA in nuclear matrices
12
3 4 5 6
23.139.426.564.36-
0.56-
7.1Fig. 2 Constituent proteins of rice nuclear matrices. Proteins
were extracted from rice nuclei and nuclear matrices and separated by 12.5% SDS-polyacrylamide gel electrophoresis. Lanes 1 and
2 were proteins from isolated nuclei and nuclear matrices, respectively. Fifty fig of protein were applied to a lane. After electrophoresis, proteins were stained by Coomassie brilliant blue R-250.
The numbers on the ordinate indicate molecular mass in kilodaltons.
Fig. 3 Southern blot analysis of cloned fragments. Genomic
DNA from isolated nuclei were digested with EcoRl. Residual
DNA fragments in nuclear matrices and DNA fragments released
from nuclei after EcoRl digestion were prepared. EcoRl digested
genomic DNA (lanes 1 and 4) and DNA from nuclear matrices
(lanes 2 and 5). Released DNA fragments (lanes 3 and 6) were separated by agarose gel electrophoresis and blotted onto a nylon membrane. They were probed by labeled NB-1 (lanes 1 to 3) and NB-2
(lanes 4 to 6).
Isolation of rice matrix associated region DNA
(Fig. 3 lanes 2 and 4). However, those fragments did not
hybridize to DNA released into the soluble fraction after
digestion of isolated nuclei with EcoRl (Fig. 3 lanes 3 and
6).
Gel mobility shift assay—The electrophoretic mobility
shift assay was carried out to see whether the cloned DNA
fragments could bind to proteins of the nuclear matrix or
not. Figure 4 shows the pattern of mobility shift of labeled
DNA fragments in the absence and presence of nuclear
matrix proteins. When proteins prepared from the nuclear
matrix were added to labeled NB-1 and NB-2 fragments,
relative migration of the labeled probes was observed
(Figure 4, lanes 1 and 2 for NB-1, lanes 4 and 5 for NB-2).
Competition was observed in one of the protein-DNA complexes between labeled DNA probes and unlabeled DNA of
the same sequence. (Fig. 4 lanes 3 and 6). The specific protein-DNA complex was marked by (B) in Figure 4.
Binding assay of cloned DNA fragments with nuclear
proteins blotted on membrane—Gel mobility shift assay
revealed that NB-1 and NB-2 formed complexes with proteins of the nuclear matrix; however, the characteristics of
these DNA binding proteins were still obscure. Therefore,
we performed a binding assay between labeled DNA fragments and blotted proteins. The cloned DNA fragments
from nuclear matrices were examined for their binding capacity with proteins extracted from both nuclei and nuclear
matrices. The proteins extracted from isolated nuclei and
Fig. 4 Gel mobility shift profiles of cloned DNA. Cloned DNA
fragments were labeled at their 3' end and mixed with constituent
proteins of rice nuclear matrices. The labeled DNA and proteinDNA mixture were separated by a native 8% polyacrylamide gel.
Lanes 1 to 3 were probed with the DNA fragment NB-1, and lanes
4 to 6, with NB-2. Lanes 1 and 4 were labeled DNA without nuclear matrix proteins. Lanes 2 and 5 were the results after reaction of
labeled DNA fragments and nuclear matrix proteins. Lanes 3 and
6 were competition experiments in the presence of 125 fold unlabeled NB-1 (lane 3) and NB-2 (lane 6). Free probes and specific
protein-complexed DNA were indicated by (F) and (B).
1065
nuclear matrices were separated by SDS-PAGE, as shown
in Fig. 2. Then they were blotted onto a nitrocellulose membrane. Clones NB-1 and NB-2 were labeled at their 3' end
and applied to the blotted proteins. The fragments bound
to proteins of isolated nuclei and nuclear matrices (Fig. 5).
In undigested nuclei, low molecular mass proteins were detected by the probes. Intensive signals of binding between
the labeled fragments and nuclear proteins were observed
at the molecular mass of 10 to 20 kDa in isolated nuclei
(Fig. 5 lanes 1 and 3). The range of molecular mass of these
10 to 20 kDa polypeptides was equivalent to those detected
in nuclei (Fig. 2, lane 1). The probes also detected several
polypeptides of the nuclear matrices. Fragments NB-1 and
NB-2 bound to polypeptides of 25, 28, 30.5 and 34 kDa
(Fig. 5, lanes 2 and 4). A control experiment was done using a rice DNA fragment which showed a lesser number of
DNA-prOtein complexes in the gel shift assay. The DNA
fragments bound to polypeptides of 25, 28 and 30.5 kDa
(Fig. 5, lane 5). Another control experiment was performed
using sheared E. colt genomic DNA. The labeled E. coli
DNA bound with the 30.5 kDa protein, but not with the
other proteins (Fig. 5, lane 6).
Nucleotide sequence of cloned DNA fragment—The
Fig. 5 Binding of DNA fragments from nuclear matrices to nuclear matrix proteins. Proteins of rice nuclei and nuclear matrix
were separated using 12.5% SDS-polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane. Each lane contained 5011% protein. Three cloned DNA fragments from nuclear
matrices, NB-1 and NB-2, were 3'-end-labeled and applied to the
transferred proteins. Lanes 1 and 3 were proteins from isolated
nuclei, and lanes 2 and 4 were proteins from nuclear matrices. The
labeled DNA fragment NB-1 was applied to lanes 1 and 2, NB-2
was applied to lanes 3 and 4. In control experiments, a rice DNA
fragment showed no MAR activity and ultrasonically sheared
E. coli genomic DNA was labeled and applied to nuclear matrix
proteins (lanes 5 and 6, respectively). The numbers on the ordinate
indicate molecular masses in kilodaltons. The arrowheads indicate
the 34 kDa protein.
1066
Isolation of rice matrix associated region DNA
(A)
TCAATCCCGCATGGGAGATTCCAAGCGCCAGACTGACAGATTG
ACCTTGTCCCCCCCTCACAAACTTACACAAAACCCTTAAAACA
TTCAAAATTCACAAATAGCTCCCTATAGGGGCTGAAATGTAAG
ACCTCGCTTCGGACAAGCCGACCCCGCCTGCTATTTCCCGAAA
CTCCAAGCCCTTGTATGAAAAAACGCCGTCTTCCTGTAGTGGG
TGGTGGAAGAAGGGjAATAAAAAAAlCAAAGAGGAAAAAAAAGGA
AGGTCTCATCTCATGGTCGCCTAGCCAAGCCAAGCCAACCTCC
TCGCCGAGGAGAGAGAAGAGAGGAGAGGAGACGAGAGGAGAGA
GAAGCCGAGGAGGAGGAGAGAGAGAGAGGAGGCCGCTCCNTTT
GCCCCCCCCCCCCCCCATGGGGACNCTGCCGGGGGGGGGCCCC
CCCCCCGGANGG
(B)
AATTCACAGTTGTACATGCCAGGAGGCAGTTTGATTATGATAG
GATAGGAGGCAGCTTCTTTCTTAGAGTATATATAATCATTGAT
TTATAATCAGATGATTGCGTCTTTTTTCAGGAAGCCAAGAAAG
TATCCAAACCTTACATTGATCAAGTTGCTAAGGCCACTAAGCC
ACATGTCGAGAAAATTACGAATTTATTTGAAGflCTTATACAAA
AAGAGCAGTCCATATATATGGAAATTTTCTTGAGAAGGCTACA
GCTTATCATCAACAGGTGATTGrrTATTTCTTTfTTTCCCTTCCA
TTT1TTCCT hT&CKn@®M@TTMT®@TTTMMA®TT7AW
OT<£TGCCATACTTCCCCAATT
Fig. 6 Nucleotide sequence and structure of MAR fragments NB-1 and NB-2. A, Partial nucleotide sequence of a strand of the NB-1
fragment. The sequence of 504 bases of NB-1 fragment was analyzed. B, Nucleotide sequence of NB-2. The sequence closely related to
the topoisomerase II consensus sequence is indicated by the underline. The double underline indicates another putative consensus sequence in the complementary strand. The sequences similar to the A-box and T-box (see text) are enclosed by the boxes. The sequence in
outlined italic letters is able to form a hairpin loop structure.
partial nucleotide sequence of NB-1 and the full-length
NB-2 was able to form a hairpin loop structure of 30 nuclesequence of the shorter fragment, NB-2, were analyzed.
otides.
The fragment NB-1 contains a sequence similar to the
A-box (AATAAAT/CAAA) (Gasser and Laemmli 1986)
D(Fig.6A). The fragment NB-2 was an AT-rich (64%) sediscussion
quence of 366 bp (Fig. 6B). This fragment had sequences
The structure of a nucleus is supported mainly by
similar to the cleavage consensus sequence of topoiso- filamentous proteins which form the nuclear matrix. The
merase II (GTNA/TAT/CATTNATNNG/A) (Sander and
major proteins of the nuclear matrix in animal cells are
Hsieh 1985) in both strands and had motifs similar to the lamins, which belong to the intermediate filament class.
A-box and T-box (TTA/TTT/ATTT/ATT) (Gasser and
Lamins have molecular masses of 60 to 70 kDa and show
Laemmli 1986) (Fig. 6B). We also found that the strand of
clearly in gel electrophoresis. However, no distinct proteins
Isolation of rice matrix associated region DNA
of these molecular masses were found in the rice nuclear
matrix proteins after SDS-PAGE. The main scaffolding
materials of nuclear matrices should be identified to improve our understanding of the function of plant nuclei. It
is still not clear whether this lack of typical lamins is attributable to the fragile nature of rice nuclei. Direct digestion of chromosomal DNA with a non-specific DNase
destroyed the nuclear matrix morphology. In rice suspension cells, it is necessary for maintenance of intact morphology to digest chromosomal DNA into fragments with a
restriction enzyme. Sudden degradation of constitutive macromolecules seems to destroy the morphology of nuclei. It
was also impossible to obtain intact structures, such as nuclear matrices, once nuclear halo DNA had been digested.
DNA fragments were cloned from the nuclear matrices
of rice nuclei which had been digested with a restriction enzyme, EcoRl. The nuclear matrices prepared by digestion
with EcoRl contained 6.2% of the total chromosomal
DNA. In a previous study, we found that about 4% of chromosomal DNA remained in nuclear matrix of carrot prepared using DNase I (Masuda et al. 1993). While a restriction enzyme was expected to leave behind more DNA in the
nuclear matrix, almost the same amount of DNA fragments were sustained in nuclear matrices in the two experiments. It seemed that the residual DNA fragments in nuclear matrices were bound tightly to the scaffolding material
for most of their sequence and were hardly attacked by any
DNase.
The DNA fragments recovered from nuclear matrices
were fractionated by gel electrophoresis. The fragments between 300 to 4,000 bp were cloned. Southern hybridization
analysis indicated that some of the fragments existed in
nuclei and nuclear matrices of rice. We selected several
clones which were found in the nuclear matrix.
Although the cloned DNA fragments existed in the nuclear matrix fraction, it was necessary to confirm the binding of those DNA fragments with proteins of nuclear
matrix. A gel mobility shift assay indicated that some of
the cloned DNA fragments bound to proteins of nuclear
matrix. Among them, clones NB-1 and NB-2 showed apparent shifts of relative migration in the presence of proteins of the nuclear matrix. However, the resolution was
not fine enough to identify individual DNA-protein complexes. One possible explanation of this unexpectedly low
resolution is the complexity of constituent proteins of the
rice nuclear matrix. In the next step, we tried to detect binding of the cloned DNA with the proteins blotted on membranes. Two clones, NB-1 and NB-2, were found to complex with several proteins in the nuclear matrix of rice.
Among the polypeptides, the 34 kDa protein showed a specific binding activity with certain nucleotide sequences.
Control experiments using labeled E. coli genomic DNA
and a rice DNA fragment which formed few DNA-protein
complexes in the gel shift assay were used as probes. Those
1067
control experiments showed that 34 kDa polypeptides
bound only with NB-1 and NB-2. This result suggested that
the 34 kDa protein bound to certain DNA sequences.
Although it was difficult to directly show in situ evidence of a DNA sequence with MAR activity, it was suggested that NB-1 and NB-2 were MARs of rice. The nucleotide sequences of NB-1 and NB-2 revealed that NB-2 was
rich in adenine and thymine residues. NB-2 contained sequences closely related to the consensus sequence of topoisomerase II (Sander and Hsieh 1985) and sequences similar
to motifs known as the A-box and T-box (Gasser and Laemmli 1986). A sequence similar to the A-box was also observed in NB-1. However, these sequences were not completely homologous to the known consensus sequences.
Another notable feature of NB-2 was a small hairpin loop,
which may be related to the function of NB-2. These observations suggested that MARs are species specific. In transgenic plant experiments, chicken lysozyme MAR (Phi-Van
and Stratling 1988) was used to assay reduction in position
effect. Position effect was reduced by the chicken MAR in
some cases, but not in others (Mlynarova et al. 1994, 1995).
The confused discussions on position effect in transgenic
plants may be due to the use of animal MARs in plant chromosomes. Use of rice MARs should be useful for better understanding of position effects in plant cells.
We thank Prof. Hyoji Namai and Dr. Michiyuki Ono for
many helpful and inspiring discussions. We also thank Drs.
Chiyoko Sakuta, Kazuhiko Tamura, and Noriyuki Kitakawachi
for technical assistance.
References
Aebi, U., Cohn, J., Buhle, L. and Gerace, L. (1986) The nuclear lamina is
a meshwork of intermediate-type filaments. Nature 323: 560-564.
Allen, G.C., Hall, G.E., Jr., Childs, L.C., Weissinger, A.K., Spiker, S.
and Thompson, W.F. (1993) Scaffold attachment regions increase
reporter gene expression in stably transformed plant cells. Plant Cell 5:
603-613.
Berezney, R. and Coffey, D.S. (1974) Identification of a nuclear protein
matrix. Biochem. Biophys. Res. Commum. 60: 1410-1417.
Beven, A., Guan, Y., Peart, J., Cooper, C. and Shaw, P. (1991) Monoclonal antibodies to plant nuclear matrix reveal intermediate filamentrelated components within the nucleus. J. Cell Sci. 98: 293-302.
Cockerill, P.N. and Garrard, W.T. (1986) Chromosomal loop anchorage
of the kappa immunoglobulin gene occurs next to the enhancer in a
region containing topoisomerase II sites. Cell 44: 273-282.
Freason, E.M., Power, J.B. and Cocking, E.C. (1973) The isolation, culture and regeneration of Petunia leaf protoplasts. Dev. Biol. 33: 130137.
Gasser, S.M. and Laemmli, U.K. (1986) Cohabitation of scaffold binding
regions with upstream/enhancer elements of three developmentally regulated genes of D. melanogaster. Cell 46: 521-530.
Gerace, L., Blum, A. and Blobel, G. (1978) Immunocytochemical localization of the major polypeptides of the nuclear pore complex-lamina fraction. J. Cell Biol. 79: 546-566.
Hall, G., Jr., Allen, G.C., Loer, D.S., Thompson, W.F. and Spiker, S.
(1991) Nuclear scaffolds and scaffold-attachment regions in higher
plants. Proc. Natl. Acad. Sci. USA 88: 9320-9324.
Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly
of the head of bacteriophage T4. Mature 227: 680-684.
1068
Isolation of rice matrix associated region DNA
Masuda, K., Kudo-Shiratori, A. and Inoue, M. (1989) Callus formation
and plant regeneration from rice protoplasts purified by density gradient
centrifugation. Plant Sci. 62: 237-246.
Masuda, K., Takahashi, S., Nomura, K., Arimoto, M. and Inoue, M.
(1993) Residual structure and constituent proteins of the peripheral
framework of the cell nucleus in somatic embryos from Daucus carota,
L.Planta 191: 532-540.
Masuda, K., Takahashi, S., Nomura, K. and Inoue, M. (1991) A simple
procedure for the isolation of pure nuclei from carrot embryos in synchronized cultures. Plant Cell Rep. 10: 329-333.
McCready, S.J. and Cook, P.R. (1984) Lesions induced in DNA by ultraviolet light are repaired at the nuclear cage. J. Cell Sci. 70: 189-196.
Mirkovitch, J., Gasser, S.M. and Laemmli, U.K. (1988) Scaffold attachment of DNA loops in metaphase chromosomes. J. Mot. Biol. 200: 101109.
Mirkovitch, J., Mirault, M.E. and Laemmli, U.K. (1984) Organization of
the higher-order chromatin loop: specific DNA attachment sites on nuclear scaffold. Cell 39: 223-232.
Mlynarova, L., Jansen, R.C., Conner, A.J., Stiekema, W.J. and Nap,
J.P. (1995) The MAR-mediated reduction in position effect can be uncoupled from copy number-dependent expression in transgenic plants. Plant
Cell 7: 599-609.
Mlynarova, L., Loonen, A., Heldens, J., Jansen, R.C., Keizer, P.,
Stiekema, W.J. and Nap, J.P. (1994) Reduced position effect in mature
transgenic plants conferred by the chicken lysozyme matrix-associated
region. Plant Cell 6: 417-426.
Mullenders, L.H.F., van Zeeland, A.A. and Natarajan, A.T. (1983) Analysis of the distribution of DNA repair patches in the DNA-nuclear matrix
complex from human cells. Biochim. Biophys. Ada 740: 428-435.
Phi-Van, L. and Stratling, W.H. (1988) The matrix attachment regions of
the chicken lysozyme gene co-map with the boundaries of the chromatin
domain. EMBO J. 7: 655-664.
Phi-Van, L., von Kries, J.P., Ostertag, W. and Stratling, W.H. (1990) The
chicken lysozyme 5' matrix attachment region increases transcription
from a heterologous promoter in heterologous cells and dampens position effects on the expression of transfected genes. Mol. Cell Biol. 10:
2302-2307.
Sander, M. and Hsieh, T. (1985) Drosophila topoisomerase II double
strand DNA cleavage: analysis of DNA sequence homology at the cleavage site. Nucl. Acids Res. 13: 1057-1071.
Scofield, G.N., Beven, A.F.. Shaw, P.J. and Doonan, J.H. (1992) Identification and localization of a nucleoporin-like protein component of
the plant nuclear matrix. Planta 187: 414-420.
Spiker, S. and Thompson, W.F. (1996) Nuclear matrix attachment regions
and transgene expression in plants. Plant Physiol. 110: 15-21.
Stief, A., Winter, D.M., Stratling, W.H. and Sippel, A.E. (1989) A nuclear DNA attachment element mediates elevated and position-independent
gene activity. Nature 341: 343-345.
Towbin, J., Staehelin, T. and Cordon, J. (1979) Electrophoretic transfer
of proteins from polyacrylamide gels to nitrocellulose sheets. Proc. Natl.
Acad. Sci. USA 76: 4350-4354.
Vogelstein, B., Pardoll, D.M. and Coffey, D.S. (1980) Supercoiled loops
and eucaryotic DNA replication. Cell 22: 79-85.
von Kries, J.P., Buhrmester, H. and Stratling, W.H. (1991) A matrix/
scaffold attachment region binding protein: Identification, purification,
and mode of binding. Celt 64: 123-135.
(Received January 13, 1997; Accepted July 10, 1997)