Plant Molecular Biology 54: 39–54, 2004.
© 2004 Kluwer Academic Publishers. Printed in the Netherlands.
39
A small family of LLS1-related non-heme oxygenases in plants with an
origin amongst oxygenic photosynthesizers
John Gray1,∗ , Ellen Wardzala1 , Manli Yang1 , Steffen Reinbothe2 , Steve Haller1 and Florencia
Pauli3
1 Department
of Biological Sciences, University of Toledo, 2801 West Bancroft Street, Toledo, OH 43606, USA
(∗ author for correspondence; email [email protected]); 2 Laboratoire de Génétique Moléculaire des
Plantes, Université Joseph Fourier et CNRS, CERMO, BP 53, 38041 Grenoble, France; 2 Department of Genetics,
School of Medicine, Stanford University, Stanford, CA 94305, USA
Received 22 July 2003; accepted in revised form 22 December 2003
Key words: Acd1, Cao (chlorophyll a oxygenase), Cmo (choline monooxygenase), dioxygenase, Lls1, non-heme
oxygenase, Pao (pheophorbide a oxygenase), Ptc52, Tic55
Abstract
Conservation of Lethal-leaf spot 1 (Lls1) lesion mimic gene in land plants including moss is consistent with its
recently reported function as pheophorbide a oxygenase (Pao) which catalyzes a key step in chlorophyll degradation (Pruzinska et al., 2003). A bioinformatics survey of complete plant genomes reveals that LLS1(PAO) belongs
to a small 5-member family of non-heme oxygenases defined by the presence of Rieske and mononuclear ironbinding domains. This gene family includes chlorophyll a oxygenase (Cao), choline monooxygenase (Cmo), the
gene for a 55 kDa protein associated with protein transport through the inner chloroplast membrane (Tic55) and
a novel 52 kDa protein isolated from chloroplasts (Ptc52). Analysis of gene structure reveals that these genes
diverged prior to monocot/dicot divergence. Homologues of LLS1(PAO), CAO, TIC55 and PTC52 but not CMO
are found in the genomes of several cyanobacteria. LLS1(PAO), PTC52, TIC55 and a set of related cyanobacterial
homologues share an extended carboxyl terminus containing a novel F/Y/W-x2 -H-x3-C-x2 -C motif not present
in CAO. These proteins appear to have evolved during the transition to oxygenic photosynthesis to play various
roles in chlorophyll metabolism. In contrast, CMO homologues are found only in plants and are most closely
related to aromatic ring-hydroxylating enzymes from soil-dwelling bacteria, suggesting a more recent evolution of
this enzyme, possibly by horizontal gene transfer. Our phylogenetic analysis of 95 extant non-heme dioxygenases
provides a useful framework for the classification of LLS1(PAO)-related non-heme oxygenases.
Introduction
The Lls1 gene was originally cloned from maize and
the absence of this gene function results in a lightdependent cell death phenotype mediated by chloroplasts (Gray et al., 1997, 2002). We have found
that this cell protective function is conserved between
monocots and dicots (Yang et al., submitted). Based
on the presence of two non-heme iron-binding motifs conserved amongst aromatic ring-hydroxylating
enzymes in bacteria it was predicted that the Lls1
gene encodes an oxygenase function (Gray et al.,
1997, 2002). This prediction has been confirmed by
the recent finding that the Arabidopsis thaliana Lls1
gene encodes pheophorbide a oxygenase (PAO) which
catalyzes a key step in chlorophyll degradation (Figure 1D) (Pruzinska et al., in press). Since the discovery
of LLS1 (PAO) in plants a few other genes have been
identified in plants that exhibit the same non-heme
iron-binding motifs (Caliebe et al., 1997; Tanaka
et al., 1998). In this study it is established that there are
a total of five Lls1(Pao)-related genes in plants. The
phylogenetic relationships between these Lls1(Pao)related genes and homologous bacterial enzymes were
examined in detail by comparing 95 known and predicted non-heme oxygenases.
40
Figure 1. Examples of known catalytic functions of non-heme oxygenases from bacteria and plants. A. Naphthalene dioxygenase from Pseudomonas sp. strain G7 catalyzes the conversion of naphthalene to cis-1,2-dihydroxy-1,2-dihydronaphthalene. B. Choline monooxygenase (CMO)
catalyzes the first step in the conversion of choline to the osmoprotectant glycine betaine in plant chloroplasts. C. Chlorophyll a oxygenase
(CAO) catalyzes the first step in the conversion of the Chl a to Chl b. D. Pheophorbide a oxygenase (PAO) catalyzes the oxygenolytic opening
of pheophorbide a at the α-mesoposition between C4 and C5 to produce a red chlorophyll catabolite (RCC).
Non-heme iron oxygenases or hydroxylases that
incorporate one or two atoms of dioxygen into substrates are found in many metabolic pathways (Lange
and Que, 1998; Moraswki et al., 2000; Prescott
and Lloyd, 2000; Ryle and Hausinger, 2002). Enzymes that incorporate only one atom of dioxygen
into substrates are termed monooxygenases (or mixedfunction oxygenases). Oxygenases that catalyze the
incorporation of both atoms of molecular oxygen are
referred to as dioxygenases. These dioxygenases comprise a large and diverse group of multi-component enzymes that play important roles in pathways as diverse
as antibiotic synthesis to the degradation of aromatic
compounds. The comparison of the deduced amino
acid sequences of numerous oxygenases is permitting
the evolutionary relationships between these enzymes
41
to be determined (Lange and Que, 1998; Prescott and
Lloyd, 2000; Ryle and Hausinger, 2002). Of particular
relevance to this study, because of their homology to
the LLS1(PAO)-like plant oxygenases, are a group of
microbial oxygenases that participate in the aerobic
degradation of aromatic hydrocarbons. These oxygenases known as aromatic ring hydroxylases (ARHs)
catalyze the hydroxylation of the aromatic ring as a
first step in the degradation of these compounds by
soil bacteria (Batie et al., 1991; Harayama et al.,
1992; Mason and Cammack, 1992; Jiang et al.,
1996; Nam et al., 2001). An example is naphthalene dioxygenase (NDO) from the soil bacterium
Pseudomonas which oxidizes naphthalene to cis-1,2dihydroxy-1,2-dihydronaphthalene (Figure 1A). NDO
has been crystallized permitting the structure and reaction mechanism to be studied in detail (Kauppi et al.,
1998; Karlsson et al., 2003). NDO consists of two
subunits (α and β) in a hexameric α3β3 composition. The α subunit contains a Rieske[2Fe-2S] center
and mononuclear iron at the active site. The Rieske
domain exhibits a conserved iron-binding domain,
C81-x-H83-x17-C101-x2-H104, which contrasts with
the Rieske domain of chloroplast-type ferredoxins, in
which four cysteine residues co-ordinate a [2Fe-2S]
center. In the NDO Rieske [2Fe-2S] center the Fe1
is coordinated by Cys-81 and Cys-101, while Fe2 is
coordinated by His-83 and His-104. The mononuclear
iron at the active site is coordinated by the two histidine residues and one carboxylate within the motif
E100-x3-D205-x2-H208x4-H213 and by D362. This
motif is now referred to as a 2-His-1-carboxylate facial
triad (Lange and Que, 1998). Electron transfer from
the Rieske domain to the active site occurs between
two a subunits which are held in close proximity by
the hydrogen bonding of D205 to both H104 in the
Rieske domain and H208 at the active site (Kauppi
et al., 1998). The conservation of these iron-binding
motifs in LLS1-like proteins (Gray et al., 1997, 2002)
suggests a common reaction mechanism, but not necessarily common enzyme substrates. Individual microbial ARH enzymes may operate on several substrates, for example, vanillate demethylase (VanA)
from Acinetobacter, which can act upon the vanillate analogues m-anisate, m-toluate and 4-hydroxy3,5-dimethylbenzoate (Moraswki et al., 2000). The
microbial ARH enzymes were originally classified by
Batie et al. (1991), based on the number of constituent
components and the nature of their redox reactions.
This system proved difficult with some newly discovered enzymes, and Nam et al. (2001) developed a
classification scheme that groups these enzymes based
on the phylogenetic comparison of their terminal oxygenase components. This system, which is simple and
powerful, is referred to here as the Nam classification system. The Nam system classifies ARH enzymes
into four groups and representative examples included
in this study are listed in Supplementary Table 1. In
this study we adapt and extend the Nam scheme for
classifying non-heme oxygenases to include plant and
cyanobacterial non-heme oxygenases.
The evolutionary relationship of plant LLS1-like
oxygenases and cyanobacterial oxygenases to these
microbial ARH enzymes is examined in this paper.
Two of the plant oxygenases related to LLS1 have
previously defined biochemical functions and these
are choline monooxygenase (CMO) and chlorophyll
a oxygenase (CAO) (Figure 1B and C). Both oxygenases do not utilize phenolic compounds as substrates. CMO is a ferredoxin-dependent enzyme that
catalyzes the first step in two-step oxidation of choline
to the osmoprotectant glycine betaine (Figure 1B).
This enzyme is found as a homodimer in the chloroplast stroma (Rathinasabapathi et al., 1997). CMO is
unique to plants: in bacteria (including halotolerant
cyanobacteria) and mammals that synthesize glycine
betaine, this first step is catalyzed by choline dehydrogenase (Incharoensakdi and Wutipraditkul, 1999).
CAO catalyzes the first step in the conversion of
chlorophyll a (Chl a) to Chl b (Figure 1c) (Tanaka
et al., 1998). The conservation of this enzyme in the
prochlorophytes Prochloron didemni and Prochlorothrix hollandica suggests that this enzymatic activity
arose once in the common ancestor of oxygenic bacteria and chloroplasts (Tomitani et al., 1999). The
absence of a close homologue of CAO from the genome of Prochlorococcus which synthesizes divinyl
Chl b has given rise to the proposition that a Chl b
synthase in this organism may have a different phylogenetic origin involving convergent evolution (Hess
et al., 2001). PTC52 from barley (PORA translocation
complex) is a 52 kDa protein that is associated with the
translocation of protochlorophyllide oxidoreductase A
(PORA). The detection of pchlide b within this complex suggests that PTC52 catalyzes the conversion of
pchlide a to pchlide b in a reaction that is analagous to
that of CAO (S. Reinbothe et al., in press).
The recent report that the AtLls1 gene encodes
a pheophorbide a oxygenase activity and that pheophorbide a accumulates in maize lls1 plants indicates
that the LLS1 protein catalyzes a key step in the
degradation of chlorophyll (Pruzinska et al., 2003).
42
Thus, three members of the Lls1-related family of nonheme oxygenases have been implicated in either the
synthesis or degradation of chlorophyll intermediates.
The fifth member of this gene family is TIC55 from
pea (translocon of inner chloroplast membrane) which
encodes a 55 kDa protein that is found associated with
the general translocon for proteins through the inner
chloroplast membrane (TIC complex) (Caliebe et al.,
1997; Küchler et al., 2002). A redox regulatory function has been proposed for TIC55 but its precise role
in the TIC import complex is yet to be defined.
The fact that LLS1(PAO)-related proteins exhibit
iron-binding motifs that are conserved in bacterial
ARH enzymes but operate on different substrates
leaves open the question of the evolutionary relationship between these enzymes. In this study we
hypothesized that all LLS1(PAO)-related oxygenases
share a common origin. We sought support for this
hypothesis by examining the phylogenetic relationship between a collection of 95 plant and bacterial
non-heme oxygenases that share similar iron-binding
motifs. Our results suggest a common origin for LLS1,
PTC52, TIC55 and CAO in oxygenic cyanobacteria
but a separate and more recent origin for CMO enzymes.
Materials and methods
Plant material
Plants of Arabidopsis ecotype Columbia were used for
mRNA isolation. Plants were grown at 22 ◦ C under a
16 h/8 h light/dark regime at ca. 200 µmol photons
m−2 s−1 . Herbaceous specimens were collected from
the vicinity of the University of Toledo, researchers
gardens, and the Stranahan Arboretum, Toledo, OH.
Protein isolation and immunoblot analysis
Total protein extracts were isolated from plant leaves
as previously described (Cheng et al., 1996). Cellular lysates were clarified, and protein was quantified by Bradford analysis (Bio-Rad, Richmond, CA).
Proteins (20 µg) were separated on a 7.5% SDSpolyacrylamide gel and blotted onto nitrocellulose.
Nitrocellulose membranes were blocked for 45 min at
room temperature with 5% skim milk in Tris-saline
buffer pH 8.0 containing 0.05% Tween-20 (TBST)
and then incubated in primary antibody, mouse antiLLS1:MBP fusion protein for 1 h. After washing in
TBST, blots were incubated for 1 h at room temperature with peroxidase-conjugated goat anti-mouse IgG
(1:5000, Jackson Immunoresearch Lab., West Grove,
PA) and the immunoreactive complexes developed for
visualization.
RNA isolation, RT-PCR and sequencing
Total RNA was isolated by grinding 1 g frozen Arabidopsis ecotype Columbia leaf tissue to a powder
and suspending in 10 ml RNA extraction buffer (REX)
(2.0 M guanidine thiocyanate, 0.6 M ammonium
thiocyanate, 0.2 M sodium acetate pH 4.0, 8% glycerol, 50% phenol). After vortexing samples for 5 min,
2 ml of chloroform was added and samples were vortexed for a further 3 min. Phases were separated by
centrifugation at 12 000 × g for 15 min, the upper
phase recovered, added to 5 ml of isopropanol, mixed,
incubated at 25 ◦ C for 10 min, and centrifuged at
12 000×g for 10 min at 4 ◦ C. The RNA precipitate was
washed with 70% ethanol and centrifuged again. The
RNA pellet was allowed to air-dry and re-suspended
in RNAase-free water. mRNA was isolated from total
RNA with the MicroPoly(A)pure isolation kit according to the manufacturer’s instructions (Ambion,
Austin, TX). Reverse transcription was performed
with the Retroscript first-strand synthesis kit according to the manufacturer’s instructions (Ambion). The
coding regions of the Arabidopsis Lls1(At3g44880)
and Ptc52(At4g25650) genes were amplified by polymerase chain reaction (PCR) employing the primer
sets AGSP47/AGSP48 and ALGSP1/ALGSP2 respectively (listed below). The annealing temperatures used were 50 ◦ C and 60 ◦ C, respectively,
and MgCl2 concentration was 4 mM. The primers
were ALGSP1 (ATGGAAGCTGCTCTTGCTGCATGCGCTCTTCC), ALGSP2 (CATTTCAAACAACAGCATGGTTGTAGTCATGGTAATGG), AGSP47
(ATGTCAGTAGTTTTACTCTCTTCTACTTCTGC),
and AGSP48 (CTACTCGATTTCAGAATGTACATAATCTCTAAAC).
Amplified PCR products were cloned into the
pTOPO cloning vector according to the manufacturer’s protocol (Invitrogen, Grand Island, NY). The
plasmids clones containing Arabidopsis Lls1(Pao) and
Ptc52 coding regions were named pYM18-1 and
pYM20-1 respectively (GenBank accession number
AY344061 and AY344062 respectively). The DNA sequence of cloned PCR products was determined with
BigDye Terminator Cycle Sequencing and an Applied
Biosystems 3700 DNA Analyzer at the Plant-Microbe
43
Genomics Facility (Ohio State University, Columbus,
OH).
Retrieval of sequences from databases and
determination of gene structure
The neighborhood search algorithm BLAST (Basic Local Alignment Search Tool; Altschul et al.,
1997) was employed for database searches through
the National Center for Biotechnology Information (NCBI), The Arabidopsis Information Resource
(TAIR), Cyanobase, and DOE Joint Genome Institute BLAST WWW servers. In addition, rice genomic sequences were retrieved from the Rice Genome
Database (http://210.83.138.53/rice/). The amino acid
sequences of 95 non-heme oxygenases were downloaded or conceptually translated from genomic DNA
and cDNA sequences available from GenBank files
which are listed in Supplementary Tables 1 and 2.
The exon/intron structure for Arabidopsis, rice and
Chlamydomonas oxygenase genes was determined by
pairwise comparison of genomic and EST sequence
information. The gene structure predicted in Genbank
files did not always match that determined by our analysis. The actual coding regions used in Figure 3 and
the accession numbers of ESTs used in this analysis
are: A thaliana Cao gene At1g4446 (AF17720050);
join bases 1–587, 715–951, 1222–1326, 1405–
1680, 1763–1910, 1986–2170, 2259–2371, 2448–
2742, 2826–2990, and supported by EST AB021316.
O. sativa Cao1 gene (scaffold AAAA01000620);
join complement bases 27477–27403, 26860–26618,
26443–26339, 26257–25979, 25883–25736, 25595–
25411, 25298–25186, 25065–24771, 24618–24436,
and supported by ESTs AF284781, AB021310,
D46313, D48707, AU095684, C24864, AU225916,
and BU672866 (Unigene Os.22029). O. sativa Cao2
gene (scaffold AAAA01000620); join complement
bases 18299–18206, 17823–17578, 17214–17110,
17034–16756, 16672–16525, 16111–159227, 15812–
15700, 15612–15318, 15167–14985, and supported partially by EST BI805076. C. reinhardtii Cao
gene (scaffold 8); join complement bases 3804–
33745, 33529–33200, 33003–32506, 32343–31840,
and supported by cDNA AB015139 and ESTs
AB015139, AV629131, BG 846842. A thaliana
Tic55 gene At2g24280 (AC006585); join complement bases 90163–91284, 91366–91468, 91560–
91954, and supported by ESTs NM 128041,
AY089083, BE529873, AV442063, BE038210,
AV439633, AI995341, BE528579, AV531633. O.
sativa Tic55 gene; Scaffold AAAA01023723, translation of 718–2337 and supported by ESTs D47027,
BU667200, BM422257, BM422260, J010H03,
BI808977, BI808984. A. thaliana Lls1(Pao) (Acd1)
gene Atg344880 (NC− 003074); join bases 16392818–
16393231,
16393535–16393770,
16393865–
16393991,
16394080–16394216,
16394300–
16394459,
16394532–16394816,
16394910–
16395164, and supported by full-length cDNA clone
RAFL07-16-F05 and pYM18-1 (AY344061), and
ESTs 175M23T7, BE526342, 84E8T7, BE844958,
pAZNII0788R,
APZ16c10R,
RAFL09-43-F19,
APZ74b02F. O. sativa Lls1(Pao) gene (scaffold
AAAA01000724); join complement bases 16095–
15707, 15609–15372, 15284–15158, 14631–14495,
14354–14195, 13993–13717, 13065–12811, and
supported by ESTs AA753785 and BI801593.
Z. mays Lls1(Pao) gene (U77346); join bases
3115–3764, 3854–4089, 4178–4304, 5480–5616,
5729–5888, 6119–6397, 6923–>7129, and supported by cDNA AAC49676, and ESTs AI979621,
AW065214, AW289039, BG265514. A. thaliana
Ptc52 gene At4g25650 (AL050400); join complement bases 13885–13370, 13246–13059, 12977–
12892, 12822–12638, 12555–12367, 12273–12083,
12008–11753, and supported by RT-PCR product
pYM20-1(AY344062). O. sativa Ptc52 gene (scaffold AAAA01007078); join complement bases 5663–
5151, 5072–4885, 4668–4566, 4449–4295, 4191–
3391, 3870–3683, 3514–3256, and supported by
ESTs AU181024, AU057990, BM421452. A. thaliana Cmo gene At4g29890 (BAC clone F27B13)
join bases 33446–33743, 33822–33867, 33945–
34080, 34174–34248, 34327–34542, 34627–34722,
34834–34955, 35036–35129, 35125–35265, 35349–
35483, and supported by ESTs BE526553, AI996605,
AV815748, AY090377. O. sativa Cmo gene (scaffold
AAAA01000729); join complement bases 36454–
36329, 35650–35605, 35390–35255, 34793–34719,
34633–34426, 34317–34222, 33942–33824, 33726–
33633, 33171–33122, 32673–32529.
Multiple sequence alignment and phylogenetic tree
analysis
Protein sequences were aligned with Clustal V within
the Megalign program (DNAStar, Madison, WI) and
with PAM250 residue weights. The PAUP 4.0b10
program (Swofford, 2002) was employed for the generation of phylogenetic trees and consensus cladograms with distance and parsimony optimality cri-
44
Figure 2. Detection of an LLS1(PAO)-like protein in vascular and
non-vascular plants. Western blot of protein samples isolated from
leaf tissue of the indicated species. A 20 µg portion of protein was
loaded per lane. Blots were probed with an anti-LLS1:MBP fusion
protein. Arrow indicates the location of the 52 kDa LLS1(PAO) protein from maize and similarly sized cross-reactive proteins in other
species.
teria respectively. Node support for these trees was
evaluated with the bootstrap method and was performed for 500 replicates. For parsimony trees all
characters were weighted equally. Starting trees were
obtained by random stepwise addition, and the treebisection-reconnection algorithm was used for branch
swapping. For distance trees the distance measure
was mean character difference; starting trees were
obtained by neighbor joining and the tree-bisectionreconnection algorithm. Bootstrap analysis with the
PAUP 4.0b10 program was performed on a Macintosh
G3 workstation or at the Ohio Supercomputer Cluster
(www.osc.edu).
Results and discussion
Lls1(Pao) belongs to a small family of non-heme
oxygenases in plants.
The relationship between the maize Lls1(Pao) genes in
different species was examined. An anti-LLS1(PAO)
monoclonal antibody was used to detect a unique
related protein not only in a selection of dicotyledonous woody and herbaceous plants but also in the
more primitive vascular plant Equisetum and the nonvascular moss Polytrichum (Figure 2). These results
indicate that an LLS1(PAO)-like protein is probably
present universally in land plants which is consistent
with its reported role in the opening of the tetrapyrrole
ring during chlorophyll detoxification (Hortensteiner,
1999; Hortensteiner et al., 2000).
The phylogenetic relationship of the Lls1(Pao)
gene to other plant genes was then examined by performing homology searches with plant EST databases
and the Arabidopsis and rice genomes. A survey of
these databases revealed that no more than five genes
in both Arabidopsis and rice contain the signature
Rieske (Motif A) and mononuclear (Motif B) ironbinding motifs exhibited by LLS1(PAO) (Gray et al.,
2002). The Arabidopsis Acd1 (At3g44880) gene is an
orthologue of the maize Lls1(Pao) gene (Yang et al.,
2004) which, in turn, is 30% identical to the product
of the Arabidopsis At4g25650 gene. The At4g25650
gene is highly homologous to the 52 kDa PTC52 gene
from barley which is proposed to encode a pchlide b
synthase activity in the chloroplast membrane (Reinbothe et al., in press). Two other genes are Cao and
Cmo, which have known functions in catalyzing Chl
b production and choline biosynthesis, respectively,
within the chloroplast compartment (Figure 1) (Burnet et al., 1995; Rathinasabapathi et al., 1997; Tanaka
et al., 1998; Espineda et al., 1999). There is a direct
duplication of the Cao gene in rice (Cao2) but it is
not clear if this is a functional gene or a pseudogene
(predicted coding region in Materials and methods).
The fifth gene is Tic55, which encodes an unknown
function in the inner chloroplast membrane but has
been found to be loosely associated with protein transport complex proteins (Caliebe et al., 1997). Pairwise
comparison of the coding regions of these genes shows
that each of the family members is conserved between
monocots and dicots, and that the five members are
distinct from one another (Figure 3A).
The completed Arabidopsis and rice plant genomic
sequences were used to compare the intron/exon structure of these genes so as to discern if any of these genes
are the result of a recent duplication event. The exact positions of introns were determined by alignment
of genomic DNA sequences with extant ESTs from
various databases (Figure 3B). In the case of A. thaliana Lls1(Pao) and Ptc52 genes, a full-length cDNA
was isolated and sequenced by RT-PCR. For three of
the five pairs of homologous genes (Lls1(Pao), Cao
and Cmo) the gene structure was conserved between
rice and Arabidopsis. In the case of the Chlamydomonas Cao gene on scaffold 8 (predicted gene 8.14),
for which a cDNA clone is known, the intron/exon
positions are also not shared with land plants (Figure 3B) as anticipated given the ancient origin of this
enzyme function (Tomitani et al., 1999). In the case
of Tic55, the Arabidopsis gene exhibits just two introns and there are none in rice. The Arabidopsis and
rice Ptc52 genes differ slightly in the size of exons
three and four but the positions of the introns are
conserved. However pairwise alignments of the exon
45
Figure 3. A. Pairwise sequence identity values of Arabidopsis and rice non-heme oxygenases. The coding regions of the plant genes depicted
in A (minus predicted transit peptides) were aligned with Clustal W (default parameters) and pairwise distance values tabulated as shown. B.
Gene structure of plant and algal non-heme oxygenases. Gene structure is shown as exons (blocks) joined by introns (lines). The conserved
Rieske and mononuclear iron-binding motifs are shown as hatched and shaded boxes. A third conserved motif of unknown function is shown
as a dotted box. Scale as shown. For intron/exon boundary and sequence information, see Materials and methods.
sequences did not reveal any conservation of intron
position between the five pairs of genes. This observation is particularly obvious in the vicinity of conserved
motifs (Figure 3B). The conservation of intron positions between the same gene family members but not
between different gene family members indicates that
all of these five genes had existed prior to monocot and
dicot divergence about 200 million years ago and thus
are not the result of a recent duplication event in land
plants. It is known that (LLS1)PAO and CAO activities are present in the algae Chlorella protothecoides
indicating a more ancient origin for these gene functions (Hortensteiner, 1999; Hortensteiner et al., 2000).
A preliminary examination of the Chlamydomonas reinhardtii draft genome reveals at least six non-heme
oxygenases other than Cao (predicted genes 37.24,
37.26, 41.13, 327.2, 2597.4, 282.0) with significant homology to Lls1(Pao), Tic55 and Ptc52 (but not
Cmo). Two of these genes appear to be the result
of a recent duplication event (predicted genes 37.24
and 37.26 on Scaffold 37) like the Cao1 and Cao2
genes in rice (data not shown). The absence of cDNAs to confirm gene structure precluded the analysis
of these genes in this study. The detection of these
genes in a eukaryotic alga, however, suggests that the
46
roles of these genes evolved prior to the transition to a
terrestrial habitat.
Conservation of iron-binding centers in
LLS1(PAO)-related non-heme oxygenases
Homologues of LLS1(PAO)-like plant non-heme oxygenases are also found in cyanobacteria indicating that
these gene functions may have existed prior to the
evolution of algae (Gray et al., 1997, 2002). This
is clearly true for the Cao gene, which has been
demonstrated to be present in the Chl b-containing
cyanobacteria Prochloron didemniii and Prochloron
hollandica (Moreira et al., 2000). However, the hypothesis that the Cao gene has a monophyletic origin
for all chlorophyll b-producing organisms (Tomitani
et al., 1999) has been questioned by the absence of
a convincing Cao homologue in the genomes of two
Prochlorococcus strains (Hess et al., 2001). A single
non-heme oxygenase with Rieske and mononuclear
motifs is encoded by these genomes but its relationship to Cao or other non-heme oxygenases has not
been defined (Hess et al., 2001).
To define the evolutionary and possible functional
relationships of plant LLS1(PAO)-like oxygenases to
other non-heme oxygenases, a phylogenetic analysis
of 95 related proteins from a wide spectrum of species was performed. Reiterative BLAST searches revealed that the LLS1(PAO)-like oxygenases share the
iron-binding motifs exhibited by the oxygenase components of multicomponent bacterial aromatic ringhydroxylating (ARH) enzymes (Pfam00484) (Neidle
et al., 1991). The Nam classification system categorized 54 different ARH enzymes into 4 groups based
on pairwise alignment scores and the separation of
key amino acid residues in the consensus Rieske type
and mononuclear-type iron-binding sites (Nam et al.,
2001). Plant and cyanobacterial LLS1(PAO)-like oxygenases were not included in the development of that
Nam classification system, but this sequence-based
classification system easily facilitates the phylogenetic
comparison with novel related proteins (where information on subunit composition is not yet known). At
least four members from each of the ARH groups were
selected for inclusion in our phylogenetic analysis and
designated NG1 (Nam Group 1) to NG4 following
their names in Figures 4–7.
In order to meaningfully align a larger set of 95
oxygenases from a broader variety of species than has
been previously considered, an operational taxonomic
unit that was less than the entire protein was chosen.
In addition, the plant proteins exhibited transit peptide
sequences that were not present in bacterial proteins.
In a region of each protein comprising the two highly
conserved iron binding motifs and the variable intervening region, it was feasible to align all 95 proteins
with the ClustalW algorithm program (Figure 4A–B
and Supplementary Figure 1). An examination of the
pairwise distance values indicated that it was possible
to place the bacterial dioxygenases into the same four
groupings as Nam although different percent similarities were used as cutoff points (data not shown). In
agreement with the Nam classification system all proteins exhibited a Rieske-type [2Fe-2S] cluster binding
site that could be expressed as Cys-X1 -His-X16−18 Cys-X2 -His (Figure 4A). In addition, an arginine
immediately adjacent to the first histidine, and two
aromatic residues in the vicinity of the second histidine, were nearly universally conserved within this
motif (Figure 4A). The mononuclear Fe2+ -binding
site in ARH enzymes can be expressed as Glu-X3−4 Asp-X2 -His-X3−5 -His (Jiang et al., 1996; Nam et al.,
2001). According to the Nam classification system, the
plant oxygenases CAO and TIC55 exhibit a spacing of
residues in both motifs that matches that of vanillate
demethylases such as VanA(19151) in Nam group 1
(Figure 4B and Supplementary Figure 1). The spacing
of residues within the mononuclear Fe2+ -binding motif for LLS1(PAO) and PTC52 is also similar to Nam
group 1 proteins, except that there is a 17 residue
spacing at the center of the Rieske motif which is
seen in Nam groups 2, 3 and 4 and gene 7970 from
Burkholderia fungorum.
In contrast, the residue spacings and alignments
within these motifs for CMO oxygenases do not match
any of the Nam groupings precisely. In particular the
CMO group is unique amongst all the oxygenases examined in having three residues between the aspartate
and the first histidine residue of the mononuclear ironbinding motif (Figure 4B). In addition, plant CMO
proteins are distinguished from other plant oxygenases
in that they each exhibit the NWK triplet that is always conserved 7 residues prior to motif B in Nam
groups 2, 3 and 4 (Figure 4B and Supplementary
Figure 1). An examination of the crystal structure
of NDO indicates that the NWK triplet is between
the I191 and P198 residues that line the pocket below the active site (Kauppi et al., 1998). A number
of other predicted oxygenases from bacteria also do
not fit easily into four groupings of the Nam classification system including gene 1092 from Ralstonia
metalidurans, gene 2224 from Ralstonia solancearum
47
Figure 4. Multiple sequence alignment of conserved iron-binding sites of selected representative plant and bacterial non-heme oxygenases (an
alignment of all 95 oxygenases used in this study is provided in Supplementary Figure 1). The alignment was performed with a region of each
protein spanning both Rieske [2Fe-2S] and mononuclear Fe2+ iron-binding motifs as the operational taxonomic unit (start and end residues are
shown and the distance between motifs is shown in the central column). Sequences were aligned with the CLUSTAL W program and a PAM250
weight matrix, a gap penalty of 8, and a gap length penalty of 10. Other settings were default. Strictly conserved residues are shaded gray and
other highly conserved residues are shown in reverse type. Proteins are listed according to their gene name or gene number (Supplementary
Tables 1 and 2), followed by the abbreviated species and strain number in parenthesis. Plant oxygenases are shaded black and cyanobacterial
oxygenases are shaded gray.
48
Figure 5. Evolutionary relationships among plant, cyanobacterial and bacterial proteins containing Rieske and mononuclear iron-binding
motifs. Partial phylogenetic tree of 95 non-heme oxygenases estimated with the weighted neighbor joining distance method. The excluded tree
branches are shown in Figure 6 and are connected to this figure by a dotted line. Phylogenetic tree was estimated from the alignment represented
in Supplementary Figure 1. Branch lengths are proportional to the expected number of amino acid substitutions per site (values shown above
center of each branch; for parameters, see Materials and methods). The reliability of each bifurcation was estimated using bootstrap analysis
(percentage values over 50% are shown encircled next to nodes, values less than 50% are not shown), and the support for each of the branches
is indicated by line thickness. The tree is unrooted with OXOO and CARAa as a monophyletic outgroup. Plant oxygenases are shaded black
and cyanobacterial oxygenases are shaded gray.
GMI1000, gene 4529 from Burkholderia fungorum
and gene 1360 from Novosphingobium europea.
Lls1(Pao)-like genes are related to non-heme
oxygenases in aerobic photosynthesizers
In order to characterize the evolutionary relationships
between the aforementioned proteins, phylogenetic
trees were estimated using both distance and parsimony criteria (Figures 5 and 6 and Supplementary
Figure 1). A comparison between trees obtained using
both of these methods is useful in discerning reliable
phylogenetic relationships (Hall, 2001). A comparison of the two trees obtained in this study shows
correlative branching, and most unreliable bifurca-
49
Figure 6. Evolutionary relationships among cyanobacterial and bacterial proteins containing Rieske and mononuclear iron-binding motifs.
Partial phylogenetic tree of 96 non-heme oxygenases estimated with the weighted neighbor joining distance method. Tree branches shown are
connected to those in figure 5 by a dotted line. Phylogenetic trees were estimated from the alignment represented in Supplementary Figure 1.
Plant oxygenases are shaded black and cyanobacterial oxygenases are shaded gray.
tions (bootstrap values <50%) seen in the distance
tree (Figures 5 and 6) are reduced to polytomies in
the parsimony tree (Supplementary Figure 1). Using a distance-based method for tree construction recapitulated the groupings determined by Nam et al.
(2001) for bacterial ARH enzymes (Figures 5 and
6). Nam groups 2, 3 and 4 form distinct clades supported by reliable forks with subclades that include
carbazole (CarAa), dioxin (DxnA1), and aniline dioxygenase (Tdn1) (Figure 6). The inclusion of more,
recently discovered ARH-type enzymes reveals that
most cluster within a major division of all the enzymes that includes Nam group I ARHs as evidenced
by a basal polytomy for this major clade (Supplementary Figure 2). This group includes a diverse set of
enzymes to which the majority of plant and cyanobacterial oxygenases are more closely related. Within
this larger group, LLS1(PAO) and PTC52 form a
distinct grouping that includes 11 cyanobacterial pro-
teins. Likewise, TIC55 and CAO homologues each
form clades that include two cyanobacterial proteins.
The failure of the single dioxygenase from Prochlorococcus species strains CCMP1378 and MIT9313 to
cluster near CAO is in agreement with the observations of Hess et al. (2001), who propose that
these enzymes may have arisen by convergent evolution. Enzymes related to vanillate demethylase form
a clade that does not include any plant or cyanobacterial enzymes. The remainder of this major group
include four cyanobacterial genes that may encode a
chlorobenzoate dioxygenase-like function and a fifth
cyanobacterial enzyme related to a dioxygenase involved in the synthesis of the aromatic ring-containing
antibiotic pyrrolnitrin encoded by Pseudomonas and
Myxococcus species.
50
Figure 7. Evolutionary relationships among LLS1(PAO)-like plant and cyanobacterial non-heme oxygenases. A. Unrooted phylogram of
concensus tree of 25 LLS1(PAO)-related oxygenases estimated using neighbor joining distance method and bootstrap analysis. A total of
25 non-heme oxygenases containing the motif in described in B were aligned with the latter 75% of each protein length as the operational
taxonomic unit (the Rieske motif to the carboxyl terminus). Branch lengths are proportional to the expected number of amino acid substitutions
per site (values shown next to each branch). The reliability of each bifurcation was estimated using bootstrap analysis (percentage values over
50% are shown encircled next to nodes, values less than 50% are not shown). B. A novel conserved motif defines a set of closely related
LLS1(PAO)-like proteins in cyanobacteria and plants. Examination of phylogenetic trees (Figure 3) revealed a clade of proteins related to
LLS1(PAO) that share a concensus motif that can be defined as D/E/N-x-F/Y/W-x2 -H-x3 -C-x2 -C. This motif is found at a common distance
of 82–84 amino acids from the carboxyl terminus of these proteins. The last sequence is from a 110 amino acid ORF from Nostoc (all0986),
in which the motif is found near the center of the predicted protein. Plant oxygenases are shown in white text against a black background and
cyanobacterial oxygenases are shown in black text against a gray background.
A separate origin for CMO amongst non-heme
oxygenases of soil-dwelling bacteria
The distance tree structure indicates that plant CAO,
LLS1(PAO), TIC55 and PTC52 proteins are more
closely related to Nam group1 oxygenases whereas
CMO is more closely related to oxygenases from Nam
Groups 2 to 4. Within the second large clade CMO
forms a small clade that does not include any strong
bacterial homologues which reflects the fact that the
51
use of a dioxygenase in the first step of glycine betaine
synthesis is provided by alternative enzymes in bacteria (Rathinasabapathi et al., 1997; Incharoensakdi
and Wutipraditkul, 1999). None of the six Lls1(Pao)related genes from C. reinhardtii genes show significant homology to Cmo (data not shown) which was
anticipated because this algae synthesizes glycerol
and not glycine betaine in response to hyperosmotic
shock (Rosa and Galvan, 1995). Strong homologues
of CMO were not identified in any cyanobacterial species, and gene 1261 from Synechococcus sp WH8102
is the only cyanobacterial protein that falls within this
second major clade. Gene 1261 is the only cyanobacterial oxygenase that exhibits the NWK tripeptide
immediately prior to motif B (Figure 4), but otherwise it does not show strong homology to CMO. It
appears that CMO, whose substrate is not aromatic,
has an evolutionary origin distinct from all other plant
oxygenases and its closer relatedness to bacterial ARH
enzymes is suggestive of the recruitment of an oxygenase upon horizontal transfer from a soil-dwelling
bacterium to a plant. The existence of the unique Synechococcus sp. WH8102 gene 1261 and the fact that
most plants are not known to accumulate significant
amounts of glycine betaine despite the presence of a
Cmo homologue is enigmatic. The reported inability
of the Arabidopsis Cmo homologue to exhibit CMO
activity in Escherichia coli (Hibino et al., 2002) is
most likely the result of a mutated PCR product used
in that study because the mutated residue I371V is
conserved across species and is not observed in extant
Arabidopsis ESTs. It is possible that glycine betaine
accumulates at very low levels in many plants, or that
it accumulates only under unusual osmotic stress conditions. Alternatively, it is possible that these plants
have alternative mechanisms to resist osmotic stress
or that these genes encode a related function that has
not yet been discovered.
Lls1(Pao), Tic55 and Ptc52 are closely related to
genes in oxygenic cyanobacteria
Phylogenetic analysis revealed a tight clustering of the
plant LLS1(PAO), TIC55 and PTC52 proteins with a
set of predicted proteins from marine and freshwater cyanobacteria (Figure 5). A closer examination of
these proteins revealed that they share an extended
carboxyl terminus that is ca. 120 amino acids longer
than that in CAO and CMO proteins. The stronger
sequence homology between these proteins permitted
the alignment of all 25 sequences in a region from the
Rieske motif to the end of each protein as the operational taxonomic unit (amino terminus sequences that
contain choroplast signal peptides were not present in
the cyanobacterial homologues). An unrooted phylogenetic tree estimated with a distance method reveals
a largely equidistant relationship between these cyanobacterial and plant proteins (Figure 7A). Plant
LLS1(PAO) and PTC52 proteins are slightly more related to gene 1779 from the marine cyanobacterium
Trichodesmium erythraeum and gene 4354 from the
freshwater cyanobacterium Nostoc sp. PCC7120 than
they are to the clade that includes gene 1747 from Synechocystis sp. PCC6803. The plant TIC55 proteins are
more related to gene 5007 from Nostoc sp. PCC7120
and gene 2180 from Nostoc punctiforme. The remaining five proteins from cyanobacteria form two clades
each containing a member from Trichodesmium erythraeum and Nostoc sp. PCC7120. The short basal
branches at the center of this tree indicate that these
25 proteins are closely related and likely to be derived
from a common ancestor. In support of this interpretation is the existence within the extended terminus of
these proteins of a third motif that is strictly conserved
(Figure 7B). This motif of unknown function contains
two aromatic amino acids and two cysteine residues
and can be summarized by the consensus sequence
F/Y/W-x2 -H-x3-C-x2 -C (Figure 7B). A search for this
motif within all non-redundant proteins in Genbank
was negative. A survey of the Nostoc genome, however, revealed a small ORF (all0956) that is predicted
to contain a 110 amino acid protein that also contains
this motif (Figure 7b). Closer examination reveals that
this gene may be slightly longer and have further homology to LLS1(PAO) but does not contain the two
motifs shared by this group of proteins. Further analysis is required to determine if all0956 is expressed
or if it is a relic gene fragment.
Neither homologues to the Lls1(Pao) gene or proteins containing this third motif were identified in a
survey of the complete genome of the photosynthetic
bacterium Chlorobium tepidum TLS. C. tepidum is a
thermophilic green sulfur bacterium and is strictly anaerobic and obligatorily autotrophic. This bacterium
synthesizes bacteriochlorophyll c and carotenoids for
light harvesting but utilizes hydrogen and various sulfur compounds as terminal electron acceptors and
not dioxygen. An anaerobic environment negates
the possibility of using dioxygen-requiring enzymes
in metabolism but not necessarily the requirement
for redox-sensing proteins. Homologues of Lls1(Pao)
were found in the genomes of all oxygenic cyanobac-
52
teria examined with the exception of both strains of
Prochlorococcus marinus. Thus, although the presence of LLS1(PAO)-like proteins correlates strongly
with the emergence of oxygenic photosynthesis they
are not requisite for photosynthesis itself. These proteins may have evolved to allow aerobic photosynthesizers organisms to adapt and become fine-tuned to the
wide variety of oxygen and light levels that exist in the
water and on land (Ting et al., 2002). All chlorophyll
b-containing organisms are aerobic and the utilization
of dioxygen for the synthesis of Chl b and pchlide b by
CAO and PTC52 were significant adaptations for light
harvesting by aerobic photosynthesizers (Tanaka et al.,
2001). Since most of the cyanobacteria examined in
this study do not synthesize Chl b, the function of
Lls1(Pao)-related genes in these species may indicate
a role in the removal of Chl which is a potent phototoxin in aerobic environments. It is known that algae
exhibit an LLS1/PAO activity but this has not yet been
reported in cyanobacteria which may use excretion as
the mechanism of chlorophyll detoxification (Miller
and Holt, 1977; Richaud et al., 2001). Finally, the
fact that 3 out of 4 Lls1(Pao)-related genes appear
to have a Chl related function is suggestive that the
TIC55 protein also plays a hitherto unsuspected role
in Chl metabolism which is not mutually exclusive
from a proposed redox regulatory role in the chloroplast (Küchler et al., 2002). One possibility is that
TIC55 catalyzes Chl b to Chl a conversion – an enzyme activity that has been reported in plants but for
which the corresponding gene has not been isolated
(Rudoi and Shcherbakov, 1998; Beale, 1999). Chl
degradation products may also serve as intracellular
signals during development and stress responses and
thus indirectly influence the import of proteins into
the chloroplast (Küchler et al., 2002). The finding in
this study that TIC55, LLS1(PAO) and PTC52 share
a common C-terminus motif with conserved cysteine
residues may lend further support to the hypothesis of
Küchler et al. (2002). Redox-regulated proteins exhibit conserved cysteine residues (Kobayashi and Ito,
1999; Kuge et al., 2001), and a recent proteomics
study identified many previously unsuspected targets
of thioredoxin regulation in the chloroplast stroma
(Yano et al., 2002; Balmer et al., 2003). Although
the C-terminus motifs of LLS1(PAO), TIC55 and
PTC52 exhibit a CxxC motif conserved in the catalytic site of thiol:disulfide oxidoreductases (Chivers
et al., 1997), the surrounding amino acids do not
suggest a thioredoxin-like fold. Further insights into
the functions of LLS1(PAO)-related proteins in plants
and their shared motifs are currently being sought
by studying knockouts of the homologous proteins in
cyanobacteria that were identified in this study.
Classification of LLS1(PAO)-related non-heme
oxygenases based on conserved iron-bonding motifs
The phylogenetic analysis by distance and parsimony methods that we performed supports the reclassification of dioxygenases by Nam et al. (2001)
and the use of a smaller, more widely conserved
operational taxonomic unit was successful in recapitulating the major groupings that they reported. The
analysis of a much larger group of genes indicates
however that further sub-classification may be required in future categorization of these enzymes. In
particular, it is clear that Nam group I dioxygenases
include diverse enzymes with non-phenolic substrates
as exemplified by LLS1(PAO), CAO and PTC52. The
phylogenetic tree that was estimated using parsimony
(Supplementary Figure 1) shows 15 clades branching
from a common polytomy that includes all group I
enzymes (including CarAa and OxoO). Newly discovered members of this large group may be assigned
a category based on clustering nearest to a group of
proteins with a known substrate type. Thus, class
IA would include enzymes clustering near genes encoding vanillate demethylase (VanA), chlorobenzoate
dioxygenase(CbaA) or phthalate dioxygenase (Pht3),
which act on phenolic compounds. This class would
include enzymes such as aminopyrrolnitrin D oxidase (PrnD), which catalyzes oxidation of the amino
side group of the aromatic ring of aminopyrrolnitrin
to a nitro group in the biosynthesis of the antibiotic pyrrolnitrin. Indeed, many of the dioxygenases in
this group have been shown to have broad specificity,
but are unified in that they act on phenolic compounds. Subclass IA would include carbazole 1,9adioxygenase (from Pseudomonas strain CA10) and
2-oxo-1,2-dihydroquinoline 8-monooxygenase (from
Pseudomonas strain 86). It was found that these two
enzymes grouped separately from other group I enzymes when using the shorter amino acid sequence
as operational taxonomic subunit, but they were more
clearly classified when the full-length protein was used
in the analysis. Subclass 1B would include CAO enzymes from various sources which use chlorophyll a
(a cyclic tetrapyrrole) as a substrate. The unique oxygenases from Prochlorococcus strains CCMP1378 and
MIT9313, are tentatively assigned in this subclass if
they can be shown to act on divinyl Chl a as a sub-
53
strate. Prochlorococcus, like other prochlorophytes, is
defined by its production of Chl b, and it has been
proposed that there is a single origin of CAO (Tomitani et al., 1999). Our alignments suggest that these
oxygenases may have originated from a Nam group Itype enzyme, but convergent evolution from a Rieske
domain protein is a plausible alternative explanation.
Prochlorococcus may have evolved in iron-limited
oceans and diversified from other cyanobacteria from
a common phycobilisome-containing ancestor (Ting
et al., 2002). The fact that these species produce unusual divinyl Chl derivatives in order to occupy a different ecological niche could account for the observed
sequence differences in a CAO-like enzyme.
Subclass IC could include all LLS1(PAO) related
enzymes (including PTC52 and TIC55) that exhibit
the third motif identified in Figure 7B until definitive
substrates are defined for all these enzymes. If these
enzymes all share a chlorophyll intermediate as substrate then it may be appropriate to combine them with
CAO in subclass 1B. It is clear that CMO-like proteins
form a distinct clade separate from Nam Groups I to
IV and we propose a new group V (Figure 6), whose
members are closely related to the monooxygenase
from spinach, which uses choline as substrate. Finally,
a clade of 9 oxygenases with unknown substrates that
also group separately from Nam groups I to IV may
be designated as class VI (Figure 6). These suggested classifications build on the groupings defined by
Nam et al. (2001) using phylogenetic analysis, which
continues to be a useful classification system in the
absence of subunit or substrate information.
Conclusions
In conclusion, our analysis indicates that LLS1(PAO)
belongs to a small but diverse group of non-heme
oxygenases in plants. Of these, CMO homologues
have evolved recently in higher plants although their
conservation in plants such as Arabidopsis, which
is not known to accumulate glycine betaine, suggests another alternative function in most plants. In
contrast, LLS1(PAO)-related non-heme oxygenases
including PTC52, TIC55 and CAO appear to have
evolved amongst oxygenic cyanobacteria that synthesize chlorophyll but are not required in all such species
such as Prochlorococcus marinus. The presence of
a novel C-terminus motif with conserved cysteine
residues suggests that LLS1(PAO), TIC55 and PTC52
may share similar redox-regulation connected with
chlorophyll metabolism in the chloroplast. Finally, our
extensive phylogenetic analysis of LLS1(PAO) related
non-heme oxygenases provides a useful reference for
future classification of these enzymes.
Acknowledgements
We thank Scott Leisner for helpful discussion and advice on this manuscript. Funding for this research was
provided by the U.S. Department of Agriculture (grant
2000–01465 to J.G.) and by the University of Toledo
(laboratory startup funds to J.G.). We thank Stefan
Hörtensteiner (University of Bern, Switzerland) for
sharing results prior to publication.
References
Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J.H., Zhang,
Z., Miller, W. and Lipman, D.J. 1997. Gapped BLAST and PSIBLAST: a new generation of protein database search programs.
Nucl. Acids Res. 25: 3389–3402.
Balmer, Y., Koller, A., del Val, G., Manieri, W., Schurmann, P. and
Buchanan, B.B. 2003. Proteomics gives insight into the regulatory function of chloroplast thioredoxins. Proc. Natl. Acad. Sci.
USA 100: 370–375.
Batie, C.J., Ballou, D.P. and Correll, C.C. 1991. Phthalate dioxygenase reductase and related flavin-iron sulfur containing
electron transferases. Chem. Biochem. Flavoenzymes 3: 543–
556.
Beale, S.I. 1999. Enzymes of chlorophyll biosynthesis. Photosyn.
Res. 60: 43–73.
Burnet, M., Lafontaine, P.J. and Hanson, A.D. 1995. Assay, purification and partial characterization of choline mononxygenase
from spinach. Plant Physiol. 108: 581–588.
Caliebe, A., Grimm, R., Kaiser, G., Lubeck, J., Soll, J. and Heins,
L. 1997. The chloroplastic protein import machinery contains a
Rieske-type iron-sulfur cluster and a mononuclear iron-binding
protein. EMBO J. 16: 7342–7350.
Cheng, W.-H., Im, K.H. and Chourey, P.S. 1996. Sucrose phosphate synthase expression at the cell and tissue level is coordinated with sucrose sink-to-source transitions in maize leaf.
Plant Physiol. 111: 1021–1029.
Chivers, P.T., Prehoda, K.E. and Raines, R.T. 1997. The CXXC
motif: a rheostat in the active site. Biochemistry 36: 4061–4066.
Espineda, C.E., Linford, A.S., Devine, D. and Brusslan, J.A. 1999.
The AtCAO gene, encoding chlorophyll a oxygenase, is required
for chlorophyllb synthesis in Arabidopsis thaliana. Proc. Natl.
Acad. Sci. USA 96: 10507–10511.
Gray, J., Close, P.S., Briggs, S.P. and Johal, G.S. 1997. A novel
suppressor of cell death in plants encoded by the Lls1 gene of
maize. Cell 89: 25–31.
Gray, J., Janick-Buckner, D., Buckner, B., Close, P.S. and Johal,
G.S. 2002. Light-dependent death of maize lls1 cells is mediated
by mature chloroplasts. Plant Physiol. 130: 1–14.
Hall, B.G., 2001. Phylogenetic Trees Made Easy: A How-To
Manual for Molecular Biologists. Sinauer, Sunderland, MA.
Harayama, S., Kok, M. and Neidle, E.L. 1992. Functional and evolutionary relationships among diverse oxygenases. Annu. Rev.
Microbiol. 46: 565–601.
54
Hess, W.R., Rocap, G., Ting, C.S., Larimer, F., Stilwagen, S., Leamerdin, J. and Chisholm, S.W. 2001. The photosynthetic apparatus
of Prochlorococcus: insights through comparative genomics.
Photosyn. Res. 70: 53–71.
Hibino, T., Waditee, R., Araki, E., Ishiwaka, H., Kenji, A., Tanaka,
Y. and Takebe, T., 2002. Functional characterization of choline
monooxygenase, an enzyme for betaine synthesis in plants. J.
Biol. Chem. 277: 41352–41360.
Hortensteiner, S., 1999. Chlorophyll breakdown in higher plants and
algae. Cell. Mol. Life Sci. 56: 330–347.
Hortensteiner, S., Chinner, J., Matile, P., Thomas, H. and Donnison,
I.S. 2000. Chlorophyll breakdown in Chlorella protothecoides:
characterization of degreening and cloning of degreening-related
genes. Plant Mol. Biol. 42: 439–450.
Incharoensakdi, A. and Wutipraditkul, N. 1999. Accumulation of
glycinebetaine and its synthesis from radioactive precursors under salt-stress in the cyanobacterium Aphanothece halophytica.
J. Appl. Phycol. 11: 515–523.
Jiang, H., Parales, R.E., Lynch, N.A. and Gibson, D.T., 1996. Sitedirected mutagenesis of conserved amino acids in the alpha subunit of toluene dioxygenase: potential mononuclear non-heme
iron coordination sites. J. Bact. 178: 3133–3139.
Karlsson, A., Parales, J.V., Parales, R.E., Gibbon, D.T., Eklund,
H. and Ramaswamy, S. 2003. Crystal structure of naphthalene
dioxygenase: side-on binding of dioxygen to iron. Science 299:
1039–1042.
Kauppi, B., Lee, K., Carredano, E., Parales, R., Gibson, D.T.,
Eklund, H. and Ramaswamy, S. 1998. Structure of an aromaticring-hydroxylating dioxygenase – naphthalene 1,2 dioxygenase.
Structure 6: 571–586.
Kobayashi, T. and Ito, K., 1999. Respiratory chain strongly oxidizes
the CXXC motif of DsbB in the Escherichia coli disulfide bond
formation pathway. EMBO J. 18: 1192–1198.
Küchler, M., Decker, S., Hörmann, F., Soll, J. and Heins, L.
2002. Portein import into chloroplasts involves redox-regulated
proteins. EMBO J. 21: 6136–6145.
Kuge, S., Arita, M., Murayama, A., Maeta, K., Izawa, S., Inoue,
Y. and Nomoto, A. 2001. Regulation of the yeast Yap1p nuclear export signal is mediated by redox signal-induced reversible
disulfide bond formation. Mol. Cell. Biol. 21: 6139–6150.
Lange, S. J. and Que, L. Jr. 1998. Oxygen activating nonheme iron
enzymes. Curr. Opin. Chem. Biol. 2: 159–172.
Mason, J.R. and Cammack, R. 1992. The electron-transport proteins
of hydroxylating bacterial dioxygenases. Annu. Rev. Microbiol.
46: 277–305.
Miller, L.S. and Holt, S.C. 1977. Effect of carbon dioxide on pigment and membrane content in Synechococcus lividus. Arch.
Microbiol. 115: 185–198.
Moraswki, B., Segura, A. and Ornston, L.N. 2000. Substrate range
and genetic analysis of Acinetobacter vanillate demethylase. J.
Bact. 182: 1383–1389.
Moreira, D., Guyader, H.L. and Phillipe, H. 2000. The origin of red
algae and the evolution of chloroplasts. Nature 405: 69–72.
Nam, J.-W., Nojiri, H., Yoshida, T., Habe, H., Yamane, H. and
Omori, T. 2001. New classification system for oxygenase components involved in ring-hydroxylating oxygenations. Biosci.
Biotechnol. Biochem. 65: 254–263.
Neidle, E.L., Hartnett, C., Ornston, L.N., Bairoch, A., Rekik, M.
and Harayama, S. 1991. Nucleotide sequences of the Acinetobacter calcoaceticus benABC genes for benzoate 1,2-dioxygenase
reveal evolutionary relationships among multicomponent oxygenases. J. Bact. 173: 5385–5395.
Prescott, A.G. and Lloyd, M.D. 2000. The iron(II) and 2-oxoaciddependent dioxygenases and their role in metabolism. Nat. Prod.
Rep. 17: 367–383.
Rathinasabapathi, B., Burnet, M., Russell, B.L., Gage, D.A., Liao,
P.-C., Nye, G.J., Scott, P., Golbeck, J.H. and Hanson, A.D. 1997.
Choline monooxygenase, an unusual iron-sulfur enzyme catalyzing the first step of glycine betaine synthesis in plants: prosthetic
group characterization and cDNA cloning. Proc. Natl. Acad. Sci.
USA 94: 3454–3458.
Richaud, C., Zabulon, G., Joder, A. and Thomas, J.-C., 2001. Nitrogen or sulfur starvation differentially affects phycobilisome
degradation and expression of the nblA gene in Synechocystis
strain PCC 6803. J. Bact. 183: 2989–2994.
Rosa, L. and Galvan, F. 1995. Metabolic pathway for glycerol
synthesis under osmotic stress in the freshwater green alga
Chlamydomonas reinhardtii. Plant Physiol. Biochem. 33: 213–
218.
Rudoi, A.B. and Shcherbakov, R.A., 1998. Analysis of the chlorophyll biosynthetic system in a chlorophyll b-less barley mutant.
Photosyn. Res. 58: 71–80.
Ryle, M.J. and Hausinger, R.P. 2002. Non-heme iron oxygenases.
Curr. Opin. Chem. Biol. 6: 193–201.
Tanaka, A., Ito, H., Tanaka, R., Tanaka, N., Yoshida, K. and Okada,
K. 1998. Chlorophyll a oxygenase is involved in chlorophyll b
formation from chlorophyll a. Proc. Natl. Acad. Sci. USA 95:
12719–12723.
Tanaka, R., Koshino, Y., Sawa, S., Ishiguro, S., Okada, K.
and Tanaka, A. 2001. Overexpression of chlorophyllide a oxygenase (CAO) enlarges the antenna size of photosystem II in
Arabidopsis thaliana. Plant J. 26: 365–373.
Ting, C.S., Rocap, G., King, J. and Chisholm, S.W. 2002.
Cyanobacterial photosynthesis in the oceans: the origins and
significance of divergent light-harvesting strategies. Trends Microbiol. 10: 134–142.
Tomitani, A., Okada, K., Miyashita, H., Matthijs, H.C. and Ohno,
T. 1999. Chlorophyll b and phycobilins in the common ancestor
of cyanobacteria and chloroplasts. Nature 400: 159–162.
Yang, M., Wardzala, E., Johal, G.S. and Gray, J. 2004. The
wound-inducible Lls1 gene from maize is an ortholog of the
Arabidopsis Acd1 gene, and the LLS1 protein is present in
non-photosynthetic tissues. Plant Mol Biol. 54: 175–191.
Yano, H., Kuroda, S. and Buchanan, B.B. 2002. Disulfide proteome
in the analysis of protein function and structure. Proteomics 2:
1090–1096.