0013-7227/06/$15.00/0
Printed in U.S.A.
Endocrinology 147(4):1621–1631
Copyright © 2006 by The Endocrine Society
doi: 10.1210/en.2005-1373
Agouti-Related Protein Is Posttranslationally Cleaved by
Proprotein Convertase 1 to Generate Agouti-Related
Protein (AGRP)83–132: Interaction between AGRP83–132
and Melanocortin Receptors Cannot Be Influenced by
Syndecan-3
John W. M. Creemers,* Lynn E. Pritchard,* Amy Gyte, Philippe Le Rouzic, Sandra Meulemans,
Sharon L. Wardlaw, Xiaorong Zhu, Donald F. Steiner, Nicola Davies, Duncan Armstrong,
Catherine B. Lawrence, Simon M. Luckman, Catherine A. Schmitz, Rick A. Davies, John C. Brennand,
and Anne White
Department of Human Genetics (J.W.M.C., S.M.), University of Leuven and Flanders Interuniversity Institute for
Biotechnology, B-3000 Leuven, Belgium; School of Medicine (L.E.P., A.G., A.W.) and Faculty of Life Sciences (L.E.P., A.G.,
P.L.R., N.D., C.B.L., S.M.L., A.W.), University of Manchester, Manchester M13 9PT, United Kingdom; Department of
Medicine (S.L.W.), Columbia University College of Physicians and Surgeons, New York, New York 10032; Department of
Biochemistry and Molecular Biology (X.Z., D.F.S.), University of Chicago, Chicago, Illinois 60637; and AstraZeneca (D.A.,
C.A.S., R.A.D., J.C.B.), Mereside, Cheshire SK10 4TG, United Kingdom
Agouti-related protein (AGRP) plays a key role in energy homeostasis. The carboxyl-terminal domain of AGRP acts as an
endogenous antagonist of the melanocortin-4 receptor (MC4R). It has been suggested that the amino-terminal domain of
AGRP binds to syndecan-3, thereby modulating the effects of
carboxyl-terminal AGRP at the MC4-R. This model assumes
that AGRP is secreted as a full-length peptide. In this study we
found that AGRP is processed intracellularly after Arg79Glu80-Pro81-Arg82. The processing site suggests cleavage by
proprotein convertases (PCs). RNA interference and overexpression experiments showed that PC1/3 is primarily responsible for cleavage in vitro, although both PC2 and PC5/6A can
also process AGRP. Dual in situ hybridization demonstrated
that PC1/3 is expressed in AGRP neurons in the rat hypothalamus. Moreover, hypothalamic extracts from PC1-null mice
T
HERE IS LITTLE doubt that the melanocortin-4 receptor
(MC4-R) plays an important role in coordinating appetite and metabolic rate with perceived metabolic requirement (reviewed in Ref. 1). In this regard, two sets of neurons
in the hypothalamic arcuate nucleus are particularly important: a) Proopiomelanocortin (POMC) neurons, which generate endogenous ligands for the MC4-R such as ␣MSH and
ACTH (2), and agouti-related peptide (AGRP)/neuropeptide Y neurons, which generate AGRP, an endogenous MCR
antagonist (3, 4). Both sets of neurons are sensitive to a wide
range of peripheral signals that indicate metabolic status,
First Published Online December 29, 2005
* J.W.M.C. and L.E.P. contributed equally to this work.
Abbreviations: AGRP, Agouti-related peptide; ISH, in situ hybridization; MCR, melanocortin-4 receptor; PC, proprotein convertase; pKb,
affinity of the antagonist; POMC, proopiomelanocortin; sh, short hairpin; shRNAi, shRNA interference; SSC, sodium saline citrate.
Endocrinology is published monthly by The Endocrine Society (http://
www.endo-society.org), the foremost professional society serving the
endocrine community.
contained 3.3-fold more unprocessed full-length AGRP, compared with wild-type mice, based on combined HPLC and RIA
analysis, demonstrating that PC1/3 plays a role in AGRP cleavage in vivo. We also found that AGRP83–132 is more potent an
antagonist than full-length AGRP, based on cAMP reporter
assays, suggesting that posttranslational cleavage is required
to potentiate the effect of AGRP at the MC4-R. Because AGRP
is cleaved into distinct amino-terminal and carboxyl-terminal
peptides, we tested whether amino-terminal peptides modulate food intake. However, intracerebroventricular injection
of rat AGRP25– 47 and AGRP50 – 80 had no effect on body weight,
food intake, or core body temperature. Because AGRP is
cleaved before secretion, syndecan-3 must influence food intake independently of the MC4-R. (Endocrinology 147:
1621–1631, 2006)
such as leptin, insulin, glucocorticoids, and gut hormones (5,
6). AGRP expression is up-regulated in situations of negative
energy balance (3, 4, 7–9). Also, genetic manipulation of
AGRP expression levels (4, 10, 11) and physiological experiments (12–15) demonstrate that AGRP has a potent and
long-term anabolic effect on food intake and metabolic rate.
Neuroanatomical data and pharmacological studies support
the view that AGRP has this effect because it acts as a competitive antagonist at the MC4-R (16 –19), although alternative mechanisms have been proposed (20 –22).
Despite the well-established role of AGRP in regulation of
energy homeostasis, surprisingly little is known of its posttranslational regulation in the hypothalamus. This information is required to understand fully the physiological role of
AGRP and the mechanism(s) by which it exerts its effects. To
date, most physiological studies of AGRP function in vivo
have used a chemically synthesized carboxyl-terminal AGRP
fragment, AGRP83–132 (23). Pharmacological studies undertaken in vitro have indicated that this peptide and similar
carboxyl-terminal derivatives, such as AGRP87–132, are suf-
1621
1622
Endocrinology, April 2006, 147(4):1621–1631
ficient to antagonize the MC4-R (16, 18, 24). Moreover, HPLC
analysis of AGRP immunoreactivity in rat hypothalamic extracts indicate that AGRP undergoes posttranslational cleavage to generate a carboxyl-terminal fragment in vivo and very
little full-length AGRP remains (25, 26). Likely candidate
proteases that may be involved in AGRP processing include
proprotein convertase (PC) 1/3, PC2, and PC5/6a, all of
which have a neuroendocrine expression profile and are
expressed in the hypothalamus (27).
However, observations that suggest AGRP is cleaved are
not consistent with the current model of how AGRP and
POMC derived peptides interact at the MC4-R in vivo. It has
been proposed that syndecan-3, a central nervous systemspecific proteoglycan that is implicated in food intake regulation, acts as a coreceptor for MC4-R by binding to aminoterminal AGRP via its heparin sulfate side chains and
presenting carboxyl-terminal AGRP to the MC4-R (28, 29).
This model is consistent with observations in genetically
manipulated mouse models (28, 30) but implies that AGRP
is secreted as a full-length molecule.
Based on these contradictory lines of evidence, it is important to determine whether AGRP undergoes posttranslational cleavage because if the syndecan-3 model is correct,
then most physiological studies have been based on peptides
that are not produced in vivo, and more appropriate studies
are needed using full-length AGRP (30). In addition, if carboxyl-terminal AGRP fragments are produced by posttranslational cleavage, then one or more amino-terminal fragments must also be produced. These peptides may exert
important physiological effects that are independent of the
melanocortin system. Finally, if AGRP is posttranslationally
processed, then the processing pathway may be tightly regulated as a means of controlling the amount of melanocortin
antagonist synthesized and secreted at any given time.
In this present study we addressed five questions: 1) is
AGRP posttranslationally processed; 2) which PCs (if any)
are capable of cleaving AGRP and which AGRP peptides are
secreted; 3) which proprotein convertases are expressed in
AGRP neurons; 4) what are the relative potencies of secreted
AGRP peptides at the MC4-R; and 5) what are the physiological effects of amino-terminal AGRP peptides in rats?
Creemers et al. • AGRP Processing in the Hypothalamus
jacent to the Arg79-X-X-Arg82 and Arg85-Arg86 sites. For the Arg79X-X-Arg82-FLAG construct, two PCR products were generated using
the following primer pairs: sense, 5⬘-AGCCAGGCCATGCTGACCGCAGCGTTGC-3⬘, antisense, 5⬘-CTTGTCGTCGTCGTCCTTGTAGTCGCGGGGCTCGCGGTCCTG-3⬘ and sense, 5⬘-GACTACAAGGACGACGACGACAAGTCCTCACGTCGCTGCGTA-3⬘, antisense, 5⬘-CCCAAGCTTCTAGGTGCGGCTGCAGGGATT-3⬘. These two PCR products
were mixed together, diluted, and amplified with the original fulllength AGRP primers. The PCR product was cloned into pCR-BluntII-TOPO (Invitrogen) and subsequently pcDNA3⫹ (Invitrogen). For the
Arg85-Arg86-FLAG construct, the following PCR primer pairs were
used: sense, 5⬘-AGCCAGGCCATGCTGACCGCAGCGTTGC-3⬘, antisense, 5⬘-CTTGTCGTCGTCGTCCTTGTAGTCGCGACGTGAGGAGCGGGG-3⬘ and sense, 5⬘-GACTACAAGGACGACGACGACAAGTGCGTAAGGCTGCATGAGT-3⬘, antisense, 5⬘-CCCAAGCTTCTAGGTGCGGCTGCAGGGATT-3⬘.
Transfection of mammalian cells and analysis of
AGRP processing
AtT20 and ␤TC3 cells were transfected using Lipofectamine (Invitrogen) and ␣TC1– 6 cells using Lipofectamine 2000 (Invitrogen) as described previously (31). Regulated secretion experiments were performed essentially as described (32), except that secretion was induced
for 3 h using 60 mm KCl. A truncated soluble form of furin (32) was used
as a control for constitutive secretion. Albumin (25 ␮g/ml) was added
to the medium samples before precipitation with 4 volumes of methanol
at ⫺20 C. Medium precipitates and cells were dissolved in sample buffer
and size separated by SDS-PAGE. Western blotting was performed as
described (33) using mouse anti-FLAG antibodies M1 or M2 (SigmaAldrich, St. Louis, MO) or a rabbit antibody directed against AGRP that
recognizes both pro-AGRP and AGRP (kindly provided by Dr. G. Barsh,
Stanford University School of Medicine, Stanford, CA).
Immunocytochemistry
Indirect immunofluorescence microscopy was performed as described (34) with some modifications. Briefly, AtT20 cells, fixed in 4%
paraformaldehyde, were incubated with mouse anti-FLAG M1 antibody
and a rabbit antibody directed against the amino terminus of POMC
(kindly provided by Dr. P. Lowry, University of Reading, Reading, UK)
diluted in PBS containing 0.5% blocking reagent (Roche, Indianapolis,
IN) and 0.2% Triton X-100. Bound antibodies were detected with fluorescently labeled secondary antibodies (Alexa dyes; Molecular Probes
Inc., Eugene, OR). Slides were mounted in Vectashield mounting medium (Vector Laboratories, Burlingame, CA) and analyzed on a Axiophot fluorescence microscope (Carl Zeiss, Inc., Oberkochen, Germany)
equipped with UV optics. Images were recorded with a CE200A chargecoupled device camera system (Photometrics Inc., Huntington Beach,
CA) using SmartCapture (Digital Scientific, Cambridge, UK) software.
Immunoelectron microscopy
Materials and Methods
Generation of human AGRP expression constructs
Full-length AGRP, including the signal peptide and a consensus
Kozak initiation signal, was PCR amplified from a human hypothalamus
cDNA library (Clontech Laboratories Inc., Mountain View, CA) using
the following primers: sense, 5⬘-AGCCAGGCCATGCTGACCGCAGCGTTGC-3⬘, antisense, 5⬘-CCCAAGCTTCTAGGTGCGGCTGCAGGGATT-3⬘. A separate reverse primer was designed to generate a
Flag epitope-tagged version of full-length AGRP: 5⬘- CCCAAGCTTCTACTTGTCGTCGTCGTCCTTGTAGTCGGTGCGGCTGCAGGGATT3⬘. PCR products were directly cloned into pCR-BluntII-TOPO (Invitrogen, Carlsbad, CA). Inserts were excised with EcoRI and subsequently
cloned into pcDNA3⫹ (Invitrogen). Clones in the correct orientation
were verified by sequence analysis. Subsequently, a series of mutated
clones were generated in which Arg79-X-X-Arg82, Arg85-Arg86, and
Arg86-X-X-Arg89 were converted to Ala79-X-X-Ala82, Ala85-Ala86, and
Ala86-X-X-Ala89. Mutagenesis was undertaken using a Quickchange
site-directed mutagenesis kit (Stratagene, La Jolla, CA) following the
manufacturer’s protocol. A further two constructs were generated, in
which internal FLAG epitope tags were incorporated immediately ad-
Ultratructural analysis was performed based on the preembedding
immunolabeling procedure described by Yi et al. (35). Cells were fixed
in 3% paraformaldehyde and 0.15% glutaraldehyde. After quenching
with 0.1% NaBH3, the cells were permeabilized with 0.035% Triton X-100
and incubated with primary antibody (1:1000 dilutions of rabbit antiAGRP polyclonal or mouse anti-ACTH monoclonal). Ultrasmall goldconjugated secondary antibodies (goat antirabbit or goat antimouse IgG;
both Aurion, Wageningen, The Netherlands) were used at 1:100 dilutions. After postfixation in 2% glutaraldehyde, silver enhancement was
performed using Aurion R-Gent SE-EM reagent (Aurion), according to
the guidelines of the supplier. Finally, the cells were osmicated in 0.5%
OsO4 and embedded in Agar 100 Resin (Agar Scientific, Essex, UK)
Ultrathin sections were cut using the Leica Ultracut UCT ultramicrotome
and stained with uranyl acetate and lead citrate. The sections were
analyzed on a CM10 transmission electron microscope (Philips, Amsterdam, The Netherlands).
RNA interference
The 19-mer target sequences for fur and Pcsk6 (PACE4 gene) have
been described previously (36). The 19-mer target regions of Pcsk1 (PC1/
Creemers et al. • AGRP Processing in the Hypothalamus
3), and Pcsk5 (PC5/6A) for RNA interference were selected using small
interfering RNA (siRNA) Target Finder (Ambion: http://ambion.com/
techlib/misc/siRNA_finder.html). The target sequences for Pcsk1 and
Pcsk5 are 5⬘-GAAGCGCTCTTCATATCAC-3⬘, and GACCATTCGACCAAACAGT-3⬘, respectively. Upper and lower 60-mer oligonucleotides
encoding the corresponding short hairpin (sh) RNAs were designed
using pSilencer Converter (Ambion: http://ambion.com/techlib/misc/
psilencer_converter.html). shRNAs contain the 19-mer target sequence,
a short hairpin loop sequence (TTCAAGAGA) and the antisense target
sequence, flanked by sequences necessary for RNA polymerase III termination (TTTTTT) and cloning. The double-stranded oligonucleotides
were cloned in the mU6pro vector, kindly provided by Dr. D. Turner
(37). PC2 was silenced using an engineered ␦-ribozyme system kindly
provided by Dr R. Day (38). The efficiency was confirmed by cotransfection of 0.8 ␮g of mU6 pro vector encoding shRNAs or the ␦-ribozyme,
with 0.2 ␮g expression vectors encoding the target mRNA and 1 ␮g
empty vector.
Generation of recombinant full-length AGRP
Full-length AGRP (minus predicted signal peptide) was expressed in
Escherichia coli, purified, and refolded essentially as previously described
(17, 39). Briefly AGRP was PCR amplified from a human hypothalamus
cDNA library (Clontech) using the primers: sense, 5⬘-CGGGATCCGGCTTGGCCCCCAT-3⬘, antisense, 5⬘-CCCAAGCTTCTAGGTGCGGCTGCAGGGATT-3⬘. The PCR product was digested with BamHI and
HindIII and cloned into pT7.36His, an in-house vector that incorporates
a 6-His tag. E. coli BL21 (Invitrogen) were transformed with pT7.36HisAGRP. Expression of the recombinant protein was induced in the presence of 0.4 mmol/liter isopropyl-␤-d-thiogalactopyranoside and purified on a Ni-NTA agarose column using the QIAexpress kit (QIAGEN,
Crawley, UK) according to manufacturer’s protocols. Recombinant
AGRP was refolded following the protocol of Rosenfeld et al. (17). Fifty
microliters of refolded material were subjected to analytical size-exclusion chromatography on a 2.4-ml Superdex 75 column (Amersham Biosciences, Chalfont St. Giles, UK) equilibrated in 50 mm Tris-HCl and 0.15
m NaCl (pH7.4). The column was eluted with the same buffer at 50
␮l/min. Protein concentration was determined by both Dc protein assay
(Bio-Rad Laboratories, Hercules, CA) and measurement of absorbance
at 280 nm using a ND-1000 spectrophotometer (Nanodrop Technologies,
Wilmington, DE), The extinction coefficient for AGRP was calculated
using the equation of Gill and Von Hippel (40).
Endocrinology, April 2006, 147(4):1621–1631
1623
sulfate], and incubated overnight at 65 C in a moist chamber. The
following day, slides were washed at room temperature for 10 min in
2⫻ SSC, followed by 2 ⫻ 30-min washes at 60 C, RNase treated [20
␮g/ml in TEN buffer: 500 mm NaCl, 10 mm Tris (pH 7), and 1 mm EDTA]
at 37 C for 30 min and then sequentially washed for 30 min at 60 C in
2⫻ SSC/50% formamide, followed by 0.5⫻ SSC.
For the detection of the digoxigenin-labeled riboprobe signal, slides
(after high stringency wash) were washed in buffer 1 [100 mm Tris (pH
7.5), 150 mm NaCl] for 2 ⫻ 10 min and then blocked for 30 min in buffer
1 ⫹ 0.1% Triton X-100 ⫹ 2% heat-inactivated fetal bovine serum (Roche).
Antidigoxigenin-alkaline phosphatase conjugated antibody (Invitrogen)
was diluted 1:500 in buffer 1 ⫹ 0.1% Triton X-100 ⫹ 1% fetal bovine serum,
and slides were incubated for 1 h in antibody solution at room temperature.
Slides were then washed in buffer 1, and incubated for 10 min in buffer 2
[0.1 m Tris (pH 9.5), 0.1 m NaCl, 50 mm MgCl2] before color detection.
Digoxigenin-labeled probes were visualized by incubating the slides in
a chromogen solution containing nitroblue tetrazolium chloride and 5bromo-4-chloro-3-indoyl-phosphate in buffer 2. The color reaction proceeded at room temperature, and once stopped, slides were extensively
washed (⬎3 h) in 10 mm Tris (pH 8.0), 1 mm EDTA, and 150 mm NaCl.
Sections were briefly dehydrated in 70% ethanol and air dried. Slides
were then dipped in K5 nuclear emulsion (Ilford, Knutsford, UK) for
autoradiography.
HPLC/RIA analysis of mouse hypothalamic extracts
Hypothalami from four PC1/3 null and four wild-type mice (41) were
dissected using consistent landmarks and were individually homogenized in 0.5 ml of 0.1 n HCl, centrifuged at 16,000 ⫻ g, and the supernatant from each was analyzed by HPLC as previously described (26).
One-milliliter fractions were collected, evaporated in a Speed Vac concentrator, and dissolved in buffer for AGRP RIA. The column was
calibrated with 5 ng AGRP83–132 (Phoenix Peptides Inc., Belmont, CA)
and with 5 ng of full-length AGRP (provided by Dr. G. Barsh, Stanford
University School of Medicine, Stanford, CA). AGRP was measured by
RIA as previously described (26) with an antiserum raised against human AGRP and directed at the C-terminal end of the molecule, provided
by Dr. G. Barsh (25). AGRP83–132 (Phoenix Peptides) was used for the
standard and tracer. Assay sensitivity is 2.5 pg with 50% displacement
of tracer at 50 pg.
Dual in situ hybridization (ISH)
cAMP reporter assays
Male Sprague Dawley rats (Charles River Laboratories, Boston, MA)
weighing 250 –300 g were used. Coronal sections (15 ␮m) were cut
through the entire rostrocaudal axis of the rat brain. Sections were thaw
mounted onto slides, quickly dried, and stored at ⫺80 C. Double-ISH
studies were performed using 33P- plus digoxigenin-labeled ribonucleotide probes (riboprobes). To generate riboprobes, PCR-amplified cDNAs encoding rat PC1/3 (accession no. NM-017091, nucleotides 2072–
2381), rat PC2 (accession no. NM-012746, nucleotides 1133–1463), and rat
neuropeptide Y (accession no. NM-012614, nucleotides 76 – 426) were
ligated into pGem-T (Promega, Madison, WI) using standard protocols.
Linearized plasmids were transcribed with either T7 or SP6 according
to manufacturer’s instructions. Reactions were terminated by digestion
of the plasmid template and riboprobes were extracted (33P-labeled
riboprobes only), precipitated, and resuspended in 50 ␮l 50% nucleasefree formamide⫹ 1 ␮l RNasin (Promega) and stored at 20 C. Riboprobes
were heated to 65 C for 5 min and quenched on ice before addition to
the hybridization buffer.
Before hybridization, slides were quickly brought to room temperature and sections were fixed for 15 min in cold 4% paraformaldehyde
in 0.1 m PBS (pH 7.4). Slides were briefly rinsed in PBS (PB⫹ 0.9% NaCl),
acetylated for 10 min in 0.25% acetic anhydride/0.1 m triethanolamine/
0.9% NaCl, and then rinsed 3 ⫻ 2 min in PBS. Sections were taken
through an increasing ethanol series, followed by 5 min in chloroform.
Air-dried sections were incubated with antisense riboprobes (5 ⫻ 105
dpm of 33P-labeled riboprobe/slide plus 30 ng digoxigenin-labeled riboprobe/slide) in hybridization buffer [50% deionized formamide, 4⫻
sodium saline citrate (SSC) (pH 7.0), 1 mm EDTA, 20 ␮g/ml yeast tRNA,
10% dextran sulfate, 1⫻ Denhardt’s solution, and 0.25% sodium dodecyl
cAMP assays were undertaken as previously described (42). Briefly,
CHOK1 cells were stably transfected with full-length human MC4-R and
a cAMP reporter construct consisting of a cAMP response element and
three vasoactive intestinal peptide enhancer elements upstream of a lac
Z reporter gene (kindly provided by Drs. M. Needham and D. Scanlan,
AstraZeneca, Cheshire, UK). Cells were grown to complete confluence
in DMEM (Sigma), 10% fetal calf serum, 1% HT supplement (Invitrogen),
1% nonessential amino acids (Invitrogen), 200 ␮g/ml G418 (Invitrogen),
and 500 ␮g/ml hygromycin B (Roche). Cells were washed in PBS and
harvested. Ligand stocks (2.5 times) were prepared in indicator free
DMEM and 40-␮l aliquots were added, in quadruplicate, to poly-lysine
coated 96-well plates. Stocks (10 times) of either full-length AGRP or
AGRP83–132 (Phoenix Peptides) were added to appropriate wells in 10-␮l
aliquots. CHOK1 cells expressing the human MC4-R were added each
well at a density of 50,000 cells/well, and the plate was incubated for 5 h
at 37 C/5% CO2. cAMP was detected by addition of 1 mm chlorophenol
red-␤-d-galactopyranoside (Roche) in buffer containing a final concentration of 40 mm Na2HPO4, 40 mm NaH2PO4, 7 mm KCl, and 0.7 mm
MgSO4. ␤-Galactosidase converts chlorophenol red-␤-d-galactopyranoside to give a red color. Results were quantified by reading absorbance
at 590 nm on a Spectrafluor (Tecan, Männedorf, Switzerland) plate
reader. Each experiment was performed a minimum of three times with
quadruplicate wells. Dose-response data were fitted to a sigmoid curve
using nonlinear squares regression (Origin 6.0, Microcal Software, Inc.,
Northampton, MA). Data from dose-response curves were transformed
according to the method of Arunlakshana and Schild (43) to determine
the affinity of the antagonist (pKb).
1624
Endocrinology, April 2006, 147(4):1621–1631
Creemers et al. • AGRP Processing in the Hypothalamus
In vivo analysis of AGRP peptides
All experiments were performed using adult male Sprague Dawley
rats (250 –300 g, Charles River Laboratories, Sandwich, UK). Animals
were kept in a 12-h light, 12-h dark cycle at 21 ⫾ 1 C with 45 ⫾ 10%
humidity and free access to food (Beekay International, Hull, UK) and
water. All experiments were performed in accordance with the United
Kingdom’s Animals (Scientific Procedures) Act (1986). Animals underwent lateral cerebroventricular cannulation (0.8 mm posterior and 1.5
mm lateral to bregma and 3.0 mm down from dura) under halothane
anesthesia. After 1 wk of recovery, animals were housed individually
and left to acclimatize. The free-moving, conscious rats were given
intracerebroventricular injections of 2 nmol AGRP83–132 (Phoenix Peptides) and rat equivalent sequences (XM_574228) for human AGRP25–51
(rat AGRP25– 47 VAPLKGIRRSDQALFPEFSGLSL) and human AGRP54 – 82
(rat AGRP50 – 80 TAADRAEDVLLQKAEALAEVLDPQNRESRSP) (peptides custom synthesized by Bachem, Bubendorf, Switzerland) or vehicle
(isotonic sterile saline) in a volume of 2 ␮l. Immediately after injections, a
preweighed amount of food was presented to the animals. Food consumption was measured after 1, 2, 4, 8, 24, and 48 h. A temperature-sensitive,
precalibrated radiotelemetery transmitter (TA10TA-F40, Data Sciences International, Minneapolis, MN) was implanted into the peritoneal cavity at
the same time as the ventricular cannulation. The core body temperature
of the animals was measured continuously throughout the 48 h experimental period. Correct cannulae placement was verified after the experiment by a positive dipsogenic response to a 2-␮l icv injection of 100 ng
human angiotensin (Sigma-Aldrich). Only animals that responded were
included in the subsequent analysis.
Statistical analysis
Quantitative measurements of AGRP peptides in hypothalamic extracts were compared using a nonparametric Mann-Whitney U test. In
the food-intake experiments, food intake and body weight gain were
analyzed using a parametric one-way ANOVA. Core body temperature
was expressed as change from mean basal values and was analyzed by
calculating area under the curve (C/h) by the trapezoid method. In all
tests, P ⬍ 0.05 was considered significant.
Results
AGRP is posttranslationally cleaved in the regulated
secretory pathway
In the absence of a suitable hypothalamic cell line that
endogenously expresses AGRP, we analyzed AGRP processing by transfecting three well-characterized murine neuroendocrine cell lines, ␣TC1– 6, ␤TC-3, and AtT20, with pcDNA3
(Invitrogen) encoding human full-length AGRP. These cells
were chosen because they represent useful model systems for
the regulated secretory pathway (44), and they endogenously express PCs that are likely to cleave AGRP in the
hypothalamus. ␣TC1– 6 and ␤TC-3 were derived from mouse
pancreatic islets and endogenously express PC2 and both
PC1/3 and PC2, respectively. AtT20 cells were derived from
mouse anterior pituitary corticotrophs and endogenously
express PC1.
In ␤TC3 cells transfected with human AGRP (Fig. 1A),
Western blot analysis of the cell lysate demonstrates that
full-length AGRP (12 kDa) is stored intracellularly and undergoes posttranslational cleavage to generate a carboxylterminal product of approximately 6 kDa. Stimulation of the
cells with KCl greatly enhanced secretion of both full-length
and carboxyl-terminal AGRP into the media, indicating that
AGRP is stored in secretory granules. Figure 1B shows immunocytochemical evidence that AGRP colocalizes with
POMC-derived peptides in transfected AtT20 cells. Analysis
of cells using electron microscopy (Fig. 1B, lower right panel)
FIG. 1. A, pcDNA3. AGRP transfected into ␤TC3 cells is predominantly stored intracellularly and is cleaved to generate a carboxylterminal 6-kDa fragment. A truncated soluble form of furin (32) is
used as control for constitutive secretion and is more predominant in
media than cell lysates. B, Coimmunofluorescence studies in AtT20
cells transfected with pcDNA3. AGRP indicate that AGRP- (red) and
POMC-derived peptides (green) colocalize. Immunoelectron microscopy (lower right panel) shows silver-enhanced gold particles labeling
AGRP predominantly in large dense-core vesicles.
demonstrates that AGRP is located in or near large densecore vesicles. A similar labeling pattern was observed for
ACTH (data not shown). These observations represent the
first direct evidence that AGRP is sorted into the regulatory
secretory pathway. Furthermore, it should be noted that the
vast majority of AGRP, both intracellular and secreted, is in
the processed 6-kDa form.
AGRP is posttranslationally cleaved after Arg79-X-X-Arg82
Processing of AGRP is likely to involve PCs, a family of
serine proteases that cleave prohormones at basic motifs,
usually R/K-R or R-X-X-R (45). Family members include
furin, PC1 (PC3), PC2, PC4, PC5 (PC6), PACE4, and LPC
(PC7, PC8), and two more distantly related members, SKI-1
and NARC-1 (46, 47). Analysis of the protein sequence of
human AGRP demonstrates that there are three potential
prohormone cleavage sites that could potentially liberate a
carboxyl-terminal peptide: Arg79-X-X-Arg82, Arg85-Arg86,
and Arg86-X-X-Arg89. In an attempt to identify which cleavage sites are processed in vitro, we generated seven expression constructs in which potential cleavage sites have been
disrupted by site-directed mutagenesis (Fig. 2A). These were
Creemers et al. • AGRP Processing in the Hypothalamus
transfected into ␤TC3 cells, and precipitated media samples
were analyzed by Western blot (Fig. 2B). In constructs in
which the Arg79-X-X-Arg82 site was mutated, processing is
blocked (constructs 1 and 3). Mutation of the Arg85-Arg86
and Arg86-X-X-Arg89 (constructs 2 and 4) did not affect
cleavage. These results strongly suggest that AGRP undergoes a posttranslational cleavage event in vitro after
Arg79-X-X-Arg82.
The main secreted peptide is AGRP83–132
In parallel to the above experiment, a series of FLAGtagged constructs were generated to precisely define the
secreted carboxyl-terminal AGRP peptide. Constructs were
engineered so that a FLAG epitope was inserted between the
P1 and P1⬘ residues of the putative cleavage sites Arg79-XX-Arg82 and Arg85-Arg86 (Fig. 2A). A cleavage event would
therefore expose a FLAG epitope at the amino-terminus of
the cleaved peptide. This could be detected by using an
anti-FLAG M1 antibody, which detects only the FLAG-tag
Endocrinology, April 2006, 147(4):1621–1631
1625
with a free amino terminus, whereas the M2 antibody detects
the FLAG epitope independent of its position in the protein.
Figure 2C shows Western blot analysis of media from ␤TC3
cells transfected with the FLAG-tagged constructs. As expected, the M2 anti-FLAG antibody detects both a full-length
band and a carboxyl-terminal cleaved fragment with all three
constructs. The cleaved fragment is strongly detected by M1
in cells transfected with construct 6. This provides further
evidence that AGRP is cleaved after Arg79-X-X-Arg82 and
AGRP83–132 are secreted. A faint band was also detected in
cells transfected with construct 5, suggesting some cleavage
at Arg85-Arg86.
AGRP is predominantly cleaved by PC1
To assess which propeptide convertases cleave AGRP, we
transfected ␣TC1– 6, AtT20, and ␤TC3 cells with pcDNA3
(Invitrogen) encoding full-length human AGRP. These cells
endogenously express PC2, PC1/3, and PC1/3/PC2, respectively. Figure 3A demonstrates that cleavage occurs in all
three of these cell lines, suggesting both PC1 and PC2 can
cleave the Arg79-X-X-Arg82. Vectors encoding shRNA interference (shRNAi) fragments targeting proprotein convertases were then transfected into ␤TC3 cells. Cotransfection
experiments with vectors encoding targeted PCs were undertaken to assess efficacy of shRNAi silencing (Fig. 3B). In
all cases complete or near complete suppression was
achieved. We found that silencing of PC1/3 in ␤TC3 cells
resulted in a partial inhibition of AGRP processing, indicating that this enzyme is important in cleavage of AGRP (Fig.
3C). Silencing of other PCs in the presence of PC1/3 had no
effect on AGRP processing, indicating that PC1/3 alone is
sufficient. Figure 3D shows silencing of PC1/3 in AtT20 cells,
which almost completely blocked processing, thereby defining a key role for PC1/3 in AGRP cleavage. To assess which
other PCs can cleave AGRP, PC1/3 shRNAi-transfected
AtT20 cells were cotransfected with furin, PACE4, PC5/6A,
PC5/6B, and PC2/7B2. This rescue experiment demonstrated that both PC5/6A and PC2 have significant capacity
to cleave AGRP in the absence of PC1/3. A potential role for
PC2 is further indicated by the observation that AGRP is
partially cleaved when transfected into ␣TC1– 6 cells.
PC1/3 cleaves AGRP in vivo
FIG. 2. A, Full-length AGRP expression constructs. In each case wildtype (W) putative cleavage sites were disrupted by site-directed mutagenesis, changing arginines to alanines (M). The position of inserted
FLAG epitopes is indicated by black circles. B, Western blot analysis
of media samples from ␤TC3 cells transfected with each construct. C,
Western blot analysis of media samples from ␤TC3 cells transfected
with FLAG tagged AGRP constructs. M2 antibody detects the FLAG
epitope regardless of its position in the protein, whereas M1 detects
only FLAG epitopes with a free amino-terminus, indicating that the
predominant secreted peptide is AGRP83–132. The position of putative
cleavage sites Arg79-X-X-Arg82 (REPR), Arg85-Arg86 (RR), and
Arg86-X-X-Arg89 (RCVR) are indicated.
To determine whether PC1/3 and PC2 colocalize with
AGRP in the hypothalamus in vivo, we undertook dual-ISH
experiments. Figure 4 shows representative dark-field autoradiograms of coronal sections of the rat forebrain. PC1/3
generally exhibits a more restricted expression profile than
PC2 but is particularly strongly expressed in the paraventricular nucleus and the supraoptic nucleus. PC2 is strongly
expressed in the hippocampus and the thalamus. The consistency of these data with previous studies demonstrates the
specificity of the riboprobes that we have designed (48, 49).
High-power bright-field photomicrographs focusing on the
arcuate nucleus demonstrate that both PC1/3 and PC2 (silver
grains) are coexpressed in AGRP neurons (dark staining). We
found that almost all AGRP neurons express both PC1/3 and
PC2, thereby implicating a physiological role for these enzymes in AGRP posttranslational processing.
1626
Endocrinology, April 2006, 147(4):1621–1631
Creemers et al. • AGRP Processing in the Hypothalamus
FIG. 4. Dark-field autoradiograms of coronal sections of rat forebrain
incubated with riboprobes for PC1/3 (i, ii) and PC2 (iv, v). PVN,
Paraventricular nucleus; TH, thalamus; VMH, ventromedial hypothalamus; HC, hippocampus; SON, supraoptic nucleus. Bright-field
photomicrographs focusing on the arcuate nucleus demonstrate that
PC1/3 (silver grains) (iii) and PC2 (silver grains) (iv) colocalize with
AGRP (dark staining).
FIG. 3. A, pcDNA3. AGRP transfected into AtT20, ␣TC1– 6, and
␤TC3 cells, indicating that AGRP is cleaved in each cell line. B, To test
shRNAi efficacy, ␤TC3 cells were cotransfected with 0.2 ␮g expression
vectors encoding target PC mRNA and either 0.8 mg mU6pro vector
encoding shRNAi (⫹) or empty vector (⫺). In each case, complete or
near complete suppression of recombinant target was achieved as
assessed by Western blot. C, ␤TC3 cells cotransfected with vectors
encoding shRNAi particles targeted to PCs. AGRP is cleaved to near
completion in cells transfected with shRNAi for furin, PC2, PACE4,
and PC5/6A to generate AGRP83–132. PC1/3 shRNAi inhibits processing of AGRP by approximately 50%. D, AtT20 cells transfected with
shRNAi particles targeted to PC1/3 blocks processing of full-length
AGRP by approximately 80%. Cotransfection with PC2/7B2 and
PC5/6A almost completely rescues cleavage of AGRP.
Based on experiments in vitro, PC1 appeared to be predominantly responsible for AGRP cleavage. To investigate
the role of PC1 in vivo, we analyzed AGRP processing in
hypothalamic lysates from PC1-null mice. Figure 5A shows
a representative chromatograph of an individual wild-type
and PC1-null mouse. In wild-type mice, the majority of
AGRP immunoreactivity coeluted with AGRP83–132, indicating that processing occurs in vivo. However, in PC1-null
mice, there was an increase in full-length AGRP immunoreactivity. Figure 5B shows quantitative analysis of fulllength AGRP and AGRP83–132 in four wild-type and four
PC1-null mice. There was no significant difference in
AGRP83–132 levels between the two groups. However, there
was significantly more full-length AGRP in the null mice vs.
the wild-type mice (648 ⫾ 237 vs. 198 ⫾ 31 pg/hypothalamus;
P ⫽ 0.04). The mean percentage full-length AGRP rose from
2.7% in wild-type mice to 9.5% in null mice (P ⫽ 0.02),
indicating that PC1 processes AGRP in vivo, although other
proteases, presumably PC2 and/or PC5/6a, compensate for
PC1 in its absence.
AGRP83–132 is more potent than full-length AGRP at
the MC4R
We undertook detailed pharmacological analysis to compare the properties of AGRP83–132, the predominant secreted
AGRP peptide, with full-length AGRP. Recombinant fulllength AGRP was generated and purified from E. coli AGRP
was refolded as previously described (17). Figure 6A shows
the recombinant protein as analyzed by size-exclusion chromatography. AGRP eluted as a single peak at a retention time
consistent with a monomeric state, suggesting that the recombinant AGRP is correctly folded. To test the relative
potencies of full-length AGRP and AGRP83–132 at the MC4-R,
cAMP reporter assays were undertaken in CHOK1 cells stably expressed with human MC4-R and a ␤-galactosidase
reporter gene under the control of cAMP response elements.
Data were subjected to Schild analysis to determine pKb
values (Fig. 6, B and C). AGRP 83–132 [pKb ⫽ 8.75 ⫾ 0.05 (1.8
nm)] was significantly more potent as an inhibitor than fulllength AGRP [pKb ⫽ 7.95 ⫾ 0.04 (11 nm)]. Interestingly, at
low concentrations (e.g. 1 nm) full-length AGRP is ineffective,
whereas AGRP83–132 significantly antagonizes ␣MSH. Given
that concentrations of secreted AGRP in vivo are likely to be
Creemers et al. • AGRP Processing in the Hypothalamus
Endocrinology, April 2006, 147(4):1621–1631
1627
FIG. 5. A, A representative chromatograph demonstrating the characterization of AGRP immunoreactivity in wild-type and PC1/3-null
mice hypothalami by HPLC. Arrows indicate elution positions of synthetic AGRP83–132 and full-length AGRP. B, Quantification of AGRP
peptides in four wild-type (hatched bars) and four PC1/3 null (black
bars) hypothalami. *, P ⬍ 0.05.
low (50), the observed modest differences in pKb values
between full-length and truncated AGRP are likely to be
physiologically significant.
Rat AGRP25– 47 and rat AGRP50 – 80 do not have a role in
energy homeostasis
The observation that AGRP is cleaved raises questions
concerning the role of the amino-terminal portion of the
molecule. In particular, we postulated that interaction of
amino-terminal peptides with syndecan-3 could affect food
intake independently of the melanocortin system. We synthesized rat peptides corresponding to the commercially
available human peptides AGRP25–51 and AGRP54 – 82 and
determined cumulative food intake in groups of rats injected
with a single bolus of 2 nmol AGRP83–132, AGRP25– 47, and
AGRP50 – 80 (Fig. 7A). As expected, AGRP83–132 had a potent
effect on food intake that was apparent over 48 h, whereas
the amino-terminal peptides did not stimulate food intake.
AGRP83–132 also significantly increased body weight, compared with the vehicle-treated cohort (Fig. 7B), and decreased core body temperature (Fig. 7C). This was attribut-
FIG. 6. A, Recombinant full-length AGRP was generated in E. coli,
purified, and refolded as described (17, 39) and subjected to sizeexclusion chromatography, which indicates that AGRP is correctly
folded in a monomeric state. B, CHOK1 cells stably expressing
hMC4-R and a ␤-galactosidase reporter construct were treated with
increasing concentrations of ␣MSH, and coincubated with 0 nM (E),
1 nM (F), 5 nM (䡺), 10 nM (f), 50 nM (‚), and 100 nM (Œ) of either
full-length AGRP or AGRP83–132. Data points represent means of
quadruplicate measurements. Data shown are one representative of
three independent experiments. For full-length AGRP the curves for
0 nM (E) and 1 nM (F) are superimposed.
able to a decrease in expression of uncoupling protein-1 in
brown adipose tissue (data not shown). Neither AGRP25– 47
nor AGRP50 – 80 had a significant effect on body weight or
body temperature.
1628
Endocrinology, April 2006, 147(4):1621–1631
FIG. 7. A, Mean food intake measurements following intracerebroventricular (icv) administration of a single 2-nmol bolus of vehicle (n ⫽
6) (f), AGRP83–132 (n ⫽ 5) (F), AGRP25– 47 (n ⫽ 5) (⽧), and AGRP50 – 80
(n ⫽ 6) (Œ). B, Mean body weight changes in rats following icv injection
of vehicle (open bars), AGRP83–132 (diagonal hatched bars), AGRP25– 47
(horizontal hatched bars), and AGRP50 – 80 (black bars). C, Core body
temperatures were measured over a 48-h period in rats injected with
vehicle (black lines), AGRP83–132 (light gray lines), AGRP25– 47 (dark gray
lines), and AGRP50 – 80 (hatched lines). *, P ⬍ 0.05; **, P ⬍ 0.01; ***, P ⬍
0.0001.
Discussion
In this study we addressed several important questions
regarding the posttranslational processing and trafficking of
AGRP. First, we provide direct evidence that AGRP is stored
intracellularly in secretory granules and is secreted via the
regulated pathway. This is consistent with it acting as an
Creemers et al. • AGRP Processing in the Hypothalamus
important regulatory neuropeptide. Indeed, analysis of
AGRP content in hypothalamic extracts (7) and secretion
experiments using perifused hypothalamic slices (25, 26) indicate that altered secretion of AGRP is more important than
secretion of POMC-derived peptides in eliciting acute
changes in melanocortinergic tone. Therefore, it is important
to understand how AGRP release from secretory granules is
regulated and which AGRP derived peptides are produced.
We clearly demonstrate that AGRP is posttranslationally
cleaved to produce a carboxyl-terminal fragment. These data
are consistent with previous HPLC analyses of AGRP immunoreactivity in rat serum and hypothalamic tissue (25, 26).
However, the published studies did not precisely define the
primary form of secreted AGRP. By undertaking a series of
site-directed mutagenesis experiments, we have shown that
cleavage occurs after the Arg79-Glu80-Pro81-Arg82 site to generate AGRP83–132. This observation is important because most
physiological studies of AGRP function have used AGRP83–
132 as it is the main commercially available form (Phoenix
Peptides). This was synthesized based on analogy to the
processing pattern of atrial-natriuretic factor, but there was
no direct evidence that this peptide was produced in vivo (23).
Our data support the concept that it is more important to
consider the effects of AGRP83–132 in physiological studies
rather than full-length AGRP (12–14).
By undertaking RNA interference and overexpression experiments in a series of neuroendocrine cell lines, we have
shown that AGRP cleavage is predominantly catalyzed by
PC1/3, although PC2 and PC5/6A have the capacity to
cleave AGRP in the absence of PC1/3 in vitro. However, in
contrast to PC1/3, RNA interference silencing of PC2 and
PC5/6A did not inhibit AGRP processing in ␤TC3 cells,
indicating that they are not primarily important in the processing of AGRP. Combined HPLC and RIA analysis of PC1null mice hypothalami indicate that PC1/3 cleaves AGRP in
vivo because there is a significant accumulation of unprocessed full-length AGRP in null vs. wild-type hypothalami.
However, it cannot be entirely excluded that processing by
other PCs at the same or another cleavage site occurs in
hypothalamic neurons in vivo. It is not surprising that genetic
ablation of PC1/3 results in only a partial reduction of processing. Similar observations have been made for other neuropeptides in the PC1/3 null mice (51) and other PCs (52). It
has become clear that for many, but not all substrates, a
limited redundancy of PCs exists. Here it seems likely that
PC2 and possibly other PCs compensate for the absence of
PC1.
The observation of posttranslational cleavage of AGRP has
important implications regarding the mechanism by which
it elicits its physiological effects. It has been demonstrated
previously that full-length AGRP, but not carboxyl-terminal
AGRP, binds to syndecan-1. Based on this observation, it was
proposed that syndecan-3, which unlike syndecan-1 is endogenously expressed in the hypothalamus, acts as a coreceptor for MC4-R (28). Experiments undertaken in syndecan3-null mice (28 –30, 53) and syndecan-1 transgenic mice (28)
clearly indicate that syndecan-3 does indeed play an important role in energy homeostasis. However, our data show that
AGRP is cleaved into distinct amino-terminal and carboxylterminal peptides before secretion. Therefore, it is difficult to
Creemers et al. • AGRP Processing in the Hypothalamus
envisage how syndecan-3 binding to an amino-terminal fragment could influence the effect of the carboxyl-terminal fragment. It is theoretically possible that despite intracellular
cleavage, AGRP fragments remain associated and form a
complex with syndecan-3, and MC4-R held together by disulfide bridges or noncovalent associations. However, we
think this possibility is highly unlikely. First, covalent association of AGRP fragments through disulfide bridges can be
ruled out because no cysteines are present in amino-terminal
AGRP. Second, noncovalent association is unlikely because
immunoprecipitation of processed AGRP under nondenaturing conditions did not result in coimmunoprecipitation of
the propeptide (data not shown). These observations indicate
that syndecan-3 cannot act as a coreceptor for the MC4-R.
Consequently, syndecan-3 and the carboxyl terminus of
AGRP must act independently in the regulation of food intake. This would explain the observation that syndecan-3null mice are resistant to diet-induced obesity (29), whereas
AGRP-null mice are not (54). Nevertheless, recent data do
support the idea that syndecan-3 facilitates the actions of
endogenous MC4-R antagonists because the obese phenotype observed in agouti lethal yellow mice is attenuated on
a syndecan-3-null background (55). This phenomenon must,
presumably, be a result of an indirect mechanism, possibly
related to the role of syndecan-3 in central nervous system
plasticity (53).
It is possible that amino-terminal AGRP fragments have a
role in energy homeostasis independent of the MC4-R, and
such a role may be mediated by syndecan-3. This possibility
is supported by the observation that syndecan-3 is highly
expressed in regions of the hypothalamus that receive dense
innervation from AGRP neurons, such as the paraventricular
nucleus (19, 28). A recent study implicated amino-terminal
AGRP in energy homeostasis. Goto et al. (15) administered
two commercially available human carboxyl-terminal AGRP
peptides, AGRP25–51 and AGRP54 – 82, into rat brains via intracerebroventricular cannulae and found that both peptides
increased body weight. However, these data are difficult to
interpret because amino-terminal AGRP, unlike carboxylterminal AGRP, is not particularly well conserved between
humans and rats and shows only 66% similarity. In our study
we synthesized the equivalent rat peptides of human
AGRP25–51 and AGRP54 – 82 and injected them into rat brains.
We found that these peptides, in contrast to AGRP83–132, did
not affect body weight, food intake, or core body temperature. Therefore, our results do not support a role for aminoterminal AGRP in the regulation of body weight. However,
owing to a lack of amino-terminal AGRP antibodies, it has
not been possible to ascertain which amino-terminal AGRP
peptides are produced. The commercially available aminoterminal peptides have presumably been synthesized on the
assumption that the Lys52-Lys53 site in human AGRP (Lys48Lys49 in rat) is posttranslationally cleaved, although there is
no direct evidence to support this. Further research is therefore required to determine which amino-terminal AGRP
peptides are produced in vivo and what, if any, functional
effect they have. Moreover, it has not been ascertained in this
study whether amino-terminal fragments of AGRP can actually bind to syndecan-3. This will require further analysis
Endocrinology, April 2006, 147(4):1621–1631
1629
to determine whether interaction between N-terminal AGRP
and syndecan-3 has any physiological significance.
Both in vitro and in vivo studies have demonstrated that
full-length AGRP displays some bioactivity (4, 17, 18, 39). In
considering the implications of AGRP processing, we predicted that full-length pro-AGRP would be less potent as an
antagonist than AGRP83–132. In this study we directly compared the pharmacological properties of recombinant fulllength AGRP and AGRP83–132 in a cAMP reporter assay using
CHO cells stably transfected with MC4-R. Based on Schild
analysis, we demonstrated that full-length AGRP is 6.1-fold
less potent than AGRP83–132. This finding is supported by
another recent study that analyzed full-length human AGRP
in a reporter gene assay (56). The differences between fulllength AGRP and AGRP83–132 could translate into subtle
differences in efficacy in vivo. Indeed, we previously demonstrated that subtle changes in POMC-derived peptide potency at the MC4-R can lead to profound obesity in vivo (42).
This study is the first to directly address posttranslational
processing and trafficking of AGRP. We have found that
AGRP is stored in secretory granules and is cleaved to generate AGRP83–132. Because amino-terminal and carboxyl-terminal AGRP are cleaved from one another before secretion,
this study strongly suggests that syndecan-3 does not act as
a coreceptor for the MC4-R. Further research is therefore
required to understand the physiological role of syndecan-3.
It would be interesting to study how AGRP processing is
regulated in the hypothalamus. Our previous studies indicate that posttranslational processing of POMC is regulated
in the hypothalamus with respect to energy balance (8).
Other studies have shown that hypothalamic expression and
activity of the PCs, PC1/3 and PC2, are altered in various
rodent models of obesity (8, 57– 60). Extrapolating from these
observations, it seems possible that AGRP processing may
also be regulated as an additional mechanism of controlling
melanocortin tone in the hypothalamus.
Acknowledgments
We thank Mrs. Irene Conwell for technical assistance and Dr. David
Smith and Dr. Andrew Turnbull of AstraZeneca for advice and helpful
discussions.
Received October 28, 2005. Accepted December 20, 2005.
Address all correspondence and requests for reprints to: Professor
Anne White, Stopford Building, University of Manchester, Oxford Road,
Manchester M13 9PT, United Kingdom. E-mail: [email protected].
This work was supported by the Wellcome Trust, AstraZeneca, and
National Institutes of Health Grant DK57561 (to S.L.W.). A.G. is funded
by a Biotechnology and Biological Sciences Research Council studentship award.
J.W.M.C., L.E.P., A.G., P.L.R., S.M., S.L.W., X.Z., D.F.S., N.D., C.B.L.,
and S.M.L. have nothing to declare. D. A., C.A.S., R.A.D., and J.C.B. are
employed by AstraZeneca. A.W. has received grant support (2003–2005)
from AstraZeneca.
References
1. Cone RD 1999 The central melanocortin system and energy homeostasis.
Trends Endocrinol Metab 10:211–216
2. Pritchard LE, Turnbull AV, White A 2002 Pro-opiomelanocortin processing
in the hypothalamus: impact on melanocortin signalling and obesity. J Endocrinol 172:411– 421
3. Shutter JR, Graham M, Kinsey AC, Scully S, Luthy R, Stark KL 1997 Hypothalamic expression of ART, a novel gene related to agouti, is upregulated
in obese and diabetic mutant mice. Genes Dev 11:593– 602
1630
Endocrinology, April 2006, 147(4):1621–1631
4. Ollmann MM, Wilson BD, Yang Y-K, Kerns JA, Chen Y, Gantz I, Barsh GS
1997 Antagonism of central melanocortin receptors in vitro and in vivo by
agouti-related protein. Science 278:135–138
5. Cone RD, Cowley MA, Butler AA, Fan W, Marks DL, Low MJ 2001 The
arcuate nucleus as a conduit for diverse signals relevant to energy homeostasis.
Int J Obesity 25:S63–S67
6. Mizuno TM, Makimura H, Mobbs CV 2003 The physiological function of the
agouti-related peptide gene: the control of weight and metabolic rate. Trends
Mol Med 35:425– 433
7. Harrold JA, Williams G, Widdowson PS 1999 Changes in hypothalamic
agouti-related protein (AGRP), but not ␣-MSH or pro-opiomelanocortin concentrations in dietary-obese and food-restricted rats. Biochem Biophys Res
Commun 258:574 –577
8. Pritchard LE, Oliver RL, McLoughlin JD, Birtles S, Lawrence CB, Turnbull
AV, White A 2003 Pro-opiomelanocortin (POMC) derived peptides in rat
cerebrospinal fluid and hypothalamic extracts: evidence that secretion is regulated with respect to energy balance. Endocrinology 144:760 –766
9. Mizuno TM, Mobbs CV 1999 Hypothalamic agouti-related protein messenger
ribonucleic acid is inhibited by leptin and stimulated by fasting. Endocrinology
140:814 – 817
10. Graham M, Shutter JR, Sarmiento U, Sarosi I, Stark KL 1997 Overexpression
of Agrt leads to obesity in transgenic mice. Nat Genet 17:273–274
11. Makimura H, Mizuno TM, Mastaitis JW, Agami R, Mobbs CV 2002 Reducing
hypothalamic AGRP by RNA interference increases metabolic rate and decreases body weight without influencing food intake. BMC Neurosci 3:18
12. Rossi M, Kim MS, Morgan DGA, Small CJ, Edwards CMB, Sunter D, Abusnana S, Goldstone AP, Russell SH, Stanley SA, Smith DM, Yagaloff K,
Ghatei MA, Bloom SR 1998 A C-terminal fragment of agouti-related protein
increases feeding and antagonizes the effect of ␣-melanocyte stimulating hormone in vivo. Endocrinology 139:4428 – 4431
13. Small CJ, Kim MS, Stanley SA, Mitchell JRD, Murphy K, Morgan DGA,
Ghatei MA, Bloom SR 2001 Effects of chronic central nervous system administration of agouti-related protein in pair-fed animals. Diabetes 248 –254
14. Hagan MM, Rushing PA, Pritchard LM, Schwartz MW, Strack AM, Van der
Ploeg LHT, Woods SC, Seeley RJ 2000 Long-term orexigenic effects of AgRP(83–132) involve mechanisms other than melanocortin receptor blockade. Am J
Physiol 279:R47–R52
15. Goto K, Inui A, Takimoto Y, Yuzuriha H, Asakawa A, Kawamura Y, Tsuji
H, Takahara Y, Takeyama C, Katsuura G, Kasuga M 2003 Acute intracerebroventricular administration of either carboxyl-terminal or amino-terminal
fragments of agouti-related peptide produces a long-term decrease in energy
expenditure in rats. Int J Mol Med 12:379 –383
16. Pritchard LE, Armstrong D, Davies N, Oliver RL, Schmitz CA, Brennand JC,
Wilkinson GF, White A 2004 Agouti related protein (83–132) is a competitive
antagonist at the human melanocortin-4 receptor: no evidence for differential
interactions with pro-opiomelanocortin derived ligands. J Endocrinol 180:183–
191
17. Rosenfeld RD, Zeni L, Welcher AA, Narhi LO, Hale C, Marasco J, Delaney
J, Gleason T, Philo JS, Katta V, Hui J, Baumgartner J, Graham M, Stark KL,
Karbon W 1998 Biochemical, biophysical and pharmacological characterization of bacterially expressed human agouti-related protein. Biochemistry 37:
16041–16052
18. Yang Y-K, Thompson DA, Dickinson CJ, Wilken J, Barsh GS, Kent SBH,
Gantz I 1999 Characterization of agouti-related protein binding to melanocortin receptors. Mol Endocrinol 13:148 –155
19. Bagnol D, Lu X-Y, Kaelin CB, Day HEW, Ollmann M, Gantz I, Akil H, Barsh
GS, Watson SJ 1999 Anatomy of an endogenous antagonist: relationship
between agouti-related protein and proopiomelanocortin in brain. J Neurosci
19:RC26 (1–7)
20. Nijenhuis WAJ, Oosterom J, Adan RAH 2001 AgRP (83–132) acts as an inverse
agonist on the human melanocortin-4 receptor. Mol Endocrinol 15:164 –171
21. Haskell-Luevano C, Monck EK 2001 Agouti-related protein functions as an
inverse agonist at a constitutively active brain melanocortin-4 receptor. Regul
Peptides 99:1–7
22. Chai B-X, Neubig RR, Millhauser GL, Thompson DA, Jackson PJ, Barsh GS,
Dickinson CJ, Li J-Y, Lai Y-M, Gantz I 2003 Inverse agonist activity of agouti
and agouti-related protein. Peptides 24:603– 609
23. Quillan JM, Sadee W, Wei ET, Jimenez C, Li J, Chang JK 1998 A synthetic
human agouti-related protein-(83–132)-NH2 fragment is a potent inhibitor of
melanocortin receptor function. FEBS Lett 428:59 – 62
24. Jackson PJ, McNulty JC, Yang Y-K, Thompson DA, Chai B, Gantz I, Barsh
GS, Millhauser GL 2002 Design, pharmacology, and NMR structure of a
minimized cystine knot with agouti-related protein activity. Biochemistry
41:7565–7572
25. Li J-Y, Finniss S, Yang Y-K, Zeng Q, Qu S-Y, Barsh G, Dickinson C, Gantz
I 2000 Agouti-related protein-like immunoreactivity: characterization of release from hypothalamic tissue and presence in serum. Endocrinology 141:
1942–1950
26. Breen TL, Conwell IM, Wardlaw SL 2005 Effects of fasting, leptin, and insulin
on AGRP and POMC peptide release in the hypothalamus. Brain Res 1032:
141–148
Creemers et al. • AGRP Processing in the Hypothalamus
27. Bergeron F, Leduc R, Day R 2000 Subtilase-like pro-protein convertases: from
molecular specificity to therapeutic applications. J Mol Endocrinol 24:1–22
28. Reizes O, Lincecum J, Wang Z, Goldberger O, Huang L, Kaksonen M, Ahima
R, Hinkes MT, Barsh GS, Rauvala H, Bernfield M 2001 Transgenic expression
of syndecan-1 uncovers a physiological control of feeding behaviour by syndecan-3. Cell 106:105–116
29. Strader AD, Reizes O, Woods SC, Benoit SC, Seeley RJ 2004 Mice lacking the
syndecan-3 gene are resistant to diet-induced obesity. J Clin Invest 114:1354 –
1360
30. Reizes O, Benoit SC, Strader AD, Clegg DJ, Akunuru S, Seeley RJ 2003
Syndecan-3 modulates food intake by interacting with the melanocortin/
AGRP pathway. Ann NY Acad Sci 994:66 –73
31. Jackson RS, Creemers JWM, Farooqi IS, Raffin-Sanson M-L, Varro A, Dockray GJ, Holst JJ, Brubaker PL, Corvol P, Polonsky KS, Ostrega D, Becker KL,
Bertagna X, Hutton JC, White A, Dattani MT, Hussain K, Middleton SJ,
Nicole TM, Milla PJ, Lindley KL, O’Rahilly S 2003 Small-intestine dysfunction accompanies the complex endocrinopathy of human proprotein convertase 1 deficiency. J Clin Invest 112:1550 –1560
32. Creemers JW, Usac EF, Bright NA, Van de Loo JW, Jansen E, Van de Ven WJ,
Hutton JC 1996 Identification of a transferable sorting domain for the regulated
pathway in the proprotein convertase PC2. J Biol Chem 271:252845–25291
33. Creemers JW, van de Loo JW, Plets E, Hendershot LM, Van de Ven WJ 2000
Binding of BiP to the processing enzyme lymphoma proprotein convertase
prevents aggregation, but slows down maturation. J Biol Chem 275:38842–
38847
34. van de Loo JW, Teuchert M, Pauli I, Plets E, Van de Ven WJ, Creemers JW
2000 Dynamic palmitoylation of lymphoma proprotein convertase prolongs its
half-life, but is not essential for trans-Golgi network localization. Biochem J
352:827– 833
35. Yi H, Leunissen J, Shi G, Gutekunst C, Hersch S 2001 A novel procedure for
pre-embedding double immunogold-silver labeling at the ultrastructural level.
J Histochem Cytochem 49:279 –284
36. Jansen S, Stefan C, Creemers JW, Waelkens E, Van Eynde A, Stalmans W,
Bollen M, 2005 Proteolytic maturation and activation of autotaxin (NPP2) a
secreted metastasis-enhancing lysophospholipase. J Cell Sci 118:3081–3089
37. Yu JY, DeRuiter SL, Turner DL 2002 RNA interference by expression of
short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad
Sci USA 99:6047– 6052
38. D’Anjou F, Bergeron LC, Larbi NB, Fournier I, Salzet M, Perreault J-P, Day
R 2004 Silencing of SPC2 expression using an engineered ␦ ribozyme in the
mouse ␤TC-3 endocrine cell line. J Biol Chem 279:14232–14239
39. Ebihara K, Ogawa Y, Katsuura G, Numata Y, Masuzaki H, Satoh N, Tamaki
M, Yoshioka T, Hayase M, Matsuoka N, Aizawa-Abe M, Yoshimasa Y,
Nakao K 1999 Involvement of agouti-related protein, an endogenous antagonist of hypothalamic melanocortin receptor, in leptin action. Diabetes 48:
2028 –2033
40. Gill SC, von Hippel PH 1989 Calculation of protein extinction coefficients
from amino acid sequence data. Anal Biochem 182:319 –326
41. Zhu X, Zhou A, Dey A, Norrbom C, Carroll R, Zhang C, Laurent V, Lindberg
I, Ugleholdt R, Holst JJ, Steiner DF 2002 Disruption of PC1/3 expression in
mice causes dwarfism and multiple neuroendocrine peptide processing defects. Proc Natl Acad Sci USA 99:10293–10298
42. Challis BG, Pritchard LE, Creemers JWM, Delplanque J, Keogh JM, Luan J,
Wareham NJ, Yeo GSH, Bhattacharyya S, Froguel P, White A, Farooqi IS,
O’Rahilly SO 2002 A missense mutation disrupting a dibasic prohormone
processing site in pro-opiomelanocortin (POMC) increases susceptibility to
early-onset obesity through a novel molecular mechanism. Hum Mol Genet
17:1997–2004
43. Arunlakshana O, Schild HO 1959 Some quantitative uses of drug antagonists.
Br J Pharmacol 14:48 –58
44. Dey A, Xhu X, Carroll R, Turck CW, Stein J, Steiner DF 2003 Biological
processing of the cocaine and amphetamine-regulated transcript precursors by
prohormone convertases, PC2 and PC1/3. J Biol Chem 278:15007–15014
45. Taylor NA, Van de Ven W, Creemers JWM 2003 Curbing activation: Proprotein convertases in homeostasis and pathology. FASEB J 17:1215–1227
46. Seidah NG, Benjannet S, Wickman L, Marcinkiewicz J, Jasmin SB, Stifani
S, Basak A, Prat A, Chretien M 2003 The secretory proprotein convertase
neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and
neuronal differentiation. Proc Natl Acad Sci USA 100:928 –933
47. Seidah NG, Prat A 2002 Precursor convertases in the secretory pathway,
cytosol and extracellular milieu. Essays Biochem 38:79 –94
48. Schafer MKH, Day R 1995 In situ hybridisation techniques to map processing
enzymes. Methods Neurosci 23:16 – 44
49. Schafer MKH, Day R, Cullinan WE, Chretien M, Seidah NG, Watson SJ 1993
Gene expression of prohormone and proprotein convertases in the rat CNS: a
comparative in situ hybridisation analysis. J Neurosci 13:1258 –1279
50. Shen CP, Wu KK, Shearman LP, Camacho R, Tota MR, Fong TM, Van der
Ploeg LHT 2002 Plasma agouti-related protein level: a possible correlation
with fasted and fed states in humans and rats. J Neuroendocrinol 14:607– 610
51. Pan H, Nanno D, Che FY, Zhu X, Salton SR, Steiner DF, Fricker LD, Devi
LA, 2005 Neuropeptide processing profile in mice lacking prohormone convertase 1. Biochemistry 44:4939 – 4948
Creemers et al. • AGRP Processing in the Hypothalamus
52. Roebroek AJ, Taylor NA, Louagie E, Pauli I, Smeijers L, Snellinx A, Lauwers
A, Van de Ven WJ, Hartmann D, Creemers JW 2004 Limited redundancy of
the proprotein convertase furin in mouse liver. J Biol Chem 279:53442–53450
53. Kaksonen M, Pavlov I, Voikar V, Lauri SE, Hienola A, Riekki R, Lakso M,
Taira T, Rauvala H 2002 Syndecan 3 deficient mice exhibit enhanced LTP and
impaired hippocampus dependent memory. Mol Cell Neurosci 21:158 –172
54. Qian S, Chen H, Weingarth D, Trumbauer ME, Novi DE, Guan X, Yu G, Shen
X, Feng Y, Frazier E, Chen A, Camancho RE, Shearman LP, Gopal-Truter S,
MacNeil DJ, Van der Ploeg LHT 2002 Neither agouti-related protein nor
neuropeptide Y is critically required for the regulation of homeostasis in mice.
Mol Cell Biol 22:5027–5035
55. Benoit SC, Clegg DJ, Strader AD, Reizes O, Deletion of the syndecan-3 gene
attenuates the hyperphagia and obesity of the agouti lethal yellow (Ay) mouse.
Program of the 87th Annual Meeting of The Endocrine Society, San Diego, CA,
2005, p 545 (Abstract P3-11)
56. de Rijke CE, Jackson PJ, Garner KM, van Rozen RJ, Douglas NR, Kas MJH,
Millhauser GL, Adan RAH 2005 Functional analysis of the Ala67Thr poly-
Endocrinology, April 2006, 147(4):1621–1631
57.
58.
59.
60.
1631
morphism in agouti related protein associated with anorexia nervosa and
leanness. Biochem Pharmacol 70:308 –316
Jing E, Nillni EA, Sanchez VC, Stuart RC, Good DJ 2004 Deletion of the Nhlh2
transcription factor decreases the levels of the anorexigenic peptides ␣ melanocyte stimulating hormone and thyrotropin-releasing hormone and implicates prohormone convertases I and II in obesity. Endocrinology 145:1503–1513
Nilaweera KN, Ellis C, Barrett P, Mercer JG, Morgan PL 2003 Precursor
protein convertase 1 gene expression in the mouse hypothalamus: differential
regulation by ob gene mutation, energy deficit and administration of leptin,
and coexpression with prepro-orexin. Neuroscience 119:713–720
Sanchez VC, Goldstein J, Stuart RC, Hovanesian V, Huo L, Munzberg H,
Friedman TC, Bjorbaek C, Nillni EA 2004 Regulation of hypothalamic prohormone convertases 1 and 2 and effects on processing of prothyrotropinreleasing hormone. J Clin Invest 114:357–369
Berman Y, Mzhavia N, Polonskaia A, Devi LA 2001 Impaired prohormone
convertases in Cpefat/Cpefat mice. J Biol Chem 276:1466 –1473
Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the
endocrine community.