Am J Physiol Gastrointest Liver Physiol 282: G491–G500, 2002;
10.1152/ajpgi.00273.2001.
Molecular cloning and functional analysis of the human
Na⫹/H⫹ exchanger NHE3 promoter
JALEH MALAKOOTI, V. C. MEMARK, PRADEEP K. DUDEJA,
AND KRISHNAMURTHY RAMASWAMY
Department of Medicine, Section of Digestive and Liver Diseases, University of Illinois
at Chicago and Chicago Veterans Affairs Westside Division, Chicago, Illinois 60612
Received 20 June 2001; accepted in final form 5 November 2001
(NHE) catalyze the electroneutral exchange of one extracellular Na⫹ for one intracellular H⫹ across the plasma membrane and play a
role in various important cellular functions that include sodium absorption, maintenance of intracellular
pH and cell volume, and regulation of cell proliferation
(for a review, see Refs. 1, 12, 31, 41, and 42). To date, at
least six members of the NHE gene family have been
identified and characterized with regard to their localization to specific sites in the cell and function of the
corresponding protein products (4, 8, 21, 30, 32, 38, 40,
44). For example, the NHE1 isoform was shown to be
ubiquitous in its expression and localized to the basolateral membrane of polarized epithelial cells, whereas
the NHE2 and NHE3 isoforms are localized to the
apical membrane. The NHE4 and NHE5 isoforms are
expressed in the kidney and neural tissues, respectively, whereas the recently cloned NHE6 isoform is
mitochondrial. Although extensive studies have recently been carried out investigating the regulation of
the NHE1 and NHE3 protein products by phosphorylation and interaction with cytoplasmic regulatory proteins (37, 43, 45), only limited studies have been reported on the transcriptional regulation of the NHE
isoforms. Studies focused on the NHE1 isoform have
demonstrated the regulation of NHE1 gene at the
transcriptional level by external acid, growth factors,
serum, and retinoic acid (35, 48, 49). The involvement
of AP-1, AP-2, and other cis elements in the 5⬘-flanking
region of the NHE1 isoform has been reported (13, 14,
26). Among the other NHE isoforms, the promoter
sequences for the human and rat NHE2 (22, 28) and
the rat NHE3 isoform (9, 19) have been identified, and
transcriptional regulation of the rat NHE3 by glucocorticoids and thyroxin has been reported (9, 10, 19).
However, transcriptional regulation of the human
NHE2 and NHE3 isoforms has not been studied.
We have recently reported the genomic organization
and cloning of the human NHE2 gene and its promoter
(22, 23). Our studies described here report, for the first
time, the molecular cloning of the human NHE3 promoter, and they demonstrate the presence of a number
of cis-acting elements that may be involved in regulation of the human NHE3 isoform. We defined a minimal promoter region that contains the maximal promoter activity in C2/bbe cell line and showed that
deletion of a DNA fragment containing the binding
sites for the transcription factors AP-2 and Sp1 results
in a drastic loss of promoter activity. By footprinting
experiments, we have shown that AP-2 binds to two
Address for reprint requests and other correspondence: J. Malakooti, Univ. of Illinois at Chicago, Dept. of Medicine, Section of
Digestive and Liver Diseases, M/C 716, 840 S. Wood St., Chicago, IL
60612 (E-mail address: [email protected]).
The costs of publication of this article were defrayed in part by the
payment of page charges. The article must therefore be hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
nucleotide sequence; transcription factor binding sites; deletion analysis; c2/bbe; transfection
THE NA⫹/H⫹ EXCHANGERS
http://www.ajpgi.org
G491
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
Malakooti, Jaleh, V. C. Memark, Pradeep K. Dudeja,
and Krishnamurthy Ramaswamy. Molecular cloning and
functional analysis of the human Na⫹/H⫹ exchanger NHE3
promoter. Am J Physiol Gastrointest Liver Physiol 282:
G491–G500, 2002; 10.1152/ajpgi.00273.2001.—Na⫹/H⫹ exchanger (NHE) isoforms NHE2 and NHE3, colocalized to the
brush border membrane of the epithelial cells, exhibit differences in their pattern of tissue expression and regulation by
various molecular signals. To investigate the mechanisms
involved in regulation of NHE3 gene expression, the human
NHE3 promoter region was cloned and characterized. Primer
extension experiments located the transcription start site to
a position 116 nucleotides upstream from the translation
start codon. The 5⬘-flanking region lacked a CCAAT box but
contained a TATA-like sequence. Nucleotide sequencing of
the 5⬘-flanking region revealed the presence of a number of
cis elements including Sp1, AP-2, MZF-1, CdxA, Cdx-2, steroid and nonsteroid hormone receptor half sites, and a phorbol 12-myristate 13-acetate-response element. Transient
transfection experiments using C2/bbe cell line defined a
maximal promoter activity in ⫺95/⫹5 region. The regulatory
response elements clustered within this region include a
potential transcription factor IID (TF IID), a CACCC, two
Sp1, and two AP-2 motifs. Deletion of a fragment containing
the AP-2 and Sp1 motifs resulted in a drastic decrease in
promoter activity. In gel mobility shift assays, an oligonucleotide spanning from ⫺78 to ⫺56 bp bound a recombinant
AP-2, and the corresponding binding activity in nuclear extracts was supershifted with anti-AP2␣ antibody. Our studies suggest that the NHE3 expression is regulated by a
combination of cis elements and their cognate transcription
factors that include the AP-2 and Sp1 family members.
G492
FUNCTIONAL ANALYSIS OF THE HUMAN NHE3 PROMOTER
regions in the NHE3 promoter. The AP-2 interaction
with the proximal AP-2 binding site was confirmed
with gel mobility shift assay and supershift analysis.
This work provides the initial framework for further
studies and understanding the molecular mechanisms
responsible for regulation of NHE3 gene expression.
METHODS
AJP-Gastrointest Liver Physiol • VOL
282 • MARCH 2002 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
Materials. All chemicals were purchased from Fisher Scientific (Pittsburgh, PA) or Sigma (St. Louis, MO); restriction
endonucleases and other modifying enzymes were from either New England Biolabs (Beverly, MA), Gibco-BRL (Gaithersburg, MD), or Promega (Madison, WI); polyclonal antihuman AP-2␣, monoclonal anti-human Sp1, Sp2, and Sp3
antibodies were from Santa Cruz Biotechnology (Santa Cruz,
CA); plasmid PCR-II, a TA cloning vector, was from Invitrogen (San Diego, CA); JM109 competent cells and luciferase
assay system were from Promega.
Molecular techniques. DNA manipulations, including restriction enzyme digestion, ligation, plasmid isolation, and
transformation were carried out by standard methods (2).
RNA extraction and PCR analysis. Total RNA was extracted by the RNAzol method (Tel-Test, Friendswood, TX)
according to the manufacturer’s directions. PCR was performed in a Perkin-Elmer/Cetus DNA cycler, with thermostable DNA polymerase rTth (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer’s directions.
Cloning of the 5⬘-flanking region. The 5⬘-regulatory region
of the NHE3 gene was cloned using the Genome Walker kit
(Clontech Laboratories, Palo Alto, CA). PCR amplifications
were performed with genomic DNA fragment pools as template, anchor primers AP1 or AP2 that hybridize to the
5⬘-end of the genomic fragments, and gene-specific primers
GI-318 (5⬘-AGAGCGCGATGACGTAGGGATCC-3⬘) or GI358 (CCCGAGTCCCCACATTGCCGCCTGC) (8). This resulted in amplification of a 1.6-kb DNA fragment. This fragment was cloned in pCR-II cloning vector (Invitrogen) after
gel purification and designated pJM1.6N3. Subsequently,
with the use of primers synthesized based on the nucleotide
sequences of the insert in pJM1.6-N3, a larger fragment (3.0
kb) of the 5⬘-flanking region was amplified and cloned in
pCR-II (pJM3.0 N3). DNA nucleotide sequences at the 3⬘-end
of the 3.0-kb fragment were determined using the dideoxy
chain termination method (36) and compared with the
hNHE3 cDNA. This confirmed that the 3.0-kb fragment represented the 5⬘-flanking region of the NHE3 gene.
Reporter plasmid construction. Plasmids used for functional analysis of the NHE3 promoter activity were generated using pGL2-basic (Promega), that contains a promoterless luciferase reporter gene. To clone the 1.6-kb NHE3
promoter DNA fragment, the insert in pJM1.6N3 was released with restriction enzyme EcoR I, and the ends were
filled in with Klenow. Following gel purification, this DNA
fragment was cloned upstream from the luciferase structural
gene in pGL2-basic that was blunt-ended at the Hind III site.
The clone that carries the promoter in forward direction was
named p1.6 N3P. The plasmid carrying the promoter in
reverse direction, p1.6N3P-Rev, was constructed by digesting
the pJM1.6 N3 with restriction enzymes Xho I plus Hind III
and ligating with pGL2-basic digested with the same enzymes. With the use of restriction enzyme recognition sites
from the NHE3 promoter sequence, chimeric plasmids containing progressive deletions of the NHE3 gene 5⬘-flanking
region were generated. The plasmid containing the ⫺1004/
⫹131 insert was constructed by subcloning a Sac I-Xho I
fragment from p1.6 N3P-Rev into pGL2-basic digested with
the same enzymes. Plasmids harboring the ⫺319/⫹131 and
⫺95/⫹131 sequences were generated by digestion of p1.6
N3P-Rev with Pvu II plus Xho I and Nru I plus Xho I,
respectively, and cloning in pGL2-basic that was digested
with Sma I plus Xho I. Plasmid containing the sequences
from ⫹2/⫹131 was constructed by deletion of a Kpn I fragment from p-1004/⫹131. Plasmid p-95/⫹5 was generated by
digestion of p-95/⫹131 with restriction enzymes Acc65 I plus
Hind III, blunting the ends and religation. Plasmids p-43/
⫹131 and p(⌬⫺187/⫺43) were constructed by deletion of Sac
I-Sac II and Sac II fragments from p-1004/⫹131, respectively.
Primer extension analysis. The transcription initiation site
of the human NHE3 gene was determined by primer extension using SuperScript II RT (Gibco-BRL). An antisense
oligonucleotide complementary to nucleotides ⫹40 to ⫹67
(see Fig. 3) was synthesized and end-labeled with [␥-32P]ATP
and T4 polynucleotide kinase. Free [␥-32P]ATP was removed
by using mini Quick Spin Oligo Columns (Boehringer Mannheim). For primer extension reaction, 105 counts/min (cpm) of
the end-labeled oligonucleotides and 15 ␮g of total RNA from
C2/bbe cells were coprecipitated and dissolved in diethyl
pyrocarbonate-treated water, heated at 75°C for 5 min, and
brought to 42°C. The reaction was complemented with 200
␮M dNTPs and reaction buffer to a final concentration of 100
mM Tris 䡠 HCl (pH 8.3), 150 mM KCl, 6 mM MgCl2, 10 mM
1,4-dithiothreitol (DTT), and 200 units of SuperScript II in a
reaction volume of 20 ␮l. The primer extension was carried
out for 60 min at 42°C. The extension products were phenolchloroform extracted, ethanol precipitated, and pelleted nucleic acids were dissolved in stop solution (US Biochemicals).
The samples were heated at 90°C for 3 min and analyzed on
a 6% polyacrylamide, 7 M urea denaturing gel. The gel was
dried and exposed to X-Omat AR film. A sequencing ladder
was used as a size marker to determine the size of the
extended primer.
Cell culture and transfections. C2/bbe cell line, a subclone
of the Caco-2 cells, was cultured and maintained as described
(22). For transfection studies, cells (1.8 ⫻ 105) were seeded
into 12-well plates and cotransfected 24 h later (80–90%
confluent) with one of the NHE3-luc constructs and pRSV␤gal using Lipofectamine Plus reagent (Gibco-BRL). The
latter plasmid served as an internal control for transfection
efficiency. A total of 2.0 ␮g DNA/well, at a ratio of 4:1 for
experimental vs. pRSV-␤gal, was used for each transfection.
After 48 h, cells were washed with phosphate-buffered saline
and lysed using a kit from Promega. Luciferase activity was
assayed using a luminometer (Promega) and normalized to
␤-galactosidase activity.
DNase I footprinting analysis. To prepare probes for footprinting experiments, the plasmid p1.0N3P was digested
with Kpn I restriction enzyme. DNA fragments were endlabeled after dephosphorylation with calf alkaline phosphatase using polynucleotide kinase and [␥-32P]ATP and then
digested with NruI or Pvu II in two separte reactions. The
labeled probes were purified on a 6% native polyacrylamide
gel. DNase I footprinting analysis was performed using a kit
from Promega, as per instructions. Briefly, 20,000 cpm of
end-labeled probe were incubated in 25 ␮l of binding buffer
(10 mM Tris 䡠 HCl, pH 7.5, 50 mM NaCl, 0.05% Nonidet P-40,
1 mM EDTA, 1 mM DTT, and 10% glycerol) for 10 min on ice
in presence or absence of 2 ␮l AP-2 extract. Fifty microliters
of a solution of Ca⫹2 and Mg⫹2 were added, and incubation
was continued for 1 min at room temperature. The reaction
mixtures were treated with 3 ␮l of diluted QRI (RNase-free
DNase from Promega) for 1 min at room temperature, and
further digestion was stopped by addition of 90 ␮l stop
FUNCTIONAL ANALYSIS OF THE HUMAN NHE3 PROMOTER
RESULTS
Cloning of the human NHE3 promoter. With the use
of the genome walking technique, we cloned a 3.0-kb
DNA fragment upstream of the human NHE3 translation initiation codon. Nucleotide sequence analysis of
the 3⬘-end of this clone confirmed that the cloned DNA
fragment overlaps with the 5⬘-end of the hNHE3 cDNA
reported previously (8).
The NHE3 promoter fragment directs luciferase activity in the C2/bbe cell line. We have chosen to use the
human intestinal epithelial cell line C2/bbe as a model
to study the functional and molecular characteristics of
the human NHE3 promoter. The C2/bbe cell line is a
subclone derived from a heterogeneous population of
the Caco-2 cells and has been shown to undergo spontaneous differentiation, as determined by exhibiting
characteristics of the microvilli and the presence of the
markers of differentiation (33). In a previous study
(22), by using RT-PCR analysis, we have established
that C2/bbe cells express NHE1, NHE2, and NHE3
mRNA. However, the endogenous level of NHE3 protein expression as assessed by Western blots seems to
be very low in these cells, becuase NHE2 is readily
detected but not NHE3 (25). Recent studies (29) from
the same group indicated that treatment with shortchain fatty acids resulted in augmentation of the
NHE3 activity and protein expression in C2/bbe cell
line.
A 1.6-kb fragment of the promoter/enhancer region
was cloned in both orientations upstream from the
luciferase reporter gene, and the luciferase activity of
the chimeric constructs, which is a direct measure of
the promoter activity, was measured in transiently
transfected C2/bbe cells. As shown in Fig. 1, the for-
Fig. 1. Expression of the human Na⫹/H⫹ exchange (NHE) 3 promoter-luciferase chimeric constructs in the C2/bbe cell line. Both
sense and antisense orientations of a 1.6-kb fragment of hNHE3
promoter region were cloned upstream from luciferase gene, and
promoter activity of the cloned DNA was established by transiently
expressing promoter-reporter constructs in C2/bbe cells. Corrections
for transfection efficiency were made by cotransfection with pRSV␤gal vector. Promoter activity was calculated by fold increase over
the luciferase activity of the control pGL2-basic. The high level of
promoter activity in the sense orientation is indicative of the promoter competence of the cloned NHE3 5⬘-regulatory region. Values
are means ⫾ SE (n ⫽ 4).
ward orientation, pJM1.6N3P, reproducibly showed a
marked increase in luciferase gene expression compared with the pGL2-basic vector. No luciferase activity over the background level was obtained for reverse
construct, pJM1.6 N3P-Rev, indicating that the promoter activity was orientation dependent.
Identification of the transcription initiation site. To
map the transcription initiation site of the NHE3 gene,
we employed primer extension analysis. A 29-mer oligonucleotide complementary to the sense strand at
position ⫹40 to ⫹67 (Fig. 3) was used as an extension
primer. Total RNA from the C2/bbe cells was hybridized with this end-labeled primer and subjected to
reverse transcription. Extension products were analyzed on sequencing gel. A 67-nucleotide primer extension product was identified where C2/bbe RNA was
used in the reaction (Fig. 2, lane 1), whereas no signal
was found in control yeast transfer RNA (Fig. 2, lane
2). On the basis of this observation, the transcription
initiation site of the human NHE3 gene was assigned
to a deoxyguanosine residue, 116 nucleotides upstream
from the translation initiation site. This site was designated ⫹1, the start of transcription initiation.
DNA Sequence and characterization of the 5⬘-flanking region of NHE3. The nucleotide sequence of the
1.6-kb NHE3 promoter fragment was determined and
is shown in Fig. 3 (GenBank accession no. AF282824).
Between the ATG translation in start codon and the
transcription initiation site lie the NHE3 minicistron
(8) and the 5⬘-untranslated region of 83 nucleotides.
Two sets of directly repeated sequences composed of
penta- and decamer were observed downstream from
the transcription initiation site (Fig. 3).
The 5⬘-flanking region of the NHE3 gene was highly
GC-rich, especially the region surrounding the transcription initiation site from a Pvu II restriction enzyme site at ⫺319 to the ATG translation start site at
AJP-Gastrointest Liver Physiol • VOL
282 • MARCH 2002 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
solution. The pellet was suspended in loading buffer after
phenol/chloroform (1:1) extraction and ethanol precipitation,
denatured by heating at 95 °C for 3 min, and analyzed on a
6% sequencing gel. The gel was dried and autoradiographed.
Gel mobility shift assay. All oligonucleotides for gel mobility shift assay (GMSA) were synthesized by Gibco-BRL. Complementary oligonucleotides were made double-stranded by
heating to 95°C for 5 min and slow cooling to 25°C in TE
buffer (10 mM Tris 䡠 HCl, pH 7.5, 1 mM EDTA). The singlestranded sequence of the AP-2 probe was 5⬘-GGCTCCGCCCCGGGGCGGGAGGG-3⬘, where homology to consensus
sequence is shown in bold letters. Nuclear proteins were
prepared essentially as previously described (2). Protein/
DNA binding reactions were performed in binding buffer [50
mM Tris 䡠 HCl (pH 7.5), 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM
DTT, 50 mM NaCl, 1 ␮g/sample poly(dI.dC)-poly(dI.dC), 4%
glycerol] and 30,000 cpm of the probe. Reactions were initiated by addition of the nuclear proteins (3–5 ␮g) and incubation for 20 min at room temperature before electrophoresis
on a native 4% polyacrylamide gel in 0.5⫻ TBE running
buffer (45 mM Tris borate, 1 mM EDTA, pH 8.3). Gels were
dried and visualized by autoradiography. In competition assays, the unlabeled competitor oligonucleotide was added to
the reaction 10 min before the addition of the labeled probe.
Supershift assays were performed by addition of 1 ␮l of the
AP-2␣ antibody (Santa Cruz Biotechnology) after the initial
20-min incubation with the labeled probe and then further
incubation for 30 min at room temperature.
G493
G494
FUNCTIONAL ANALYSIS OF THE HUMAN NHE3 PROMOTER
⫹117 has an overall G⫹C content of 80%. The nucleotide sequence of the 1.6-kb promoter fragment was
screened for potentially important cis elements. The
putative response elements found within this region
are indicated in Fig. 3. A TATA boxlike sequence,
GATTAAA, is located at position ⫺40, whereas no
CCAAT box were found in close vicinity of the transcription initiation site. However, a cluster of binding
sites for a number of transcription factors is present
immediately upstream of the transcription start site.
These include binding sites for Sp1 (⫺25 to ⫺12, ⫺69
to ⫺72, ⫺84 to ⫺72, and ⫺142 to ⫺130); AP-2 (⫺17 to
⫺28 and ⫺56 to ⫺67); CACCC (⫺32 to ⫺27); MZF-1
(⫺22 to ⫺14); TF IID (⫺41 to ⫺35). Further upstream,
several other potentially important sites were identified such as AP-4/E47/MyoD, PEA3, CCAAT, Cdx-2,
and cAMP-response element binding site. Moreover,
putative cis elements for TRE and 1/2 sites for GRE
were also identified in this region.
The rat NHE3 promoter has been cloned and sequenced by two different groups (9, 19). Some of the cis
elements identified in the human NHE3 promoter region are also present in the rat gene. Given these
similarities, we compared the DNA nucleotide sequences of the 5⬘-nontranscribed regions of these promoters (Fig. 4). The sequence of the human NHE3
proximal promoter region (⫺100 to ⫹1) was 79% identical to that of the rat sequence. The consensus sequences for Sp1, TF IID, and CACCC were present in
AJP-Gastrointest Liver Physiol • VOL
282 • MARCH 2002 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
Fig. 2. Primer extension experiment. A total of 15 ␮g RNA from
C2/bbe cells (lane 1) and yeast tRNA (lane 2) was annealed to
32
P-labeled antisense primer corresponding to position ⫹40 to ⫹67
(Fig. 3), and extended by SuperScript II RT. The extension products
were analyzed by electrophoresis on a 6% polyacrylamide, 7 M urea
sequencing gel. A sequence ladder of the NHE3 5⬘-flanking DNA
region primed with the same primer as in primer extension reactions
is shown and indicated by A, C, G, and T. The transcription initiation
site is indicated by * on the sense strand.
similar positions in the two species in this region.
However, there were other cis elements for different
transcription factor binding sites that are unique in
each promoter (Fig. 4), suggesting that different mechanisms may be involved in the expression of NHE3 in
these species. The overall sequence homology was 38%,
and no obvious regional sequence identities were found
with this homology search in the upstream region.
5⬘-Deletion analysis of the NHE3 promoter in C2/bbe
cells. To identify the promoter regions that were involved in directing NHE3 gene expression, luciferase
reporter constructs carrying serially truncated segments of the 5⬘-flanking region were generated in
pGL2-basic vector. Figure 5 shows a comparison of the
luciferase activity between deletion constructs. The
full-length promoter construct, p3.0N3P (⫺2900 to
⫹131), exhibited a 20-fold activation of the luciferase
activity compared with the promoterless vector. The
deletion of sequences from ⫺2900 to ⫺1507 bp led to a
40-fold increase in promoter activity compared with
promoterless vector, suggesting that an inhibitory element may be located at this region. Further deletion
from ⫺1507 to ⫺1004 did not show a significant difference in the luciferase activity. However, more extensive deletions to positions at ⫺319 and ⫺95 bp resulted
in ⬃50- and 65-fold increases in promoter activity
compared with the vector or 2.6- and 3.2-fold over the
full-length promoter construct, respectively. The moderate increase in luciferase activity in plasmid containing ⫺319/⫹131 bp compared with the previous truncated construct may also be attributed to the loss of a
suppressor cis element contained within the deleted
DNA region. A number of putative response elements
are located within this region (Fig. 3), and whether any
of these regulatory factor(s) is involved in transcriptional repression of the NHE3 promoter is not clear at
this point. As shown in Fig. 5, the construct containing
sequences ⫺95 to ⫹5 bp contained the highest luciferase activity.
Transcriptional activity of the ⫺1004/⫹131 construct after deletion of AP-2 and Sp1. We examined the
importance of the sequences in the proximal promoter
region by introducing an internal deletion that removed a 144-bp Sac II fragment immediately upstream
from the putative TF IID-like binding site. A schematic
drawing of the cis elements contained within the deleted region is shown in Fig. 6, top, and includes an
overlapping Sp1/Egr-1, Sp1, and an overlapping Sp1/
AP-2 motif. Expression of this deletion construct
(⌬⫺187 to ⫺43) in C2/bbe cells resulted in a 75%
decrease in the basal level of NHE3 transcription compared with the parental construct (⫺1004/⫹131; Fig.
6), indicating a critical role for this region in NHE3
promoter expression. When the sequences upstream
from nucleotides ⫺43 (Fig. 6, ⫺43/⫹131) or ⫹2 (⫹2/
⫹131; Fig. 6) were removed, the level of luciferase
activity dropped to the background level, suggesting
that sequences downstream from the ⫺43 position
alone do not contribute to transcription activity of the
NHE3 gene. However, deletion of sequences between
⫹5 to ⫹131 had a positive effect on the reporter gene
FUNCTIONAL ANALYSIS OF THE HUMAN NHE3 PROMOTER
G495
expression, as shown by a 25% increase in luciferase
activity of the ⫺95/⫹5 construct compared with ⫺95/
⫹131 construct (Fig. 6). Thus these observations indicate that the smallest promoter fragment containing
sequences between ⫺95 to ⫹5 promotes the maximal
luciferase activity and that all of the cis elements
required for optimal NHE3 promoter activity are
present in the first 95 nucleotides of the 5⬘-flanking
region.
To investigate the involvement of the putative cis
elements indicated by Sac II deletion (Fig. 6) in transcriptional regulation of the NHE3, DNase I footprinting experiments were undertaken. An Escherichia coli
extract containing the cloned AP-2 protein, AP-2 extract, was used as the source of AP-2 transcription
factor. Figure 7 shows an autoradiogram of the footprint seen with the AP-2 extract and two overlapping
DNA probes from the NHE3 5⬘-regulatory region. In
Fig. 4. Alignment of the human and rat NHE3 promoter sequences. The hNHE3 promoter sequence (GenBank
accession no. AF282824) was aligned with the rat NHE3 promoter sequence. Bold characters represent the
identical nucleotides. The potential cis elements that may be conserved between the 2 species are boxed. The
putative transcription factor binding sites specific to the human NHE3 or the rat NHE3 are over- and underlined,
respectively. The ⫹ or ⫺ signs represent the location of the cis elements on the sense or antisense strand. The
transcription initiation site of the hNHE3 gene is shown by ⫹1. Sequence gaps are shown by dashes.
AJP-Gastrointest Liver Physiol • VOL
282 • MARCH 2002 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
Fig. 3. Nucleotide sequence of the 1.6-kb hNHE3 promoter region. The transcription start site is marked ⫹1. The
translation initiation codon of hNHE3 gene is indicated by double underlines. The start and stop codons of the
hNHE3 minicistron are underlined. The putative trans-acting transcription factor binding sites are indicated by
bold characters and presented by (⫹) or (⫺) for their location on the sense or antisense strand. Two sets of direct
repeat elements are indicated by arrows.
G496
FUNCTIONAL ANALYSIS OF THE HUMAN NHE3 PROMOTER
these experiments, two DNase I-protected regions were
identified: a proximal AP-2 binding site was present at
bp ⫺51 to ⫺71 and another site at ⫺176 to ⫺198. The
role of the proximal AP-2 binding site in the NHE3
gene expression was explored further by GMSA.
Fig. 6. Transcriptional activity of the
truncated constructs of the human
NHE3 promoter region. A schematic
diagram depicting the 1.0 kb of the
hNHE3 gene promoter and an enlarged ⫹1 to ⫺187 DNA region is
shown above the constructs. Various
deletions of the NHE3 promoter region
were linked to the promoterless luciferase gene and cotransfected with
pRSV-␤gal as an internal control for
transfection efficiency into C2/bbe
cells. The promoter activity is corrected for transfection efficiency using
␤-galactosidase activity and presented
relative to the luciferase activity of the
promoterless vector. Results presented
are the means of at least 3 independent
transfection experiments performed in
triplicates ⫾ SE. The construct name
of each plasmid indicates the length of
the regulatory region based on sequence data of Fig. 3, except for
⌬⫺187/⫺43, which is a Sac II internal
deletion in plasmid carrying ⫺1004/
⫹131 DNA region. The potential transcription binding sites on the ⫺187/⫹1
DNA region are indicated on the left.
AJP-Gastrointest Liver Physiol • VOL
282 • MARCH 2002 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
Fig. 5. The structure and promoter activity of various 5⬘-deletion
constructs of the human NHE3 gene promoter region. A series of
promoter deletion mutant-luciferase gene chimeric plasmids with
various 5⬘-ends and a common 3⬘-end (⫹131) were cotransfected with
pRSV-␤gal into C2/bbe cells. After 48 h, the cells were lysed and
assayed for luciferase and ␤-galactosidase activities. The promoter
activity is expressed relative to the activity of the pGL2-basic and is
normalized for variations in transfection efficiency using ␤-galactosidase activity. Results presented are means of at least 3 independent transfections experiments performed in triplicates ⫾ SE. The
arrow indicates the transcription initiation site and the direction of
transcription. The construct name of each plasmid indicates the
length of the regulatory region based on sequence data of Fig. 3. Luc,
luciferase.
The transcription factor AP-2 Binds to the NHE3
proximal promoter. A perfect match to the consensus
AP-2 binding site (5⬘-GCCCNNNGGC-3⬘) (47) is located in the proximal footprint shown in Fig. 7. Labeled oligonucleotides spanning this AP-2 element at
⫺67 to ⫺56 bp, N3-Ap2, were coupled with AP-2 extract (Promega) and analyzed by GMSA. As illustrated
in Fig. 8A, lane 2, a single DNA/protein complex was
detected (shown by an arrow). To determine the specificity of this DNA/protein complex, an excess of 100and 200-fold unlabeled N3-AP2 oligonucleotide was
used as a competitor. This resulted in the elimination
of the DNA/protein complex (Fig. 8A, lanes 3 and 4),
whereas inclusion of an unlabeled nonspecific oligonucleotide as a competitor did not affect the complex
formation (lanes 5 and 6). With the use of a labeled
oligonucleotide containing the consensus sequence for
AP-2 transcription factor binding site as a probe (Promega), a complex was formed (lane 7) that migrated at
the same position as that of the N3-AP2 probe. This
DNA/protein complex was competed away with unlabeled N3-AP2 oligonucleotide (lanes 7 and 8). Gel mobility shift assays were also performed with nuclear
extracts from three human intestinal cell lines: Caco-2,
T84, and C2/bbe. The nuclear extracts of all three cell
lines contained the same binding activity with N3-Ap2
probe, which migrated at the same positions. The result of GMSA with the C2/bbe nuclear extract is shown
in Fig. 8B, lanes 5–8. To confirm the identity of the
protein in this complex, we performed supershift experiments using antibody against AP-2␣. As shown in
Fig. 8B, lane 3, the DNA/protein complex formed by
AP-2 extract was shifted completely, whereas the complex formed by C2/bbe nuclear proteins (lane 6) was
FUNCTIONAL ANALYSIS OF THE HUMAN NHE3 PROMOTER
G497
antibody. These data confirm that Ap-2⬀ is one of the
transcription factors from C2/bbe nuclear proteins that
interact with the NHE3 promoter.
DISCUSSION
Members of NHE gene family exhibit highly restricted temporal and spatial expression patterns.
NHE2 and NHE3 isoforms are expressed at the apical
membranes of the epithelial cells, where they play a
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
Fig. 7. DNase I footprinting analysis of AP-2 binding sites. Two
fragments (⫺95 to ⫹1 and ⫺319 to ⫹1) from the NHE3 promoter
region were end-labeled at the ⫹1 position and used as probes. The
location of DNase I protected sites are indicated on the right of each
panel. The panel on the left is the top portion of the panel on the
right, showing the DNase I protected region of the longer probe.
Lanes 1 and 3 are control probe without AP-2 extract; in lanes 2 and
4, probes were coupled with 2 ␮l AP-2 extract. The numbers indicate
the position of the protected region relative to the transcription
initiation site.
shifted only partially. The identity of the remaining
unshifted protein in not clear at this time, but it may
be another protein interacting with this probe, or it
could be the residual AP-2 that is not coupled with the
Fig. 8. AP-2 transcription factor interacts with the AP-2 binding site in
the human NHE3 promoter region. A: GMSA performed with 1 ␮g AP-2
extract (Promega) and double-stranded end-labeled N3-AP2 oligonucleotides (position ⫺74 to ⫺49; lanes 1–6) or control AP-2 oligonucleotides
(lanes 7–9; Promega). Competition experiments performed with either
unlabeled specific oligonucleotides or unrelated (nonspecific) competitor. The end-labeled probes were incubated with nuclear extract for 20
min at room temperature and binding mixtures analyzed by electrophoresis on 4% polyacrylamide gels. B: N3-AP-2 probe was tested in a
GMSA with either AP-2 extract (lanes 1–4) or nuclear extracts (5 ␮g)
isolated from C2/bbe cells. ⫹ and ⫺ signs indicate the presence or
absence of reaction components (shown on the left) in the binding
mixture. An arrow shows the DNA/protein complex. Anti-AP-2␣ antibody (Santa Cruz) was added to the binding reaction in lane 6. The
supershift complex is indicated by *.
AJP-Gastrointest Liver Physiol • VOL
282 • MARCH 2002 •
www.ajpgi.org
G498
FUNCTIONAL ANALYSIS OF THE HUMAN NHE3 PROMOTER
repeat elements (Fig. 3), and a number of potential
transcription factor binding sites (data not shown).
Whether these motifs are responsible for the inhibitory
effect residing in the ⫹5/⫹131 region is not known at
the present. A deletion from ⫺95 to ⫺43, which includes the Sp1 and AP-2 cis elements resulted in a total
loss of reporter plasmid activity, suggesting the importance of the Sp1 and AP-2 transcription factors for the
hNHE3 gene expression in C2/bbe cells.
A comparison of the human and the rat (19) NHE3
promoter sequences in the nontranscribed region exhibited that the sequence identity of the two promoters
was confined to the vicinity of the transcription initiation site (Fig. 4). This region coincides with the human
NHE3 promoter region (⫺95/⫹1) that drives the maximal luciferase activity in promoter-reporter transfection assays (Fig. 6). The consensus is that Sp1, AP-2,
and TATA-like sequences appeared at the same positions in both species in this region. However, there
were other potential cis elements for different transcription factor binding sites that are unique in each
promoter (Fig. 4), suggesting that different mechanisms may be involved in the expression of NHE3 in
these species and may offer a clue to the mechanisms
by which the NHE3 gene is regulated.
Transcriptional regulation of the NHE3 gene by various agents is likely to be mediated by trans-acting
factors that bind to the promoter region. Glucocorticoids have been shown to increase NHE3 mRNA levels
(9, 19, 50). Thyroid hormone has also been reported to
activate NHE3 transcription (10). Phorbol 12-myristate 13-acetate on the other hand showed inhibitory
effects on expression of NHE3 gene (3, 16, 20). Ontogenic increase in Na⫹/H⫹ exchange activity that correlated with the increasing levels of NHE3 mRNA and
protein abundance has been reported (5, 11). In addition, postnatal administration of glucocotricoids and
thyroid hormone was shown to increase NHE3 mRNA
and protein levels during maturation (5, 6). We have
identified a potential binding site for T3R at position
⫺211 to ⫺198 and many half sites for glucocorticoid
receptor binding on the NHE3 promoter region. These
sites may be responsible for mediating the stimulatory
effects of thyroid hormone and glucocorticoids shown in
the studies mentioned above. Furthermore, it appears
that at least two Sp1 and AP-2 cis-acting elements in
the proximal promoter region control the basal transcription activity. AP-2 transcription factor modulates
the expression of many genes as an activator (13, 18) or
as a repressor (17). The ability of the recombinant AP-2
transcription factor to physically interact with the
NHE3 promoter region was established by DNase I
footprinting experiments (Fig. 7) and GMSA (Fig. 8).
AP-2 transcription factor binds to at least two regions
in the NHE3 promoter. The proximal binding site at
the ⫺51 to ⫺71 position is contained within the
⫺95/⫹1 promoter fragment. Interaction of AP-2 with
this motif was shown by GMSA and confirmed by
supershift experiments where an antibody against
AP-2␣ was utilized. Deletion of this AP-2 cis element
along with the upstream Sp1 binding sites resulted in
AJP-Gastrointest Liver Physiol • VOL
282 • MARCH 2002 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
major role in transepithelial Na⫹ absorption. To better
understand the mechanisms underlying the regulation
of the apical membrane NHE isoforms, we have focused our studies on the transcriptional regulation of
the human NHE2 and NHE3. Previously we (22) have
reported the cloning and preliminary characterization
of the human NHE2 promoter. In the current study, we
have cloned and identified the human NHE3 promoter
region. Primer extension analysis identified a transcription initiation site 116 nucleotides upstream from
the translation start codon. Nucleotide sequence analysis of the 1.6-kb promoter region revealed multiple
potential cis-acting elements upstream from the transcription initiation site. These included Sp1, AP-2,
Cdx-2, Mzf-1, MyoD, Egr-1, glucocorticoid, and thyroid
hormone receptor binding sites. A CCAAT box sequence was not present in the immediate vicinity of the
transcription initiation site, but a TATA-like sequence
was found at approximately the ⫺40 position. These
features and also the presence of a highly GC-rich
region surrounding the transcription initiation site in
conjunction with multiple Sp1 cis elements in this
region may suggest a housekeeping role for the NHE3
gene. However, NHE3 promoter also contains features
common in regulated genes. This is evident by the
presence of the potential transcription factor binding
sites that mediate tissue-specific and developmental
regulation of the regulated genes. For example, the
presence of Cdx-2, which is involved in gene expression
and differentiation in the intestine (39), MyoD, which
is implicated in myocyte differentiation (7), and Mzf-1,
which is involved in erythrocyte-specific gene expression and regulation (27) would suggest developmental
expression and tissue-specific regulation of this isoform.
Deletion of a 1.5-kb fragment from the 5⬘-flanking
region of the NHE3 promoter showed that the deleted
region had a marked inhibitory effect on the expression
of the luciferase gene. Moreover, further deletions toward the transcription initiation site also resulted in
augmentation of the luciferase activity of the corresponding reporter constructs (Fig. 4). Although the
elements responsible for the inhibitory effect have not
been defined, the increase in the luciferase activity of
the 5⬘-deletion reporter constructs argues that the upstream region contains repressive functions. The physiological role of the negative regulatory elements in the
NHE3 promoter remains to be determined. One possibility is that it could mediate the divergent levels of the
NHE3 gene expression seen in various tissues (8).
Further deletions revealed that the region between
⫺95 and ⫹131 contained the highest luciferase activity. This region contained three potential Sp1, two
AP-2, and also an atypical TATA cis element. When the
⫹5 to ⫹131 DNA region was eliminated, the luciferase
activity of the new construct was increased ⬃25% (Fig.
5), suggesting that the nucleotide sequence between
transcription initiation site and the translation start
codon may be involved in the repression of NHE3
promoter activity. The exon-1 sequence in this region
harbors the NHE3 minicistron (8), two sets of direct
FUNCTIONAL ANALYSIS OF THE HUMAN NHE3 PROMOTER
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
We thank R. Dahdal for technical help.
This study was funded by the National Institute of Diabetes and
Digestive and Kidney Diseases Grant DK-33349 and by the Dept. of
Veterans Affairs.
20.
REFERENCES
21.
1. Aronson PS. Kinetic properties of the plasma membrane
Na⫹-H⫹ exchanger. Annu Rev Physiol 47: 545–560, 1985.
2. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman
JG, and Struhl K (Editors). Current Protocols in Molecular
Biology. New York: Wiley, 1995.
3. Azarani A, Goltzman D, and Orlowski J. Parathyroid hormone and parathyroid hormone-related peptide inhibit the api-
22.
AJP-Gastrointest Liver Physiol • VOL
cal Na⫹/H⫹ exchanger NHE3 isoform in renal cells (OK) via a
dual signaling cascade involving protein kinase A and C. J Biol
Chem 270: 20004–20010, 1995.
Baird NR, Orlowski J, Szabo EZ, Zaun HC, Schultheis PJ,
Menon AG, and Shull GE. Molecular cloning, genomic organization, and functional expression of Na⫹/H⫹ exchanger isoform 5
(NHE5) from human brain. J Biol Chem 274: 4377–4382, 1999.
Baum M, Biemesderfer D, Gentry D, and Aronson PS.
Ontogeny of rabbit renal cortical NHE3 and NHE1: effect of
glucocorticoids. Am J Physiol Renal Fluid Electrolyte Physiol
268: F815–F820, 1995.
Baum M, Dwarakanath V, Alpern RJ, and Moe OW. Effects
of thyroid hormone on the neonatal renal cortical Na⫹/H⫹ antiporter. Kidney Int 53: 1254–1258, 1998.
Blackwell TK and Weintraub H. Differences and similarities
in DNA-binding preferences of MyoD and E2A protein complexes
revealed by binding site selection. Science 250: 1104–1110, 1990.
Brant SR, Yun CH, Donowitz M, and Tse CM. Cloning, tissue
distribution, and functional analysis of the human Na⫹/H⫹ exchanger isoform, NHE3. Am J Physiol Cell Physiol 269: C198–
C206, 1995.
Cano A. Characterization of the rat NHE3 promoter. Am J
Physiol Renal Fluid Electrolyte Physiol 271: F629–F636, 1996.
Cano A, Baum M, and Moe OW. Thyroid hormone stimulates
the renal Na/H exchanger NHE3 by transcriptional activation.
Am J Physiol Cell Physiol 276: C102–C108, 1999.
Collins JF, Xu H, Kiela PR, Zeng J, and Ghishan FK.
Functional and molecular characterization of NHE3 expression
during ontogeny in rat jejunal epithelium. Am J Physiol Cell
Physiol 273: C1937–C1946, 1997.
Counillon L and Pouyssegur J. The expanding family of
eucaryotic Na⫹/H⫹ exchangers. J Biol Chem 275: 1–4, 2000.
Dyck JR, Silva NL, and Fliegel L. Activation of the Na⫹/H⫹
exchanger gene by the transcription factor AP- 2. J Biol Chem
270: 1375–1381, 1995.
Horie S, Moe O, Yamaji Y, Cano A, Miller RT, and Alpern
RJ. Role of protein kinase C and transcription factor AP-1 in the
acid-induced increase in Na⫹/H⫹ antiporter activity. Proc Natl
Acad Sci USA 89: 5236–5240, 1992.
Janecki AJ, Montrose MH, Tse CM, de Medina FS,
Zweibaum A, and Donowitz M. Development of an endogenous epithelial Na⫹/H⫹ exchanger (NHE3) in three clones of
caco-2 cells. Am J Physiol Gastrointest Liver Physiol 277: G292–
G305, 1999.
Janecki AJ, Montrose MH, Zimniak P, Zweibaum A, Tse
CM, Khurana S, and Donowitz M. Subcellular redistribution
is involved in acute regulation of the brush border Na⫹/H⫹
exchanger isoform 3 in human colon adenocarcinoma cell line
Caco-2. Protein kinase C-mediated inhibition of the exchanger.
J Biol Chem 273: 8790–8798, 1998.
Jiang JG, DeFrances MC, Machen J, Johnson C, and
Zarnegar R. The repressive function of AP2 transcription factor
on the hepatocyte growth factor gene promoter. Biochem Biophys
Res Commun 272: 882–886, 2000.
Johnson AC. Activation of epidermal growth factor receptor
gene transcription by phorbol 12-myristate 13-acetate is mediated by activator protein 2. J Biol Chem 271: 3033–3038, 1996.
Kandasamy RA and Orlowski J. Genomic organization and
glucocorticoid transcriptional activation of the rat Na⫹/H⫹ exchanger Nhe3 gene. J Biol Chem 271: 10551–10559, 1996.
Kandasamy RA, Yu FH, Harris R, Boucher A, Hanrahan
JW, and Orlowski J. Plasma membrane Na⫹/H⫹ exchanger
isoforms (NHE1, -2, and -3) are differentially responsive to
second messenger agonists of the protein kinase A and C pathways. J Biol Chem 270: 29209–29216, 1995.
Klanke CA, Su YR, Callen DF, Wang Z, Meneton P, Baird
N, Kandasamy RA, Orlowski J, Otterud BE, Leppert M,
Shull GE and Menon AG. Molecular cloning and physical and
genetic mapping of a novel human Na⫹/H⫹ exchanger (NHE5/
SLC9A5) to chromosome 16q221. Genomics 25: 615–622, 1995.
Malakooti J, Dahdal RY, Dudeja PK, Layden TJ, and Ramaswamy K. The human Na⫹/H⫹ exchanger NHE2 gene:
genomic organization and promoter characterization. Am J
Physiol Gastrointest Liver Physiol 280: G763–G773, 2001.
282 • MARCH 2002 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
the loss of promoter activity of the corresponding reporter construct, alluding to the potential functional
importance of AP-2 and Sp1 in transcription activation
of the NHE3 promoter. The second AP-2 binding motif
at ⫺179 to ⫺199 was not readily identified by homology search due to its lower sequence identity to the
AP-2 consensus sequence; however, this region was
clearly protected from DNase I digestion by interactions with the AP-2 protein. Dyck et al. (13) have
shown that the AP-2 transcription factor is involved in
the activation of the mouse NHE1 gene. The expression
of AP-2 is increased on cell differentiation and is regulated in a cell-type specific manner (46). Our RT-PCR
analysis of RNA isolated from C2/bbe cells grown for 1,
3, 7, 14, and 21 days postplating exhibited increasing
levels of NHE3 mRNA expression on cell differentiation (J. Malakooti and K. Ramaswamy, unpublished
data). In addition, Janecki and co-workers (15) have
reported that the NHE3 gene activity increases during
Caco-2 cell differentiation. Therefore, in light of these
observations, it is tempting to speculate that the increased expression of NHE3 gene might be linked to
increased AP-2 levels; however, this theory remains to
be proven experimentally.
In summary, to understand how the apical Na⫹/H⫹
exchanger isoforms are regulated, we have located and
isolated the human NHE3 gene promoter. Our studies
showed that the NHE3 promoter has potential binding
sites for a number of nuclear proteins. According to the
transient transfection assays in a luciferase-reporter
system, the first 95 nucleotides upstream from the
transcription initiation site of the NHE3 promoter hold
the majority of the transcriptional activity of the NHE3
promoter. The ⫺95/⫹1 fragment contains two overlapping Sp1 sites, one on the sense and the other on the
antisense strands, of which the latter also overlaps
with the AP-2 site. Deletion of a portion of the promoter that includes the binding sites for the Sp1 and
AP-2 motifs resulted in a drastic decrease in the promoter activity. We showed by footprinting and GMSA
assays that AP-2 interacted with this promoter region.
Additional studies are underway to better understand
how Sp1 family members interact with the NHE3 promoter region and how the overlapping Sp1 and AP-2
binding sites contribute to the expression of the NHE3
gene. The overlapping Sp1 and AP-2 binding sites have
been reported to be involved in gene regulation in other
systems (24, 34). Therefore, this region might prove to
be important for expression of the NHE3 gene.
G499
G500
FUNCTIONAL ANALYSIS OF THE HUMAN NHE3 PROMOTER
36. Sanger F, Nicklen S, and Coulson AR. DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463–
5467, 1977.
37. Sardet C, Counillon L, Franchi A, and Pouyssegur J.
Growth factors induce phosphorylation of the Na⫹/H⫹ antiporter, glycoprotein of 110 kD. Science 247: 723–726, 1990.
38. Sardet C, Franchi A, and Pouyssegur J. Molecular cloning,
primary structure, and expression of the human growth factoractivatable Na⫹/H⫹ antiporter. Cell 56: 271–280, 1989.
39. Suh E, Chen L, Taylor J, and Traber PG. A homeodomain
protein related to caudal regulates intestine-specific gene transcription. Mol Cell Biol 14: 7340–7351, 1994.
40. Tse CM, Brant SR, Walker MS, Pouyssegur J, and Donowitz M. Cloning and sequencing of a rabbit cDNA encoding an
intestinal and kidney-specific Na⫹/H⫹ exchanger isoform
(NHE3). J Biol Chem 267: 9340–9346, 1992.
41. Tse M, Levine S, Yun C, Brant S, Counillon LT, Pouyssegur J, and Donowitz M. Structure/function studies of the
epithelial isoforms of the mammalian Na⫹/H⫹ exchanger gene
family. J Membr Biol 135: 93–108, 1993.
42. Wakabayashi S, Shigekawa M, and Pouyssegur J. Molecular physiology of vertebrate Na⫹/H⫹ exchangers. Physiol Rev 77:
51–74, 1997.
43. Wang H, Silva NL, Lucchesi PA, Haworth R, Wang K,
Michalak M, Pelech S, and Fliegel L. Phosphorylation and
regulation of the Na⫹/H⫹ exchanger through mitogen-activated
protein kinase. Biochemistry 36: 9151–9158, 1997.
44. Wang Z, Orlowski J, and Shull GE. Primary structure and
functional expression of a novel gastrointestinal isoform of the
rat Na/H exchanger. J Biol Chem 268: 11925–11928, 1993.
45. Weinman EJ and Shenolikar S. The Na-H exchanger regulatory factor. Exp Nephrol 5: 449–52, 1997.
46. Williams T, Admon A, Luscher B, and Tjian R. Cloning and
expression of AP-2, a cell-type-specific transcription factor that
activates inducible enhancer elements. Genes Dev 2: 1557–1569,
1988.
47. Williams T and Tjian R. Analysis of the DNA-binding and
activation properties of the human transcription factor AP-2.
Genes Dev 5: 670–682, 1991.
48. Yang W, Dyck JR, Wang H, and Fliegel L. Regulation of
NHE1 promoter in mammalian myocardium. Am J Physiol
Heart Circ Physiol 270: H259–H266, 1996.
49. Yang W, Wang H, and Fliegel L. Regulation of Na⫹/H⫹ exchanger gene expression. Role of a novel poly(dA dT) element in
regulation of the NHE1 promoter. J Biol Chem 271: 20444–
20449, 1996.
50. Yun CH, Gurubhagavatula S, Levine SA, Montgomery JL,
Brant SR, Cohen ME, Cragoe EJ Jr, Pouyssegur J, Tse
CM, and Donowitz M. Glucocorticoid stimulation of ileal Na⫹
absorptive cell brush border Na⫹/H⫹ exchange and association
with an increase in message for NHE3, an epithelial Na⫹/H⫹
exchanger isoform. J Biol Chem 268: 206–211, 1993.
AJP-Gastrointest Liver Physiol • VOL
282 • MARCH 2002 •
www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.5 on June 18, 2017
23. Malakooti J, Dahdal RY, Schmidt L, Layden TJ, Dudeja
PK, and Ramaswamy K. Molecular cloning, tissue distribution, and functional expression of the human Na⫹/H⫹ exchanger
NHE2. Am J Physiol Gastrointest Liver Physiol 277: G383–
G390, 1999.
24. Mayfield C, Ebbinghaus S, Gee J, Jones D, Rodu B, Squibb
M, and Miller D. Triplex formation by the human Ha-ras
promoter inhibits Sp1 binding and in vitro transcription. J Biol
Chem 269: 18232–18238, 1994.
25. McSwine RL, Musch MW, Bookstein C, Xie Y, Rao M, and
Chang EB. Regulation of apical membrane Na⫹/H⫹ exchangers
NHE2 and NHE3 in intestinal epithelial cell line C2/bbe. Am J
Physiol Cell Physiol 275: C693–C701, 1998.
26. Miller RT, Counillon L, Pages G, Lifton RP, Sardet C, and
Pouyssegur J. Structure of the 5⬘-flanking regulatory region
and gene for the human growth factor-activatable Na/H exchanger NHE1. J Biol Chem 266: 10813–10819, 1991.
27. Morris JF, Hromas R, and Rauscher FJ III. Characterization of the DNA-binding properties of the myeloid zinc finger
protein MZF1: two independent DNA-binding domains recognize
two DNA consensus sequences with a common G-rich core. Mol
Cell Biol 14: 1786–1795, 1994.
28. Muller YL, Collins JF, Bai L, Xu H, and Ghishan FK.
Molecular cloning and characterization of the rat NHE2 gene
promoter. Biochim Biophys Acta 1442: 314–319, 1998.
29. Musch MW, Bookstein C, Xie Y, Sellin JH, and Chang EB.
SCFA increase intestinal Na absorption by induction of NHE3 in
rat colon and human intestinal C2/bbe cells. Am J Physiol
Gastrointest Liver Physiol 280: G687–G693, 2001.
30. Numata M, Petrecca K, Lake N, and Orlowski J. Identification of a mitochondrial Na⫹/H⫹ exchanger. J Biol Chem 273:
6951–6959, 1998.
31. Orlowski J and Grinstein S. Na⫹/H⫹ exchangers of mammalian cells. J Biol Chem 272: 22373–22376, 1997.
32. Orlowski J, Kandasamy RA, and Shull GE. Molecular cloning of putative members of the Na/H exchanger gene family.
cDNA cloning, deduced amino acid sequence, and mRNA tissue
expression of the rat Na⫹/H⫹ exchanger NHE1 and two structurally related proteins. J Biol Chem 267: 9331–9339, 1992.
33. Peterson MD and Mooseker MS. Characterization of the
enterocyte-like brush border cytoskeleton of the C2BBe clones of
the human intestinal cell line, Caco-2. J Cell Sci 102: 581–600,
1992.
34. Quinn JP, McAllister J, and Mendelson S. Multiple protein
complexes, including AP2 and Sp1, interact with a specific site
within the rat preprotachykinin-A promoter. Biochim Biophys
Acta 1263: 25–34, 1995.
35. Rao GN, Sardet C, Pouyssegur J, and Berk BC. Na⫹/H⫹
antiporter gene expression increases during retinoic acid-induced granulocytic differentiation of HL60 cells. J Cell Physiol
151: 361–366, 1992.