Journal of Gerontology: BIOLOGICAL SCIENCES
2001, Vol. 56A, No. 4, B172–B179
Copyright 2001 by The Gerontological Society of America
Telomere Erosion and Senescence in Human Articular
Cartilage Chondrocytes
James A. Martin and Joseph A. Buckwalter
Iowa City Veterans Administration Medical Center and University of Iowa Department of Orthopaedics, Iowa City.
Aging and the degeneration of articular cartilage in osteoarthritis are distinct processes, but a
strong association exists between age and the incidence and prevalence of osteoarthritis. We hypothesized that this association is due to in vivo replicative senescence, which causes agerelated declines in the ability of chondrocytes to maintain articular cartilage. For this hypothesis
to be tested, senescence-associated markers were measured in human articular chondrocytes
from donors ranging in age from 1 to 87 years. These measures included in situ staining for senescence-associated ␤-galactosidase activity, 3H-thymidine incorporation assays for mitotic activity, and Southern blots for telomere length determinations. We found that senescenceassociated ␤-galactosidase activity increased with age, whereas both mitotic activity and mean
telomere length declined. These findings indicate that chondrocyte replicative senescence occurs in vivo and support the hypothesis that the association between osteoarthritis and aging is
due in part to replicative senescence. The data also imply that transplantation procedures performed to restore damaged articular surfaces could be limited by the inability of older chondrocytes to form new cartilage after transplantation.
A
RTICULAR cartilage stability depends on the biosynthetic activities of chondrocytes, which counteract
normal degradation of matrix macromolecules. In most
young people, the timely synthesis of appropriate extracellular matrix (ECM) molecules prevents the progressive loss
of articular cartilage associated with the clinical syndrome
of osteoarthritis; however, the incidence and prevalence of
synovial joint degeneration increases dramatically in middle
age, suggesting that age-related cartilage changes render the
tissue incapable of adequately maintaining the ECM. This
phenomenon has been attributed to the harmful effects of
mechanical and chemical stress that are thought to impair
maintenance activity by killing chondrocytes outright or by
inducing apoptosis (1,2,3). Although such environmental
factors undoubtedly contribute to degenerative disease in
some individuals, they do not explain the seemingly irreversible age-dependent decline in chondrocyte growth factor responsiveness and ECM synthesis found by a number
of investigators (4–15). These changes, which persist in cell
culture, are more likely a reflection of aging processes intrinsic to chondrocytes and other somatic cells (4,5,12–14).
One recently formulated hypothesis suggests that cell aging is regulated by an intrinsic genetic “clock” associated
with changes in DNA structures termed telomeres. Telomeres are DNA sequences at the ends of chromosomes that
are necessary for chromosomal replication (16). Mean telomere length can be estimated from preparations of genomic
DNA by using terminal restriction fragment analysis. This
Southern blot approach uses a telomere sequence-specific
probe and takes advantage of the fact that common restriction enzyme cleavage sites, which are frequent in most geB172
nomic DNA, are not found within telomere repeats. Chromosomes from young, normal somatic cells show relatively
long terminal restriction fragments of ⬎9 kilobase pairs
(kbp), but these are eroded at the rate of 100–200 base pairs
(bp) with each cell division cycle (17,18). Erosion beyond
the minimum critical length necessary for DNA replication
(5–7.6 kbp) results in cell cycle arrest, a condition referred
to as replicative senescence (19,20). Most cell types reach
cell cycle arrest after a characteristic number of population
doublings. This fundamental barrier to unbridled growth,
termed the Hayflick limit, is common to somatic cells that
lack an enzyme responsible for replacing telomere sequences (16,21). The Hayflick limit for human fibroblasts
has been estimated at ⵑ60 population doublings (22),
whereas the estimated limit for human chondrocytes is ⵑ35
doublings (23). In contrast, germ cell lines and cancer cell
lines, in which the “telomerase” enzyme is active, are virtually immortal (18,24,25). Furthermore, transfection with the
telomerase gene is sufficient to greatly extend the replicative life span of normal somatic cells (26,27). In telomerasenegative cells, telomere length can be viewed as a cumulative history of preceding cell division as well as a predictor
of future capacity to divide (19,20).
Comparisons of telomeres from young and old donors
show a significant correlation between telomere length and
donor age for some cell types, including T-cells, dystrophic
skeletal muscle cells, kidney cells, and vascular smooth
muscle cells, indicating significant cell turnover and the absence of telomerase expression in these tissues (28–31). In
the case of vascular smooth muscle cells, telomere shortening was directly associated with replicative senescence and
EROSION AND SENESCENCE IN ARTICULAR CARTILAGE
degenerative disease. Senescent smooth muscle cells accumulate with age and mechanical stress exposure in blood
vessel walls, where high stress levels continuously stimulate
demand for new cells. Senescent or near-senescent cells
from these sites fail to proliferate in culture and bear shortened telomeres compared with those of their counterparts
from low stress sites. Finally, abnormal metabolism and gene
expression by senescent cells appears to contribute to atherosclerotic plaque development (31,32). These data confirm that cell turnover-driven telomere erosion occurs in
vivo and leads to senescence and degenerative disease.
Declining protein synthesis, altered growth factor and cytokine responses, and longer population doubling times are
senescence-like phenotypic changes that begin to appear in
continuously grown somatic cell cultures long before Hayflick limits are reached (28,33–36). This suggests that cell
populations begin to drift toward senescence relatively early
in their replicative life spans, before telomeres have eroded
to critical lengths. Declines in cartilage ECM synthesis in
serially passaged chondrocyte cultures support the idea that
early replicative history is important for chondrocytic gene
expression. Chondrocyte growth in a monolayer culture generally results in the rapid loss of the chondrogenic phenotype or “dedifferentiation.” Up to a point, these changes are
reversible by subculturing the monolayer-grown cells in threedimensional gels. The ability to return to chondrogenic gene
expression in gel culture depends on the number of preceding passages in the monolayer: After approximately five
monolayer passages, the maximum rate of protein synthesis
and cartilage matrix production (Type II collagen synthesis)
in gel culture declines by twofold to fourfold, compared to
primary cultures or to cultures passaged only one to four
times (37). These chondrocyte cultures were capable of
growth beyond passage 5, indicating that they were not yet
senescent. These results suggest that replication-induced
phenotypic drift occurs in chondrocytes before their entry into
senescence. These observations also suggest that declining
ECM expression associated with chondrocyte turnover could
gradually undercut cartilage maintenance activities with aging.
The relevance of telomeres to cartilage aging and disease
rests on proof that in vivo chondrocyte turnover rates are
sufficient to cause telomere erosion. Short-term DNA labeling studies indicate that chondrocyte mitoses are present but
relatively rare in normal cartilage (38–40). Although this
apparent rate of turnover is too slow to result in significant
telomere erosion over the short term, decades of turnover
might well be sufficient. Furthermore, mitotic activity increases severalfold following cartilage injury, which could
significantly accelerate telomere erosion in some individuals (3,38). Increased mitotic activity during cartilage degeneration may also speed up the accumulation of senescent,
growth-arrested chondrocytes in end-stage osteoarthritis
(39,40). These findings suggest that, in many cases, in vivo
chondrocyte turnover is sufficient to result in biologically
significant telomere erosion.
The role of chondrocyte turnover in cartilage aging and
disease has not been systematically studied, partly because
of the difficulty of assessing the in vivo replicative history
of chondrocytes. Terminal restriction fragment length analysis of telomeres offers a simple means to overcome this
B173
problem as cell turnover should be detectable as an agerelated decline in average telomere length. If telomere erosion causes senescence, telomere length should correlate
with phenotypic measures of senescence. With the use of
these rationales, we hypothesized that telomere length in
human articular cartilage chondrocytes declines as a function of donor age as phenotypic measures of senescence increase. Southern blot analyses of telomere restriction fragments were used to determine mean terminal restriction
fragment lengths in cells isolated from donors aged 1 to 85
years. In addition, we investigated phenotypic changes associated with cell senescence, including declines in DNA
synthesis rates, and expression of senescence-associated
␤-galactosidase activity.
MATERIALS AND METHODS
Human articular cartilage samples were harvested, chopped,
and digested overnight in Dulbecco’s modified Eagle medium (DMEM), containing 10% fetal calf serum (FCS; GibcoBRL, Rockville, MD) and 0.5 mg/ml of Pronase E (Sigma,
St. Louis, MO), and 0.5 mg/ml of Collagenase Type 1A
(Sigma). The resulting single cell suspension was filtered
through 70-␮m mesh nylon cloth, and the cells were
counted by using a hemocytometer. Cells were then plated
in a monolayer culture and incubated for 1–5 days in
DMEM–10% FCS without enzymes. Human chondrosarcoma cells from a tumor excised at the University of Iowa
Department of Orthopaedic surgery, and a human fibrosarcoma cell line, HT1080 (ATCC), were thawed from frozen
stocks and cultured as monolayers for one to three passages.
Genomic DNA was isolated from ⵑ1 ⫻ 106 to 5 ⫻ 106
cells by using a DNEasy kit (Qiagen, Valencia, CA), according to the manufacturer’s directions. The DNA concentration of each sample was determined by ultraviolet spectrophotometry and 2 ␮g was digested to completion with 10
units each of Rsa I and Hinf I (New England Biolabs, Beverly, MA) in a 60-␮l reaction. The reactions were electrophoresed on 0.5% SeaKem Gold agarose (FMC Bioproducts, Rockland, ME) in parallel with digoxigenin-labeled ␭
Hind III size standards (Roche, Indianapolis, IN). The gels
were transferred by capillary action to Hybond-N⫹ (Amersham, Piscataway, NJ) nylon membranes in 20⫻ standard
sodium citrate (SSC) and baked for 2 hours at 80⬚C. Nonradioactive methods were used to detect telomere sequences
according to Genius system directions published by the
manufacturer (Roche). In brief, the membranes were prehybridized for 4–16 hours at 37⬚C in hybridization buffer
(50% formamide, 5⫻ SSC, 0.1% sodium lauryl sulfate,
0.02% sodium dodecyl sulfate, or SDS, and 2% block). A
synthetic oligonucleotide complimentary to human telomeric repeat sequences, (CCCTAA)3, labeled at the 3⬘ end
with digoxigenin (Genosys, Sigma) was diluted to 50 pM in
hybridization buffer, and the membrane was probed for 16–24
hours at 37⬚C. Excess probe was removed by washing the
membranes twice in 2⫻ SSC with 0.1% SDS at ambient
temperature (2 ⫻ 15 minutes), then in 0.5⫻ SSC with 0.1
SDS at 37⬚C (2 ⫻ 15 minutes). A goat antidigoxigenin alkaline phosphatase-conjugated antibody and a chemiluminescent substrate, CDP-Star (Roche), were used to detect the
digoxigenin-labeled probe. Autoradiograms of the blots
B174
MARTIN AND BUCKWALTER
(15- to 120-minute exposures) were digitized by using a flat
bed scanner (ScanJet II CX, Hewlett Packard, Palo Alto,
CA). Optical density scans of each lane were performed by
using Scion Image (Scion Corp., Frederick, MD) on a personal computer. The positions of the ␭ Hind III standard
bands were plotted (log molecular weight versus relative migration distance) and the data were fitted by using a linear regression analysis (Microcal Origin). Mean telomere terminal restriction fragment lengths (MTLs) were derived as
decribed (22). In brief, the standard regression line was used
to calculate the molecular weight at each pixel row from the
origin and to demarcate the region corresponding to 3–17
kbp. The MTL was then calculated for each lane as ⌺ODi/
(⌺ODi/Li), where OD is the optical density at position i and
L is the length in kilobase pairs at position i. All DNA samples were digested and analyzed on at least two gels.
Total RNA was prepared from one T-25 flask as described (41) and used as a template for reverse transcription
polymerase chain reaction (RT-PCR). cDNA reactions were
done by using a cDNA Cycle kit (Invitrogen, Carlsbad, CA)
with polydT as a primer. Oligonucleotide primers for amplification of human GAPDH (1635⬘GACCCCTTCATTGACCTCAAC3⬘/4215⬘TGATGACCCTTTTGCTCCC3⬘), collagen
type II (36435⬘AGACCTGAAACTCTGCCAC3⬘/41395⬘ACAGTCTTGCCCCACTTAC3⬘), and telomerase catalytic subunit (29615⬘TGCGTTCTTGGCTTTCAG3⬘/32115⬘AACATGCGTCGCAAACTC3⬘) were used for PCR reactions, which
were performed by using a “hot start” protocol and 36 cycles of 94⬚C (1 minute), 55⬚C (1 minute), and 72⬚ (2 minutes). The products were electrophoresed on 1.2% agarose
gels in parallel with ␾X174 Hae III size standards.
Senescence-associated ␤-galactosidase activity assays were
performed essentially as described (42). In brief, chondrocytes were transfered to four-well chamber slides (65,000
cells per well) and incubated overnight. The cell layers were
washed twice by using phosphate-buffered saline (PBS),
and then fixed for 2 minutes in 2% paraformaldehyde. After
three PBS washes the cell layers were overlaid with assay
solution (2.0 mg/ml of X-gal in 40 mM of citric acid-sodium
phosphate, pH 6.0, 5 mM of K ferricyanide, 150 mM of
NaCl, 2 mM of MgCl2) and were incubated in a sealed
chamber at 37⬚C without CO2 supplementation for 6–10
hours. The reactions were stopped by removal of the substrate and repeated washing in cold PBS. The slides were
mounted and viewed on a Olympus BX60 (Olympus America, Lake Success, NY) microscope fitted with differential
interference contrast optics. At least four images taken were
recorded on color slide film by using a 20⫻ objective (25–
50 cells/field), and the percentage of positively stained cells
in the field were scored by an observer who was unaware of
sample donor age.
Incorporation of 3H-thymidine was measured by establishing three replicate cultures in 24-well plates at a concentration of 130,000 cells/well. The cells were incubated overnight
in DMEM/10% FCS before the addition of fresh medium
containing 5 ␮Ci/ml of 3H-thymidine (Amersham). After 24
hours the medium was removed and the wells were washed
three times for 5 minutes in PBS at 4⬚C before trypsinization with 0.25% trypsin, ethylenediamine tetra-acetic acid in
Hanks balanced salt solution (Gibco-BRL). Cells in the
trypsinized suspension were counted by using a hemacytometer, and then they were pelleted by centrifugation at
200 ⫻ g. Cell pellets were extracted by boiling for 2 minutes in 7.7 M of urea with 1% SDS. An aliquot of the extract
was added to a scintillation cocktail and counted on a Beckman LSII liquid scintillation counter (Arlington Heights, IL).
The total counts in the extracts were normalized to the cell
number.
RESULTS
Primary first or second passaged chondrocyte cell strains
were cultured as monolayers after isolation from articular
cartilage specimens. Donor ages and sources of each of the
27 cartilage specimens used are given in Table 1. In order to
avoid in vitro telomere erosion, the cells were harvested for
analyses as soon as possible after their isolation. Isolated
cells (ⵑ1.0 ⫻ 106 to 4 ⫻ 106) were plated initially in T-75
flasks and then passed to three T-25 flasks after 1–5 days. Total RNA was prepared for PCR analysis from one of the
three T-25 flasks. Amplification reactions for GAPDH,
Type II collagen, and the telomerase catalytic subunit
(hTERT) were performed, and the products were analyzed
by agarose electrophoresis. Photographs of typical ethidium
bromide-stained agarose gels are shown in Figure 1. All of
the primary chondrocyte cultures analyzed were positive for
expression of GAPDH (258-bp product) and Type II collagen (496-bp product) but not for hTERT expression. A fibrosarcoma cell line (HT1080) did express detectable levels
of hTERT message (250-bp product) but did not express
Type II collagen. These analyses confirmed that the primary
Table 1. Sources of Articular Cartilage for Chondrocyte
Cell Strains
Specimen
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
Age
(years)
Site
Procedure
66
72
87
77
70
67
40
62
56
78
60
2.5
64
52
70
1
77
13
52
84
37
81
77
44
87
50
8
Knee
Knee
Knee
Knee
Tibiotalar
Knee
Hip
Knee
Hip
Knee
Knee
Tibiotalar
Hip
Knee
Knee
Tarsal/metatarsal
Hip
Knee
Knee
Knee
Knee
Knee
Knee
Knee
Knee
Knee
Knee
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Talectomy
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Amputation
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Arthroplasty
Amputation
EROSION AND SENESCENCE IN ARTICULAR CARTILAGE
Figure 1. Collagen and hTERT expression in chondrocytes and fibrosarcoma cells. Ethidium bromide stained agarose gels show RT
PCR reaction products for five chondrocyte strains from donors of
different ages (60, 52, 1, 87, and 40 years old), a human fibrosarcoma
line (HT1080), and a human chondrocarcoma cell line (CS). Samples
were analyzed for expression of hTERT (t, the telomerase catalytic
subunit), collagen Type II (c), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, g). Molecular weight standards (␾X174 Hae III
digest) are shown on each gel. Sizes of selected standard bands are indicated in base pairs to the left of the first gel.
cultures were chondrocytic and lacked significant telomerase activity.
Chondrocyte genomic DNA was extracted from a second
T-25 flask and analyzed by Southern blotting to determine
mean terminal restriction fragment length (MTL). A typical
Southern blot with results for 14 chondrocyte cultures is
shown in Figure 2. Each lane of the pictured blot is labeled
with donor age together with the results of senescence-associated ␤-galactosidase (SA ␤-gal), and 3H-thymidine incorporation assays. Telomere signals from the Rsa I/Hinf 1 di-
B175
gested DNA samples appear as a broad smear of densities
ranging in size from ⵑ20 kbp to ⵑ3 kbp. This heterogeneity
of sizes within each sample arises in part from variation in
the proximity of restriction enzyme sites to telomere sequences in different chromosomes (22). MTLs from digitized blots were calculated and plotted as a function of donor age (Figure 3). Each data point in the plot represents the
means from at least two different digestions analyzed on
different gels. Error bars show standard deviations for samples analyzed at least three times (on three different blots).
Coefficients of variation for replicate determinations, which
were in the range of 10%, showed that the measurements were
reproducible. Absolute MTL values varied from a maximum of 11,759 bp (13 year old) to a minimum of 8,731 bp
(87 year old). These values fell in the range calculated for
human fibroblasts and smooth muscle cells (19,20,31). A
regression analysis showed a significant linear correlation
between MTL and age (r ⫽ ⫺.71, p ⫽ .0004).
SA ␤-gal assays were performed to determine if senescent chondrocytes accumulate with age. These assays were
performed on replicate cultures of the same first or second
passage chondrocytes used for telomere analyses. Bluestaining cells (SA ␤-gal positives) were scored as a percentage
of all cells in four or more randomly chosen 20⫻ microscopic fields. A series of light micrographs showing staining
in three different cultures is presented in Figure 4. A cell
identified as positive at 20⫻ is pictured at 100⫻ in Figure
4A. Examples of 20⫻ images used for cell counting are
shown in Figures 4B–4D. Positively stained cells can be
readily identified in all the images as a result of the intense
blue product formed by X-gal catabolism. At high magnification (4A) the stain appears intracellularly in a punctate
pattern, consistent with its lysosomal localization. A strongly
positive cell is embedded in a group of at least four other
cells that contained only scattered blue particles and were
scored as unstained. Additional positive cells intersect the
right and bottom edges of the image. The series of three
20⫻ images shows staining patterns for the 8-year-old donor (B), the 52-year-old donor (C), and the 87-year-old donor (D). The series shows the increase in frequency of positively stained cells with increasing donor age. Means and
standard deviations based on four different 20⫻ fields were
plotted as a function of donor age (Figure 5). The minimum
value across all samples (N ⫽ 15) was 4.5% positive (1 year
old) and the maximum value was 55% (77 year old). A regression analysis of these data revealed a significant linear
relationship between the stain and donor age (r ⫽ .80, p ⫽
.0001); the percentage of positive staining cells increased at
an average rate of 4% per decade. These results indicated
that ␤-galactosidase expressing chondrocytes accumulate in
articular cartilage as a function of age.
3H-thymidine incorporation assays were used to measure
DNA synthesis in subconfluent cultures of first or second
passaged chondrocytes. Triplicate cultures labeled for 24 hours
were trypsinized and the cells counted prior to DNA extraction. Tritium counts in the extract were normalized to number of cells in each culture (CPM/cell, where CPM stands
for counts per minute) and the data were plotted as a function of donor age (Figure 6). Incorporation values ranged
from 2.93 CPM/cell (1-year-old donor) to 0.62 CPM/cell
B176
MARTIN AND BUCKWALTER
relationship (r ⫽ .77, p ⫽ .001) between the two variables,
indicating that incorporation declines with decreasing MTL.
Figure 2. Telomere Southern blot. Autoradiograph of a typical
Southern blot used to determine mean terminal restriction fragment
lengths. Data above each lane indicates the age in years of each donor represented on the autoradiograph and the results of ␤-galactosidase (␤-Gal) and 3H-thymidine (3H-Thy) incorporation assays for
that donor. CPM stands for counts per minute; ND indicates that the
parameter was not determined. Results for 14 primary chondrocyte
strains are shown. Molecular weight standards (␭ Hind III digests)
flank the sample lanes. Sizes of the standard bands are indicated in
kilobase pairs.
(87-year-old donor). A regression analysis of the plot
showed a significant negative linear relationship between
the age of the donor and DNA synthesis activity (r ⫽ ⫺.77,
p ⫽ .001).
MTL data shown in Figure 1 were plotted as a function of
SA ␤-gal activity (Figure 7A) or as a function of 3H-thymidine incorporation (Figure 7B) to determine if MTL correlated with these senescence markers. The plot for ␤-galactosidase expression revealed a negative linear relationship (r ⫽
⫺.62) that was statistically significant (p ⫽ 0.01). These
findings indicated that the proportion of senescent chondrocytes increases as MTL declines. Similar results were found
when MTL was plotted against 3H-thymidine incorporation:
A regression analysis showed a significant positive, linear
Figure 3. Mean terminal restriction fragment lengths. Mean telomere lengths (MTLs) for 27 chondrocyte strains are plotted as a function of donor age. Each data point shows the mean of at least two determinations. For clarity, error bars indicate only positive standard
deviations (means from three or more determinations). The results of
a regression analysis are shown (inset) and the line of best fit is
drawn. Here kbp stands for kilobase pairs.
DISCUSSION
We hypothesized that replicative senescence brought on
by a lifetime of cell turnover contributes to the age-related
changes in chondrocyte phenotype that decrease the ability
of the cells to maintain articular cartilage and thereby increase the risk of osteoarthritis. Our results show that human articular cartilage chondrocytes become senescent with
increasing age. In particular, we found that telomere erosion
increased with the chronological age of articular chondrocyte donors and that telomere changes were linked to changes
in phenotype associated with cell senescence.
Because our goal was to evaluate age-related changes that
occurred in vivo, we avoided in vitro expansion of the primary chondrocyte populations used in this study. The chondrocytic nature of these populations was confirmed by RT
PCR analysis for Type II collagen expression. In addition, it
was essential to confirm that chondrocytes do not express
the telomerase catalytic subunit that blocks telomere erosion in germ line cells as well as in many transformed cells
(25,43–45). We found that although hTERT mRNA was
readily detectable in a fibrosarcoma cell line by RT PCR, it
was undetectable in all 12 chondrocyte strains we tested.
These data provided evidence that even young chondrocytes
lack significant telomerase activity and thus, like most other
somatic cells, suffer telomere erosion with each cell cycle.
Southern blot analyses of articular chondrocyte DNA from
a broad range of ages (1 to 87 years) showed a significant
correlation between MTL and age (p ⫽ .0004). These data
ranged from 11.8 kbp for 13-year-old chondrocytes to 8.7
kbp for 87-year-old chondrocytes. The slope of the line
suggests that the rate of telomere erosion for articular chondrocytes is ⵑ22 bp/year whereas the difference between
maximum and minimum values was 3028 bp/74 years, suggesting a rate approaching 40 bp/year. These rates are somewhat lower than those of vascular endothelial cells, which
ranged from 47 bp/year for iliac vein cells (14- to 49-year
old donors) to 102 bp/year for iliac artery cells (14- to 58year old donors). From these results the authors concluded
that hemodynamic stress in the iliac artery leads to excessive cell turnover, a high rate of telomere erosion, senescent
cell accumulation, and age-related atherosclerosis. By analogy we expect that cell turnover in cartilage depends on mechanical stress exposure and injury. Because stress and the
frequency of injuries vary across cartilage surfaces, even
within the same joint, we expect local variations in telomere
erosion rates. The relatively modest average telomere erosion we observed may reflect the focal nature of cell turnover in cartilage: Locally high concentrations of cells with
very short telomeres would be expected to have only a modest impact on average telomere lengths when measurements
are based on cells taken from an entire joint surface. Thus,
though our chondrocyte results are not as dramatic as results
for endothelial cells, the data are consistent with the hypothesis that chondrocyte turnover over the course of several decades is sufficient to induce senescence.
Chondrocyte populations used for telomere analysis were
also tested for evidence of phenotypic changes associated
EROSION AND SENESCENCE IN ARTICULAR CARTILAGE
B177
Figure 4. In situ staining for senescence-associated ␤-galactosidase activity. A, typical appearance of the stain at high magnification (100⫻ objective); strong blue punctate staining is seen in three of the eight cells in the micrograph (52-year-old donor). B, C, and D show one of four lowmagnification fields (20⫻ objective) used to quantitate staining in each cell strain: B, 8-year-old donor (9% positive); C, 52-year-old donor (33%
positive); D, 87-year-old donor (55% positive).
with senescence. We found that the percentage of chondrocytes that expressed SA ␤-gal, a senescence marker enzyme
rose 10-fold over eight decades of donor age. These data
showed a significant linear correlation between activity and
age (p ⫽ .0001). SA ␤-gal was expressed by some cells
(⬍10%) in young chondrocyte populations (⬍15-year-old
donors), a result that agrees with previous studies that reported the presence of a small number of senescent cells in
somatic cell populations regardless of age (46). Mitotic activity, as measured by 3H-thymidine incorporation, also correlated with donor age ( p ⫽ .0013), declining ⵑ10-fold
between the youngest (1-year-old) chondrocytes, which incorporated 2.9 CPM/cell, and the oldest (87-year-old) chondrocytes, which incorporated 0.26 CPM/cell. Significant
correlations between MTL and SA ␤-gal activity (p ⫽ .010)
and between MTL and 3H-thymidine incorporation (p ⫽
.0046) showed that MTL erosion parallels an apparent phenotypic shift toward senescence.
Although the telomere erosion and phenotypic changes
we observed appeared to be correlated with donor age, these
data must be interpreted with caution. First, the apparant
linear relations we found between senescence markers and
donor age may be due in part to the uneven age distribution
of the donors. Relatively few young and middle-aged donors were analyzed, and the resulting clustering of points at
very young and old ages could lead to a false impression of
linearity over the entire age range. Second, other processes
such as oxidative stress and damage to DNA may induce senescence. Thus, some of the senescence we observed in
chondrocyte strains, particularly those harvested from osteoarthritic donors following inflammatory episodes, may
have been due to processes other than telomere erosion (47).
Third, ␤-galactosidase activity at pH 6.0 is a somewhat controversial senescence marker. Although our results with
articular chondrocytes are similar to findings for vascular
smooth muscle cells, which appear to exhibit the same
strong correlation between age and activity, investigators
studying human fibroblasts have been unable to observe a
relationship between activity and donor age. This suggests
that senescent cells accumulate in different tissues at different rates. Moreover, although ␤-galactosidase activity is
strongly associated with replicative senescence, it is also
present in quiescent cells (48,49), which may be common
in some cartilage samples. Lastly, the apparent age-related
Figure 5. Senescence-associated ␤-galactosidase (SA ␤-gal) scores.
SA ␤-gal activity, shown as SA ␤-gal positive (%), is plotted as a
function of donor age. Each point represents means and standard deviations (error bars) from four microscope fields. Linear regression
parameters are shown (inset) and the line of best fit is drawn.
Figure 6. 3H-Thymidine incorporation data plotted against donor
age. The data (CPM/cell where CPM stands for counts per minute)
are the means and standard deviations (error bars) from triplicate
cultures. The best-fit line from a linear regression analysis is shown
together with regression parameters (inset).
B178
MARTIN AND BUCKWALTER
ble of proliferating and forming new tissue. Future studies
in our laboratory will focus on the underlying molecular
mechanisms that link telomere length, cell cycle timing, and
gene expression in chondrocytes. These studies will help to
elucidate the role of replicative senescence in cartilage degeneration and may shed light on the reasons for the notoriously short replicative life span of chondrocytes, which has
sharply limited their availability for the treatment of cartilage defects.
Acknowledgments
This work was funded by the Veterans Administration (Merit Review)
and the Department of Orthopaedic Surgery at the University of Iowa. We
thank Aaron Schroeder and Stacy Smith for technical assistance.
Address correspondence to J.A. Martin, Department of Orthopaedic
Surgery, Biochemistry Laboratory, 1182 ML, The University of Iowa,
Iowa City, IA 52242. E-mail: [email protected]
References
Figure 7. Mean telomere length (MTL) versus senscence markers.
A, linear regression parameters (inset) for MTL versus senescenceassociated ␤-galactosidase activity, shown as SA ␤-gal (% positive).
B, Linear regression parameters (inset) for MTL versus 3H-thymidine incorporation; CPM ⫽ counts per minute.
changes we observed might have been due to other ongoing
disease processes in osteoarthritic donors that were clustered in the old age range. Potentially relevant disease processes include chondrocyte “cloning,” a classic histologic
feature of osteoarthritis (OA) that refers to isolated clusters
of chondrocytes formed by clonal expansion of a single cell.
Cells within such clusters show accelerated mitotic activity
(39,40), suggesting a cause for rapid telomere erosion. Thus
the rapid decline in mitotic activity and ECM synthesis typical of end-stage OA chondrocytes may reflect replicative
senescence brought on by cloning, a hypothesis that might
explain why OA samples typically showed shorter telomeres than nonosteoarthritic samples. Although this hypothesis indicates that replicative senescence is a result
rather than a cause of OA, it also implies that the phenomenon plays an important role in the progression from early to
end-stage degeneration.
The results summarized here demonstrate for the first time
that chondrocyte telomeres erode in vivo in parallel with
phenotypic changes associated with senescence. How these
processes contribute to degenerative disease is not yet clear;
however, our data strongly suggest that replicative senescence contributes to either the development or progression
of OA. These observations also suggest that telomere erosion could lead to senescence in chondrocyte populations
used in transplantation procedures performed to replace lost
or damaged articular surfaces (50–54). Most protocals require in vitro expansion of the initial populations obtained
from biopsy, and several population doublings may be necessary to furnish sufficient cells. Moreover, articular cartilage chondrocytes from older individuals may be less capa-
1. Lotz M, Hashimoto S, Kuhn K. Mechanisms of chondrocyte apoptosis. Osteoart Cart. 1999;7:389–391.
2. Horton WE, Feng L, Adams C. Chondrocyte apoptosis in development, aging, and disease. Matrix Biol. 1998;17:107–115.
3. Tew SR, Kwan AP, Hann A, Thomson BM, Archer CW. The reactions
of articular cartilage to experimental wounding: role of apoptosis. Arthritis Rheum. 2000;43:215–225.
4. Adolphe M, Ronot X, Jaffray P, Hecquet C, Fontagne J, Lechat P. Effects of donor’s age on growth kinetics of rabbit articular chondrocytes
in culture. Mech Ageing Dev. 1983;23:191–198.
5. Dominice J, Levasseur C, Larno S, Ronot X, Adolphe M. Age-related
changes in rabbit articular chondrocytes. Mech Aging Dev. 1987;37:
231–240.
6. Bayliss MT, Osborne D, Woodhouse S, Davidson C. Sulfation of
chondroitin sulfate in human articular cartilage. The effect of age, topographical position, and zone of cartilage on tissue composition. J
Biol Chem. 1999;274:15,892–15,900.
7. Hardingham T, Bayliss M. Proteoglycans of articular cartilage: changes
in aging and in joint disease. Semin Arthritis Rheum. 1990;20S1:12–33.
8. Melching LI, Roughley PJ. A matrix protein of Mr 55,000 that accumulates in human articular cartilage with age. Biochim Biophys Acta.
1990;1036:213–220.
9. Brand HS, de Koning MH, van Kampen GP, van der Korst JK. Agerelated changes in the turnover of proteoglycans from explants of bovine articular cartilage. J Rheumatol. 1991;18:599–605.
10. Buckwalter JA, Woo SL, Goldberg VM, et al. Soft-tissue aging and
musculoskeletal function. J Bone Joint Surg Am. 1993;75:1533–1548.
11. Sah RL, Chen AC, Grodzinsky AJ, Trippel SB. Differential effects of
bFGF and IGF-I on matrix metabolism in calf and adult bovine cartilage explants. Arch Biochem Biophys. 1994;308:137–147.
12. Guerne PA, Blanco F, Kaelin A, Desgeorges A, Lotz M. Growth factor responsiveness of human articular chondrocytes in aging and
development. Arthritis Rheum. 1995;38:960–968.
13. Martin JA, Ellerbroek SM, Buckwalter JA. Age-related decline in
chondrocyte response to insulin-like growth factor-I: the role of
growth factor binding proteins. J Orthop Res. 1997;15:491–498.
14. Rosen F, McCabe G, Quach J, et al. Differential effects of aging on
human chondrocyte responses to transforming growth factor beta: increased pyrophosphate production and decreased cell proliferation.
Arthritis Rheum. 1997;40:1275–1281.
15. Lorenzo P, Bayliss MT, Heinegard D. A novel cartilage protein
(CILP) present in the mid-zone of human articular cartilage increases
with age. J Biol Chem. 1998;273:23,463–23,468.
16. Blackburn EH. Structure and function of telomeres. Nature. 1991;350:
569–572.
17. Alsopp RC, Chang E, Kashefi-Aazam M, et al. Telomere shortening is
associated with cell division in vitro and in vivo. Exp Cell Res. 1995;
220:194–200.
18. Levy MZ, Alsopp RC, Futcher AB, Greider CW, Harley CB. Telo-
EROSION AND SENESCENCE IN ARTICULAR CARTILAGE
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
mere end replication problem and cell aging. J Mol Biol. 1992;225:
951–960.
Allsopp RC, Vaziri H, Piatyszek MA, et al. Telomere length predicts
replicative capacity of human fibroblasts. Proc Natl Acad Sci USA.
1992;89:10,114–10,118.
Allsopp RC, Harley CB. Evidence for a critical telomere length in senescent human fibroblasts. Exp Cell Res. 1995;219:130–136.
Hayflick L, Moorehead PS. The serial cultivation of human diploid
cell strains. Exp Cell Res. 1961;25:585–621.
Harley CB, Futcher AB, Greider CW. Telomeres shorten during aging
of human fibroblasts. Nature. 1990;345:458–460.
Kolettas E, Buluwela L, Bayliss MT, Muir HI. Expression of cartilagespecific molecules is retained in long-term cultures of human articular
chondrocytes. J Cell Sci 1995;108:1991–1999.
Counter CM, Avilion AA, LeFeuvre CE, et al. Telomere shortening
associated with chromosome instability is arrested in immortal cells
which express telomerase activity. EMBO J. 1992;11:1921–1929.
Aue G, Muralidhar B, Schwartz H, Butler MG. Telomerase activity in
skeletal sarcomas. Ann Surg Oncol. 1998;5:627–634.
Bodnar AG, Ouellette M, Frolkis M, et al. Extension of life-span by
introduction of telomerase into normal human cells. Science. 1998;
279:349–352.
Vaziri H, Benchimol S. Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative
life span. Curr Biol. 1998;8:279–282.
Efros RB. Loss of CD28 expression on T lymphocytes: a marker of
replicative senescence. Dev Comp Immunol. 1997;21:471–478.
Decary S, Hamida CB, Mouly V, Barbet JP, Hentati F, Butler-Browne
GS. Shorter telomeres in dystrophic muscle consistent with extensive
regeneration in young children. Neuromuscul Disord. 2000;10:113–120.
Melk A, Ramassar V, Helms LM, et al. Telomere shortening in kidneys with age. J Am Soc Nephrol. 2000;11:444–453.
Chang E, Harley CB. Telomere length and replicative aging in human
vascular tissues. Proc Natl Acad Sci USA. 1995;92:11,190–11,194.
Shanahan CM, Weissberg PL. Smooth muscle cell phenotypes in atherosclerotic lesions. Curr Opin Lipidol. 1999;10:507–513.
Kassem M, Ankersen L, Ericksen EF, Clark BFC, Ratten SIS. Demonstration of aging and senescence in serially passaged long-term cultures
of human trabecular osteoblasts. Osteoporosis Int. 1997;7:514–524.
Khatib AM, Siegfied G, Messai H, Quintero M, Barbara A, Mitrovic
RD. Basal and induced nitric oxide and cGMP productions are decreased in senescent cultured rat articular chondrocytes. Mech Age
Dev. 1998;101:21–32.
Maciero-Coelho A. Larkers of cell senescence. Mech Aging Dev.
1998;103:105–109.
Reddel RR. A reassessment of the telomere hypothesis of senescence.
Bioessays. 1998;20:977–984.
Benya PD, Schaffer JD. Dedifferentiated chondrocytes reexpress the
differentiated collagen phenotype when cultured in agarose gels. Cell.
1982;30:215–224.
Mankin HJ. Mitosis in articular cartilage of immature rabbits. A histologic stathmokinetic (colchicine) and autoradiographic study. Clin
Orthop. 1964;34:170–183.
B179
39. Hirotani H, Ito T. Chondrocyte mitosis in the articular cartilage of
femoral heads with various diseases. Acta Orthop Scand. 1975;46:
979–986.
40. Havdrup T, Telhag H. Mitosis of chondrocytes in normal adult joint
cartilage. Clin Orthop. 1980;153:248–252.
41. Reno C, Marchuk P, Sciore P, Frank CB, Hart DA. Rapid isolation of
total RNA from small samples of hypocellular, dense connective tissues. Biotechniques. 1997;22:1082–1086.
42. Dimri GP, Lee X, Basile G, et al. A biomarker that identifies senescent
human cells in culture and in aging skin in vivo. Proc Natl Acad Sci
USA. 1995;92:9363–9367.
43. Meyerson M, Counter CM, Eaton EN, et al. hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells
and during immortalization. Cell. 1997;90:785–795.
44. Avilion AA, Piatyszek MA, Gupta J, Shay JW, Bacchetti S, Greider
CW. Human telomerase RNA and telomerase activity in immortal cell
lines and tumor tissues. Cancer Res. 1996;56:645–650.
45. Bryan TM, Cech TR. Telomerase and the maintenence of chromosome
ends. Curr Opin Cell Biol. 1999;11:318–324.
46. Rubelj I, Vondracek Z. Stochastic mechanism of cellular aging-abrupt
telomere shortening as a model for stochastic nature of cellular aging.
J Theoret Biol. 1999;197:425–438.
47. Campisi J. Cancer, aging and cellular senescence. In Vivo. 2000;14:
183–188
48. Cristafalo VJ, Allen RG, Pignolo RJ, Martin BG, Beck JC. Relationship between donor age and the replicative lifespan of human cells in
culture: a reevaluation. Proc Natl Acad Sci USA. 1998;95:10,614–
10,619.
49. Severino J, Allen RG, Balin S, Balin A, Cristofalo VJ. Is beta-galactosidase staining a marker of senescence in vitro and in vivo? Exp Cell
Res. 2000;257:162–171.
50. Brittberg M, Faxen E, Peterson L. Carbon fiber scaffolds in the treatment of early knee osteoarthritis. Clin Ortho Rel Res. 1994;307:155–164.
51. Brittberg M, Lindahl A, Nilsson A, Ohlsson C, Isaksson O, Peterson
L. Treatment of deep cartilage defects in the knee with autologous
chondrocyte transplantation. N Engl J Med. 1994;331:889–895.
52. Brittberg M, Nilsson A, Lindahl A, Ohlsson C, Peterson L. Rabbit articular cartilage defects treated with autologous cultured chondrocytes.
Clin Ortho Rel Res. 1996;326:270–283.
53. Buckwalter JA, Mankin HJ. Articular cartilage II. Degeneration and
osteoarthrosis, repair, regeneration and transplantation. J Bone Joint
Surg. 1997;79A:612–632.
54. Caplan AI, Goto T, Wakitani S, Pineda SJ, Haynesworth SE, Goldberg
VM. Cell-based technologies for cartilage repair. In: Finerman GAM,
Noyes FR, eds. Biology and Biomechanics of the Traumatized Synovial Joint: The Knee as a Model. Rosemont, IL: American Academy
of Orthopaedic Surgeons; 1992:111–122.
Received October 23, 2000
Accepted November 1, 2000
Decision Editor: John A. Faulkner, PhD