Cell-Autonomous Role for NF-κB in
Immature Bone Marrow B Cells
This information is current as
of June 18, 2017.
Subscription
Permissions
Email Alerts
J Immunol 2009; 182:3406-3413; ;
doi: 10.4049/jimmunol.0803360
http://www.jimmunol.org/content/182/6/3406
This article cites 44 articles, 12 of which you can access for free at:
http://www.jimmunol.org/content/182/6/3406.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2009 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
Estefania Claudio, Sun Saret, Hongshan Wang and Ulrich
Siebenlist
The Journal of Immunology
Cell-Autonomous Role for NF-␬B in Immature Bone Marrow
B Cells1
Estefania Claudio, Sun Saret, Hongshan Wang, and Ulrich Siebenlist2
N
uclear factor ␬B transcription factors play many essential roles in B cells. Freshly isolated mature splenic B
cells have elevated levels of NF-␬B activity when compared with many other primary cells. Furthermore, most B cell
lines in culture exhibit substantial levels of constitutive NF-␬B
activity, which is how NF-␬B was first discovered as a DNAbinding activity in unstimulated B cell lines (1, 2). It was only later
that this transcription factor was understood to lie dormant in most
cells and become activated only in response to particular signals.
Even in these B cells, NF-␬B activity can be increased to much
higher levels in response to signals, e.g., via stimulation of Ag
receptors (BCRs) or Toll receptors (1– 6). Nevertheless, the basal
activation of NF-␬B in these B cells is physiologically relevant.
Current understanding suggests that continuous low level signaling
via the BCR, so-called tonic signaling in the absence of Ag ligands, may be partially responsible for the basal activity of NF-␬B
in primary as well as cultured cells (7–9). In addition, primary B
cells appear to also receive other NF-␬B activation signals in vivo.
They are likely to encounter the cytokine BAFF3 (B cell-activating
factor of the TNF family, also known as Blys) in spleens and
elsewhere, which activates NF-␬B primarily via the BAFF receptor (BAFFR, BR3) (10, 11). The NF-␬B activity resulting from
both basal levels as well as BAFF and possibly other signals, such
Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892
Received for publication October 7, 2008. Accepted for publication January 6, 2009.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by funds from the intramural program of the National
Institute of Allergy and Infectious Diseases.
2
Address correspondence and reprint requests to Dr. Ulrich Siebenlist, National Institutes of Health, Building 10, Room 11B15A, Bethesda, MD 20892-1876. E-mail
address: [email protected]
3
Abbreviations used in this paper: BAFF, B cell-activating factor of the TNF family;
dKO, double knockout; TACI, transmembrane activator and calcium modulator and
cyclophilin ligand interactor; IKK, inhibitor of ␬B kinase; WT, wild type; HSA,
heat-stable Ag; BCMA, B cell maturation Ag.
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0803360
as CD19, is necessary for long-term maintenance of mature B cells
in vivo (8, 9, 12, 13).
Signaling via the BCR activates the classical pathway, which is
characterized by activation of the I␬B kinase (IKK) complex
(composed of IKK␣, IKK␤, and NEMO/IKK␥), followed by phosphorylation and ubiquitin-mediated degradation of I␬B inhibitory
proteins, in particular of I␬B␣ (6). This leads to activation of RelA
dimers and with time and/or costimulatory signals to activation of
c-Rel dimers as well (14, 15). In contrast, BAFFR activates the
alternative pathway, which involves NF-␬B-inducing kinase-mediated activation of IKK␣, followed by phosphorylation and ubiquitin-mediated processing of p100/NF-␬B2 to p52/NF-␬B2 (2, 11,
16, 17). This activates RelB dimers because p100 is the main inhibitor of RelB. Based on a recent report, activation of the alternative
pathway by lymphotoxin ␤ receptors in fibroblasts was also suggested
to liberate RelA dimers (18), but the significance of this mechanism
for BAFF-stimulated B cells in vivo remains to be demonstrated.
Loss of IKK␤ and thus loss of the classical pathway in mature
B cells in the periphery dramatically shortens the life span of these
cells (8, 19). Loss of the alternative pathway also shortens survival
of mature B cells, but appears to have a less dramatic effect than
loss of the classical pathway (9, 12, 20 –22). Enhanced survival in
response to stimulation of either pathway correlates with NF-␬Bdependent induction of antiapoptotic genes, among other targets
(12, 23). Once mature B cells encounter Ag and costimulatory
signals, the resulting high levels of NF-␬B, in particular of c-Rel,
have essential roles for both the proliferation and differentiation of
these cells (14, 15).
NF-␬B activity is also necessary for development of B cells in
spleen, where mature recirculating B cells are generated from
newly arriving immature/transitional B cells. Compound loss of
c-Rel and RelA or compound loss of NF-␬B1 and NF-␬B2 within
B cells completely blocks maturation of transitional cells, although
it is not known whether this happens at the exact same stage in
these two mutant mouse models (11, 12, 15, 24). Nevertheless, in
both compound knockout mutant B cells, the loss of NF-␬B activity prevents the expression of survival factors and the developing B cells default to death by apoptosis. Consistent with this,
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
The NF-␬B transcription factors have many essential functions in B cells, such as during differentiation and proliferation of
Ag-challenged mature B cells, but also during final maturation of developing B cells in the spleen. Among the various specific
functions NF-␬B factors carry out in these biologic contexts, their ability to assure the survival of mature and maturing B cells
in the periphery stands out. Less clear is what if any roles NF-␬B factors play during earlier stages of B cell development in the
bone marrow. Using mice deficient in both NF-␬B1 and NF-␬B2, which are thus partially compromised in both the classical and
alternative activation pathways, we demonstrate a B cell-autonomous contribution of NF-␬B to the survival of immature B cells
in the bone marrow. NF-␬B1 and NF-␬B2 also play a role during the earlier transition from proB to late preB cells; however, in
this context these factors do not act in a B cell-autonomous fashion. Although NF-␬B1 and NF-␬B2 are not absolutely required
for survival and progression of immature B cells in the bone marrow, they nevertheless make a significant contribution that marks
the beginning of the profound cell-autonomous control these factors exert during all subsequent stages of B cell development.
Therefore, the lifelong dependency of B cells on NF-␬B-mediated survival functions is set in motion at the time of first expression
of a full BCR. The Journal of Immunology, 2009, 182: 3406 –3413.
The Journal of Immunology
Materials and Methods
Mice
Mice lacking NF-␬B1 or NF-␬B2 or both (double knockout (dKO)) have
been described previously (11). Mice used were on C57BL/6 and 129/
C57BL/6 backgrounds. RAG1-deficient (129/C57BL6) and Ly5.1⫹ wildtype mice (WT; C57BL/6) were imported from the Jackson Laboratory.
Mice were maintained in National Institutes of Health/National Institute of
Allergy and Infectious Diseases animal facilities and all experiments were
done with the approval of the National Institute of Allergy and Infectious
Diseases Animal Care and Use Committee and in accordance with all relevant institutional guidelines.
Flow cytometry
Single-cell suspensions prepared from bone marrow were depleted of
erythrocytes with ammonium-chloride-potassium lysis buffer; 106 of
the resulting cells were incubated with different combinations of Abs
for three- or four-color fluorescence surface staining. Data were collected with a FACSCalibur or a FACSCanto flow cytometer (BD Biosciences) and analyzed with CellQuest (BD Biosciences) or FlowJo
software (Tree Star). The following mAbs were used: anti-IgM (clone
II/41), anti-B220 (clone RA3-6B2), anti-CD43 (clone S7), anti-heatstable Ag (HSA) (clone M1/69), anti-BP-1 (clone 6C3), anti-Ly5.1
(clone A20), anti-Ly5.2 (clone 104) (all purchased from BD Pharmingen), anti-CD21 (clone 4E3), anti-CD23 (clone B3B4; eBioscience),
anti- IgD (clone 11-26c.2a; Southern Biotechnology Associates), antiBAFFR (BR3) (clone 7H22-E16; Alexis), FITC anti-rat IgG1 (Southern
Biotechnology Associates), and antitransmembrane activator and calcium modulator cyclophilin ligand interactor (TACI) (PE; R&D
Systems).
Bone marrow transfers
A total of 2.5–3 ⫻ 106 bone marrow cells from 14- to 18-day-old NF␬B1/2 dKO or WT donor mice were injected i.v. into a 6- to 8-wk-old
RAG-1 knockout mouse. The RAG-1 recipients had been lethally irradiated at 900 rad 24 h before transfer. Recipient mice were analyzed at 6 – 8
wk after the adoptive bone marrow transfers.
For the cotransfer experiments,1 ⫻ 106 bone marrow cells from 14- to
18-day-old NF-␬B2/1 dKO or WT (Ly5.2⫹) mice were mixed with 1 ⫻ 106
bone marrow cells from WT (Ly5.1⫹) mice and then injected i.v. into 6- to
8-wk-old lethally irradiated (900 rad) Ly5.1⫹ WT mice. The cotransfer
recipient mice were analyzed after 6 – 8 wk.
B cell isolation
Single-cell suspensions were prepared from bone marrow of 10- to 14-day
old as well as from 6- to 8-wk-old mice and from spleens of 6- to 8-wk-old
mice. Immature bone marrow B cells used in Western blot analysis were
purified first by negative selection with a mixture of MACS magnetic beads
containing anti-CD11B, anti-CD11c, anti Thy1.2, anti-Ter119, anti-CD43,
and anti-CD62L and then by positive selection with anti-B220 beads according to the manufacturer’s instructions (Miltenyi Biotec). For the
caspase, trypan blue exclusion and real-time PCR assays, bone marrow
immature B cells were purified from whole bone marrow single-cell suspensions first by negative selection with a mixture of MACS magnetic
beads containing anti-CD11B, anti-CD11c, anti-Thy1.2, anti-Ter119, antiCD43, and anti-CD62L followed by positive selection with anti-IgM
beads; early transitional B cells were purified from spleen suspensions first
by negative selection with a mixture of MACS magnetic beads containing
anti-CD43 and anti-CD62L and then followed by positive selection with
anti-CD19 beads using a manual column or AutoMACS Pro (Miltenyi
Biotec).
p100 (NF-␬B2) processing and caspase assays
Purified immature bone marrow B cells were incubated with medium alone
or with 1 ␮g/ml BAFF (PeproTech) for up to 24 h and total cell lysates
were extracted and analyzed by Western blot with NF-␬B2 Abs as described previously (11). For the caspase assay, purified immature B cells
were incubated with medium alone or with 1 ␮g/ml BAFF (PeproTech) for
18 –20 h and caspase 3 activation was measured using a NucView 488
Caspase 3 Assay Kit for Live Cells (Biotium) according to the manufacturer’s instructions.
Cell viability (trypan blue exclusion)
Purified immature bone marrow B cells and early transitional splenic B
cells were incubated with medium alone or with 1 ␮g/ml BAFF (PeproTech) for 24 h, then cells with mixed 1:1 with a 2% trypan blue solution
in PBS, and finally dead and alive cells were counted with a Cellometer
Vision Trio cell counter and the data were analyzed with Cellometer vision
4 software from Nexcelom Bioscience.
Real-time PCR
Total RNA was extracted from purified immature B cells and DNasetreated (TRIzol; Invitrogen and RNeasy; Qiagen). cDNA was synthesized
from 1–2 ␮g of total RNA using a cDNA kit per the manufacturer’s instructions (Invitrogen). To determine relative concentration levels, cDNAs
were subjected to real-time PCR with the Rotorgene 6000 (per the manufacturer’s instructions; Corbett), as well as with the Applied Biosystems
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
overexpression of Bcl-2 rescues these cells from immediate death,
but, interestingly, does not restore full maturation in the mutant B
cells (12, 25). This suggests that full maturation of B cells requires
functions of NF-␬B factors in addition to their role in cell survival.
Based on the results with NF-␬B1, NF-␬B2 doubly deficient B
cells, there may be two distinct, although at least partially redundant survival signals that activate NF-␬B in transitional B cells
(11, 12). One survival signal is mediated via the BAFF receptor,
which induces processing of NF-␬B2 (the alternative pathway).
The identity of the second signal remains unclear, but such a signal
may be mediated by the classical pathway, given that this pathway
readily activates most NF-␬B1 complexes, although other complexes can be activated as well. Involvement of the classical pathway at this stage of development is suggested by the fact that
abrogation of this pathway in B cells lacking the IKK regulatory
subunit NEMO completely blocks development of B cells at the
transitional stage, similar to what is seen in NF-␬B1, NF-␬B2 double knockout mice (8, 9).
In addition to contributing to the final stages of B cell development, NF-␬B has also been implicated in even earlier stages of
development. Before entering the spleen, B cells first begin their
development in the bone marrow, starting with pre-proB cells, then
traversing through early proB, late proB/early preB, late preB, and
immature B cell stages (26, 27). Previous reports have documented
limited basal NF-␬B activity at all stages, starting with proB cells,
and an apparent relative peak of activity at the early preB stage, at
a time when the preBCR is expressed on the cell surface (28). In
addition, suppression of NF-␬B activity via ectopic expression of
I␬B superrepressors partially impaired early B cell development,
possibly by interfering with preBCR signaling (28, 29) However,
this hypothesis remains to be proven and appears to be inconsistent
with another study in which the classic pathway was completely
eliminated: Conditional deletion of NEMO at the proB cell stage
failed to impede subsequent B cell development in the bone marrow (9).
Given that loss of both NF-␬B1 and NF-␬B2 had such a profound effect on B cell development in the spleen (11) and given
that loss of these two proteins impairs NF-␬B activity differently
than the superrepressor (28, 29) or the loss of NEMO (9), we more
carefully explored the development of B cells in the bone marrow
of NF-␬B1 and NF-␬B2 double knockout mutants. We discovered
a partial loss of late preB and immature B cells in these mutant
mice. Interestingly, the impaired bone marrow development in the
double knockout mutant was due to loss of both B cell-autonomous and B cell-nonautonomous (possibly B cell extrinsic) functions of NF-␬B1 and NF-␬B2. B cell-autonomous functions of
these two factors specifically aided immature B cells. Consistent
with an involvement of the NF-␬B2-dependent alternative pathway of activation, we provide evidence that BAFFR-mediated activation of this pathway contributes to the survival of immature B
cells. We conclude that distinct components of the NF-␬B transcription factor family, activated by different stimuli and pathways,
assist in B cell development in the bone marrow.
3407
NF-␬B-MEDIATED SURVIVAL OF IMMATURE B CELLS
3408
WT
NF-κB1,2 dKO
38 5.21
B220
52 6.26
CD43
Gate B220+ CD43+
C
B
C
HSA
B
A
BP-1
A
Gate B220+ CD43F
0.89
D
34.9
D
26.3
E
10.9
E
4.27
IgM
FIGURE 1. Reduced numbers of B220⫹CD43⫺ bone marrow B cells in
NF-␬〉1,2 dKO mice. FACS analyses of bone marrow from 16- to 20-dayold WT and NF-␬B1/2 dKO mice. Bone marrow B cells were separated
into six populations (A–F) according to the Hardy classification by staining
for cell surface expression of CD43, B220, HSA, BP-1, IgD, and IgM. A,
Pre-proB; B, proB; C, late proB/early preB; D, late preB; E, immature B;
and F, mature B. Data shown are representative of analyses of at least three
mice each for WT and dKO mice.
StepOne (according to the manufacturer’s instructions; Applied Biosystems). Primers were designed using the LUX primers software online (Invitrogen); they were labeled with FAM or left unlabeled but using SYBR
green in the PCR mix.
Primers were as follows: A1: forward (F), 5⬘-GATTGCCCTGGATC
TATGTGCT-3⬘ and backward, 5⬘-CACAGGGCCGTATCCATTCTCC
TG[FAM]G-3⬘; Mcl-1: F, 5⬘-GTCAAACAAAGAGGCTGGGATG-3⬘ and B,
5⬘-CGTACAGCCGCCTTCTAGGTCCTGTA[FAM]-G3⬘; Bcl-xL: F, 5⬘-CG
CAGGGCGATGAGTTTGAACTG[FAM]G-3⬘ and B, 5⬘-TGTGAAGCTG
GGATGTTAGATCA-3⬘; Bcl2: F, 5⬘-AAACAGAGGTCGCATGCTG-3⬘
and B, 5⬘-TCGCTACCGTCGTGACTTC-3⬘; BAFFR: F, 5⬘-GGCTGGAGAA
ATTCATGGTCAACAG-3⬘ and B, 5⬘-TCCTTGTATGTTAGGGGCTCAG
TCC-3⬘; GAPDH: F, 5⬘-ACCACAGTCCATGCCATCAC-3⬘ and B, 5⬘-TC
CACCACCCTGTTGCTGTA-3⬘ and F, 5⬘-CACCATCGTCCCGTAGACAA
AATGG[FAM]G-3⬘ and B, 5⬘-CAAATGGCAGCCCTGGTGA-3⬘.
Results
Reduced numbers of preB and immature B cells in NF-␬B1⫺/⫺,
NF-␬B2⫺/⫺ mice
Bone marrow cells from WT and NF-␬B1, NF-␬B2 dKO mice
were analyzed with flow cytometry to determine the proportion of
B cells at the various stages of their development. The dKO mice
yielded significantly lower numbers of cells from bone marrow
than WT mice due to the restricted marrow space in the bone of
mutant mice, which is the result of a block in osteoclast development (30). We performed flow cytometry on equal numbers of
bone marrow cells from young (16 –20 days old) mutant and control animals to determine the relative proportion of B cells at the
various stages of their development; this was accomplished by
harvesting more bone marrow from mutant mice. The CD43⫹
B220⫹ fraction encompasses the earliest developmental stages and
their proportion within the total bone marrow population appeared
to be normal; the CD43⫺B220⫹ fraction encompasses the later
stages and their proportion appeared to be reduced (Fig. 1, upper
panels). The B220⫹CD43⫹ fraction could be subdivided further
B cell developmental defect in dKO mice intrinsic to
hematopoietic cells
Loss of NF-␬B1 and NF-␬B2 could interfere with B cell development by impairing functions within B cells, other hematopoietic
cells, or stromal cells or a combination of cell types. To address
this issue, we first adoptively transferred bone marrow from dKO
mutant (and WT mice) into lethally irradiated Rag knockout mice
to reconstitute the hematopoietic system. Similar to the original
dKO mice, the mice adoptively transferred with dKO bone marrow
contained normal or even higher relative proportions of B cells in
the earlier phases of their development (CD43⫹B220⫹) and significantly reduced proportions of B cells in the later phases
(CD43⫺B220low) relative to the total number of bone marrow cells
(Fig. 2, upper panels). CD43⫺B220high B cells are only seen in the
control transfer of WT bone marrow, as expected; they represent
the mature recirculating cells which fail to form in spleens in the
absence of NF-␬B1 and NF-␬B2. These results indicate that the
partial block in bone marrow B cell development (CD43⫺
B220low) seen in the dKO mice could be transferred into recipient
mice, implying that the defect is intrinsic to hematopoietic cells
and not stromal cells. Furthermore, the results imply that the impaired development of B cells was not an indirect consequence of
restricted bone marrow space, since the host mice in these transfers
are not osteopetrotic.
We next analyzed the CD43⫺B220low B cells to distinguish immature (BP-1⫺IgM⫹) from late preB cells (BP-1⫹IgM⫺) (Fig. 2,
middle and lower panels, respectively). Consistent with what was
observed in the original dKO mice, both the immature and late
preB cell fractions were reduced in the transfer of mutant cells
when compared with WT cells. Again, the loss of late preB and
immature B cells was not observed in transfers of single knockouts, as expected (data not shown). Therefore, hematopoietic cellintrinsic defects in dKO mice are responsible for the partial block
in bone marrow B cell development, which is characterized by
reduced numbers of late preB and immature B cells.
Cell-autonomous role of NF-␬B in immature bone marrow
B cells
The relative loss of late preB cells in NF-␬B1 and NF-␬B2 doubly
deficient mice could be due to a failure in signaling from the
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
IgD
F
5.83
into pre-proB cells (gate A/fraction A: HSA⫺BP-1⫺), early proB
cells (gate B/fraction B: HSA⫹ BP-1⫺) and late proB/early preB
cells (gate C/fraction C/C’: HSA⫹ BP-1⫹) (26, 27) (Fig. 1, middle
panels).
We observed similar proportions of mutant and WT B cells in
these fractions, suggesting that the dKO mutant B cells progressed
normally through these early stages. The CD43⫺ fraction could be
subdivided further into late preB (fraction D: IgM⫺IgD⫺), immature B (fraction E: IgM⫹IgD⫺/low), and recirculating mature B
cells (fraction F: IgM⫹/lowIgD⫹) (Fig. 1, lower panels). We previously determined that full maturation of B cells is completely
blocked in the spleen of these dKO mutant mice, which explains
the total absence of mature recirculating B cells in the bone marrow (11). Unexpectedly, however, the proportions of late preB and
immature B cells (gates D and E) were also reduced in relation to
the total number of bone marrow cells. By comparison, NF-␬B1 or
NF-␬B2 single knockout mice did not exhibit any reductions in
late pre-B or immature B cells in the bone marrow, while NF-␬B2
knockouts did show a reduction in the numbers of mature recirculating B cells, as expected (data not shown). These data suggest
that NF-␬B1 and NF-␬B2 act redundantly to promote the development of B cells during transit through the late preB and immature phases.
The Journal of Immunology
WT
5.33
5.27
3409
NF-κB1,2 dKO
0.09
A Ly5.2 WT+Ly5.1 WT
B220
B220
14.97
18.74
36.67
11.82
1.54
19.24
CD43
Gate B220high CD43 -
Late preB
11.92
B220
Imm
4.21
BP-1
Gate B220low CD43Late preB
26.56
1.95
17.09
CD43
Imm
7.82
Ly5.2 dKO+Ly5.1 WT
9.80
57.53
Ly5.2
24.53
6.94
15.13
Immature
3.35
IgM
FIGURE 2. The relative loss of late preB and immature B cells in NF␬B1/2 dKO mice is due to a defect intrinsic to adoptively transferred hematopoietic cells. The numbers of B220⫹CD43⫺ late preB and immature B cells
were specifically reduced after reconstitution of lethally irradiated RAG-1
knockout mice with bone marrow from NF-␬B1/2 dKO mice. Bone marrow
for the adoptive transfers was taken from 14- to 18-day-old WT and NF-␬B1/2
dKO mice. Recipient mice were analyzed 6 wk after transfer and bone marrow
cell suspensions were stained for expression of B220, CD43, HAS, BP-1, IgM,
and IgD as in Fig. 1. Data shown are representative of five independent adoptive transfer experiments each for WT and dKO transfers. Imm, Immature.
preBCR within B cells, as was suggested by previous work in
which NF-␬B activity was suppressed with I␬B superrepressors
(28). On the other hand, this theory has been cast in doubt by a
more recent study with NEMO knockout B cells, in which no such
loss of preB cells was evident (9) (see Discussion). The present
analysis is distinct, since loss of NF-␬B1 and NF-␬B2 impairs
NF-␬B activity differently than the superrepressor or loss of
NEMO. To further investigate the mechanisms underlying the partial block in B cell development, we cotransferred WT Ly5.1marked and dKO Ly5.2-marked bone marrow cells into lethally
irradiated WT (Ly5.1) mice. This experimental design permits us
to determine whether the partial B cell developmental block was
due to defects intrinsic and autonomous to B cells, or whether it
was due to defects intrinsic to hematopoietic cells, acting indirectly
on B cells. Although the degree of reconstitution varied somewhat
between individual transfers, cotransfer of Ly5.2 dKO plus Ly5.1
WT bone marrow reconstituted the total B cell compartment generally as well as the control cotransfer of Ly5.2 WT plus Ly5.1
WT bone marrow (Fig. 3A, upper panels).
When the relative fractions of mutant Ly5.2-marked B cells
were compared with WT 5.2-marked B cells in the control transfers, no stage-specific defect was apparent in the earlier CD43⫹
stages, as expected (data not shown). Also, as predicted from our
findings above, the presence of WT bone marrow, regardless of Ly
marker type, fully restored CD43⫹B220high mature recirculating
Gate B220low CD43 -
39.39
26.06
49.26
29.16
17.57
16.99
16.82
4.75
Ly5.2
B
*
Ratio Late preB/ Immature B cells
Late
preB
B220
Immature
1.62
8
6
4
2
0
Ly5.1WT Ly5.2WT Ly5.1WT Ly5.2dKO
Co-Transfer
Co-Transfer
FIGURE 3. The relative loss of immature B cells, but not late preB cells
in NF-␬B1/2 dKO mice is due to a B cell-autonomous defect. A, Lethally
irradiated WT mice bearing the Ly5.1 marker were reconstituted with a
mixture (cotransfer) of bone marrow cells from Ly5.1 WT mice and Ly5.2
dKO mice or with a mixture of bone marrow from Ly5.1 WT and Ly5.2
WT mice (control for Ly5.2 transfer). Bone marrow for transfers was obtained from 14- to 18-day-old mice. Recipient mice were analyzed 6 – 8
wk after transfers and bone marrow cells were analyzed with FACS analyses after staining for expression of B220, CD43, BP-1, Ly5.2, and Ly5.1.
Data are representative of three independent experiments each for WT ⫹
WT and WT ⫹ dKO cotransfers. B, Ratio of late preB:immature B cells
averaged over the three independent cotransfer analyses represented by the
FACS data in A. Shown are the ratios for the Ly5.1 WT and Ly5.2 WT B
cells from the WT/WT cotransfers and the ratios for the Ly5.1 WT and
Ly5.2 dKO cells from the WT/dKO cotransfers. ⴱ, p ⫽ 0.03 (one-way
ANOVA; GraphPad Prism).
cells, while Ly5.2⫹ dKO cells failed to do so (Fig. 3A, middle
panels). Analysis of the remaining CD43⫺B220low cells revealed
an unexpected result, however. The fraction of Ly5.2⫹ dKO
BP-1⫹ late preB cells were present at normal or even elevated
levels, while the BP-1⫺ mutant immature B cell fraction was reduced when compared with either Ly5.2⫺ cells (WT Ly5.1⫹ cells)
in the same mouse or when compared with either WT Ly5.2⫹ or
WT Ly5.1⫹ cells in the control transfers (Fig. 3A, lower panels).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Late
preB
90.45
BP-1
BP-1
37.04
NF-␬B-MEDIATED SURVIVAL OF IMMATURE B CELLS
3410
A
Late preB
Immature
Transitional1
Transitional2
Mature B
C
-
+
BAFF
p100
*
BAFFR
p52
β-actin
TACI
B 15
Spleen
Bone Marrow
*
60
10
MFI
MFI
*
40
*
5
20
0
0
BAFFR
Isotype
*
To more clearly visualize this, we pooled the data from all transfers and displayed them as the ratio of late preB to immature B
cells for Ly5.2⫹ and for Ly5.1⫹ (Ly5.2⫺) cells for both dKO and
control transfers (Fig. 3B). We observed a consistent ratio for all
WT cells, regardless of transfer and Ly marker subtype, while the
dKO Ly5.2⫹ B cells revealed a clear change in this ratio in favor
of the late preB cells over the immature B cells. These data suggest
that the loss of late preB cells observed in the original dKOs and
Rag transfers was not due to defects autonomous and intrinsic to B
cells, even though it was due to defects intrinsic to hematopoietic
cells. We speculate that problems in non-B cells affected the
generation of late preB cells in the original dKO mice and in the
Rag transfers (see Discussion). Regarding the immature B cells,
however, the present cotransfer data clearly reveal a B cell-autonomous role for NF-␬B1 and NF-␬B2 at this stage of development.
BAFFR activates the alternative pathway and induces survival
in immature B cells
Because NF-␬B2 is an integral part of the alternative pathway of
activation, we suspected that this pathway may be activated by
BAFF not only in transitional and mature B cells in the spleen (11,
24), but also in immature B cells in the bone marrow. This is
conceivable since BAFF is known to be expressed in the bone
marrow (31). We therefore investigated binding of BAFF to the
various populations of developing B cells. In agreement with an
earlier report, we confirmed binding of BAFF to immature bone
marrow B cells, in addition to binding to transitional and mature B
cells in the spleen (data not shown) (32–34).
BAFF can bind to three receptors, BAFFR (BR3), B cell maturation Ag (BCMA), and TACI, although the BAFFR appears to
be the preferred receptor (35, 36). BCMA and TACI are also targeted by the ligand APRIL, but not BAFFR. All three receptors
have been shown to lead to activation of NF-␬B activity, but
among them, only the BAFFR is known to activate the alternative
pathway. It has not previously been determined which receptor
may be responsible for BAFF binding on immature bone marrow
B cells. We used flow cytometry to assess expression of these
receptors on the various B cell populations from freshly isolated
bone marrow and spleen (representative experiment is shown in
Fig. 4A; median fluorescent intensity of multiple BAFFR experiments shown in Fig. 4B). BCMA expression was below the levels
of detection on the particular B cell populations analyzed here
(data not shown). TACI expression was essentially undetectable on
late preB and immature bone marrow B cells. A small number of
T1 B cells began to show TACI expression; TACI expression was
much more pronounced among T2 cells and all mature follicular B
cells stained positive for this receptor. BAFFR expression was
essentially undetectable on late preB cells, but in contrast to TACI,
low levels of BAFFR were evident on some immature bone marrow B cells. Consistent with previous reports (32, 33), BAFFR was
clearly expressed on T1 cells in the spleen and expression of this
receptor was further increased on T2 and mature B cells. We also
confirmed the expression of BAFFR with quantitative real-time
PCR analyses of isolated immature B cells (data not shown).
To directly test whether BAFFR-mediated activation of the alternative pathway in immature B cells could conceivably explain
the involvement of NF-␬B2 at this stage of development, we stimulated freshly isolated immature B cells with BAFF. Extracts from
these cells were analyzed for processing of p100 NF-␬B2 to p52,
the hallmark of alternative signaling. As shown in Fig. 4C, BAFF
induced processing in immature bone marrow B cells, consistent
with BAFFR expression on these cells and in agreement with a
previously reported experiment (11). This is most clearly evidenced by the changed ratio of the precursor p100 to the processed
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Expression of a functional BAFFR begins at the immature bone marrow B cell stage during B cell development. A, Bone marrow single-cell
suspensions were stained with Abs to cell surface markers B220, CD43, and IgM as well with Abs to either BAFFR or TACI. Total splenocytes were stained
with Abs to IgM, CD23, and AA4.1 as well as with Abs to either BAFFR or TACI. The FACS analyses show levels of BAFFR or TACI expression on
late preB cells (B220⫹CD43⫺IgM⫺), immature B cells (B220lowCD43⫺IgM⫹), T1 (AA4.1⫹CD23⫺IgM⫹), T2 (AA4.1⫹CD23⫹IgM⫹), and mature follicular B cells (AA4.1⫺CD23⫹IgM⫹). The data shown are representative of four independent analyses for BAFFR and two for TACI. B, Median
fluorescence intensity (MFI) analysis of four independent experiments for BAFFR. C, BAFFR is functional in immature B cells (CD43⫺B220⫹CD62L⫺).
Stimulation of purified immature B cells with BAFF at 1 ␮g/ml for 24 h induces some processing of p100 (NF-␬B2) to p52 as shown by Western blot
analysis with an anti-NF-␬B2 Ab. Reblotting with a ␤-actin Ab shows equal loading of lanes. p100 and p52 are shown with arrows; ⴱ, A nonspecific band.
Similar results were obtained in three additional independent experiments.
The Journal of Immunology
3411
Discussion
FIGURE 5. BAFF induces antiapoptotic genes in immature B cells.
A, Real-time PCR analyses of immature B cells left unstimulated or
stimulated with BAFF at 1 ␮g/ml for 18 –20 h. Ratio of stimulated:
unstimulated mRNA levels for antiapoptotic proteins Bcl-2, Bcl-xL,
Mcl-1, and A1 are shown. Also shown for comparison are real-time
PCR ratios of BAFF stimulated:unstimulated levels of Bcl-2 and A1 in
splenic early transitional B cells (BAFF at 1 ␮g/ml for 18 –20 h). Bone
marrow and spleen cells from four to five mice were pooled and isolated
as described in Materials and Methods. Data for immature B cells are
from three (Mcl-1, Bcl-xL) or four (Bcl-2, A1) independent experiments; data for early transitional B cells are from two independent
experiments. ⴱ, p ⬍ 0.05 (Student’s t test; GraphPad Prism). B, BAFF
blunts caspase 3 activation in immature B cells. Caspase 3 activation
assay in immature B cells left unstimulated or stimulated with BAFF (1
␮g/ml) for 18 –20 h. Immature B cells were collected as described in A.
A similar result was obtained in a second independent experiment. C,
BAFF induced increase in viability in both bone marrow immature and
splenic early transitional B cells. Trypan blue exclusion analyses of
immature and transitional B cells left unstimulated or stimulated with
BAFF at 1 ␮g/ml for 24 h. Bone marrow and spleen cells from four to
five mice were pooled and isolated as described in Materials and Methods. Data are from three independent experiments. ⴱ, p ⬍ 0.05 (Student’s t test; GraphPad Prism).
p52. We isolated the immature CD43⫺CD62L⫺ B220⫹ bone
marrow B cells from very young mice that did not yet contain
recirculating mature B cells or by careful sorting from adult bone
marrow, avoiding contamination with recirculating mature B cells;
either way, BAFF induced processing. As shown previously (11),
peripheral splenic B cells contain higher levels of p100 then the
We have analyzed the early B cell development in mice lacking
both NF-␬B1 and NF-␬B2. In addition to causing a complete block
in B cell maturation in the spleen, as reported previously (11, 30),
we now show that loss of these two NF-␬B proteins partially
blocks B cell development in the bone marrow. NF-␬B1 and NF␬B2 contribute to the generation of normal levels of late preB and
immature B cells. Surprisingly, only the generation of immature B
cells involves B cell-intrinsic and cell-autonomous function(s) of
these two factors, while the generation of late preB cells involves
function(s) of NF-␬B1/2 intrinsic to hematopoietic cells, but not
autonomous to B cells.
These data establish NF-␬B as a stage-specific, B cell-autonomous contributor to immature B cell development in the bone marrow. Therefore, B cells appear to develop a dependency on NF-␬B
activity concomitant with expression of IgM receptors on their
surface. Whether NF-␬B could have such a role in bone marrow B
cell development has been controversial. Earlier reports suggested
that the I␬B superrepressor expressed in B cells partially interferes
with preBCR-initiated survival signals, thereby partially blocking
generation of late preB cells (28, 29). However, the various bone
marrow B cell stages could not be fully distinguished in some of
the initial experiments and the studies did not strictly rule out the
possibility that B cells were largely lost at a much earlier stage,
when bone marrow precursors were transduced with I␬B superrepressor ex vivo before adoptive transfer. During these ex vivo
manipulations, B cell precursors were likely to be exposed to high
levels of stress, probably including TNF. The I␬B superrepressor
is known to lower resistance to TNF and thus may have facilitated
early apoptosis in stressed B cell precursors, a scenario also suggested by others (37). In addition to these concerns regarding the
roles of NF-␬B in early B cell development, a more recent report
concluded that the classical pathway for NF-␬B activation is completely dispensable for bone marrow B cell development (8, 9).
NEMO is an essential component of the classical, IKK-dependent
activation pathway which leads to degradation of I␬B␣. Cre-mediated loss of NEMO at the proB cell stage (preceding preB cells)
failed to impede subsequent development of B cells in the bone
marrow, but completely blocked development during the transitional B cell phase in the spleen. Relevant to the present study,
none of the previous studies cited above has addressed possible
contributions of NF-␬B components activated by the alternative
(NEMO-independent) pathway, which cannot be directly inhibited
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
immature bone marrow B cells, and BAFF stimulation results in
more dramatic levels of processing of p100 to p52.
We also tested for antiapoptotic gene expression in freshly isolated immature B cells stimulated with BAFF. This cytokine
induced the expression of the antiapoptotic genes for Bcl-2 and A1
and, to a lesser extent, Mcl1 and Bcl-xL, either directly or indirectly, as determined with real-time PCR assays (Fig. 5A). For
comparison, the BAFF-induced increase in expression of A1 and
Bcl-2 in early transitional splenic cells is shown as well. Consistent
with the induction of antiapoptotic genes, BAFF functionally protected immature B cells from spontaneous apoptosis, at least partially, as judged by a reproducible reduction in activated caspase 3
levels in response to BAFF (Fig. 5B). The freshly isolated immature B cells contained significant levels of activated caspase 3,
while late preB cells harbored much lower levels of activated
caspase 3 that were unaffected by BAFF, as expected from lack of
receptor expression (data not shown). Consistent with the BAFFinduced reduction in activated caspase 3 levels, the viability of
bone marrow immature B cells also improved (as did that of
splenic early transitional cells; Fig. 5C).
3412
lation is reduced in a naturally arising mutant mouse strain that
harbors a mutation in the BAFFR. Therefore, BAFF must play a
role to facilitate the generation of such T2-like bone marrow B
cells from immature cells. There may be an overlapping continuum
of developing B cells in bone marrow and spleen, which might
arise if B cells have a window during which they migrate out of the
bone, instead of a sharply defined stage of development. This window may persist long enough so that some immature B cells can
progress to the transitional stages in bone marrow with the help of
BAFF, while most immature B cells may exit to migrate to the
spleen before reaching the transitional stages.
It is not clear what signals target NF-␬B1 at the immature B cell
stage in vivo. It also remains to be shown whether NF-␬B1 contributes as part of the classical pathway of activation or in some
other capacity. An association with the classical pathway might be
suggested by the fact that dimers of p50/NF-␬B1 and RelA are the
primary, although not exclusive targets of this pathway. One possible signal could be “tonic” or low-level Ag-stimulated signaling
from the BCR itself, since immature B cells are the first to express
this receptor and since the machinery is present to activate the
classical pathway from this receptor (40). Indeed, NF-␬B has been
suggested to be involved in control of Rag expression downstream
of a functional BCR in immature bone marrow B cells, providing
further evidence for a role of NF-␬B in immature B cells (44).
Taken together, the data indicate that NF-␬B is not only essential for the maturation and long-term maintenance of B cells in the
periphery, but that it already begins to contribute to survival and
thus development of immature B cells in the bone marrow. NF␬B1 and NF-␬B2 have redundant, B cell-autonomous functions
that assure optimal numbers of immature B cells in vivo and that
may allow some of these cells to progress well into the transitional
phases before emigrating to the spleen. In addition, NF-␬B1 and
NF-␬B2 have a role in B cell development during the transition
from proB to late preB cells, but in the model analyzed here this
involves hematopoietic cell-intrinsic, but not B cell-autonomous
functions. We conclude that NF-␬B begins its dominant role in the
life of B cells upon expression of a fully functional BCR on immature B cells in the bone marrow. Therefore, BAFF levels in the
bone marrow might be expected to influence positive and negative
selection of immature B cells and could help regulate homeostatic
control of B cells in health and loss of tolerance in disease.
Acknowledgments
We thank Dr. A. S. Fauci for continued support.
Disclosures
The authors have no financial conflict of interest.
References
1. May, M. J. 2006. A nuclear factor in B cells and beyond. J. Immunol. 177:
7483–7484.
2. Hoffmann, A., and D. Baltimore. 2006. Circuitry of nuclear factor ␬B signaling.
Immunol. Rev. 210: 171–186.
3. Carmody, R. J., and Y. H. Chen. 2007. Nuclear factor-␬B: activation and regulation during Toll-like receptor signaling. Cell Mol. Immunol. 4: 31– 41.
4. Doyle, S. L., and L. A. O’Neill. 2006. Toll-like receptors: from the discovery of
NF␬B to new insights into transcriptional regulations in innate immunity. Biochem. Pharmacol. 72: 1102–1113.
5. Weil, R., and A. Israel. 2004. T-cell-receptor- and B-cell-receptor-mediated activation of NF-␬B in lymphocytes. Curr. Opin. Immunol. 16: 374 –381.
6. Schulze-Luehrmann, J., and S. Ghosh. 2006. Antigen-receptor signaling to nuclear factor ␬B. Immunity 25: 701–715.
7. Brezski, R. J., and J. G. Monroe. 2007. BCR-linked factors in developmental fate
decisions. Adv. Exp. Med. Biol. 596: 47–55.
8. Sasaki, Y., E. Derudder, E. Hobeika, R. Pelanda, M. Reth, K. Rajewsky, and
M. Schmidt-Supprian. 2006. Canonical NF-␬B activity, dispensable for B cell
development, replaces BAFF-receptor signals and promotes B cell proliferation
upon activation. Immunity 24: 729 –739.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
by the I␬B superrepressor. Our studies here suggest that NF-␬B2,
functioning via the alternative pathway, and NF-␬B1, most likely
acting via the classical pathway, make redundant, B cell-autonomous contributions at the immature B cell stage in the bone marrow (see further discussion below). These factors contribute to
developmental progression of B cells in the bone marrow, but are
not absolutely required for immature B cells to emigrate to the
spleen.
In addition to the B cell autonomous role at the immature B cell
stage, NF-␬B1 and NF-␬B2 also have redundant functions in hematopoietic cells that contribute to optimal generation of preB
cells. In dKO mice or in mice in which the entire hematopoietic
system was regenerated with dKO bone marrow, a significant reduction of preB cells was observed in addition to a reduction of
immature B cells. However, the presence of WT hematopoietic
cells corrected the loss of mutant late preB cells in cotransfer experiments. NF-␬B1 and NF-␬B2 may be responsible for production of a factor by hematopoietic cells (possibly including B cells
themselves) that helps generate optimal numbers of late preB cells.
Such a factor might act similar to hemokinin 1. hemokinin 1 is
produced by B cells and other hematopoietic cells in the bone
marrow, such as myeloid cells, and this peptide has been shown to
help the proliferation/survival of B cells during their transition
from proB to late preB cells (38). We have confirmed the ability of
hemokinin 1 to promote generation of late preB cells in bone marrow cultures (our unpublished data). Hemokinin 1 is not known to
be controlled by NF-␬B, but it is conceivable that other factors like
Hemokinin 1 exist that are regulated by this transcription factor. It
is also possible that loss of NF-␬B1 and NF-␬B2 in hematopoietic
cells caused a rise in apoptotic cytokines or stress mediators that
targeted preB cells and reduced their numbers.
How might NF-␬B1 and NF-␬B2 help generate and/or sustain
immature B cells in a cell-autonomous manner? Immature B cells
are the first to express IgM. They are subject to negative selection/
receptor editing to eliminate autoreactive B cell receptors and they
may also be under positive selection to assure progression of only
those B cells that have a functional BCR (39, 40). Our data indicate that freshly isolated immature B cells have a high level of
cleaved (activated) caspase 3 and survive poorly in culture, which
suggests that these cells are intrinsically prone to undergo apoptosis and may thus benefit greatly from survival signals. BAFF is
known to be expressed in the bone marrow and is thus likely to be
accessible to developing B cells, although it could be spatially
restricted (31). Addition of BAFF to freshly isolated immature B
cells induced the processing of NF-␬B2 p100 to p52, which indicates that the BAFFR is not only present, but that it is capable of
signaling as well. BAFF significantly reduced the levels of activated caspase 3 in immature B cells and improved cell viability,
consistent with directly or indirectly induced expression of antiapoptotic proteins, in particular Bcl-2 and A1. This suggests that
BAFF contributes to survival of immature B cells and that it does
so at least in part via NF-␬B2 and the alternative pathway. BAFF
can also engage the TACI receptor, which activates the classical
NF-␬B activation pathway. However, this receptor appears not be
expressed at significant levels on immature bone marrow B cells,
although it is clearly expressed on transitional and mature B cells
in the spleen (41).
A recent report lends support to the notion that a BAFF-BAFFR
pathway is functioning in the bone marrow to support development
of B cells (42, 43). Although most CD23⫹CD62L⫹ B cells in the
bone marrow are recirculating mature B cells, a small subpopulation with lower but detectable levels of these markers has been
identified which appears to resemble the peripheral T2 B cell pool,
but which originates de novo in the bone marrow; this subpopu-
NF-␬B-MEDIATED SURVIVAL OF IMMATURE B CELLS
The Journal of Immunology
28. Jimi, E., R. J. Phillips, M. Rincon, R. Voll, H. Karasuyama, R. Flavell, and
S. Ghosh. 2005. Activation of NF-␬B promotes the transition of large, CD43⫹
pre-B cells to small, CD43- pre-B cells. Int. Immunol. 17: 815– 825.
29. Feng, B., S. Cheng, W. S. Pear, and H. C. Liou. 2004. NF-␬B inhibitor blocks B
cell development at two checkpoints. Med. Immunol. 3: 1.
30. Franzoso, G., L. Carlson, L. Xing, L. Poljak, E. W. Shores, K. D. Brown,
A. Leonardi, T. Tran, B. F. Boyce, and U. Siebenlist. 1997. Requirement for
NF-␬B in osteoclast and B-cell development. Genes Dev. 11: 3482–3496.
31. Schaumann, D. H., J. Tuischer, W. Ebell, R. A. Manz, and R. Lauster. 2007.
VCAM-1-positive stromal cells from human bone marrow producing cytokines
for B lineage progenitors and for plasma cells: SDF-1, flt3L, and BAFF. Mol.
Immunol. 44: 1606 –1612.
32. Hsu, B. L., S. M. Harless, R. C. Lindsley, D. M. Hilbert, and M. P. Cancro. 2002.
Cutting edge: BLyS enables survival of transitional and mature B cells through
distinct mediators. J. Immunol. 168: 5993–5996.
33. Treml, L. S., J. E. Crowley, and M. P. Cancro. 2006. BLyS receptor signatures
resolve homeostatically independent compartments among naive and antigenexperienced B cells. Semin. Immunol. 18: 297–304.
34. Stadanlick, J. E., and M. P. Cancro. 2008. BAFF and the plasticity of peripheral
B cell tolerance. Curr. Opin. Immunol. 20: 158 –161.
35. Mackay, F., and M. P. Cancro. 2006. Travelling with the BAFF/BLyS family:
Are we there yet? Semin. Immunol. 18: 261–262.
36. Mackay, F., P. A. Silveira, and R. Brink. 2007. B cells and the BAFF/APRIL
axis: fast-forward on autoimmunity and signaling. Curr. Opin. Immunol. 19:
327–336.
37. Igarashi, H., Y. Baba, Y. Nagai, E. Jimi, S. Ghosh, and P. W. Kincade. 2006.
NF-␬B is dispensable for normal lymphocyte development in bone marrow but
required for protection of progenitors from TNF␣. Int. Immunol. 18: 653– 659.
38. Zhang, Y., A. Berger, C. D. Milne, and C. J. Paige. 2006. Tachykinins in the
immune system. Curr. Drug Targets 7: 1011–1020.
39. Hippen, K. L., B. R. Schram, L. E. Tze, K. A. Pape, M. K. Jenkins, and
T. W. Behrens. 2005. In vivo assessment of the relative contributions of deletion,
anergy, and editing to B cell self-tolerance. J. Immunol. 175: 909 –916.
40. Tze, L. E., B. R. Schram, K. P. Lam, K. A. Hogquist, K. L. Hippen, J. Liu,
S. A. Shinton, K. L. Otipoby, P. R. Rodine, A. L. Vegoe, et al. Basal immunoglobulin signaling actively maintains developmental stage in immature B cells.
PLoS Biol. 3:e82, 2005.
41. Crowley, J. E., J. L. Scholz, W. J. Quinn Iii, J. E. Stadanlick, J. F. Treml,
L. S. Treml, Y. Hao, R. Goenka, P. J. O’Neill, A. H. Matthews, et al. 2008.
Homeostatic control of B lymphocyte subsets. Immunol. Res. 42: 75– 83.
42. Lindsley, R. C., M. Thomas, B. Srivastava, and D. Allman. 2007. Generation of
peripheral B cells occurs via two spatially and temporally distinct pathways.
Blood 109: 2521–2528.
43. Allman, D., and S. Pillai. 2008. Peripheral B cell subsets. Curr. Opin. Immunol.
20: 149 –157.
44. Verkoczy, L., D. Ait-Azzouzene, P. Skog, A. Martensson, J. Lang, B. Duong, and
D. Nemazee. 2005. A role for nuclear factor ␬B/Rel transcription factors in the
regulation of the recombinase activator genes. Immunity 22: 519 –531.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
9. Sasaki, Y., M. Schmidt-Supprian, E. Derudder, and K. Rajewsky. 2007. Role of
NF␬B signaling in normal and malignant B cell development. Adv. Exp. Med.
Biol. 596: 149 –154.
10. Brink, R. 2006. Regulation of B cell self-tolerance by BAFF. Semin. Immunol.
18: 276 –283.
11. Claudio, E., K. Brown, S. Park, H. Wang, and U. Siebenlist. 2002. BAFF-induced
NEMO-independent processing of NF-␬B2 in maturing B cells. Nat. Immunol. 3:
958 –965.
12. Claudio, E., K. Brown, and U. Siebenlist. 2006. NF-␬B guides the survival and
differentiation of developing lymphocytes. Cell Death Differ. 13: 697–701.
13. Del Nagro, C. J., D. C. Otero, A. N. Anzelon, S. A. Omori, R. V. Kolla, and
R. C. Rickert. 2005. CD19 function in central and peripheral B-cell development.
Immunol. Res. 31: 119 –131.
14. Liou, H. C., and C. Y. Hsia. 2003. Distinctions between c-Rel and other NF-␬B
proteins in immunity and disease. BioEssays 25: 767–780.
15. Gerondakis, S., R. Grumont, R. Gugasyan, L. Wong, I. Isomura, W. Ho, and
A. Banerjee. 2006. Unravelling the complexities of the NF-␬B signalling pathway using mouse knockout and transgenic models. Oncogene 25: 6781– 6799.
16. Bonizzi, G., and M. Karin. 2004. The two NF-␬B activation pathways and their
role in innate and adaptive immunity. Trends Immunol. 25: 280 –288.
17. Hayden, M. S., A. P. West, and S. Ghosh. 2006. NF-␬B and the immune response. Oncogene 25: 6758 – 6780.
18. Basak, S., H. Kim, J. D. Kearns, V. Tergaonkar, E. O’Dea, S. L. Werner,
C. A. Benedict, C. F. Ware, G. Ghosh, I. M. Verma, and A. Hoffmann. 2007. A
Fourth I␬B protein within the NF-␬B signaling module. Cell 128: 369 –381.
19. Pasparakis, M., M. Schmidt-Supprian, and K. Rajewsky. 2002. I␬B kinase signaling is essential for maintenance of mature B cells. J. Exp. Med. 196: 743–752.
20. Mills, D. M., G. Bonizzi, M. Karin, and R. C. Rickert. 2007. Regulation of late
B cell differentiation by intrinsic IKK␣-dependent signals. Proc. Natl. Acad. Sci.
USA 104: 6359 – 6364.
21. Senftleben, U., Y. Cao, G. Xiao, F. R. Greten, G. Krahn, G. Bonizzi, Y. Chen,
Y. Hu, A. Fong, S. C. Sun, and M. Karin. 2001. Activation by IKK␣ of a second,
evolutionary conserved, NF-␬B signaling pathway. Science 293: 1495–1499.
22. Kaisho, T., K. Takeda, T. Tsujimura, T. Kawai, F. Nomura, N. Terada, and
S. Akira. 2001. I␬B kinase ␣ is essential for mature B cell development and
function. J. Exp. Med. 193: 417– 426.
23. Sen, R. 2006. Control of B lymphocyte apoptosis by the transcription factor
NF-␬B. Immunity 25: 871– 883.
24. Siebenlist, U., K. Brown, and E. Claudio. 2005. Control of lymphocyte development by nuclear factor-␬B. Nat. Rev. Immunol. 5: 435– 445.
25. Grossmann, M., L. A. O’Reilly, R. Gugasyan, A. Strasser, J. M. Adams, and
S. Gerondakis. 2000. The anti-apoptotic activities of Rel and RelA required during B-cell maturation involve the regulation of Bcl-2 expression. EMBO J. 19:
6351– 6360.
26. Hardy, R. R., and S. A. Shinton. 2004. Characterization of B lymphopoiesis in
mouse bone marrow and spleen. Methods Mol. Biol. 271: 1–24.
27. Hardy, R. R., P. W. Kincade, and K. Dorshkind. 2007. The protean nature of cells
in the B lymphocyte lineage. Immunity 26: 703–714.
3413