Microbiology (2005), 151, 1313–1323
DOI 10.1099/mic.0.27701-0
Pseudomonas aeruginosa lectin LecB is located in
the outer membrane and is involved in biofilm
formation
Denis Tielker,1 Stephanie Hacker,2 Remy Loris,3 Martin Strathmann,4
Jost Wingender,4 Susanne Wilhelm,1 Frank Rosenau1
and Karl-Erich Jaeger1
1
Institut für Molekulare Enzymtechnologie, Heinrich-Heine-Universität Düsseldorf,
Forschungszentrum Juelich, D-52426 Juelich, Germany
Correspondence
Karl-Erich Jaeger
[email protected]
2
Lehrstuhl für Biologie der Mikroorganismen, Ruhr-Universität Bochum, D-44801 Bochum,
Germany
3
Laboratorium voor Ultrastructuur, Vlaams Interuniversitair Instituut voor Biotechnologie and
Vrije Universiteit Brussel, B-1050 Brussel, Belgium
4
Biofilm Centre, Abteilung Aquatische Mikrobiologie, Universität Duisburg-Essen, D-47057
Duisburg, Germany
Received 13 October 2004
Revised
1 February 2005
Accepted 3 February 2005
Pseudomonas aeruginosa is an opportunistic pathogen which causes a variety of diseases,
including respiratory tract infections in patients suffering from cystic fibrosis. Therapeutic
treatment of P. aeruginosa infections is still very difficult because the bacteria exhibit high
intrinsic resistance against a variety of different antibiotics and, in addition, form stable biofilms,
e.g. in the human lung. Several virulence factors are produced by P. aeruginosa, among them the
two lectins LecA and LecB, which exert different cytotoxic effects on respiratory epithelial
cells and presumably facilitate bacterial adhesion to the airway mucosa. Here, the physiology has
been studied of the lectin LecB, which binds specifically to L-fucose. A LecB-deficient
P. aeruginosa mutant was shown to be impaired in biofilm formation when compared with the
wild-type strain, suggesting an important role for LecB in this process. This result prompted an
investigation of the subcellular localization of LecB by cell fractionation and subsequent
immunoblotting. The results show that LecB is abundantly present in the bacterial outer-membrane
fraction. It is further demonstrated that LecB could be released specifically by treatment of the
outer-membrane fraction with p-nitrophenyl a-L-fucose, whereas treatment with D-galactose
had no effect. In contrast, a LecB protein carrying the mutation D104A, which results in a defective
sugar-binding site, was no longer detectable in the membrane fraction, suggesting that LecB
binds to specific carbohydrate ligands located at the bacterial cell surface. Staining of biofilm cells
using fluorescently labelled LecB confirmed the presence of these ligands.
INTRODUCTION
Lectins represent a specific class of carbohydrate-binding
proteins different from enzymes or antibodies (Barondes
et al., 1988). They are found in a wide range of organisms
including viruses, bacteria, plants and animals, and are
believed to play an important role in cell–cell interactions
(Gabius et al., 2002). Specific recognition of or attachment
to target cells was demonstrated for the mannose-specific
lectin FimH from Escherichia coli, which mediates adhesion
Abbreviations: CF, cystic fibrosis; CLSM, confocal laser scanning
microscopy; pNPC, p-nitrophenyl caproate; pNPF, p-nitrophenyl a-Lfucose.
0002-7701 G 2005 SGM
between the bacterium and the urothelium (Beachey, 1981).
Furthermore, lectins may have significant biotechnological
and medical potential, as exemplified by the galactosidespecific mistletoe lectin, which is used on a large scale to
support anti-cancer therapy (Beuth et al., 1995).
Pseudomonas aeruginosa, an important opportunistic
pathogen associated with chronic airway infections, synthesizes two lectins, LecA and LecB (formerly respectively
named PA-IL and PA-IIL) (Gilboa-Garber, 1982). Strains of
P. aeruginosa that produce high levels of these virulence
factors exhibit an increased virulence potential (GilboaGarber & Garber, 1992). The lectins play a prominent role
in human infections, as it was demonstrated that a P.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
Printed in Great Britain
1313
D. Tielker and others
aeruginosa-induced otitis externa diffusa (Steuer et al., 1993)
as well as respiratory tract infections (von Bismarck et al.,
2001) could successfully be treated by application of a solution containing LecA- and LecB-specific sugars. The sugar
solutions presumably prevented lectin-mediated bacterial
adhesion to the corresponding host tissue. The expression of
lectin genes in P. aeruginosa is coordinately regulated with
certain other virulence factors and controlled via quorum
sensing and by the alternative sigma factor RpoS (Winzer
et al., 2000).
The galactophilic LecA has been characterized in great detail
over the last 30 years. It consists of four 12?75 kDa subunits
(Gilboa-Garber, 1972; Avichezer et al., 1992) and has been
shown to cause cytotoxic effects on respiratory epithelial
cells by decreasing their growth rate, thus contributing to
respiratory epithelial injury during P. aeruginosa infection
(Bajolet-Laudinat et al., 1994). In addition, it was demonstrated that LecA induces a permeability defect in the
intestinal epithelium, resulting in increased absorption of
exotoxin A, an important extracellular virulence factor of
P. aeruginosa (Laughlin et al., 2000).
LecB consists of four 11?73 kDa subunits, each exhibiting
a high specificity for L-fucose and its derivatives (GilboaGarber et al., 2000; Garber et al., 1987) and also for Dmannose, with lower affinity. Its crystal structure was
determined recently (Mitchell et al., 2002, 2005; Loris et al.,
2003). In cystic fibrosis (CF), increased terminal fucosylation of airway epithelial glycoproteins is found, as well as
a higher percentage of sialylated and sulfated oligosaccharides in Lewis A oligosaccharide side chains, which
presumably represent preferential ligands for LecB (Mitchell
et al., 2002), which thereby contributes significantly to
chronic respiratory Pseudomonas infections (Scanlin &
Glick, 2001). In addition, LecB decreases in vitro the ciliary
beat frequency of the airway epithelium, hence inhibiting
an important defence mechanism of the human lung (Adam
et al., 1997a, b).
Both P. aeruginosa lectins were shown to be located mainly
in the cytoplasm of planktonic cells (Glick & Garber, 1983).
These findings make it difficult to explain the lectinmediated cytotoxic and adhesive properties. Recently, it was
suggested that LecB is exposed on the surface of sessile
Pseudomonas cells, since the addition of L-fucose-branched
chitosan leads to specific cell aggregation (Morimoto et al.,
2001).
Biofilms are accumulations of micro-organisms at solid–
liquid or solid–air interfaces, where the cells are embedded
in a matrix of self-produced extracellular polymeric substances, with polysaccharides and proteins as characteristic
components (Wingender et al., 1999). Exopolysaccharides
are considered as key components which determine the
structural and functional integrity of microbial biofilm
aggregates by the formation of a three-dimensional, gel-like,
highly hydrated and locally charged biofilm matrix, in which
the micro-organisms are immobilized. Also, binding of
1314
biofilm cells (cohesion) and anchoring of biofilms to the
substratum (adhesion) are mediated by exopolysaccharides.
Consequently, extracellular proteins with lectin-like functions may contribute to polymer network formation in
biofilms (Higgins & Novak, 1997; Imberty et al., 2004). The
formation of P. aeruginosa biofilms on tissues of infected
patients as well as on medical devices was recently shown to
be responsible for the inherent resistance of the bacterium
to certain antibiotics and other various antimicrobial agents
(Costerton et al., 1999; Stewart & Costerton, 2001). Since
cell-surface-exposed oligosaccharide receptors on eukaryotic host cells are ubiquitous in nature, it is reasonable to
assume that both lectins are involved in the attachment of
cells to biotic surfaces. Moreover, lectin-mediated cell–cell
interactions within a given bacterial population may be
involved in the development and maintenance of biofilms,
thereby determining the ability of P. aeruginosa to colonize
biotic and abiotic surfaces and to persist in the biofilm mode
of growth (Parsek & Greenberg, 2000; Imberty et al., 2004).
In this paper, we report on the role of LecB in biofilm
formation and its cellular localization in planktonic and
sessile P. aeruginosa cells. Confocal laser scanning microscopy (CLSM) was used to monitor biofilm formation of a
LecB-deficient mutant strain and the localization of LecB
in sessile cells was investigated by fractionation of bacterial cells grown as a biofilm and determination of LecB
localization in the different cellular compartments using a
LecB-specific polyclonal antiserum. The interaction of LecB
with the outer membrane of P. aeruginosa was investigated
by constructing a LecB-mutant defective in sugar binding as
suggested by analysis of the LecB crystal structure we have
recently solved (Loris et al., 2003). The presence of putative
ligands on the surface of biofilm cells was visualized by cell
staining using fluorescently labelled LecB.
METHODS
Bacterial strains and plasmids. The strains and plasmids used in
this study are listed in Table 1. E. coli DH5a was used for cloning
experiments and E. coli BL21(DE3) as a heterologous expression
host for plasmid-encoded LecB. E. coli S17-1 was used for conjugal
transfer.
Media and growth conditions. Precultures for all experiments
were prepared overnight in 5 ml Luria–Bertani (LB) medium in
glass tubes at 37 uC. Plasmid-carrying E. coli cells were selected with
50 mg chloramphenicol ml21, 100 mg ampicillin ml21, 10 mg tetracycline ml21 and/or 20 mg gentamicin ml21. In the case of plasmidor cassette-carrying P. aeruginosa strains, 300 mg chloramphenicol
ml21, 100 mg tetracycline ml21 and/or 50 mg gentamicin ml21 were
added.
Cultivation of biofilms. Biofilms were grown under static condi-
tion on glass slides. Fifteen millilitres nutrient broth (NB) [8 g
nutrient broth (Oxoid); 4 g NaCl l21] in a sterile Petri dish was
inoculated to an OD580 of 0?05 from overnight cultures grown in
NB, glass slides were submerged and the cultures were incubated for
48 or 72 h at 30 uC. Prior to CLSM analysis, glass slides were rinsed
with 2 ml 0?14 M NaCl to remove unadsorbed cells. For staining of
P. aeruginosa PAO1 cells with fluorescently labelled LecB, biofilms
were grown on membrane filters (Strathmann et al., 2002). Bacteria
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
Microbiology 151
P. aeruginosa lectin LecB
Table 1. Bacterial strains and plasmids
lecB* is a mutant lecB gene encoding LecB with a deactivated sugar-binding site (D104A).
Strain/plasmid
Strains
P. aeruginosa
PAO1
SG81
PATI2
PATI4
E. coli
DH5a
BL21(DE3)
S17-1
Plasmids
pET22b
pBCSK
pBSL141
pSUP202
pEC2
pEYL2
pEXCH2
pBBR1MCS
pBBC2
pBBXCH2
pL2US
pL2DS
pL2UG
pUGD2
pSUGD2
pSUD2
pFF19-EYFP
Genotype/phenotype
Reference/source
Wild-type
Mucoid biofilm isolate from technical water system
LecB mutant strain derived from PAO1. lecB : : VGmr
LecB mutant strain carrying a chromosomal deletion derived from PATI2
Holloway et al. (1979)
Grobe et al. (1995)
This study
This study
supE44 D(lacZYA–argF)U196 (w80DlacZM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1
2
F2 ompT hsdSB(r2
B m B ) gal dcm (lcIts857 ind1 Sam7 nin5 lacUV5-T7 gene1)
Ec294 : : [RP4-2 (Tc : : Mu) (Km : : Tn7)], pro, res, recA, tra+, Tpr, Smr
Woodcock et al. (1989)
Studier & Moffat (1986)
Simon et al. (1986)
T7 expression vector for E. coli, PelB signal sequence, Apr
P37 PT3 Plac lacZ9 Cmr ColE1
ColE1 Apr Gmr
pBR325, Apr Cmr Tcr mob
pET22b containing the 345 bp NdeI/BamHI PCR product bearing the lecB gene
pET22b containing yfp : : lecB fusion
pET22b containing the 345 bp NdeI/BamHI PCR product bearing the lecB* gene
lacZa Cmr rep mob
pBBR1MCS containing a 398 bp XbaI/SacI fragment with lecB derived from pEC2
pBBR1MCS containing a 345 bp XbaI/SacI fragment encoding lecB* derived from pEXCH2
515 bp XbaI/BamHI fragment upstream of lecB in pBCSK
616 bp BamHI/HindIII fragment downstream of lecB in pBCSK
1?6 kb MluI fragment derived from pBSL141 (V-Gmr cassette) in pL2US
2?1 kb XbaI/BamHI fragment derived from pL2UG in pL2DS
2?6 kb XbaI/HindIII fragment derived from pUGD2 (DlecB : : V-Gmr cassette) in pSUP202
pSUGD2 without V-Gmr cassette
Plant expression vector carrying yfp
Novagen
Stratagene
Alexeyev et al. (1995)
Simon et al. (1983)
Loris et al. (2003)
This study
This study
Kovach et al. (1994)
This study
This study
This study
This study
This study
This study
This study
This study
Timmermans et al. (1990)
were grown for 24 h at 37 uC on Pseudomonas isolation agar (PIA;
Difco) containing 2 % glycerol. Single colonies were suspended in
0?14 M NaCl to a concentration of approximately 106 cells ml21.
Ten millilitres of this suspension was vacuum-filtered onto 25 mm
black polycarbonate filters (0?4 mm pore size; Millipore), which were
then placed on the surface of PIA plates and cultivated for 24 h at
37 uC.
Lectin staining of biofilm cells. The method was modified from
Strathmann et al. (2002). Fifty microlitres of a solution containing
10 mg LecBYFP ml21 and 75 mM of the red fluorescent nucleic-acidbinding dye SYTO 62 (Molecular Probes) in 10 mM phosphate
buffer, pH 7?5, was carefully applied directly on top of biofilms
grown on membrane filters (Strathmann et al., 2002). After incubation for 1 h in the dark at room temperature, excess staining solution was removed by three rinses with 1 ml phosphate buffer.
Competitive inhibition of lectin binding was studied by preincubation of the LecBYFP staining solution with 100 mg L-fucose ml21 for
15 min at room temperature.
CLSM. Biofilms were always grown in two independent experiments
and at least three different sites were analysed by CLSM. Biofilms on
glass slides were stained non-destructively with the green fluorescent
nucleic-acid-binding dye SYTO 9 (Molecular Probes) as described
by the manufacturer. Images of biofilms were obtained with a
confocal laser scanning microscope (LSM 510; Zeiss) using an LD
Achroplan 406/0?60 NA (corr.) lens. Three-dimensional image
http://mic.sgmjournals.org
stacks were recorded at 488 nm excitation wavelength using an LP
505 nm long-pass detection filter. Confocal images were recorded
from at least three fields of view for each sample. The extent of
the analysis was done in order to fulfil the minimum sampling area
requirement as suggested by Korber et al. (1993) for biofilm samples. The pinhole size was adjusted to equal 1?0 Airy unit. Image
recording of CLSM optical thin sections was performed with the
Zeiss LSM software (version 2.8). Biofilm mean thickness, surface
coverage, roughness and biomass were determined by digital image
processing using COMSTAT image-analysis software (Heydorn et al.,
2000). Images of the biofilms on polycarbonate filters were recorded
by CLSM as described above at 488 nm excitation wavelength using
a BP 505–550 nm band-pass detection filter and at 633 nm excitation wavelength using an LP 650 nm long-pass detection filter for
LecBYFP and SYTO 62, respectively.
DNA manipulation and PCR. Recombinant DNA techniques were
performed as described by Sambrook et al. (1989). DNA fragments
were amplified by standard PCR methods. DNA-modifying enzymes
(Fermentas) were used according to the manufacturer’s instructions. Plasmid DNA was prepared as described by Birnboim & Doly
(1979) and by using the HiSpeed plasmid purification midi kit or,
for genomic DNA from P. aeruginosa, the DNeasy Tissue kit
(Qiagen).
Construction of a P. aeruginosa PAO1 lecB-deletion mutant.
A P. aeruginosa lecB mutant was constructed by PCR amplification
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
1315
D. Tielker and others
of the regions located upstream and downstream of the lecB gene
using primers L2USA (59-GGGGTCTAGATTGAACCCAACGGGCAAATC)/L2USB (59-GGGGATCCACGCGTGGTGTATCTCCACTGAATAC) and L2DSA (59-GGGGATCCACGCGTGAGTTCGGAAGGGACGGGATG)/L2DSB (59-GGGGAAGCTTCCGACCAGAACAATAACAAG). The resulting fragments were cloned into the XbaI/
BamHI and BamHI/HindIII sites of plasmid pBCSK, giving pL2US
and pL2DS, respectively. An V-gentamicin cassette was isolated as a
1?6 kb fragment by digesting the plasmid pBSL141 with MluI and
subsequently cloned into the MluI site of pL2US resulting in
pL2UG. This plasmid was digested with XbaI/BamHI and the resulting 2?1 kb fragment was cloned into pL2DS to give pUGD2. After
restriction of this plasmid with XbaI/HindIII and blunt-ending
with T4 polymerase, the resulting 2?6 kb fragment carried the Vgentamicin cassette located between the upstream and downstream
sequences of lecB. This fragment was ligated into ScaI-digested
pSUP202, resulting in the suicide vector pSUGD2. Replacement
of the chromosomal copy of lecB by the V-gentamicin cassette was
achieved after conjugation and resulted in P. aeruginosa lecB-mutant
strain PATI2, as confirmed by PCR and Western-blotting. Finally,
the V-gentamicin cassette was removed by digestion of plasmid
pSUGD2 with MluI and religation resulting in pSUD2, which was
subsequently transferred by conjugation into the DlecB : : Gmr strain
of P. aeruginosa. Deletion of the V-gentamicin cassette was confirmed by PCR and Western blotting and the resulting mutant strain
was named P. aeruginosa PATI4.
Cloning of lecB for localization studies. The cellular distribu-
tion of LecB was studied using the lecB-negative strains P. aeruginosa
PATI2 and PATI4, which were transformed with plasmid pBBC2
containing the lecB gene under transcriptional control of the lac promoter. This plasmid was constructed by digestion of plasmid pEC2
with SacI/XbaI. The resulting fragment consisting of the lecB gene
and the ribosome-binding site of pET22b was cloned into the SacI/
XbaI sites of pBBR1MCS giving pBBC2, which was transferred into
P. aeruginosa PATI4 by conjugation.
Cloning of a yfp : : lecB fusion. A 765 bp DNA fragment carrying
the gene encoding YFP (a yellowish-green variant of the green fluorescent protein from Aequorea victoria) excluding the stop codon
was amplified by PCR using plasmid pFF19-EYFP as the template
with oligonucleotide primers YFPFusUp (59-GCTCTAGAAAGAAGGAGATATATATATGGTGAGCAAGGGCGAGGAGCT)
and
YFPFusDWN (59-GGAATTCCATATGCCATGGCTTGTACAGCTCGTCCATGC), introducing an XbaI, NdeI or NcoI site. Primer
YFPFusUp contained the sequence encoding the ribosome-binding
site (underlined). This fragment was digested with XbaI/NdeI and
cloned into the lecB-carrying plasmid pEC2, resulting in plasmid
pEYL2, which was transformed into E. coli BL21(DE3). The fusion
protein expressed from this plasmid is referred to as LecBYFP.
Overexpression and purification of LecBYFP. The overexpres-
sion and purification of LecBYFP was performed as described
previously for the native LecB protein (Loris et al., 2003).
Mutation of the sugar-binding site in LecB. The lecB gene was
amplified by PCR using the oligonucleotide primers LIINdeI
(59-AAAACATATGGCAACACAAGGAGTGTTCA)
and
LIIXch
(59-AAAAGGATCCCTAGCCGAGCGGCCAGTTGATCACGGCGGCGGCGGCGTTGTAGTCGTTGTC). The amplified DNA fragment
was cloned into the NdeI/BamHI sites of pET22b, excised by digestion with SacI/XbaI and ligated into pBBR1MCS which had been
digested with the same enzymes. The resulting plasmid pBBXCH2
was introduced into P. aeruginosa PATI4 by conjugation.
Fractionation of P. aeruginosa cells. The method was modified
from Witholt et al. (1976). P. aeruginosa PATI2 and PATI4, containing pBBC2 or pBBXCH2, was grown in NB medium or on NB agar
1316
plates at 37 uC for 48 h. Bacterial cells (1?2 mg dry weight) were
washed off with 1 ml 0?14 M NaCl and then centrifuged at 3000 g ;
the supernatant was sterile-filtered and used to determine the content of LecB in the extracellular space. The cell pellet was carefully
suspended in 240 ml 100 mM Tris/HCl, pH 8, containing 20 % (w/
v) sucrose. After addition of 240 ml of the same buffer containing
5 mM EDTA and 20 mg lysozyme, the sample was incubated for
30 min at room temperature, spheroplasts were collected by centrifugation at 10 000 g for 20 min and the supernatant was used as the
periplasmic fraction. Spheroplasts were disrupted by sonication
(Sonifier W250; Branson) in 240 ml 100 mM Tris/HCl, pH 8. After
centrifugation for 5 min at 5000 g to remove undisrupted cells and
cell debris, the total membrane fraction was collected by centrifugation for 45 min at 13 000 g and the supernatant was used as the
cytoplasmic fraction. An amount equivalent to an OD at 580 nm of
0?5 of each fraction was used for Western blotting.
Isolation of inner and outer membranes. This was done as
described by Wilhelm et al. (1999). P. aeruginosa PATI2 cells containing plasmid pBBC2 (50 mg dry weight) were isolated after
growth for 48 h from NB agar plates by resuspension in 20 ml
0?14 M NaCl. Cells were incubated for 30 min at 37 uC with 1 mg
lysozyme, disrupted using a glass bead mill followed by three freezing and thawing cycles and intact cells were separated from the cell
extract by centrifugation at 5000 g for 10 min. The supernatant was
centrifuged at 13 000 g for 1 h. The pellet, consisting of the total
membrane fraction, was resuspended in 1 ml 10 mM Tris/HCl,
pH 8, containing 1 mM EDTA and 30 % (w/v) sucrose, and layered
on the top of a discontinuous gradient prepared by combining
sucrose solutions of the following concentrations: 0?5 ml 60 %,
2?1 ml 55 %, 2?1 ml 50 %, 2?1 ml 45 %, 2?1 ml 40 % and 2?1 ml
35 % (w/v) sucrose in 10 mM Tris/HCl, pH 8, 1 mM EDTA. The
gradient was centrifuged using an SW41 rotor in an L8-70 ultracentrifuge (Beckman) at 36 000 r.p.m. and 4 uC for 36 h, and 0?5 ml
fractions were subsequently removed from the centrifugation tube.
Enzyme assays. These were described by Wilhelm et al. (1999).
NADH oxidase and esterase activities were determined as marker
enzymes for the inner and outer membrane, respectively, by spectrophotometric determination of the absorbance decrease at 340 nm
for NADH oxidase and the absorbance increase at 410 nm for esterase. For NADH oxidase, 900 ml reaction mixture (50 mM Tris/HCl,
pH 7?5, 0?2 mM DTT, 0?12 mM NADH) was incubated for 5 min
at 25 uC with 100 ml of each fraction. For esterase activity, 23?7 mg
p-nitrophenyl caproate (pNPC; Sigma) was dissolved in 5 ml ethanol
and added to 95 ml 100 mM potassium phosphate buffer, pH 7,
supplemented with 10 mM MgSO4, to yield a final pNPC concentration of 1 mM. Aliquots (20 ml) of each fraction were added to
180 ml substrate solution in a microtitre plate, the samples were
incubated for 10 min at 25 uC and the A410 was recorded.
The fractions with the highest NADH oxidase and esterase activities,
which respectively represented the inner and outer membrane fractions, were pooled. For immunodetection of LecB, 100 ml of these
fractions was diluted to 2 ml with 10 mM Tris/HCl, pH 8. Proteins
were collected by precipitation with trichloroacetic acid (Sivaraman
et al., 1997).
Washing the outer membrane with solutions of different
carbohydrates. Proteins from 100 ml of the outer-membrane
fraction were collected by centrifugation at 13 000 g for 1 h. The
pellet was suspended in 100 ml 100 mM Tris/HCl, pH 8, containing 20 mM p-nitrophenyl a-L-fucose (pNPF; Sigma) or 20 mM Dgalactose (Sigma) as a negative control, and shaken gently for 1 h at
37 uC. After centrifugation of the samples, the proteins in pellets and
supernatants were analysed by immunoblotting using LecB-specific
antibodies.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
Microbiology 151
P. aeruginosa lectin LecB
Western blotting. Prior to electrophoresis, samples were sus-
pended in SDS-PAGE sample buffer, boiled for 5 min at 95 uC and
loaded onto an SDS-16 % polyacrylamide gel followed by electrophoretic protein transfer at 0?3 A for 30 min to PVDF membranes.
LecB was detected using the polyclonal antibody at a dilution of
1 : 20 000 in TBST (25 mM Tris/HCl, pH 8, 150 mM NaCl, 3 mM
KCl, 0?2 % v/v Tween 20) followed by an anti-rabbit immunoglobulin G–horseradish peroxidase conjugate (Bio-Rad) and developed
with the ECL kit (Pharmacia).
RESULTS
A LecB-negative mutant is impaired in biofilm
formation
The biofilm-forming capacities of the P. aeruginosa wildtype strain PAO1 and the LecB-deficient mutant PATI2
were investigated by growing static biofilms in NB medium
on glass slides over growth periods of 48 and 72 h at 30 and
37 uC. Regular examination of the glass slides by CLSM
revealed that the LecB-mutant P. aeruginosa PATI2 was
affected in biofilm formation at both temperatures. The
biofilms of the mutant strain were found to be thinner than
those formed by the wild-type (Fig. 1; Table 2). Furthermore, the surface coverage of the mutant strain was lower
than that of the wild-type. This effect was not caused by
a general growth defect, as planktonic populations of the
wild-type and the LecB-negative mutant exhibited the same
growth rates and reached the same maximal cell densities
(data not shown).
LecB is associated with the outer membrane
The finding that the LecB-deficient P. aeruginosa strain was
impaired in biofilm formation prompted us to determine
the subcellular localization of LecB. For this, planktonic
cells were compared with sessile P. aeruginosa PATI2 cells,
which harboured the plasmid pBBC2 containing the wildtype lecB gene under transcriptional control of the constitutive lac promoter and had been grown as an unsaturated
biofilm on the surface of NB agar. This method has been
shown to result in the formation of unsaturated biofilms
(Steinberger et al., 2002) of the type that is also found in the
lungs of CF patients suffering from a P. aeruginosa infection
(Lyczak et al., 2002). Cellular compartments were isolated
using differential cell fractionation and proteins were
analysed by SDS-PAGE and subsequent Western blotting
using a LecB-specific antiserum raised against purified LecB.
After 48 h of growth at 37 uC, LecB was detected in the
cytoplasm as well as in the total membrane fraction in both
sessile and planktonic cells (Fig. 2).
The precise localization of LecB was investigated by
separating the inner and the outer bacterial membrane of
sessile P. aeruginosa cells by discontinuous sucrose-density
centrifugation. Activities of the marker enzymes NADH
oxidase and esterase were determined to identify innerand outer-membrane fractions, respectively. The fractions
showing the highest enzyme activities were pooled and
analysed by SDS-PAGE and Western blotting, revealing that
http://mic.sgmjournals.org
LecB was located exclusively in the bacterial outer
membrane (Fig. 3).
LecB binds to carbohydrate ligands in the outer
membrane
The localization of LecB in the outer membrane of P.
aeruginosa and its high affinity for L-fucose and its
derivatives, like pNPF (Garber et al., 1987), suggested that
this lectin might be bound to the outer membrane via
fucose-containing structures. This assumption was tested
by incubating an isolated outer-membrane fraction with
20 mM of either pNPF or D-galactose, which served as a
negative control because the affinity of LecB for D-galactose
is extremely low (Garber et al., 1987). The outer membrane was isolated by centrifugation and the proteins of the
membrane-containing pellet and the supernatant were
subjected to SDS-PAGE and Western blotting. LecB was
detected in the supernatant obtained from the pNPF-treated
outer-membrane fraction, whereas it was missing in the
corresponding pellet (Fig. 4). In contrast, treatment with Dgalactose did not result in any detectable release of LecB
from the outer membrane. These findings strongly suggest
that LecB is bound to the outer membrane by interaction
with fucose-containing ligands.
The outer-membrane localization of LecB
depends on an intact sugar-binding site
LecB was located in the outer membrane at an advanced
stage of biofilm formation (Fig. 3). Treatment of the outermembrane fraction with pNPF resulted in the release of
LecB, suggesting that this lectin interacts with fucosecontaining receptors at the cell surface (Fig. 4). Analysis of
the LecB crystal structure we have recently solved (Loris
et al., 2003) allowed us to identify those amino acid residues
which are involved in carbohydrate binding. Among
them, D104 plays a crucial role by coordinating two calcium
atoms which themselves are directly involved in carbohydrate binding. Therefore, we have constructed plasmid
pBBXCH2, which expresses a mutated LecB carrying the
substitution D104A, which renders this protein unable to
bind carbohydrates (Fig. 5a). This plasmid was introduced
into the LecB-deficient P. aeruginosa strain PATI4. After
growth for 48 h on NB agar plates, cells were fractionated
and analysed for the presence of mutant LecB in comparison with the wild-type. Both strains produced LecB in the
cytoplasm, but, in contrast to the wild-type lectin, the
mutated LecB was not detected in the membrane fraction
(Fig. 5b), indicating that the sugar-binding capacity of LecB
may be essential for its outer-membrane localization.
LecB specifically binds to the surface of biofilm
cells
Our results clearly indicated that LecB interacted with the
outer membrane via binding to carbohydrate ligands. The
presence of these ligands on the surface of living biofilm
cells was investigated by growing P. aeruginosa PAO1 on
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
1317
D. Tielker and others
WT
LecB
48 h
72 h
membrane filters for 24 h at 37 uC on PIA plates. After
treatment for 1 h with a staining solution containing a
fluorescently labelled LecB (green) and the DNA-binding
dye SYTO 62 (red), biofilms were washed and analysed by
CLSM. The intense fluorescent signal covering the cell periphery shown in Fig. 6(a, c) demonstrates the binding of
LecBYFP to the surface of the red-stained cells. This binding
was even more pronounced when the mucoid P. aeruginosa
strain SG81 was used (Fig. 6b, d). Preincubation of LecBYFP
with L-fucose prior to cell staining inhibited this interaction
Fig. 1. Biofilms formed by wild-type P. aeruginosa PAO1 (WT) and the LecB-deficient
mutant P. aeruginosa PATI2 (LecB”).
Biofilms were grown statically on glass
slides for 48 or 72 h in NB medium. The
cells were stained with the DNA-binding dye
SYTO 9 and biofilm formation was monitored by CLSM. The upper and lower
images represent horizontal and vertical sections, respectively, of the same biofilm. Bar,
50 mm. The data are summarized in Table 2.
of the lectin with the cell surface (Fig. 6e, f). These results
clearly showed that carbohydrate receptors on the surface
of P. aeruginosa biofilm cells were accessible to LecB.
DISCUSSION
P. aeruginosa is the major pathogen in the respiratory
tract of patients suffering from CF. The treatment of these
chronic P. aeruginosa airway infections is thwarted by
its innate antibiotic resistance, which is aggravated by
Table 2. Biofilm properties in P. aeruginosa wild-type and LecB-deficient mutant
Parameters were determined by digital image processing using
Fig. 1 for example images.
Strain
Wild-type
LecB2
1318
COMSTAT
image analysis software. See
Growth period
(h)
Biomass
(mm3 mm”2)
Mean thickness
(mm)
Surface coverage
(%)
48
72
48
72
4?14
18?35
0?02
0?12
8?19
27?38
0?06
0?33
36?3
55?5
0?3
0?9
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
Microbiology 151
Fucose supernatant
Fucose pellet
Galactose supernatant
Galactose pellet
50 ng LecB
_
P. aeruginosa LecB
Cytoplasm
Periplasm
Total membranes
Extracellular
LecB
_
P. aeruginosa LecB
P. aeruginosa lectin LecB
Biofilm
Planktonic
Fig. 2. Subcellular localization of LecB in biofilm and planktonic
cells of P. aeruginosa grown for 48 h at 37 6C. Equivalent
amounts of fractions obtained from the extracellular space, the
periplasm, cytoplasm and the total membrane were subjected
to SDS-PAGE analysis followed by immunoblotting using a
LecB-specific antibody. The LecB-negative strain P. aeruginosa
PATI2 and 50 ng purified LecB respectively served as negative
and positive controls.
Fig. 4. Fucose treatment specifically removes LecB from P.
aeruginosa outer membranes. Outer membranes isolated from
P. aeruginosa biofilm cells were incubated with 20 mM pNPF
(lanes labelled fucose) or D-galactose for 1 h at 37 6C. Cells
were separated from supernatants by centrifugation and
LecB was detected in both fractions by immunoblotting. The
LecB-deficient strain P. aeruginosa PATI2 and purified LecB
respectively served as negative and positive controls.
(a)
Fig. 3. Subcellular localization of LecB in biofilm cells of
P. aeruginosa. A crude membrane preparation was subjected
to sucrose-density-gradient centrifugation and fractions were
tested for NADH oxidase and esterase activities indicating inner
and outer membrane. Fractions showing the highest activities of
the respective marker enzyme were pooled and used for immunodetection of LecB. LecB was detected in the inner- and outermembrane fractions after immunoblotting using a LecB-specific
antiserum. Purified LecB (50 ng) was used as a positive control.
http://mic.sgmjournals.org
Mutant
Cytoplasm
Wild-type
Periplasm
Mutant
Wild-type
Mutant
Wild-type
Membranes
Extracellular
Mutant
Wild-type
LecB
(b)
_
P. aeruginosa LecB
Outer membrane
Inner membrane
LecB
the formation of biofilms on the respiratory epithelium
(Costerton et al., 1999; Singh et al., 2000). The application of
drugs that inhibit or even prevent biofilm formation seems
to be a promising approach (Stewart & Costerton, 2001).
Therefore, the mechanisms responsible for biofilm formation have been the subject of numerous recent studies and
several proteins involved in biofilm formation and development have been identified (O’Toole & Kolter, 1998; Vallet
et al., 2001; Klausen et al., 2003).
Fig. 5. The sugar-binding ability of P. aeruginosa LecB is
essential for outer-membrane localization. (a) D104 was
replaced by an alanine and the resulting lecB mutant gene was
expressed in the LecB-deficient strain P. aeruginosa PATI4. (b)
Subcellular localization of wild-type and mutant LecB in P.
aeruginosa biofilm cells was performed by isolation of cellular
compartments after growth for 48 h at 37 6C on NB agar
plates. LecB was detected by Western immunoblotting.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
1319
D. Tielker and others
Fig. 6. Selective binding of LecB to the cell
surface of P. aeruginosa. Biofilms were
grown on membrane filters for 24 h on PIA
plates. Biofilms of P. aeruginosa PAO1 (a, c)
and the mucoid isolate P. aeruginosa SG81
(b, d) were treated with fluorescently labelled
LecBYFP (green), washed and counterstained
with the DNA-binding dye SYTO 62 (red).
Inhibition of lectin binding to P. aeruginosa
PAO1 (e) and SG81 (f) by L-fucose is also
shown. Prior to cell staining, LecBYFP was
preincubated with 100 mg L-fucose ml”1 for
15 min at room temperature. Bars, 5 mm.
This study clearly demonstrates that the lectin LecB is an
important factor in the development of biofilms by P.
aeruginosa for the following reasons: (i) a LecB-deficient
P. aeruginosa mutant strain was clearly impaired in the
formation of biofilms and (ii) LecB has been shown to be
localized mainly in the cytoplasm of planktonic cells (Glick
& Garber, 1983). This finding raises the question of how
an internally localized lectin can contribute to the formation of a biofilm. Biofilm cells differ fundamentally from
their planktonic counterparts in a variety of physiological
aspects (Costerton et al., 1999). Therefore, we decided to
investigate the subcellular localization of LecB in planktonic
and sessile cells. In contrast to previous observations (Glick
& Garber, 1983), our results showed that, in both cases, LecB
was present in the outer membrane of P. aeruginosa, even
though the protein lacks structural characteristics of outermembrane proteins, e.g. a terminal F residue and typical bbarrel-forming structures (Mitchell et al., 2002, 2005; Loris
et al., 2003). The binding constants of LecB for L-fucose
and D-mannose were determined to be 1?56106 M21 and
3?16102 M21, respectively (Garber et al., 1987). Treatment
of the outer-membrane fraction with pNPF, which has been
shown to be bound by LecB with an even higher affinity than
L-fucose itself (Garber et al., 1987), caused the dissociation
of LecB from the outer membrane. A mutation in the sugarbinding site of LecB resulted in a mutant LecB which no
longer appeared in the membrane fraction. These results
indicated that LecB is associated with the bacterial cell
surface via binding to carbohydrate ligands. The presence
of such putative LecB receptors on the surface of P.
aeruginosa cells was demonstrated by specific cell staining
1320
using YFP-labelled LecB. As expected, this process could be
inhibited by preincubation of the lectin with L-fucose. The
carbohydrate ligands may reside on either lipopolysaccharide or glycosylated cell-surface proteins, which include P.
aeruginosa pili and type A flagella (Brimer & Montie, 1998;
Castric et al., 2001). Interestingly, O-antigenic oligosaccharides of different P. aeruginosa serotypes contain the a-Lfucose derivative a-L-N-acetyl fucosamine, which is also
part of the trisaccharide which decorates the pili of the
clinical P. aeruginosa isolate 1244 (DiGiandomenico et al.,
2002). Additionally, it was recently demonstrated that
mannose is one of the primary constituents of the extracellular polysaccharide of biofilms formed by the typically
non-mucoid strain P. aeruginosa PAO1 (Wozniak et al.,
2003). Furthermore, several other pathogenic bacteria are
known to contain glycosylated cell-surface proteins, among
them the Gram-positive organisms Streptococcus sanguinis
(Erickson & Herzberg, 1993) and Mycobacterium tuberculosis (Dobos et al., 1995) and the Gram-negative Neisseria
meningitidis, N. gonorrhoeae, Campylobacter jejuni, E. coli
and Helicobacter pylori (Power & Jennings, 2003). However,
in most of these cases, the structures of the glycans are
unknown, as are the physiological roles of the glycosylation
of the proteins.
Surface-exposed LecB may mediate the adhesion of P.
aeruginosa to receptors located on cells of either the same
or different species, thus enabling the colonization of host
tissues or the formation of mono- or multispecies biofilms.
Several P. aeruginosa proteins, including pilus and flagellar
proteins as well as the outer-membrane protein OprF, have
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
Microbiology 151
P. aeruginosa lectin LecB
previously been identified as adhesins, which may bind to
receptors, e.g. those present on the respiratory epithelium,
thus initiating bacterial adherence (Doig et al., 1990; Arora
et al., 1998; Scharfman et al., 2001; Azghani et al., 2002). In
an earlier report, it was shown that biotinylated LecB specifically binds to the surface of human nasal polyp explants
(Adam et al., 1997a). Interestingly, it was demonstrated that
mucin from patients suffering from CF contains increased
amounts of fucosylated glycoproteins (Shori et al., 2001;
Scanlin & Glick, 2001), suggesting that surface-exposed
LecB may bind to these glycoproteins and promote persistent infections with P. aeruginosa. This hypothesis is
further substantiated by the recent finding that the upregulation of a Fuc(a1-2) fucosyltransferase was responsible
for increased fucosylation of intestinal mucins from CF
mice (Thomsson et al., 2002). For CF, the membrane
glycoproteins from respiratory epithelial cells expressing a
mutated cftr gene were shown to be more fucosylated than
those from cells expressing the wild-type gene (Rhim et al.,
2001). Therefore, LecB in particular may facilitate the
attachment of P. aeruginosa to the CF airway epithelium.
The successful treatment of a patient suffering from a
Pseudomonas-induced respiratory tract infection with a
solution containing LecA- and LecB-specific sugars (von
Bismarck et al., 2001) supports the hypothesis that LecB
contributes to the development of chronic airway infections via binding to fucosylated glycoproteins of the mucin
and/or the respiratory epithelium.
Interestingly, P. aeruginosa LecB does not contain any of
the presently known secretion signals (Ma et al., 2003).
Thus, it is unlikely that it is secreted via the type I pathway
or via the Sec or Tat pathway. In a previous report, it was
suggested that cell lysis was responsible for release of LecB
into the extracellular medium (Wentworth et al., 1991). This
hypothesis seems unlikely, as we have found that mutant
LecB was produced in the cytoplasm in the same amount
as the wild-type protein (see Fig. 5b), but it was neither
translocated into the outer membrane nor released into the
extracellular space.
human ciliary beating: therapeutic implications of fucose. Am J Respir
Crit Care Med 155, 2102–2104.
Adam, E. C., Schumacher, D. U. & Schumacher, U. (1997b). Cilia
from a cystic fibrosis patient react to cilitoxic Pseudomonas
aeruginosa II lectin in a similar manner to normal control cilia: a
case report. J Laryngol Otol 111, 760–762.
Alexeyev, M. F., Shokolenko, I. N. & Croughan, T. P. (1995).
Improved antibiotic-resistance gene cassettes and omega elements for
Escherichia coli vector construction and in vitro deletion/insertion
mutagenesis. Gene 160, 63–67.
Arora, S. K., Ritchings, B. W., Almira, E. C., Lory, S. & Ramphal, R.
(1998). The Pseudomonas aeruginosa flagellar cap protein, FliD, is
responsible for mucin adhesion. Infect Immun 66, 1000–1007.
Avichezer, D., Katcoff, D. J., Garber, N. C. & Gilboa-Garber,
N. (1992). Analysis of the amino acid sequence of the Pseudo-
monas aeruginosa galactophilic PA-I lectin. J Biol Chem 267,
23023–23027.
Azghani, A. O., Idell, S., Bains, M. & Hancock, R. E. (2002).
Pseudomonas aeruginosa outer membrane protein F is an adhesin in
bacterial binding to lung epithelial cells in culture. Microb Pathog 33,
109–114.
Bajolet-Laudinat, O., Girod-de Bentzmann, S., Tournier, J. M.,
Madoulet, C., Plotkowski, M. C., Chippaux, C. & Puchelle, E. (1994).
Cytotoxicity of Pseudomonas aeruginosa internal lectin PA-I to
respiratory epithelial cells in primary culture. Infect Immun 62,
4481–4487.
Barondes, S. H., Gitt, M. A., Leffler, H. & Cooper, D. N. (1988).
Multiple soluble vertebrate galactoside-binding lectins. Biochimie 70,
1627–1632.
Beachey, E. H. (1981). Bacterial adherence: adhesin-receptor
interactions mediating the attachment of bacteria to mucosal
surface. J Infect Dis 143, 325–345.
Beuth, J., Stoffel, B., Ko, H. L., Jeljaszewicz, J. & Pulverer, G. (1995).
Mistellektin-1: neue therapeutische Perspektiven in der Onkologie.
Onkologie 18, 36–40 (in German).
Birnboim, H. C. & Doly, J. (1979). A rapid alkaline extraction
procedure for screening recombinant plasmid DNA. Nucleic Acids
Res 7, 1513–1523.
Brimer, C. D. & Montie, T. C. (1998). Cloning and comparison
of fliC genes and identification of glycosylation in the flagellin
of Pseudomonas aeruginosa a-type strains. J Bacteriol 180,
3209–3217.
Castric, P., Cassels, F. J. & Carlson, R. W. (2001). Structural
characterization of the Pseudomonas aeruginosa 1244 pilin glycan.
J Biol Chem 276, 26479–26485.
In conclusion, our findings support the notion that LecB
may contribute to the pathogenicity of P. aeruginosa in CF
in several different ways and therefore represents an
interesting target for the development of anti-P. aeruginosa
drugs.
Costerton, J. W. (2001). Cystic fibrosis pathogenesis and the role of
ACKNOWLEDGEMENTS
DiGiandomenico, A., Matewish, M. J., Bisaillon, A., Stehle, J. R.,
Lam, J. S. & Castric, P. (2002). Glycosylation of Pseudomonas
This study was supported by the Mukoviszidose e.V., by the European
Commission (project no. QLRT-2001-02086) and by the Deutsche
Forschungsgemeinschaft (project no. WI 831/3-1). R. L. acknowledges
support from the VIB, the OZR-VUB and the FWO Vlaanderen.
biofilms in persistent infection. Trends Microbiol 9, 50–52.
Costerton, J. W., Stewart, P. S. & Greenberg, E. P. (1999). Bacterial
biofilms: a common cause of persistent infections. Science 284,
1318–1322.
aeruginosa 1244 pilin: glycan substrate specificity. Mol Microbiol 46,
519–530.
Dobos, K. M., Swiderek, K., Khoo, K. H., Brennan, P. J. & Belisle, J. T.
(1995). Evidence for glycosylation sites on the 45-kilodalton
glycoprotein of Mycobacterium tuberculosis. Infect Immun 63,
2846–2853.
REFERENCES
Doig, P., Sastry, P. A., Hodges, R. S., Lee, K. K., Paranchych, W. &
Irvin, R. T. (1990). Inhibition of pilus-mediated adhesion of Pseudo-
Adam, E. C., Mitchell, B. S., Schumacher, D. U., Grant, G. &
Schumacher, U. (1997a). Pseudomonas aeruginosa PA-II lectin stops
monas aeruginosa to human buccal epithelial cells by monoclonal
antibodies directed against pili. Infect Immun 58, 124–130.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
1321
D. Tielker and others
Erickson, P. R. & Herzberg, M. C. (1993). Evidence for the covalent
from
Mitchell, E., Houles, C., Sudakevitz, D., Wimmerova, M., Gautier, C.,
Perez, S., Gilboa-Garber, N. & Imberty, A. (2002). Structural basis
Gabius, H. J., Andre, S., Kaltner, H. & Siebert, H.-C. (2002). The
for oligosaccharide-mediated adhesion of Pseudomonas aeruginosa in
the lungs of cystic fibrosis patients. Nat Struct Biol 9, 918–921.
linkage of carbohydrate polymers to a glycoprotein
Streptococcus sanguis. J Biol Chem 268, 23780–23783.
sugar code: functional lectinomics. Biochim Biophys Acta 1572,
165–177.
Garber, N. C., Guempel, U., Gilboa-Garber, N. & Doyle, R. J. (1987).
Specificity of the fucose-binding lectin of Pseudomonas aeruginosa.
FEMS Microbiol Lett 48, 331–334.
Gilboa-Garber, N. (1972). Purification and properties of hemagglu-
Mitchell, E. P., Sabin, C., Snajdrova, L. & 8 other authors (2005).
High affinity fucose binding of Pseudomonas aeruginosa lectin PAIIL: 1?0 Å resolution crystal structure of the complex combined with
thermodynamics and computational chemistry approaches. Proteins
58, 735–746.
Morimoto, M., Saimoto, H., Usui, H., Okamoto, Y., Minami, S. &
Shigemasa, Y. (2001). Biological activities of carbohydrate-branched
tinin from Pseudomonas aeruginosa and its reaction with human
blood cells. Biochim Biophys Acta 273, 165–173.
chitosan derivatives. Biomacromolecules 2, 1133–1136.
Gilboa-Garber, N. (1982). Pseudomonas aeruginosa lectins. Methods
O’Toole, G. A. & Kolter, R. (1998). Flagellar and twitching motility
Enzymol 83, 378–385.
Gilboa-Garber, N. & Garber, N. C. (1992). Microbial lectins. In
Glycoconjugates: Composition, Structure and Function, pp. 541–591.
Edited by H. J. Allen & E. C. Kisailus. New York: Marcel Dekker.
Gilboa-Garber, N., Katcoff, D. J. & Garber, N. C. (2000).
Identification and characterization of Pseudomonas aeruginosa PAIIL lectin gene and protein compared to PA-IL. FEMS Immunol Med
Microbiol 29, 53–57.
Glick, J. & Garber, N. C. (1983). The intracellular localization of
Pseudomonas aeruginosa lectins. J Gen Microbiol 129, 3085–3090.
Grobe, S., Wingender, J. & Trüper, H. G. (1995). Characterization of
mucoid Pseudomonas aeruginosa strains isolated from technical water
systems. J Appl Bacteriol 79, 94–102.
Heydorn, A., Nielsen, A. T., Hentzer, M., Sternberg, C., Givskov, M.,
Ersbøll, B. K. & Molin, S. (2000). Quantification of biofilm struc-
are necessary for Pseudomonas aeruginosa biofilm development. Mol
Microbiol 30, 295–304.
Parsek, M. R. & Greenberg, E. P. (2000). Acyl-homoserine lactone
quorum sensing in Gram-negative bacteria: a signaling mechanism
involved in associations with higher organisms. Proc Natl Acad Sci
U S A 97, 8789–8793.
Power, P. M. & Jennings, M. P. (2003). The genetics of glycosylation
in Gram-negative bacteria. FEMS Microbiol Lett 218, 211–222.
Rhim, A. D., Stoykova, L., Glick, M. C. & Scanlin, T. F. (2001).
Terminal glycosylation in cystic fibrosis (CF): a review emphasizing
the airway epithelial cell. Glycoconj J 18, 649–659.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory.
Scanlin, T. F. & Glick, M. C. (2001). Glycosylation and the cystic
Microbiology 146,
fibrosis transmembrane conductance regulator. Respir Res 2,
276–279.
Higgins, M. J. & Novak, J. T. (1997). Characterization of exocellular
Scharfman, A., Arora, S. K., Delmotte, P., Van Brussel, E., Mazurier,
J., Ramphal, R. & Roussel, P. (2001). Recognition of Lewis x
tures by the novel computer program
2395–2407.
COMSTAT.
protein and its role in bioflocculation. J Environ Eng 123, 479–485.
Holloway, B. W., Krishnapillai, V. & Morgan, A. F. (1979).
Chromosomal genetics of Pseudomonas. Microbiol Rev 43, 73–102.
Imberty, A., Wimmerova, M., Mitchell, E. P. & Gilboa-Garber, N.
(2004). Structures of lectins from Pseudomonas aeruginosa: insights
into the molecular basis for host glycan recognition. Microbes Infect
6, 221–228.
derivatives present on mucins by flagellar components
Pseudomonas aeruginosa. Infect Immun 69, 5243–5248.
of
Shori, D. K., Genter, T., Hansen, J. & 7 other authors (2001). Altered
sialyl- and fucosyl-linkage on mucins in cystic fibrosis patients
promotes formation of the sialyl-Lewis X determinant on salivary
MUC-5B and MUC-7. Pflugers Arch 443 (Suppl. 1), S55–S61.
Simon, R., Priefer, U. & Pühler, A. (1983). A broad host range
Klausen, M., Heydorn, A., Ragas, P., Lambertsen, L., AaesJorgensen, A., Molin, S. & Tolker-Nielsen, T. (2003). Biofilm
mobilization for in vitro genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology 1, 784–791.
formation by Pseudomonas aeruginosa wild type, flagella and type IV
pili mutants. Mol Microbiol 48, 1511–1524.
Simon, R., O’Connell, M., Labes, M. & Puhler, A. (1986).
Korber, D. R., Lawrence, J. R., Hendry, M. J. & Caldwell, D. E. (1993).
Analysis of spatial variability within mot+ and mot2 Pseudomonas
fluorescens biofilms using representative elements. Biofouling 7,
339–358.
Plasmid vectors for the genetic analysis and manipulation of
rhizobia and other gram-negative bacteria. Methods Enzymol 118,
640–659.
Singh, P. K., Schaefer, A. L., Parsek, M. R., Moninger, T. O., Welsh,
M. J. & Greenberg, E. P. (2000). Quorum-sensing signals indicate
Kovach, M. E., Phillips, R. W., Elzer, P. H., Roop, R. M., II & Peterson,
K. M. (1994). pBBR1MCS: a broad-host-range cloning vector.
that cystic fibrosis lungs are infected with bacterial biofilms. Nature
407, 762–764.
Biotechniques 16, 800–802.
Sivaraman, T., Kumar, T. K., Jayaraman, G. & Yu, C. (1997). The
Laughlin, R. S., Musch, M. W., Hollbrook, C. J., Rocha, F. M., Chang,
E. B. & Alverdy, J. C. (2000). The key role of Pseudomonas aeruginosa
mechanism of 2,2,2-trichloroacetic acid-induced protein precipitation. J Protein Chem 16, 291–297.
PA-I lectin on experimental gut-derived sepsis. Ann Surg 232,
133–142.
Steinberger, R. E., Allen, A. R., Hansa, H. G. & Holden, P. A. (2002).
Loris, R., Tielker, D., Jaeger, K.-E. & Wyns, L. (2003). Structural basis
Elongation correlates with nutrient deprivation in Pseudomonas
aeruginosa-unsaturated biofilms. Microb Ecol 43, 416–423.
of carbohydrate recognition by the lectin LecB from Pseudomonas
aeruginosa. J Mol Biol 331, 861–870.
Steuer, M. K., Herbst, H., Beuth, J., Steuer, M., Pulverer, G. &
Matthias, R. (1993). Hemmung der bakteriellen Adhäsion durch
Lyczak, J. B., Cannon, C. L. & Pier, G. B. (2002). Lung infections
Lektinblockade bei durch Pseudomonas aeruginosa induzierter Otitis
externa im Vergleich zur lokalen Therapie mit Antibiotika.
Otorhinolaryngol Nova 3, 19–25 (in German).
associated with cystic fibrosis. Clin Microbiol Rev 15, 194–222.
Ma, Q., Zhai, Y., Schneider, J. C., Ramseier, T. M. & Saier, M. H., Jr
(2003). Protein secretion systems of Pseudomonas aeruginosa and P.
Stewart, P. S. & Costerton, J. W. (2001). Antibiotic resistance of
fluorescens. Biochim Biophys Acta 1611, 223–233.
bacteria in biofilms. Lancet 358, 135–138.
1322
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
Microbiology 151
P. aeruginosa lectin LecB
Strathmann, M., Wingender, J. & Flemming, H.-C. (2002).
Wilhelm, S., Tommassen, J. & Jaeger, K. E. (1999). A novel lipolytic
Application of fluorescently labelled lectins for the visualization
and biochemical characterization of polysaccharides in biofilms of
Pseudomonas aeruginosa. J Microbiol Methods 50, 237–248.
enzyme located in the outer membrane of Pseudomonas aeruginosa.
J Bacteriol 181, 6977–6986.
Studier, F. W. & Moffat, B. A. (1986). Use of bacteriophage T7 RNA
Wingender, J., Neu, T. R. & Flemming, H.-C. (1999). What are
polymerase to direct selective high level expression of cloned genes.
J Mol Biol 189, 113–130.
bacterial extracellular substances? In Microbial Extracellular Polymeric
Substances, pp. 1–19. Edited by J. Wingender, T. R. Neu & H.-C.
Flemming. Berlin: Springer.
Thomsson, K. A., Hinojosa-Kurtzberg, M., Axelsson, K. A., Domino,
S. E., Lowe, J. B., Gendler, S. J. & Hansson, G. C. (2002). Intestinal
Winzer, K., Falconer, C., Garber, N. C., Diggle, S. P., Camara, M. &
Williams, P. (2000). The Pseudomonas aeruginosa lectins PA-IL and
mucins from cystic fibrosis mice show increased fucosylation due to
an induced Fuc a1-2 glycosyltransferase. Biochem J 367, 609–616.
PA-IIL are controlled by quorum sensing and by RpoS. J Bacteriol
182, 6401–6411.
Timmermans, M. C., Maliga, P., Vieira, J. & Messing, J. (1990). The
Witholt, B., Boekhout, M., Brock, M., Kingma, J., Heerikhuizen, H. V.
& Leij, L. D. (1976). An efficient and reproducible procedure for the
pFF plasmids: cassettes utilising CaMV sequences for expression of
foreign genes in plants. J Biotechnol 14, 333–344.
Vallet, I., Olson, J. W., Lory, S., Lazdunski, A. & Filloux, A. (2001).
formation of spheroplasts from variously grown Escherichia coli. Anal
Biochem 74, 160–170.
The chaperone/usher pathways of Pseudomonas aeruginosa: identification of fimbrial gene clusters (cup) and their involvement in
biofilm formation. Proc Natl Acad Sci U S A 98, 6911–6916.
Woodcock, D. M., Crowther, P. J., Doherty, J., Jefferson, S., DeCruz,
E., Noyer-Weidner, M., Smith, S. S., Michael, M. Z. & Graham, M. W.
(1989). Quantitative evaluation of Escherichia coli host strains for
von Bismarck, P., Schneppenheim, R. & Schumacher, U. (2001).
tolerance to cytosine methylation in plasmid and phage recombinants. Nucleic Acids Res 17, 3469–3478.
Successful treatment of Pseudomonas aeruginosa respiratory tract
infection with a sugar solution – a case report on a lectin based
therapeutic principle. Klin Padiatr 213, 285–287.
Wentworth, J. S., Austin, F. E., Garber, N. C., Gilboa-Garber, N.,
Paterson, C. A. & Doyle, R. J. (1991). Cytoplasmic lectins contribute
to the adhesion of Pseudomonas aeruginosa. Biofouling 4, 99–104.
http://mic.sgmjournals.org
Wozniak, D. J., Wyckoff, T. J., Starkey, M., Keyser, R., Azadi, P.,
O’Toole, G. A. & Parsek, M. R. (2003). Alginate is not a significant
component of the extracellular polysaccharide matrix of PA14 and
PAO1 Pseudomonas aeruginosa biofilms. Proc Natl Acad Sci U S A
100, 7907–7912.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 11:34:28
1323