Carcinogenesis vol.20 no.7 pp.1293–1301, 1999
Sequence-dependent mutations in a shuttle vector plasmid
replicated in a mismatch repair deficient human cell line
Simon E.Tobi1,4, Dan D.Levy2, Michael M.Seidman1,3 and
Kenneth H.Kraemer1,5
1Laboratory of Molecular Carcinogenesis, National Cancer Institute,
National Institutes of Health, Bethesda, MD 20892, USA, 2CFSAN, Food
and Drug Administration, Washington, DC, USA and 3Laboratory of
Molecular Genetics, National Institute of Aging, Baltimore, MD, USA
4Present address: Division of Biological Sciences, Institute of Environmental
and Biological Sciences, Lancaster University, Lancaster LA1 4YQ, UK
5To whom correspondence should be addressed
Email: [email protected]
We utilized a shuttle vector plasmid (pLSC) to assess the
role of DNA sequence and mismatch repair on mutagenesis
in human cells. pLSC contains an interrupted 29 bp mononucleotide poly(G) run within a bacterial suppressor tRNA
gene, which acts as a highly sensitive mutagenic target for
detection of base substitution and frameshift mutations.
The frequency of spontaneous mutations in pLSC was
found to be similar after replication in either the hMSH6
(GT binding protein) mismatch repair-deficient MT1 line or
its parental, mismatch repair-proficient line, TK6. However,
the classes of plasmid mutations showed distinct differences
in the two cell lines. Single base deletions comprised 48%
of the mutations in the 56 independent pLSC plasmids
sequenced from MT1 cells while these represented only
18% of the 40 independent pLSC mutants sequenced from
the wild-type TK6 cells (P J 0.001). Virtually all the
deletions included the mononucleotide run. In contrast, in
pSP189, which contains the unmodified supF tRNA without
the mononucleotide sequence, no single base deletions were
observed for either cell line (P < 0.001). UV treatment of
pLSC and pSP189 resulted in a 12–140-fold increase in
mutations in TK6 and MT1 cells. These were predominately
single base substitution mutations without a large increase
in deletion mutations in the mononucleotide run in pLSC.
These data indicate that a mononucleotide poly(G) run
promotes single base deletion mutations. This effect is
enhanced in a hMSH6 mismatch repair-deficient cell line
and is independent of UV-induced mutagenesis.
Introduction
Studies in Escherichia coli and yeast have shown that postreplication mismatch repair is vital to maintaining the stability
of simple repetitive sequences in DNA (1,2). The observation
of a high degree of microsatellite instability in the cells from
certain human tumors [e.g. hereditary non-polyposis colorectal
cancer led to the identification of mutations in several human
homologues of yeast mismatch repair proteins, namely MSH2,
MLH1, PMS1 and PMS2 (3–6)]. Apart from causing instability
in microsatellite sequences scattered throughout the genome,
defects in mismatch repair might also be expected to produce
mutations in the repeat motifs that occur within the coding
sequences of genes. Several mismatch repair-deficient colon
© Oxford University Press
carcinoma cell lines produce multiple single base frameshifts
(a mutation hotspot) within a G6 run in the hypoxanthineguanine phosphoribosyl transferase (hprt) locus (7–9) or a G8
run in the BAX gene (10). Other colon cancer lines have been
shown to harbor frameshift mutations in the coding region of
the type II transforming growth factor β receptor, mostly
occurring within a mononucleotide A10 run as one or two base
deletions (11). Loss of function of this receptor might produce
a proliferative advantage leading to malignancy. Subsequent
studies have identified two additional human mutS homologues, hMSH6 and hMSH3, each of which purifies as a
complex with hMSH2 (12–14). In vitro analysis suggests that
while the hMSH2–hMSH6 complex (mutSα) repairs base–
base mismatches and single base loop-outs, the hMSH2–
hMSH3 complex (mutSβ) is directed towards larger loop-out
mismatches although recent data point to some degree of
redundancy in their roles (15,16).
We examined the effect of the human mismatch repair system
on spontaneous mutagenesis in the context of a mononucleotide
repeat. We have utilized a shuttle vector system developed in
this laboratory (17) based on an E.coli suppresser tRNA, supF,
which acts as a highly sensitive mutagenic target for both base
substitution and frameshift mutations. A construct was prepared
(pLSC) in which the tRNA sequence of supF in pSP189 (18)
was modified to contain an interrupted 29 bp mononucleotide
poly(G) run. As sequence controls, we made use of a plasmid
containing the unmodified supF sequence, pSP189 (18).
Several observations suggest that the mismatch repair system
may be involved in the processing of UV damage. Mutations
in mutS and mutL of E.coli and in the human hMSH2 and
hMLH1 mismatch repair proteins, produce defects in post-UV
transcription-coupled repair (19,20). In addition, the human
homologue of mutS (hMSH2) has been reported to bind to
thymine–thymine dimers and 6–4 thymine–thymine photoproducts (21). We have, therefore, extended our study to
examine the effect of DNA mismatch repair on processing of
a UV-irradiated shuttle-vector template.
We have studied mutagenesis after replication of the
shuttle vectors in the mismatch repair-deficient human lymphoblastoid line, MT1, and the parental mismatch repair-proficient
TK6 line (22). The MT1 derivative was first isolated by virtue
of its resistance to the alkylating agent N-methyl-N9-nitro-Nnitrosoguanidine (1500-fold) and subsequently reported to
show a 60-fold increase in spontaneous mutations at the hprt
locus (23). More recently, the mismatch repair defect in the
MT1 line has been pinpointed to two mutations in the GT
binding protein (GTBP) (24,25), also known as hMSH6
(26), the human homologue of the Saccharomyces cerevisiae
MSH6 protein (27). In contrast with MT1 cells, the tumor line
HCT-15 (and its genetically related DLD-1 line) which has
been the subject of several studies of mutagenesis (7,9,28)
contains not only mutated hMSH6 alleles but in addition a
point mutation in the polymerase δ gene (29,30).
Our results show that, while there was no increase in the
1293
S.E.Tobi et al.
produce better quality gels more rapidly. pSP189 was also analyzed by
cycle sequencing using either Thermosequenase or Sequitherm polymerase
(Epicentre Technologies, Madison, WI). Sequencing primers were as
follows: for pSP189, the coding strand (forward) primer (59-GGCGACACGGAAATGTTGAA) (31) was used. Sequencing pLSC with this primer
proved difficult through the poly(C) run, but a reverse strand primer (59TTTGTGATGCTCGTCAGGGG) provided a clear reading through the poly(G)
repeat. Clonal duplicates were excluded by only counting one mutation at a
given site per transfection. However, studies with a similar plasmid carrying
a random, signature sequence have shown a low frequency of these clonal
duplicates (18).
Results
Fig. 1. The DNA sequence of the tRNA gene and adjacent sequence of
pLSC folded into the secondary structure of the mature tRNA product.
Bases coding for the mature tRNA product are indicated in uppercase
letters; lowercase letters are sequences trimmed at the RnaseP site. Boxes
indicate mononucleotide G:C runs. Double-line boxes are bases which were
altered from pSP189. Solid lines indicate potential base pairing in the stems
of the mature tRNA. Dashed line indicates a potential T:G mispairing. The
plasmid sequence beyond XhoI and SacI is identical to pSP189 (18).
frequency of spontaneous mutants produced by the mutant
MT1 line in pLSC, the distribution of mutation types was very
different from that in the wild-type TK6 line. However, the
mismatch repair defect in MT1 cells did not affect UV survival
or mutagenesis of the shuttle vector plasmids.
Materials and methods
Cell culture
The human lymphoblastoid cell lines, TK6 and its alkylation-tolerant derivative
MT1 (23), (gifts from W.Thilly) were cultured in RPMI 1640 medium
supplemented with 16% fetal bovine serum and 2 mM glutamine (Life
Technologies, Gaithersburg, MD) at 37°C in a 5% CO2 atmosphere.
Plasmids
pLSC was constructed from pSP189 (DDBJ/EMBL/GenBank accession no.
U14594.gb_sy) which was previously constructed in this laboratory (18).
Complementary synthetic oligonucleotides were phosphorylated, annealed and
ligated into the XhoI–SacI-digested recipient vector (31). The new tRNA and
surrounding altered sequence are shown in Figure 1. pZ189K (32), a variant
of pZ189 with the bacterial gene for kanamycin resistance in place of the
ampicillin resistance gene was a gift from Dr Steve Akman (WinstonSalem, NC).
UV-irradiation and transfection
Cesium chloride-purified plasmid stocks were diluted to a concentration of
31 µg/ml in water and irradiated on ice as described previously (32).
Transfections of the plasmids into the human cell lines were performed using
DEAE dextran. A UV-irradiated or untreated plasmid sample (1 µg) of pLSC
or pSP189 was mixed with 1 µg of unirradiated pZ189K in 1 ml of medium
containing 500 µg DEAE dextran and added to 303106 exponentially growing
cells. Following a 10 min incubation at 37°C in a 5% CO2 atmosphere, the
cells were washed with 15 ml of fresh medium and resuspended in 40 ml of
RPMI 1640 for further culture.
Plasmid recovery, selection of mutants and sequencing
After 48 h in culture, replicated plasmids were recovered from the cells by
an alkaline lysis procedure (33) and transformed into an indicator bacterial
strain MBM7070 (17) by electroporation (32). Transformation mixtures were
plated onto LB-Amp or LB-Kan plates coated with X-gal (20 mg/ml) and
IPTG (50 mg/ml). Plasmids containing a mutated, inactive supF tRNA
sequence yielded white colonies due to a lack of suppression of the amber
codon in the LacZ gene of MBM7070; functional supF produced blue colonies.
Mutant pLSC plasmids containing the mononucleotide poly(G) run
were initially sequenced from mini-preps using Sequenase 2.0 (Amersham,
Piscataway, NJ) (34). However, cycle sequencing with Thermosequenase
(Amersham) using a single-colony lysis method (35) subsequently proved to
1294
pLSC mutagenesis
pLSC contains a novel sequence expected to function as a
suppressor tRNA in E.coli. It was made by modifying the
sequence of supF, a tyrosine suppressor of amber stop codons.
As shown in Figure 1, modest changes were made in the
sequence which codes for two of the tRNA stems. These
changes created mononucleotide runs of three, five, seven,
nine and 13 [G:C] base pairs. Most of these changes were
configured to allow base pairing to occur in the mature
tRNA product, although one G:T wobble mispair was included
(Figure 1). The sequence outside of the mature tRNA was
more highly modified. The inserted sequence codes for a
functional equivalent of supF, since when transformed into
an appropriate E.coli host, the host bacteria were able to
metabolize X-gal, through suppression of the amber mutation
in the episomal lacZ gene.
The tRNA gene of pLSC was inactivated by variety of base
substitution and deletion mutations (see below). In addition to
those described, the gene is inactivated by single base insertion
mutations in the mononucleotide runs of seven and nine [G:C]
pairs. Mutations in the longest run of 13 [G:C] pairs were not
expected to alter tRNA function since these lie entirely outside
the mature tRNA product.
Spontaneous mutagenesis produced by TK6 and MT1 lines
Mutation frequency. The frequency of mutant plasmids
obtained in pLSC and pSP189 following replication of the
untreated plasmids in the TK6 or mismatch repair-deficient
MT1 cell lines was similar. Spontaneous pLSC mutants were
produced at a frequency of 0.071 6 0.006% in TK6 cells and
0.077 6 0.009% in MT1 cells. The spontaneous mutation
frequency was lower with pSP189 but was not significantly different between the TK6 (0.025 6 0.007%) and
MT1 (0.017 6 0.003%) cells.
Analysis of mutations. Inactivating mutations in the supF gene
(producing white or light blue colonies) were characterized by
sequencing. Figure 2 displays the frequency of different classes
of spontaneous mutations obtained in pLSC and pSP189
following replication in either TK6 or MT1 cells. The mononucleotide sequence of pLSC provoked a large shift in the
classes of mutant plasmids observed in both cell lines with a
greater increase in deletions in the repair-deficient cell line.
Thus, in the pLSC plasmid, deletion mutations accounted for
41% of all mutations from TK6 cells and 61% from MT1
cells (P 5 0.06). Small frameshift mutations were never
observed using pSP189, but in pLSC they represented 18% of
the mutations in TK6 and almost half of all mutated plasmids
(49%) from MT1 cells (P 5 0.002).
The locations of mutations in pLSC are displayed in the
spectra of Figure 3. In both cell lines, the spontaneous deletions
were localized to the mononucleotide poly(G) run. There was
Sequence dependence of mutations in mismatch repair
Fig. 2. Classes of spontaneous mutations in pLSC and pSP189 replicated in
wild-type and mismatch repair-deficient cells. Independent mutant plasmids
pLSC (left) and pSP189 (right), isolated from the wild-type (TK6, upper)
and mismatch repair-deficient (MT1, lower) cells were sequenced. Plasmids
containing the supF marker gene were characterized as having a single base
deletion (solid area), 10 or more bases deleted (cross hatched area), a single
base substitution (wide bands), two or more base substitutions (narrow
bands) or an insertion (open area) in the marker gene. (One deletion
**P 5 0.002 TK6 versus MT1 for pLSC).
a hotspot for single base deletions at position 170 and within
the region 171–179 in MT1 cells. Only one insertional event
(1GG) was observed (in TK6 cells) in this study; however,
our system is sensitive to 1 frameshifts since passage of pLSC
through a MutS E.coli mutant yields a significant number of
insertional events in the mononucleotide poly(G) region (data
not shown).
In contrast to the deletion mutagenesis occurring in pLSC,
no spontaneous single base deletions were found in pSP189
[which lacked the mononucleotide poly(G) run] after replication in either the TK6 or MT1 cells (Figures 2 and 3). The
majority of mutations in both cell lines were single base
substitutions. The distributions of spontaneous pSP189
mutations (Figure 3C and D) showed no differences between
the two cell types except for a T→C hotspot in MT1 cells at
position 153 (P 5 0.016).
The types of spontaneous single base substitution mutations
found in pLSC and pSP189 are displayed in Figure 4. Since
tandem and multiple base mutations probably occur by a
different mechanism in the shuttle vector (36), these were
excluded from the analysis. With both plasmids, G:C→A:T
transitions were the major base substitutions in TK6 cells
[pLSC, 10/15 (67%); pSP189, 18/22 (82%)]. In contrast, this
mutation made up a much lower proportion of single base
changes in MT1 cells [pLSC, 7/19 (37%); pSP189, 11/33
(33%)—TK6 versus MT1, P ,0.005]. A:T→G:C transitions
made up 30% of pSP189 single base transitions from MT1
but none was detected from TK6 cells (P 5 0.003). The only
type of transversion mutation which differed significantly
between the two cell lines was a G:C→T:A change in pSP189
(TK6, 1/22; MT1, 8/33; P 5 0.05).
UV plasmid survival
The survival of pLSC and pSP189 following UV-C irradiation
of the plasmid and replication in the TK6 and MT1 cell lines
is shown in Figure 5A. These experiments involved cotransfecting an unirradiated kanamycin plasmid, pZ189K, into
the cell lines to act as an internal standard and thus reduce
inter-sample variability (32). Survival was reduced in all cases
with increasing UV dose. The plasmid survival was slightly
greater in the MT1 cells than in the TK6 cells with both pLSC
and pSP189.
UV-induced mutagenesis
The frequency of mutant plasmids recovered from the
two cell lines increased with increasing UV doses to the
plasmids (Figure 5B). The mutation frequencies were higher
with pSP189; however, both TK6 and MT1-derived samples
contained similar mutant fractions at each UV dose. At
1000 J/m2 UV treatment to the plasmid, there was a 12–21fold increase in mutation frequency with pLSC and a 74–
140-fold increase with pSP189 compared with the untreated
plasmids.
UV mutation analysis
Deletion mutations were much less frequent following UV
treatment of pLSC plasmids (Figure 6) in comparison with the
spontaneous frequency (Figure 2) with both cell types. Thus,
with TK6 cells only 4% (2/52) plasmids contained deletions,
and with MT1 only 7% (4/59) plasmids contained deletions.
UV treatment of the pLSC produced single base substitutions
with the greatest abundance as in earlier studies of normal and
excision repair-deficient cells with pSP189 (18) and pZ189
(18,37–41). With both cell lines and both plasmids 54–92%
of mutant plasmids were single base substitutions (Figure 6).
Tandem base substitution mutations (involving adjacent bases
or bases with 1 intervening base) were the next most abundant
(7–25%) for each plasmid, followed by multiple base substitutions (three or more base substitutions or two base substitutions
.2 bases apart) (2–15%). There were, however, differences
between pLSC and pSP189 in the abundance of plasmids with
tandem and multiple mutations. The frequency of tandem
mutations was significantly greater in pLSC than in pSP189
for both TK6 (P 5 0.03) and MT1 (P 5 0.007) cell lines.
Plasmids with multiple mutations were also significantly more
frequent in pLSC mutants from MT1 cells (compared with
pSP189) (P 5 0.007) but not in the case of TK6 cells.
The UV mutation spectra for plasmids pLSC and pSP189
are shown in Figure 7. There were hotspots for base substitution
mutations in pLSC at positions 155 and 159 with TK6
cells and at positions 120 and 159 with MT1 cells. The
mononucleotide poly(C) run contains a high frequency of
photoproducts (42); however, there were relatively few
mutations observed. There were two deletion mutations in the
interrupted mononucleotide poly(C) run with MT1 cells, but
there were no base substitution mutation hotspots in the
poly(C) region beginning at base pair 168. pSP189 mutants
recovered from TK6 cells showed the strongest hotspots at
positions 155, 156, 164 and 169. The pSP189 mutants in MT1
cells were at positions 156 and 172. There were no significant
differences in frequencies of types of transition or transversion
mutations between the UV-treated plasmids with either cell line.
Discussion
Spontaneous mutation frequency
We did not observe an increase in the frequency of mutant
pLSC or pSP189 plasmids recovered from the mismatch repairdefective MT1 cell line despite a reported 60-fold increase in
spontaneous mutation frequency at the endogenous hprt locus
(23). It is believed that the spontaneous mismatches occur in
chromosomal DNA as a consequence of replication errors,
which are then repaired in a strand-specific manner. The rate
limiting step for mutations which are eliminated by the
1295
S.E.Tobi et al.
Fig. 3. Location of spontaneous mutations in pLSC and pSP189 replicated in wild-type and mismatch repair-deficient cells. A portion of the modified supF
suppressor tRNA marker gene (containing the interrupted mononucleotide G:C run, shaded) in pLSC (A and B) and of the unmodified supF gene in pSP189
(C and D) is shown. Single base deletions are indicated by ∆, larger deletions are indicated by a ∆ at each end connected by a solid line. Base substitutions
are indicated below the altered base pair as a change in the lower strand. Each letter represents the mutation found in a sequenced independent plasmid.
Tandem mutations (consisting of mutations in adjacent bases or two bases with one intervening base) and multiple base substitutions in one plasmid are
indicated by underlining. Data are from experiments presented in Figure 2. (A) pLSC replicated in TK6 cells (40 plasmids sequenced). (B) pLSC replicated in
MT1 cells (56 plasmids sequenced). (C) pSP189 replicated in TK6 cells (38 plasmids sequenced; two plasmids with large deletions not shown). (D) pSP189
replicated in MT1 cells (40 plasmids sequenced; 1 plasmid with large deletion not shown).
1296
Sequence dependence of mutations in mismatch repair
Fig. 4. Types of spontaneous mutations in pLSC and pSP189 replicated in
wild-type and mismatch repair-deficient cells. Single base substitution
mutations in pLSC (left) and pSP189 (right), isolated from the wild-type
(TK6, upper) and mismatch repair-deficient (MT1, lower) cells from
experiments in Figure 3 are shown. G:C→A:T mutations (solid area),
A:T→G:C (cross hatched), G:C→T:A (wide bands), G:C→C:G (narrow
bands), A:T→T:A (vertical bands) and A:T→C:G (horizontal bands) are
indicated. (*P 5 0.05, **P ,0.004 TK6 versus MT1 for pSP189.)
Fig. 5 Post-UV plasmid survival and mutation frequency in wild-type and
mismatch repair-deficient cells. UV treated pLSC (open symbols) and
pSP189 (closed symbols) were transfected into repair-proficient
lymphoblastoid cells (TK6, triangles) and its mismatch repair-deficient
subline (MT1, circles). In each experiment untreated pZ189kan was
cotransfected along with the UV treated plasmid as an internal standard.
Replicated plasmids were harvested and used to transform indicator
bacteria to ampicillin or kanamycin resistance (32). (A) Relative plasmid
survival was measured 2 days after transfection with plasmid treated with
250–1000 J/m2 UV. Each point represents the results of an independent
transfection. (B) Frequency of plasmids with mutations after transfection
with plasmid treated with 250–1000 J/m2 UV. The proportion of bacterial
colonies with mutant plasmids (white or light blue colonies) was compared
with those with wild-type plasmids (dark blue colonies). Each point
represents the results of an independent transfection [the same transfections
as in (A)].
mismatch repair system is the repair event. Loss of mismatch
repair would be noticed as an increase in mutation frequency,
particularly at runs of simple sequence where mismatches are
most likely to appear.
However, in the shuttle vector, the basis of spontaneous
mutations is not replication. Most spontaneous mutations are
caused early in transfection prior to vector replication and the
frequency of spontaneous vector mutations is higher than
the frequency of spontaneous mutations in a chromosomal
marker. This is because the vector is exposed to damaging
events, such as imposed by nicking activities, that are
substantially more frequent than seen by a chromosomal
marker. And that is probably because the vectors enter the cell
as naked DNA, rather than as chromatinized DNA. There are
several consequences to the nick: deletions, insertions, point
Fig. 6 Classes of post-UV mutations in pLSC and pSP189 replicated in
wild-type and mismatch repair-deficient cells. Independent mutant plasmids
pLSC (left) and pSP189 (right), isolated from the wild-type (TK6, upper)
and mismatch repair-deficient (MT1, lower) cells from experiments in
Figure 5 were sequenced. Plasmids containing the supF marker gene were
characterized as having a single base deletion (solid area), 10 or more bases
deleted (cross hatched area), a single base substitution (wide bands), two or
more base substitutions (narrow bands) or an insertion (open area) in the
marker gene. (*P 5 0.03 pLSC versus pSP189 for TK6; **P 5 0.007
pLSC versus pSP189 for MT1.)
mutations, multple point mutations, etc. When we provide the
opportunity for some slippage we add another kind of mutational event to the mix. However, there is already an appreciable
level of mutagenesis. So it is likely that the spontaneous
mutation frequency did go up a little but not by enough
to notice.
Mutations in the supF marker gene of the shuttle vector
plasmid do not alter plasmid survival and, thus, are not selected
for or against. The mutagenic target in the shuttle vector is
the gene that codes for tRNA, where most bases are essential
(43), rather than one that codes for protein such as hprt, where
the third base in each codon (the wobble position) may be
changed without altering protein function. Furthermore, the
functioning of the supF gene is not essential for plasmid
survival. Thus, the plasmid system may be more able to detect
mutations than the hprt system. This may contribute to a
higher spontaneous mutation frequency in the shuttle vector
compared with a chromosomal gene (7–9) and a failure to
see increased spontaneous mutations in the mismatch repairdeficient MT1 cells.
Spontaneous deletion mutations
In order to study the impact of loss of hMSH6 function on
mutagenesis in human cells, we have modified the supF gene
to contain runs of mononucleotides [poly(G):C], producing
a target sensitive to both frameshift and base substitution
mutagenesis (pLSC). Our data demonstrate a clear shift to
spontaneous single base deletion mutations in the interrupted
mononucleotide poly(G) run of pLSC by replication in a
hMSH6 mutant background (MT1).
Naked plasmid DNA transfected into cells is nicked by
cellular processes. The nick gives the region an opportunity
to be replicated by an error-prone polymerase that can make
single point mutations but can also give rise to the slippage
product of a mismatch (loop-out). In mismatch repair-proficient
cells this is recognized and repaired, in mismatch repairdeficient cells they are not repaired, since they are localized
to the mononucleotide poly(G) runs and that is where we see
them. If we eliminated all the scattered point mutations and
1297
S.E.Tobi et al.
Fig. 7. Location of post-UV mutations in pLSC and pSP189 replicated in wild-type and mismatch repair-deficient cells. A portion of the modified supF
suppressor tRNA marker gene (containing the interrupted mononucleotide G:C run, shaded) in pLSC (A and B) and of the unmodified supF gene in pSP189
(C and D) are shown. Base substitutions are indicated below the altered base pair as a change in the lower strand. Each letter represents the mutation found in
a sequenced independent plasmid. Tandem mutations (consisting of mutations in adjacent bases or two bases with one intervening base) and multiple base
substitutions in one plasmid are indicated by underlining. Single base deletions are indicated by ∆, larger deletions are indicated by a ∆ at each end connected
by a solid line. Data are from experiments presented in Figures 5 and 6. (A) pLSC replicated in TK6 cells (52 plasmids sequenced). (B) pLSC replicated in
MT1 cells (60 plasmids sequenced). (C) pSP189 replicated in TK6 cells (68 plasmids sequenced). (D) pSP189 replicated in MT1 cells (62 plasmids
sequenced).
the large deletion mutations from the spontaneous spectrum
(making the collection more like a chromosomal collection)
then our data indicates a large increase in spontaneous single
base deletions in the mismatch repair-deficient cells (Figure 2).
When considering the specific single base deletion frameshift
mutation the frequency is nearly 3-fold greater in the MT1
cell line than in the TK6 with pLSC. Data from S.cerevisiae
indicate that the mutator phenotype produced by loss of MSH6
function is weak compared with that of MSH2 mutants both
in the context of a G18 repeat (32- versus 6300-fold over wildtype) and in a target (CAN1) prone mainly to base substitutions
(7- versus 32-fold over wild-type) (44). As a chromosomally
integrated sequence in λ phage, however, supF does reflect a
mutator phenotype in mice deficient in PMS2 (45). Our results
are consistent with the findings that hMSH6/GTBP mutants
are not as strong mutators as hMSH2 mutants, perhaps because
of the ability of hMSH3 to bind to hMSH2 and partially
1298
complement the defect in hMSH6 (15). Clearly this complementation is only partial since there are definite repair
deficiencies in hMSH6 cell lines.
Sequence effects on mutations
Comparison of the spontaneous mutation spectra obtained from
pLSC and pSP189 suggests that a mononucleotide run of G
or C longer than the five in the latter plasmid (positions 172–
176) is required to produce deletion mutations. However, the
sequence context of a repeat may also be important since the
7 base mononucleotide stretch from 99 to 105 in pLSC shows
little deletion activity in our cell lines. In addition, it should
be noted that there is a single sequence difference between
the two targets at position 171 which might affect mutagenesis.
The mononucleotide poly(G) run of pLSC tends to be a
stronger focus for mutations in the mismatch repair-deficient
MT1 cells than in the TK6 parental line [75% (45/60) of all
Sequence dependence of mutations in mismatch repair
mutations in MT1 and 43% (23/53) of all mutations in TK6
are in the shaded repeat region]. This is consistent with data
in the yeast S.cerevisiae which point to mononucleotide runs
as strong targets for mutagenesis in mismatch repair-deficient
cells (46,47). Moreover, analysis of human colonic tumors
deficient in mismatch repair has shown that mononucleotide
tracts are preferentially targeted in genes whose inactivation
may be important for tumorigenesis, e.g. a G8 stretch of the
proapoptotic gene BAX (10,48,49), an A10 run in the type II
transforming growth factor receptor gene (11), and the APC
gene (50).
The predominance of single deletions in the poly(G):C tract
of pLSC mutants from MT1 cells is consistent with a role for
the hMSH6–hMSH2 complex (mutSα) in the repair of single
insertion/deletion mismatches. Indeed, cell extracts from MT1
cells are defective in repair of single nucleotide—loop-out—
heteroduplexes as well as base–base mismatches; in contrast,
repair of larger (two, three or four) insertion/deletions is
relatively efficient (12). This selectivity in repair is borne out
by the observed instability of a poly(A) repeat marker but not
a dinucleotide (CA) microsatellite from these cells (25).
However, mononucleotide runs tend to produce only deletions
of a single base in several mismatch mutant backgrounds
where the defects (e.g. MSH2 and PMS2 ) would be expected
to extend to loop-outs of two or even three bases (44–46).
These findings suggest that slippages of only one base occur
during replication of such a repeat if the model of (51) is
invoked. The lack of insertions in our spectrum from MT1
cells is also in broad agreement with the predominance of
deletions in mononucleotide stretches in mismatch deficient
yeast (44,46). The supF target is clearly sensitive to this event,
however, since a number appear in the PMS2 background of
the study by Narayanan (45). The appearance of larger deletions
of ù13 bases in the spectra from wild-type TK6 cells suggests
that even a functional mismatch repair system cannot efficiently
correct errors in all types of repetitive DNA. It is possible
that the replication machinery is confronted with topological
challenges other than simple strand slippage during processing
of such sequences. In any case, although localized to the
mononucleotide poly(G) run of pLSC, these deletions may not
be the result of unrepaired loop-outs but may arise through a
different mechanism.
hMSH6 mutations and cancer
Mutations in hMSH6 have been found in several solid tumor
(25,52) and leukemia lines (53). There is a report of one
hereditary non-polyposis colon cancer family with a germline
mutation in hMSH6 (48). However, mice carrying a null
mutation in MSH6 do develop spontaneous gastrointestinal
tumors and lymphomas without microsatellite instability (54).
hMSH6 deficiency and UV repair
Escherichia coli strains that are defective in the DNA mismatch
repair genes mutS and mutL are moderately sensitive to killing
by UV radiation and are unable to perform transcriptioncoupled excision repair (20). Similarly, human tumor cell lines
deficient in one of three mismatch repair genes (hMSH2,
hPMS2 or hMLH1) were slightly hypersensitive to killing by
UV and showed deficiency of transcription-coupled DNA
repair (19). Deficiency in transcription-coupled DNA repair is
seen in cells from patients with the hereditary, progressive
disorder, Cockayne syndrome (55). We previously found that
defective transcription-coupled DNA can be detected by the
plasmid shuttle vector in cells from patients with Cockayne
syndrome as decreased post-UV plasmid survival and increased
post-UV plasmid mutability (34). However, in the present
study there was similar post-UV plasmid survival and postUV plasmid mutation frequency in the mismatch repairdeficient (MT1) and proficient (TK6) cells. This suggests that
hMSH6 deficient cells (MT1) are proficient in transcription
coupled DNA repair.
The interrupted mononucleotide sequence in pLSC containing C25 on one strand (and G25 on the other) is expected
to be a region of intense UV-induced DNA damage in the
polypyrimidine tract (42) as well as being subject to creation
of small loops that are subject to base slippage. The hMSH2
protein binds to cis–syn thymine–thymine cyclobutane dimers
and 6–4 thymine–thymine dimers (21) while the hMSH2–
hMSH6 complex binds too weakly to these lesions (56).
However, there were only a few base substitution mutations
(mostly CC to TT tandems) found in this region with the UVtreated plasmid pLSC in the mismatch repair-deficient or
proficient cells. These UV-treated mononucleotide regions are
potential sites for compound DNA lesions (base damage and
mismatch) of the type studied by Mu et al. (56). Our finding
of no apparent effect of human mismatch repair on UV damage
processing is in keeping with the results of Mu et al. (56), in
which no functional overlap between excision repair and
mismatch repair was observed.
Only three frameshift mutations (two single base deletions
and one single base insertion in the MT1 cells) were seen with
the UV treated pLSC (Figure 7). In the plasmid pSP189 there
is a shorter mononucleotide sequence of C5 that was a hotspot
for C→T transversion mutations in the mismatch repairdeficient MT1 cells. However, there were no frameshift
mutations in this region with UV treated pSP189. Nucleotide
excision repair creates an ~30 bp gap during processing of
UV damage (57). Since there must be extensive repair of the
C run in the UV-treated plasmid, the repair synthesis step must
be quite unlikely to generate mismatches. Thus, the structure of
the gap filling complex must preclude formation of mismatched
sequences, at least those that would require hMSH6 mismatch
repair activity to remove.
References
1. Modrich,P. and Lahue,R. (1996) Mismatch repair in replication fidelity,
genetic recombination and cancer biology. Annu. Rev. Biochem., 65,
101–133.
2. Strand,M., Prolla,T.A., Liskay,R.M. and Petes,T.D. (1993) Destabilization
of tracts of simple repetitive DNA in yeast by mutations affecting DNA
mismatch repair. Nature, 365, 274–276.
3. Fishel,R., Lescoe,M.K., Rao,M.R., Copeland,N.G., Jenkins,N.A., Garber,J.,
Kane,M. and Kolodner,R. (1993) The human mutator gene homolog MSH2
and its association with hereditary nonpolyposis colon cancer [published
erratum appears in Cell (1994) 77, p. 167]. Cell, 75, 1027–1038.
4. Leach,F.S., Nicolaides,N.C., Papadopoulos,N., Liu,B., Jen,J., Parsons,R.,
Peltomaki,P., Sistonen,P., Aaltonen,L.A. and Nystrom-Lahti,M. (1993)
Mutations of a mutS homolog in hereditary nonpolyposis colorectal cancer.
Cell, 75, 1215–1225.
5. Papadopoulos,N., Nicolaides,N.C., Wei,Y.-F. et al. (1994) Mutation of a
mutL homolog in hereditary colon cancer. Science, 263, 1625–1629.
6. Nicolaides,N.C., Papadopoulos,N., Liu,B. et al. (1994) Mutations of two
PMS homologues in hereditary nonpolyposis colon cancer. Nature, 371,
75–80.
7. Malkhosyan,S., McCarty,A., Sawai,H. and Perucho,M. (1996) Differences
in the spectrum of spontaneous mutations in the hprt gene between tumor
cells of the microsatellite mutator phenotype. Mutat. Res. DNAging Genet.
Instability Aging, 316, 249–259.
8. Bhattacharyya,N.P., Ganesh,A., Phear,G., Richards,B., Skandalis,A. and
Meuth,M. (1995) Molecular analysis of mutations in mutator colorectal
carcinoma cell lines. Hum. Mol. Genet., 4, 2057–2064.
1299
S.E.Tobi et al.
9. Ohzeki,S., Tachibana,A., Tatsumi,K. and Kato,T. (1997) Spectra of
spontaneous mutations at the hprt locus in colorectal carcinoma cell lines
defective in mismatch repair. Carcinogenesis, 18, 1127–1133.
10. Rampino,N., Yamamoto,H., Ionov,Y., Li,Y., Sawai,H., Reed,J.C. and
Perucho,M. (1997) Somatic frameshift mutations in the BAX gene in colon
cancers of the microsatellite mutator phenotype. Science, 275, 967–969.
11. Markowitz,S., Wang,J., Myeroff,L., Parsons,R., Sun,L., Lutterbaugh,J.,
Fan,R.S., Zborowska,E., Kinzler,K.W. and Vogelstein,B. (1995)
Inactivation of the type II TGF-beta receptor in colon cancer cells with
microsatellite instability [see comments]. Science, 268, 1336–1338.
12. Drummond,J.T., Li,G.-M., Longley,M.J. and Modrich,P. (1995) Isolation
of an hMSH2-p160 heterodimer that restores DNA mismatch repair to
tumor cells. Science, 268, 1909–1912.
13. Palombo,F., Iaccarino,I., Nakajima,E., Ikejima,M., Shimada,T. and
Jiricny,J. (1996) hMutSβ, a heterodimer of hMSH2 and hMSH3, binds to
insertion/deletion leaps in DNA. Curr. Biol., 6, 1181–1184.
14. Acharya,S., Wilson,T., Gradia,S., Kane,M.F., Guerrette,S., Marsischky,
G.T., Kolodner,R. and Fishel,R. (1996) hMSH2 forms specific mispairbinding complexes with hMSH3 and hMSH6. Proc. Natl Acad. Sci. USA,
93, 13629–13634.
15. Umar,A., Risinger,J.I., Glaab,W.E., Tindall,K.R., Barrett,J.C. and
Kunkel,T.A. (1998) Functional overlap in mismatch repair by human
MSH3 and MSH6. Genetics, 148, 1637–1646.
16. Genschel,J., Littman,S.J., Drummond,J.T. and Modrich,P. (1998) Isolation
of MutSβ from human cells and comparison of the mismatch repair
specificities of MutSβ and MutSα. J. Biol. Chem., 273, 19895–19901.
17. Seidman,M.M., Dixon,K., Razzaque,A., Zagursky,R.J. and Berman,M.L.
(1985) A shuttle vector plasmid for studying carcinogen-induced point
mutations in mammalian cells. Gene, 38, 233–237.
18. Parris,C.N. and Seidman,M.M. (1992) A signature element distinguishes
sibling and independent mutations in a shuttle vector plasmid. Gene, 117,
1–5.
19. Mellon,I., Rajpal,D.K., Koi,M., Boland,C.R. and Champe,G.N. (1996)
Transcription-coupled repair deficiency and mutations in human mismatch
repair genes. Science, 272, 557–560.
20. Mellon,I. and Champe,G.N. (1996) Products of DNA mismatch repair
genes mutS and mutL are required for transcription-coupled nucleotideexcision repair of the lactose operon in Escherichia coli. Proc. Natl Acad.
Sci. USA, 93, 1292–1297.
21. Fishel,R. and Wilson,T. (1997) MutS homologs in mammalian cells. Curr.
Opin. Genet. Dev., 7, 105–113.
22. Goldmacher,V.S., Cuzick,R.A. Jr and Thilly,W.G. (1986) Isolation and
partial characterization of human cell mutants differing in sensitivity
to killing and mutation by methylnitrosourea and N-methyl-N9-nitro-Nnitrosoguanidine. J. Biol. Chem., 261, 12462–12471.
23. Kat,A., Thilly,W.G., Fang,W., Longley,M.J., Li,G.-M. and Modrich,P.
(1993) An alkylation-tolerant, mutator human cell line is deficient in
strand-specific mismatch repair. Proc. Natl Acad. Sci. USA, 90, 6424–6428.
24. Palombo,F., Gallinari,P., Iaccarino,I., Lettieri,T., Hughes,M., D’Arrigo,A.,
Truong,O., Hsuan,J.J. and Jiricny,J. (1995) GTBP, a 160-kilodalton protein
essential for mismatch-binding activity in human cells. Science, 268,
1912–1914.
25. Papadopoulos,N., Nicolaides,N.C., Liu,B., Parsons,R., Lengauer,C.,
Palombo,F., D’Arrigo,A., Markowitz,S., Willson,J.K.V., Kinzler,K.W.,
Jiricny,J. and Vogelstein,B. (1995) Mutations of GTBP in genetically
unstable cells. Science, 268, 1915–1917.
26. Iaccarino,I., Marra,G., Palombo,F. and Jiricny,J. (1998) hMSH2 and
hMSH6 play distinct roles in mismatch binding and contribute differently
to the ATPase activity of hMutSα. EMBO J., 17, 2677–2686.
27. Iaccarino,I., Palombo,F., Drummond,J., Totty,N.F., Hsuan,J.J., Modrich,P.
and Jiricny,J. (1996) MSH6, a Saccharomyces cerevisiae protein that binds
to mismatches as a heterodimer with MSH2. Curr. Biol., 6, 484–486.
28. Glaab,W.E. and Tindall,K.R. (1997) Mutation rate at the hprt locus in
human cancer cell lines with specific mismatch repair-gene defects.
Carcinogenesis, 18, 1–8.
29. Da Costa,L.T., Liu,B., El-Deiry,W.S., Hamilton,S.R., Kinzler,K.W.,
Vogelstein,B., Markowitz,S., Willson,J.K.V., De la Chapelle,A.,
Downey,K.M. and So,A.G. (1995) Polymerase δ variants in RER colorectal
tumours. Nature Genet., 9, 10–11.
30. Umar,A., Koi,M., Risinger,J.I., Glaab,W.E., Tindall,K.R., Kolodner,R.D.,
Boland,C.R., Barrett,J.C. and Kunkel,T.A. (1997) Correction of
hypermutability, N-methyl-N9-nitro-N-nitrosoguanidine resistance and
defective DNA mismatch repair by introducing chromosome 2 into human
tumor cells with mutations in MSH2 and MSH6. Cancer Res., 57,
3949–3955.
1300
31. Parris,C.N., Levy,D.D., Jessee,J. and Seidman,M.M. (1994) Proximal and
distal effects of sequence context on ultraviolet mutational hotspots in a
shuttle vector replicated in xeroderma cells. J. Mol. Biol., 236, 491–502.
32. Moriwaki,S.-I., Tarone,R.E. and Kraemer,K.H. (1994) A potential
laboratory test for dysplastic nevus syndrome: Ultraviolet hypermutability
of a shuttle vector plasmid. J. Invest. Dermatol., 103, 7–12.
33. Parris,C.N. and Kraemer,K.H. (1992) Ultraviolet mutagenesis in human
lymphocytes: the effect of cellular transformation. Exp. Cell Res., 201,
462–469.
34. Parris,C.N. and Kraemer,K.H. (1993) Ultraviolet-induced mutations in
Cockayne syndrome cells are primarily caused by cyclobutane dimer
photoproducts while repair of other photoproducts is normal. Proc. Natl
Acad. Sci. USA, 90, 7260–7264.
35. Levy,D.D., Magee,A.D. and Seidman,M.M. (1996) Single nucleotide
positions have proximal and distal influence on UV mutation hotspots and
coldspots. J. Mol. Biol., 258, 251–260.
36. Seidman,M.M., Bredberg,A., Seetharam,S. and Kraemer,K.H. (1987)
Multiple point mutations in a shuttle vector propagated in human cells:
evidence for an error-prone DNA polymerase activity. Proc. Natl Acad.
Sci. USA, 84, 4944–4948.
37. Seetharam,S., Kraemer,K.H., Waters,H.L. and Seidman,M.M. (1991)
Ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma
pigmentosum lymphoblastoid cells and fibroblasts. Mutat. Res., 254,
97–105.
38. Seetharam,S., Waters,H.L., Seidman,M.M. and Kraemer,K.H. (1989)
Ultraviolet mutagenesis in a plasmid vector replicated in lymphoid cells
from patient with the melanoma-prone disorder dysplastic nevus syndrome.
Cancer Res., 49, 5918–5921.
39. Seetharam,S., Protic-Sabljic,M., Seidman,M.M. and Kraemer,K.H. (1987)
Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in
cultured fibroblasts from a patient with the skin cancer-prone disease,
xeroderma pigmentosum. J. Clin. Invest., 80, 1613–1617.
40. Bredberg,A., Kraemer,K.H. and Seidman,M.M. (1986) Restricted
ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma
pigmentosum cells. Proc. Natl Acad. Sci. USA, 83, 8273–8277.
41. Waters,H.L., Seetharam,S., Seidman,M.M. and Kraemer,K.H. (1993)
Ultraviolet hypermutability of a shuttle vector propagated in xeroderma
pigmentosum variant cells. J. Invest. Dermatol., 101, 744–748.
42. Brash,D.E., Seetharam,S., Kraemer,K.H., Seidman,M.M. and Bredberg,A.
(1987) Photoproduct frequency is not the major determinant of UV base
substitution hot spots or cold spots in human cells. Proc. Natl Acad. Sci.
USA, 84, 3782–3786.
43. Kraemer,K.H. and Seidman,M.M. (1989) Use of supF, an Escherichia coli
tyrosine suppressor tRNA gene, as a mutagenic target in shuttle-vector
plasmids. Mutat. Res., 220, 61–72.
44. Sia,E.A., Kokoska,R.J., Dominska,M., Greenwell,P. and Petes,T.D. (1997)
Microsatellite instability in yeast: Dependence on repeat unit size and
DNA mismatch repair genes. Mol. Cell. Biol., 17, 2851–2858.
45. Narayanan,L., Fritzell,J.A., Baker,S.M., Liskay,R.M. and Glazer,P.M.
(1997) Elevated levels of mutation in multiple tissues of mice deficient in
the DNA mismatch repair gene Pms2. Proc. Natl Acad. Sci. USA, 94,
3122–3127.
46. Tran,H.T., Keen,J.D., Kricker,M., Resnick,M.A. and Gordenin,D.A. (1997)
Hypermutability of homonucleotide runs in mismatch repair and DNA
polymerase proofreading yeast mutants. Mol. Cell. Biol., 17, 2859–2865.
47. Greene,C.N. and Jinks-Robertson,S. (1997) Frameshift intermediates in
homopolymer runs are removed efficiently by yeast mismatch repair
proteins. Mol. Cell. Biol., 17, 2844–2850.
48. Miyaki,M., Konishi,M., Tanaka,K., Kikuchi-Yanoshita,R., Muraoka,M.,
Yasuno,M., Igari,T., Koike,M., Chiba,M. and Mori,T. (1997) Germline
mutation of MSH6 as the cause of hereditary nonpolyposis colorectal
cancer. Nature Genet., 17, 271–272.
49. Yamamoto,H., Sawai,H., Weber,T.K., Rodriguez-Bigas,M.A. and
Perucho,M. (1998) Somatic frameshift mutations in DNA mismatch repair
and proapoptosis genes in hereditary nonpolyposis colorectal cancer.
Cancer Res., 58, 997–1003.
50. Huang,J., Papadopoulos,N., McKinley,A.J., Farrington,S.M., Curtis,L.J.,
Wyllie,A.H., Zheng,S., Willson,J.K.V., Markowitz,S.D., Morin,P.,
Kinzler,K.W., Vogelstein,B. and Dunlop,M.G. (1996) APC mutations in
colorectal tumors with mismatch repair deficiency. Proc. Natl Acad. Sci.
USA, 93, 9049–9054.
51. Streisinger,G., Okada,Y., Emrich,J., Newton,J., Tsugita,A., Terzaghi,E. and
Inouye,M. (1966) Frameshift mutations and the genetic code. This paper
is dedicated to Professor Theodosius Dobzhansky on the occasion of his
66th birthday. Cold Spring Harb. Symp. Quant. Biol., 31, 77–84.
52. Risinger,J.I., Umar,A., Boyd,J., Berchuck,A., Kunkel,T.A. and Barrett,J.C.
Sequence dependence of mutations in mismatch repair
(1996) Mutation of MSH3 in endometrial cancer and evidence for its
functional role in heteroduplex repair. Nature Genet., 14, 102–105.
53. Hosoya,N., Hangaishi,A., Ogawa,S., Miyagawa,K., Mitani,K., Yazaki,Y.
and Hirai,H. (1998) Frameshift mutations of the hMSH6 gene in human
leukemia cell lines. Jpn. J. Cancer Res., 89, 33–39.
54. Edelmann,W., Yang,K., Umar,A. et al. (1997) Mutation in the mismatch
repair gene Msh6 causes cancer susceptibility. Cell, 91, 467–477.
55. Bootsma,D., Kraemer,K.H., Cleaver,J.E. and Hoeijmakers,J.H.J. (1998)
Nucleotide excision repair syndromes: xeroderma pigmentosum, Cockayne
syndrome and trichothiodystrophy. In Vogelstein,B. and Kinzler,K.W. (eds)
The Genetic Basis of Human Cancer. McGraw-Hill, New York, NY, pp.
245–274.
56. Mu,D., Tursun,M., Duckett,D.R., Drummond,J.T., Modrich,P. and
Sancar,A. (1997) Recognition and repair of compound DNA lesions (base
damage and mismatch) by human mismatch repair and excision repair
systems. Mol. Cell. Biol., 17, 760–769.
57. Sancar,A. (1996) DNA excision repair. Annu. Rev. Biochem., 65, 43–81.
Received November 18, 1998; revised February 9, 1999;
accepted March 17, 1999
1301