Am J Physiol Endocrinol Metab 288: E335–E341, 2005.
First published September 28, 2004; doi:10.1152/ajpendo.00250.2004.
Differential expression of Kv4 pore-forming and KChIP
auxiliary subunits in rat uterus during pregnancy
Takahiro Suzuki and Koichi Takimoto
Department of Environmental and Occupational Health, Graduate School
of Public Health, University of Pittsburgh, Pittsburgh, Pennsylvania
Submitted 11 June 2004; accepted in final form 23 September 2004
smooth muscle cell (13, 24). Kv current is further classified into
several components with distinct gating properties and sensitivities to drugs. For example, myometrial cells from pregnant
humans appear to contain three separable Kv current components (14): 4-aminopyridine (4-AP)-insensitive, 4-AP-sensitive
slowly inactivating, and 4-AP-sensitive rapidly inactivating
currents. Although the molecular identity of the channels
responsible for these currents remains uncertain, several poreforming and auxiliary subunits are significantly expressed in
myometrium. For instance, KvLQT1, human ether-a-go-gorelated gene (HERG), and their potential one-transmembrane
auxiliary subunits are abundant in these tissues (6 –10, 16).
Likewise, significant Kv4.3 mRNA and proteins are found in
rat uteri (26). Thus the former and latter channel subunits may
constitute the 4-AP-insensitive and the 4-AP-sensitive rapidly
inactivating channels, respectively (26).
We wished to further identify molecular components of
uterine Kv channels. Specifically, recent studies revealed that
functional expression of Kv4 channels requires their association with Kv channel-interacting proteins (KChIPs) (2, 15).
Thus the 4-AP-sensitive rapidly inactivating channels in myometrial cells may also contain these auxiliary subunits. To test
this possibility, we examined the expression of mRNAs and
proteins for KChIPs, as well as Kv4 pore-forming subunits, in
rat uterus at various pregnancy stages. Here we report that the
expression of Kv4 and KChIP subunits is uniquely and dynamically regulated in rat uterus during pregnancy.
voltage-gated K⫹ channel; myometrium; gene regulation
MATERIALS AND METHODS
in size, structure, and
contractility during pregnancy. Regulation of membrane excitability plays essential roles in these changes: quiescence of
myometrial cells allows expansion of uterus without contraction during pregnancy, whereas synchronous slow-wave contractions are initiated at term. These processes are controlled
by fine tuning of Ca2⫹ manifestation at the plasma membrane
via the activity of various ion channels (21, 24). In particular,
K⫹ channels are considered major determinants of excitability
and are known to control the membrane potential of various
smooth muscle cells (1, 12, 18, 20). Thus changes in the
expression and/or function of K⫹ channels may mediate altered uterus contractility during pregnancy.
Electrophysiological studies have shown that Ca2⫹-activated and voltage-gated K⫹ (Kv) currents are present in uterine
Animals. The animal investigation conformed with the Guide for
the Care and Use of Laboratory Animals published by the United
States National Institutes of Health (NIH Publication No. 85-23,
revised 1996) and was performed under the animal protocol approved
by the University of Pittsburgh Animal Committee. Sprague-Dawley
rats were used at a nonpregnant stage and at various times of
pregnancy (gestation days 13–15 and 19 –22) or postparturition (6 –
12, 12–24, and 24 –36 h). Whole uterus was taken out and excised into
the upper bicornis (corpus) and the lower unicollis (cervix) portions.
The obtained uterine tissues were then rinsed with phosphate-buffered
saline and immediately frozen on dry ice.
RT and real-time PCR. RNA was extracted from frozen uterine
tissues using the guanidium thiocyanate-based method, following the
manufacturer’s instruction (RNeasy; Qiagen, Valencia, CA). Firststrand cDNA was synthesized with 2.5 ␮g of total RNA in a 20-␮l
reaction, using oligo(dT)20 primer and ThermoScript RT-PCR System (Invitrogen, Carlsbad, CA) at 50°C for 1 h. For a standard PCR
reaction, 1 ␮l of the synthesized cDNA was used in a 25-␮l PCR
Address for reprint requests and other correspondence: K. Takimoto, Dept.
of Environmental and Occupational Health, Univ. of Pittsburgh, 3343 Forbes
Ave., Pittsburgh, PA 15260 (E-mail: [email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
THE UTERUS UNDERGOES DRAMATIC CHANGES
http://www.ajpendo.org
0193-1849/05 $8.00 Copyright © 2005 the American Physiological Society
E335
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.1 on June 18, 2017
Suzuki, Takahiro, and Koichi Takimoto. Differential expression
of Kv4 pore-forming and KChIP auxiliary subunits in rat uterus
during pregnancy. Am J Physiol Endocrinol Metab 288: E335–E341,
2005. First published September 28, 2004; doi:10.1152/ajpendo.
00250.2004.—Regulation of voltage-gated K⫹ (Kv) channel expression may be involved in controlling contractility of uterine smooth
muscle cells during pregnancy. Functional expression of these channels is not only controlled by the levels of pore-forming subunits, but
requires their association with auxiliary subunits. Specifically, rapidly
inactivating Kv current is prominent in myometrial cells and may be
carried by complexes consisting of Kv4 pore-forming and KChIP
auxiliary subunits. To determine the molecular identity of the channel
complexes and their changes during pregnancy, we examined the
expression and localization of these subunits in rat uterus. RT-PCR
analysis revealed that rat uterus expressed all three Kv4 pore-forming
subunits and KChIP2 and -4 auxiliary subunits. The expression of
mRNAs for these subunits was dynamically and region selectively
regulated during pregnancy. In the corpus, Kv4.2 mRNA level increased before parturition, whereas the expression of Kv4.1 and Kv4.3
mRNAs decreased during pregnancy. A marked increase in KChIP2
mRNA level was also seen at late gestation. In the cervix, the
expression of all three pore-forming and two auxiliary subunit
mRNAs increased at late gestation. Immunoprecipitaton followed by
immunoblot analysis indicated that Kv4.2-KChIP2 complexes were
significant in uterus at late pregnancy. Kv4.2- and KChIP2-immunoreactive proteins were present in both circular and longitudinal myometrial cells. Finally, Kv4.2 and KChIP2 mRNA levels were similarly
elevated in pregnant and nonpregnant corpora of one side-conceived
rats. These results suggest that diffusible factors coordinate the pregnancy-associated changes in molecular compositions of myometrial
Kv4-KChIP channel complexes.
E336
UTERINE KV4 AND KCHIP GENE EXPRESSION
noprecipitation and immunoblot analyses were performed with the
affinity-purified anti-KChIP2 antibody-conjugated resin, according to
the previously published method (23).
Uterine tissues were homogenized in 5 vol of 0.25 M sucrose
supplemented with 0.2 mM phenylmethylsulfonate, 1 mM iodoacetaminde, and protease inhibitor cocktail (Complete; Roche, Indianapolis, IN), using a polytron-type homogenizer. The postnuclear membrane fraction (P2/3) was obtained by differential centrifugation (27).
The pellet membrane fraction was rehomogenized in the Tritoncontaining lysis buffer [20 mM Tris 䡠 HCl (pH 7.5), 0.2 M NaCl, 1 mM
EDTA, and 1% Triton X-100] supplemented with protease inhibitors
at ⬃5 mg protein/ml, using a Teflon pestle homogenizer. Triton
extract was then obtained by centrifugation at 100,000 g for 30 min.
Triton extract (⬃800 ␮g) was mixed with the antibody-linked protein
G-Sepharose (Pierce) for immunoprecipitation.
Immunostaining. Uterine tissue sections (a middle portion of corpus tissues) were prepared from 4% paraformaldehyde-fixed and
paraffin-embedded blocks. Various dilutions of affinity-purified antiKChIP2 and -Kv4.2 (Alomone) were used for staining transfected
cells and sections at 4°C overnight. To confirm the specificity of the
KChIP2 signals, preimmune rabbit IgG or affinity-purified antibody
preincubated with antigenic peptide was also used in the place of
primary antibody. Immunoreactive proteins were detected with indirect fluorescence, using Alexa Fluor 488-conjugated anti-rabbit IgG
(Molecular Probes).
RESULTS
Expression of Kv4 and KChIP mRNAs is regulated during
pregnancy. We used RT-PCR analysis with primers specific
for each Kv4 or KChIP mRNA (Table 1) to estimate their
abundances in uterine tissues. All Kv4.1– 4.3 mRNAs were
significant in the corpus and cervix of rat uterus at some points
during pregnancy (Fig. 1, A and B). Only the long Kv4.3
splicing isoform (28) (GenBank no. U92897) was detected in
these tissues. In corpus, the Kv4.3 mRNA level was high in
nonpregnant rats and decreased during pregnancy. The observed decrease in Kv4.3 mRNA during pregnancy is consistent with a previous observation (26). In contrast, the Kv4.2
mRNA level increased during pregnancy and declined after
parturition. In cervix, the levels of all three Kv4 mRNAs were
highest at late gestation. RT-PCR with various amounts of
cDNA indicated that Kv4.2 mRNA levels were 2.5 ⫾ 0.7 and
Table 1. Oligonucleotide sequences of primers used for RT-PCR
GenBank Accession No.
Sequence 5⬘-3⬘
Position
Expected Sizes, bp
Kv4.1
Gene
XM_217601
NM_031730
Kv4.3
NM_031739
KChIP1
AY082657
KChIP2
AF269283
1683–1702
1953–1934
507–526
1085–1064
1455–1474
1671–1652
1–20
239–219
53–73
376–356
271
Kv4.2
tcacagggaagagatcttga
actagcgggtcttcggagga
tccgccacatcctcaacttc
catcctcattgtctgtcatcac
gcaagaccacgtcactcatc
aggtgcgtggtcttcttgct
atgggggccgtcatgggcac
accacaccactggggcactcg
gctcctatgaccagcttacgg
cctcgttgacaatcccactgg
KChIP3
NM_032462
KChIP4
AF345444
GAPDH
NM_017008
aggctcagacagcagtgaca
gggggaagaactgggaataa
agatgaacgtgagaagggtgga
gtgcatatgtggtggagtctc
gccatcactgccactcag
gtgagcttcccgttcagc
197–216
393–374
376–397
753–733
1381–1397
1528–1512
AJP-Endocrinol Metab • VOL
288 • FEBRUARY 2005 •
www.ajpendo.org
579
217 (Kv4.3S)
274 (Kv4.3L)
239
324 (KChIP2a)
270 (KChIP2b)
174 (KChIP2c)
197
377 (KChIP4L)
275 (KChIP4S)
148
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.1 on June 18, 2017
reaction containing 2.0 mM MgCl2, 0.2 mM dNTPs, 1.25 U Taq DNA
polymerase (Genechoice, Frederick, MD), and 0.5 ␮M forward and
reverse primers (Table 1). The standard amplification protocol was
2-min denaturation at 94°C and 25 cycles consisting of 94°C for 20 s,
62°C for 20 s, and 72°C for 1 min, followed by a final extension at
72°C for 5 min. Different cycle numbers and amounts of cDNAs were
used to test the linearity of PCR reactions. The level of mRNA was
estimated from the data that were in the linear range with respect to
the amount of cDNA used. As negative controls, we used cDNA
produced without RT. These negative controls yielded no detectable
signals at the expected size in the standard PCR at 35 cycles. PCR
products were separated on a 1.8% agarose gel and visualized by
ethidium bromide staining. Stained gel images were captured, and
band intensities were analyzed using a charge-coupled device camerabased system (BioChem II; UVP, Upland, CA).
Taqman-based real-time PCR for KChIP2 mRNA was performed
with primers and probe targeted at a region that is commonly present
in all splicing isoforms (29): 5⬘-GCTGTATCACAAAGGAGGAAATGC-3⬘ (5⬘-primer, AF269285 431– 454), 5⬘-GAAGCTCTCCACGTGTTCTCTTG-3⬘ (3⬘-primer, 546 –524), and 5⬘-TGACATGATGGGCAAGTACACATACCCTG-3⬘ (probe, 477–505). The
PCR reaction was done with 200 nM primers and 100 nM 5⬘-6-FAM/
3⬘-TAMRA-labeled probe (Integrated DNA Technology, Coralville,
IA) on an ABI Prizm-7000 machine. A commercially available rat
␤-glucuronidase kit was used as a normalization control (Applied
Biosciences, Foster City, CA). We used the same brain RNA as an
internal control for all experiments, and KChIP2 mRNA levels were
determined with a threshold cycle (CT) with the comparative CT
method using the value obtained with the brain RNA.
Immunoprecipitation and immunoblot analysis. Anti-KChIP2 sera
were raised by injecting hemocyanine conjugated with the first 24amino acid peptide of rat KChIP2 (MRGQGRKESLSESRDLDGSYDQLTC, in which the last cysteine was introduced for conjugation
purposes) in rabbits. Anti-KChIP2 antibody was affinity purified with
peptide-linked resin (Sulfolink, Pierce). Anti-Kv4.2 antibodies were
obtained from commercial sources (Alomone, Jerusalem, Israel, and
Upstate, Chicago, IL). For control experiments, 5 ␮g each of Myctagged Kv4.3 and Emerald [modified green fluorescent protein
(GFP)]-tagged KChIP2 or KChIP3 cDNAs were transfected into
human embryonic kidney HEK-293 cells on a 100-mm plastic dish by
calcium phosphate precipitation, as described previously (29). For
immunoprecipitation, affinity-purified anti-KChIP2 antibody was
cross-linked to protein G-Sepharose (0.1 ml of resin conjugated with
⬃20 ␮g of affinity-purified anti-KChIP2 antibody), using a disuccinimidyl suberate-based method (SiezeX; Pierce, Rockford, IL). Immu-
UTERINE KV4 AND KCHIP GENE EXPRESSION
E337
3.2 ⫾ 0.6 times larger in corpus and cervix at late pregnancy
than in nonpregnant animals [nonpregnant vs. late pregnant,
P ⬍ 0.05 (2-tailed t-test), n ⫽ 3]. Thus the expression of three
Kv4 pore-forming subunit mRNAs is uniquely and region
selectively regulated in rat uterus during and after pregnancy.
Unlike the significant expression of all three pore-forming
subunit genes, we found that KChIP2 and -4, but not KChIP1
or -3, mRNAs were detectable in uterine tissues (Fig. 2, A and
B). All three KChIP2 splicing variants (29) were found in both
corpus and cervix, with the ratio of the three isoforms being
a:b:c ⫽ ⬃2:1:4. Two KChIP4 variants (GenBank nos.
AAK28291 and AAK28292) were also detectable in rat uterus,
with the longer one being predominant. Similar to the poreforming subunit mRNAs, KChIP2 and -4 message levels were
region selectively regulated during and after pregnancy. In
both corpus and cervix, KChIP2 mRNAs were very low in
nonpregnant animals and markedly increased at late gestation.
The KChIP4 mRNA level was significant in nonpregnant
animals and slightly reduced during pregnancy in corpus,
whereas it exhibited a marked increase at late gestation in
cervix. Real-time PCR analysis for KChIP2 mRNAs indicated
that the levels of the auxiliary subunit message were 11.4 ⫾
3.4- and 39.7 ⫾ 17.1-fold higher in corpus and cervix at late
gestation than in nonpregnant animals, respectively (nonpregnant vs. pregnant, P ⬍ 0.01, n ⫽ 3 for each time point; Fig. 2,
C and D). Thus the expression of KChIP2 and -4 mRNAs is
dynamically and region selectively regulated in uterus during
pregnancy.
Fig. 2. Expression of uterine KChIP
mRNAs alters during pregnancy. KChIP
mRNAs were detected by RT-PCR analysis
with RNAs from corpus (A) and cervix (B) at
various pregnant or postparturition periods,
as described in the legend for Fig. 1. PCR
was performed with primers that distinguish
splicing isoforms with different sizes: 3
KChIP2 variants (KChIP2a, -2b, and -2c)
(29) and 2 KChIP4 variants (longer and
shorter isoforms are presented as 4a and 4b,
GenBank nos. AAK28291 and AAK28292).
No significant generation of KChIP1 or the 3
products occurred, even after extended PCR
(35 cycles). Total KChIP2 mRNA levels
were determined by Taqman-based real-time
PCR (C and D). Columns and error bars
represent means ⫾ SE, respectively (n ⫽ 3).
*P ⬍ 0.01 compared with nonpregnant animals (two-tailed t-test).
AJP-Endocrinol Metab • VOL
288 • FEBRUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.1 on June 18, 2017
Fig. 1. Expression of uterine Kv4 mRNA changes during pregnancy. Total RNA was isolated from corpus (A) and cervix (B) of uterus from animals at various
pregnant or postparturition periods: nonpregnant (NP), midpregnant (MP, 13–15 days in gestation), late pregnant (LP, 19 –22 days in gestation), 6 –12 h after
parturition (PP1), 12–24 h after parturition (PP2), and 24 –36 h after parturition (PP3). RNA from whole brain of adult rats was used as a positive control. RT-PCR
was performed with primers specific for indicated voltage-dependent K⫹ (Kv) channel pore-forming subunits or GAPDH (see Table 1). PCR products were
separated on an agarose gel and visualized by staining with ethidium bromide. Sizes of all obtained products corresponded to those expected from their sequences
(see Table 1).
E338
UTERINE KV4 AND KCHIP GENE EXPRESSION
gestation but were very low in nonpregnant rat tissue (Fig. 3C,
middle). Immunoblot analysis with anti-Kv4.2 antibody also
showed that significant Kv4.2 proteins are associated with
KChIP2 proteins at late pregnancy (Fig. 3B, right). Thus the
pregnancy-associated increases in Kv4.2 and KChIP2 mRNAs
result in raised expression of complexes containing these
subunits.
Various Kv4 pore-forming and KChIP auxiliary subunits
may be expressed in distinct cell types. For example, the
myometrium contains circular and longitudinal cell layers.
Intense Kv4.3 immunoreactivity has been observed in the
circular layer of uterus from nonpregnant rats (26). Therefore,
the detected Kv4.2-KChIP2 complexes may be selectively
expressed in longitudinal cells. It is also possible that these
channel complexes are present in nonmyometrial cells. To test
these possibilities, we examined cellular localization of Kv4.2and KChIP2-immunoreactive proteins (Fig. 4). We used a
middle portion of corpus tissues for immunostaining. We
Fig. 3. Uterine KChIP2 and Kv4.2 proteins are abundant at late gestation. A: postnuclear membrane fractions from adult rat brain, heart, and late-gestation uterus
(⬃50 ␮g for brain and ⬃150 ␮g of protein for other tissues) were subjected to immunoblot (IB) analysis with affinity-purified anti-KChIP2 antibody (None; left).
The antibody was preincubated with antigenic peptide (w/peptide; middle). Note that the sizes of the larger (⬃30 kDa) and smaller KChIP2 (⬃24 kDa) bands
were nearly identical to those seen with KChIP2a- and KChIP2c-transfected HEK-293 cells, respectively. *Nonspecific bands. Specificity of anti-Kv4.2 antibody
(Alomone) was tested with extracts from tissues and channel cDNA-transfected HEK-293 cells (right). Kv4.2-HEK-293 and mock-HEK-293 indicate extracts
prepared from HEK-293 cells that were transiently transfected with Kv4.2 cDNA and empty vector (pcDNA3), respectively. Anti-Kv4.2 antibody against distinct
epitope (Upstate) showed a pattern of an ⬃70-kDa band on immunoblots, indistinguishable from those obtained with the one from Alomone, except that it
strongly detected a smaller protein with ⬃40 kDa. B: Myc-tagged Kv4.3 and green fluorescent protein (GFP)-tagged KChIP2 or KChIP3 cDNAs were transfected
into HEK-293 cells. Immunoprecipitation (IP) was performed with the resin covalently attached with affinity-purified anti-KChIP2 antibody. Lysate and
immunoprecipitate were subjected to immunoblot analysis with anti-Myc antibody (left) or anti-GFP antibody (right). Note that the anti-KChIP2 antibody
specifically precipitates its target and associated Kv4.3 proteins. C: protein extracts were prepared from uterine corpus tissues of nonpregnant and late-pregnant
rats. Protein extracts were separated on an SDS gel and stained with Coomassie brilliant blue (left). Immunoprecipitation was performed with the anti-KChIP2
antibody-conjugated resin, followed by immunoblot analysis with the same antibody (middle) or the anti-Kv4.2 antibody (right). Note that weak signals (*) above
the strong anti-KChIP2-reactive band are likely a nonspecific reaction, because similar signals were obtained when a large amount of extract from
mock-transfected HEK-293 cells was used (data not shown).
AJP-Endocrinol Metab • VOL
288 • FEBRUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.1 on June 18, 2017
Expression of myometrial Kv4.2-KChIP2 complexes is increased at late gestation. To test whether the observed changes
in Kv4 and KChIP mRNA levels might lead to alterations in
their encoding proteins, we examined immunoreactive Kv4.2
and KChIP2 protein levels. We generated an antibody against
the first 24-amino acid peptide of the rat KChIP2 protein. This
region is present in all three splicing isoforms and shows no
apparent similarity to other KChIP gene products (29). When
used for standard immunoblot analysis, this antibody gave only
a weak signal with uterine KChIP2 proteins (Fig. 3A). Therefore, we used this antibody for immunoprecipitation and subsequent immunoblot analysis to facilitate detection of the
auxiliary subunit proteins. Control experiments in a heterologous expression system showed that the affinity-purified antiKChIP2 antibody effectively immunoprecipitated the target
KChIP2 and its associated Kv4.3 proteins (Fig. 3B). Immunoprecipitation, followed by immunoblot analysis, revealed that
corpus KChIP2 proteins were significant in uterus at late
E339
UTERINE KV4 AND KCHIP GENE EXPRESSION
found that these antibodies detected intense staining in endometrial cells in some, but not all, areas of uterus from latepregnant rats (Fig. 4A, left). Although the observed regional
variation of the detected immunoreactivities might indicate a
nonspecific reaction, it is possible that some Kv4.2- and/or
KChIP2-immunoreactive proteins are present in these cells. In
contrast to the variabilities in endometrium, anti-Kv4.2- or
anti-KChIP2-positive cells were consistently found in both
circular and longitudinal cell layers of myometrium from
late-pregnant rats. In longitudinal cell layers, both immunoreactivities were most obvious in some stretched larger cells,
where they were located throughout (Fig. 4B). Unlike uterine
tissues of late-pregnant rats, only very weak Kv4.2 or KChIP2
immunoreactivities were detected in uteri of nonpregnant animals (Fig. 4A, right). These localizations suggest that Kv4.2KChIP2 complexes are present in myometrial cells.
Diffusible factors control the pregnancy-associated regulation of Kv4.2 and KChIP2 mRNA expression. There are a
number of factors that might contribute to the observed pregnant stage-associated regulation of uterine Kv channel gene
expression. Notably, sex steroids are known to induce changes
in the expression of various proteins, including Ca2⫹-activated
AJP-Endocrinol Metab • VOL
BK (4, 17) and voltage-gated Kv4.3 subunits (26). Female sex
steroids are produced mainly by the ovary and distributed to
various tissues throughout the body via circulation. Other
diffusible factors, such as prostaglandins, act in much shorter
distances to influence gene expression within a tissue in which
producing cells reside. Finally, mechanical stress induced by
developing embryos may also contribute to the altered gene
expression. To obtain insight into the regulatory mechanisms,
we used uterine tissues of animals that carry embryos in only
one side of their bicornis corpora. The one-side conception can
be induced by surgical operation; however, it often naturally
occurs. Because one-side pregnancy was predicted when animals gave 5–7 littermates, we obtained pregnant and nonpregnant corpora from these naturally occurring one side-pregnant
animals 6 –12 h after parturition. Examining pregnant and
nonpregnant corpora in the same animals allows us to test
whether pregnant stage-associated changes in diffusible factors, such sex steroids, might be sufficient for inducing altered
KChIP2 and/or Kv4.2 expression. RT-PCR analysis revealed
that the pregnancy-induced upregulation of Kv4.2 and KChIP2
mRNA expression occurs in both sides (Fig. 5). Using various
amounts of cDNAs for PCR and real-time PCR, we estimated
288 • FEBRUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.1 on June 18, 2017
Fig. 4. KChIP2 and Kv4.2 proteins are expressed in circular and longitudinal myometrial cells at late gestation. A: corpora from
nonpregnant (left) and late-pregnant (middle)
rats were subjected to indirect immunofluorescent staining with anti-Kv4.2 (top) or affinity-purified anti-KChIP2 (bottom) antibodies. Lower magnifications show entire uterine
tissues. Affinity-purified anti-KChIP2 antibody was preincubated with the antigenic
peptide (right). EM, LM, and CM, endometrial, longitudinal, and circular muscle layers,
respectively. Note that Kv4.2 and KChIP2
immunoreactivities were detected in both
longitudinal and circular cells of late-pregnant rats, whereas only weak reactions with
these antibodies were seen in tissues from
nonpregnant animals. B: higher magnifications illustrate cellular and subcellular localizations in longitudinal cells at late gestation.
Note that intense Kv4.2 or KChIP2 immunoreactivities are seen in some stretched larger
cells.
E340
UTERINE KV4 AND KCHIP GENE EXPRESSION
that Kv4.2 and KChIP2 mRNA levels in the pregnant side were
121 ⫾ 37 and 124 ⫾ 67% of those in the nonpregnant side,
respectively (n ⫽ 3). These data suggest that circulating
hormonal factors largely account for the pregnancy-associated
increases in Kv4.2 and KChIP2 mRNA expression.
DISCUSSION
The rapidly inactivating 4-AP-sensitive K⫹ current is prominent in myometrial cells (11, 19, 22, 25, 30, 31) and plays an
important role in controlling membrane potential during gestation (19, 25). The kinetics and pharmacological properties of
this current resemble those produced by channel subunits in the
Kv4 family. However, recent studies revealed that native Kv4
channels are composed of pore-forming and KChIP auxiliary
subunits (2, 15). Consistent with this notion, the expression of
KChIPs is found in smooth muscle cells from various tissues
(1). In this study, we examined the expression and cellular
localization of Kv4 pore-forming and KChIP auxiliary subunits. Our data indicate that all three pore-forming (Kv4.1– 4.3)
and two auxiliary (KChIP2 and -4) subunits are significantly
expressed in rat uterus. Furthermore, the expression of these
subunits is dramatically regulated during and after pregnancy.
Specifically, Kv4.2 and KChIP2 mRNAs and proteins are
markedly increased in late gestation. Immunostaining also
showed that these two proteins are similarly distributed in
circular and longitudinal myometrial cells at late pregnancy.
These results suggest that Kv4.2-KChIP2 complexes constitute
a significant portion of the rapidly inactivating current in
myometrial cells at late gestation. They also indicate that
molecular compositions of the rapidly inactivating channels in
myometrial cells change during pregnancy.
Electrophysiological studies revealed that myometrial cells
contain at least three Kv current components that differ in
gating properties and sensitivities to drugs. In addition to the
rapidly inactivating current, 4-AP-sensitive and -insensitive
slow-inactivating components are seen in these cells. Because
channels encoded by Kv1– 4 families are sensitive to 4-AP, the
drug-sensitive slow-inactivating currents are likely generated
by these channel subunits. For example, we found abundant
AJP-Endocrinol Metab • VOL
ACKNOWLEDGMENTS
Present address of T. Suzuki: Dept. of Obstetrics and Gynecology, Sapporo
Medical University, Sapporo, Hokkaido 060-8543, Japan.
288 • FEBRUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.1 on June 18, 2017
Fig. 5. KChIP2 and Kv4.2 mRNA levels are similarly increased in pregnant
and nonpregnant corpora of one-side-conceived rats. RT-PCR analysis was
performed with total RNA isolated from corpora of rats that carried embryos
on one side at 6 –12 h after parturition and nonpregnant animals. Representative RT-PCR results for Kv4.2 and KChIP2 are shown. Kv4.2 mRNA level in
the pregnant side was estimated to be 121 ⫾ 37% of that in the nonpregnant
side (n ⫽ 3). Real-time PCR analysis indicated that the KChIP2 mRNA level
in the pregnant side was 124 ⫾ 67% of the nonpregnant side.
expression of some Kv1 family, Kv2.1, and silent Kv9.3
subunit mRNAs in rat uterus (unpublished observation). Thus
Kv1.x and/or Kv2.1-Kv9.3 complexes may significantly contribute to the 4-AP-sensitive slow-inactivating component.
Furthermore, it has been shown that mRNAs for KvLQT1
(KCNQ1) and HERG (KCNH1), as well as their potential
one-transmembrane auxiliary subunits (KCNEs) (5–10, 16,
22), are highly expressed in the uterus. Therefore, the 4-APinsensitive component with rather unusual gating properties
may be carried by KCNQ- and/or KCNH-KCNE channel
complexes.
Sex steroids have been shown to regulate expression and
splicing of various ion channels in uterus. For example, estrogens appeared to alter the expression and subcellular localization of Kv4.3 proteins (26). Likewise, the expression levels of
Ca2⫹-activated BK channel pore-forming ␣- and auxiliary
␤-subunits are altered by pregnancy and estrogens (4, 17). In
addition, these hormones were found to induce the switch in
splicing pattern of the ␣-subunit (3). Finally, mRNA and
protein levels for the one-transmembrane K⫹ channel auxiliary
subunit, minK, are dramatically changed during pregnancy and
by estrogens (5, 6, 8, 22). Our experiments with one sidepregnant animals indicate that the pregnancy-associated upregulation of Kv4.2 and KChIP2 mRNAs is largely accounted
for by diffusible factors. Hence, diffusible hormonal factors,
such as sex steroids, may play important roles in orchestrating
the expression and splicing of various K⫹ channel poreforming and auxiliary subunits. However, changes in estrogen
levels may not be sufficient to induce the observed dramatic
changes in Kv4.2 and KChIP2 gene expression. Although we
did not measure estrogen levels in nonpregnant animals, Kv4.2
or KChIP mRNA levels were relatively stable in all nonpregnant animals. This suggests that the estrous cycle-related
changes in hormone levels are not sufficient to produce dramatic regulation of channel subunit gene expression. Rather,
sustained elevations in these sex steroids or additional factors,
the levels of which alter during pregnancy, may be required for
the induction of the pregnancy-associated changes in Kv4.2
and KChIP2 gene expression.
A previous study has shown that Kv4.3 expression is reduced during pregnancy. We also observed a similar reduction
in the Kv4.3 mRNA level. In addition, the KChIP4 mRNA
level appeared to decrease during pregnancy in corpus of rat
uterus. Therefore, it is tempting to speculate that Kv4.3KChIP4 channel complexes are major forms of the rapidly
inactivating channels in nonpregnant animals, whereas they are
replaced with Kv4.2-KChIP2 complexes during pregnancy.
This potential subunit composition switch may occur in the
same cells or distinct cell populations. While it has been shown
that Kv4.3 proteins are mostly present in circular myometrial
cells, our immunostaining revealed that Kv4.2 and KChIP2
proteins are present in both circular and longitudinal cells.
Thus the observed changes in subunit compositions occur at
least in part in distinct cell populations. Further studies with
cell isolation from individual layers, as well as the use of toxins
specific for each Kv channel type, may be required to unambiguously resolve these issues.
UTERINE KV4 AND KCHIP GENE EXPRESSION
REFERENCES
AJP-Endocrinol Metab • VOL
16. Lee MP, Hu RJ, Johnson LA, and Feinberg AP. Human KVLQT1 gene
shows tissue-specific imprinting and encompasses Beckwith-Wiedemann
syndrome chromosomal rearrangements. Nat Genet 15: 181–185, 1997.
17. Matharoo-Ball B, Ashford MLJ, Arulkumaran S, and Khan RN.
Down-regulation of the ␣- and ␤-subunits of the calcium-activated potassium channel in human myometrium with parturition. Biol Reprod 68:
2135–2141, 2003.
18. Michelakis ED, Reeve HL, Huang JM, Tolarova S, Nelson DP, Weir
EK, and Archer SL. Potassium channel diversity in vascular smooth
muscle cells. Can J Physiol Pharmacol 75: 889 – 897, 1997.
19. Mironneau J, Savineau JP, and Mironneau C. Fast outward current
controlling electrical activity in rat uterine smooth muscle during gestation. J Physiol (Paris) 77: 851– 859, 1981.
20. Nelson MT. Regulation of arterial tone by potassium channels. Jpn
J Pharmacol 58, Suppl 2: 238P–242P, 1992.
21. Parkington HC and Coleman HA. Ionic mechanisms underlying action
potentials in myometrium. Clin Exp Pharmacol Physiol 15: 657– 665,
1988.
22. Pragnell M, Snay KJ, Trimmer JS, MacLusky NJ, Naftolin F, Kaczmarek LK, and Boyle MB. Estrogen induction of a small, putative K⫹
channel mRNA in rat uterus. Neuron 4: 807– 812, 1990.
23. Ren X, Shand SH, and Takimoto K. Effective association of KChIPs
with Kv4 channel is mediated with their unique core peptide. J Biol Chem
278: 43564 – 43570, 2003.
24. Sanborn BM. Relationship of ion channel activity to control of myometrial calcium. J Soc Gynecol Investig 7: 4 –11, 2000.
25. Satoh H. Enhancement of K⫹ currents by stimulation of protein kinase C
in the uterine smooth muscle cells of the pregnant rat. Gen Pharmacol 27:
455– 458, 1996.
26. Song M, Helguera G, Eghbali M, Zhu N, Zarei MM, Olcese R, Toro
L, and Stefani E. Remodeling of Kv4.3 potassium channel gene expression under the control of sex hormones. J Biol Chem 276: 31883–31890,
2001.
27. Takimoto K and Levitan ES. Altered K⫹ channel subunit composition
following hormone induction of Kv1.5 gene expression. Biochemistry 35:
14149 –14156, 1996.
28. Takimoto K, Li D, Hershman KM, Li P, Jackson EK, and Levitan ES.
Decreased expression of Kv4.2 and novel Kv43 K⫹ channel subunit
mRNAs in ventricles of renovascular hypertensive rats. Circ Res 81:
533–539, 1997.
29. Takimoto K, Yang EK, and Conforti L. Palmitoylation of KChIP
splicing variants is required for efficient cell surface expression of Kv4.3
channels. J Biol Chem 277: 26904 –26911, 2002.
30. Toro L, Stefani E, and Erulkar S. Hormonal regulation of potassium
currents in single myometrial cells. Proc Natl Acad Sci USA 87: 2892–
2895, 1990.
31. Wang SY, Yoshino M, Sui JL, Wakui M, Kao PN, and Kao CY.
Potassium currents in freshly dissociated uterine myocytes from nonpregnant and late-pregnant rats. J Gen Physiol 112: 737–756, 1998.
288 • FEBRUARY 2005 •
www.ajpendo.org
Downloaded from http://ajpendo.physiology.org/ by 10.220.33.1 on June 18, 2017
1. Amberg GC, Koh SD, Imaizumi Y, Ohya S, and Sanders KM. A-type
potassium currents in smooth muscle. Am J Physiol Cell Physiol 284:
C583–C595, 2003.
2. An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendoza G, Hinson
JW, Mattsson KI, Strassle BW, Trimmer JS, and Rhodes KJ. Modulation of A-type potassium channels by a family of calcium sensors.
Nature 403: 553–556, 2000.
3. Benkusky NA, Fergus DJ, Zucchero TM, and England SK. Regulation
of the Ca2⫹-sensitive domains of the maxi-K channel in the mouse
myometrium during gestation. J Biol Chem 275: 27712–27719, 2000.
4. Benkusky NA, Korovkina VP, Brainard AM, and England SK. Myometrial maxi-K channel ␤1 subunit modulation during pregnancy and after
17␤-estradiol stimulation. FEBS Lett 524: 97–102, 2002.
5. Boyle MB, Azhderian EM, MacLusky NJ, Naftolin F, and Kaczmarek
LK. Xenopus oocytes injected with rat uterine RNA express very slowly
activating potassium currents. Science 235: 1221–1224, 1987.
6. Boyle MB, MacLusky NJ, Naftolin F, and Kaczmarek LK. Hormonal
regulation of K⫹-channel messenger RNA in rat myometrium during
oestrus cycle and in pregnancy. Nature 330: 373–375, 1987.
7. Cherubini A, Taddei GL, Crociani O, Paglierani M, Buccoliero AM,
Fontana L, Noci I, Borri P, Borrani E, Giachi M, Becchetti A, Rosati
B, Wanke E, Olivotto M, and Arcangeli A. HERG potassium channels
are more frequently expressed in human endometrial cancer as compared
to non-cancerous endometrium. Br J Cancer 83: 1722–1729, 2000.
8. Folander K, Smith JS, Antanavage J, Bennett C, Stein RB, and
Swanson R. Cloning and expression of the delayed-rectifier IsK channel
from neonatal rat heart and diethylstilbestrol-primed rat uterus. Proc Natl
Acad Sci USA 87: 2975–2979, 1990.
9. Gould TD and Pfeifer K. Imprinting of mouse Kvlqt1 is developmentally
regulated. Hum Mol Genet 7: 483– 487, 1998.
10. Grunnet M, Jespersen T, Rasmussen HB, Ljungstrom T, Jorgensen
NK, Olesen SP, and Klaerke DA. KCNE4 is an inhibitory subunit to the
KCNQ1 channel. J Physiol 542: 119 –130, 2002.
11. Inoue Y, Shimamura K, and Sperelakis N. Forskolin inhibition of K⫹
current in pregnant rat uterine smooth muscle cells. Eur J Pharmacol 240:
169 –176, 1993.
12. Jackson WF. Ion channels and vascular tone. Hypertension 35: 173–178,
2000.
13. Khan RN, Matharoo-Ball B, Arulkumaran S, and Ashford ML.
Potassium channels in the human myometrium. Exp Physiol 86: 255–264,
2001.
14. Knock GA, Smirnov SV, and Aaronson PI. Voltage-gated K⫹ currents
in freshly isolated myocytes of the pregnant human myometrium.
J Physiol 518: 769 –781, 1999.
15. Kuo HC, Cheng CF, Clark RB, Lin JJ, Lin JL, Hoshijima M,
Nguyen-Tran VT, Gu Y, Ikeda Y, Chu PH, Ross J, Giles WR, and
Chien KR. A defect in the Kv channel-interacting protein 2 (KChIP2)
gene leads to a complete loss of I(to) and confers susceptibility to
ventricular tachycardia. Cell 107: 801– 813, 2001.
E341