4877
Development 127, 4877-4889 (2000)
Printed in Great Britain © The Company of Biologists Limited 2000
DEV9714
Development of cranial parasympathetic ganglia requires sequential actions
of GDNF and neurturin
Hideki Enomoto1, Robert O. Heuckeroth2,3, Judith P. Golden3, Eugene M. Johnson, Jr3 and
Jeffrey Milbrandt1,*
1Department
of Pathology and Internal Medicine, Washington University School of Medicine, 660 South Euclid Avenue, Box 8118,
St Louis, MO 63110, USA
2Department of Pediatrics, Washington University School of Medicine, 660 South Euclid Avenue, Box 8116, St Louis, MO 63110,
USA
3Department of Molecular Biology and Pharmacology, Washington University School of Medicine, 660 South Euclid Avenue, Box
8113, St Louis, MO 63110, USA
*Author for correspondence (e-mail: [email protected])
Accepted 30 August; published on WWW 24 October 2000
SUMMARY
The neurotrophic factors that influence the development
and function of the parasympathetic branch of the
autonomic nervous system are obscure. Recently, neurturin
has been found to provide trophic support to neurons of
the cranial parasympathetic ganglion. Here we show that
GDNF signaling via the RET/GFRα1 complex is crucial
for the development of cranial parasympathetic ganglia
including the submandibular, sphenopalatine and otic
ganglia. GDNF is required early for proliferation and/or
migration of the neuronal precursors for the
sphenopalatine and otic ganglia. Neurturin exerts its effect
later and is required for further development and
maintenance of these neurons. This switch in ligand
dependency during development is at least partly governed
by the altered expression of GFRα receptors, as evidenced
by the predominant expression of GFRα2 in these neurons
after ganglion formation.
INTRODUCTION
E13, a period when these neurons encounter their final targets.
Efforts to purify these target-derived survival factors resulted
in the identification of ciliary neurotrophic factor (CNTF)
(Barbin et al., 1984), a protein structurally related to members
of the hematopoietic cytokine family. Other growth factors
such as basic fibroblast growth factor (FGF2) and insulin-like
growth factor 1 (IGF1) have also been shown to promote
survival and enhance choline acetyltransferase activity in vitro
(Crouch and Hendry, 1991; Schmidt and Kater, 1995; Unsicker
et al., 1987). However, despite their ability to support the
survival of ciliary neurons in culture, the actions of these
factors on parasympathetic neurons in vivo remains elusive as
no adverse effects on parasympathetic neurons have been
described in mice lacking any of these factors (Baker et al.,
1993; Liu et al., 1993; Masu et al., 1993; Ortega et al., 1998).
The discovery of glial cell line-derived neurotrophic factor
(GDNF) and successive efforts to identify related proteins has
resulted in the establishment of the GDNF family of ligands
(GFLs) that currently includes GDNF, neurturin (NRTN),
artemin (ARTN) and persephin (PSPN) (Baloh et al., 1998;
Kotzbauer et al., 1996; Lin et al., 1993; Milbrandt et al., 1998).
The biological functions of the GFLs are mediated by a
multicomponent receptor complex composed of the receptor
tyrosine kinase RET and a member of the GFRα family, a
group of glycosylated proteins linked to the cell surface by a
The parasympathetic nervous system represents one major
division of the autonomic nervous system that, along with the
sympathetic nervous system, plays a central role in controlling
and coordinating the body’s homeostatic mechanisms.
Peripheral parasympathetic innervation of visceral target
tissues consists of pre- and postganglionic neurons. In the
cranial region, postganglionic parasympathetic neurons are
located close to the target tissue and form discrete ganglia that
include the ciliary, sphenopalatine, submandibular and otic
ganglia, whose major target organs are the pupillary sphincter,
the lacrimal gland and nasal mucosa, the submandibular gland,
and the parotid gland, respectively. Although previous studies
using chick-quail transplants have revealed that neurons of the
parasympathetic ganglion derive from neural crest cells and
have identified the axial level of neural crest cells that populate
each ganglion (D’Amico-Martel and Noden, 1983; LeDouarin,
1986), little is known about mechanisms controlling formation
and maintenance of these ganglia.
The existence of neurotrophic factors for parasympathetic
neurons has been implied by a number of developmental
studies on the avian ciliary ganglion (Landmesser and Pilar,
1974). These neurons undergo programmed cell death and 50%
of the entire population is lost from embryonic day 8 (E8) to
Key words: GDNF, Neurturin, Cranial parasympathetic neurons,
Gene targeting, Mouse
4878 H. Enomoto and others
glycosylphosphatidylinositol (GPI)-anchor. In vitro studies
have shown that GDNF, NRTN, ARTN and PSPN
preferentially bind GFRα1, GFRα2, GFRα3 and GFRα4,
respectively; however, signaling of NRTN and ARTN via
GFRα1/RET, and of GDNF via GFRα2/RET can also occur
(Airaksinen et al., 1999; Rosenthal, 1999). Neuronal culture
experiments have demonstrated the survival-promoting
activities of GFLs for a wide variety of central and peripheral
neurons that include midbrain dopaminergic, motor, sensory,
enteric and autonomic neurons (Baloh et al., 1998; Buj-Bello
et al., 1995; Henderson et al., 1994; Heuckeroth et al., 1998;
Kotzbauer et al., 1996; Lin et al., 1993; Trupp et al., 1995).
Consistent with these in vitro observations, mice with targeted
disruption of members of the GFL and GFRα families exhibit
a number of deficits in both central and peripheral nervous
systems (Cacalano et al., 1998; Enomoto et al., 1998;
Heuckeroth et al., 1999; Moore et al., 1996; Nishino et al.,
1999; Pichel et al., 1996; Rossi et al., 1999; Sanchez et al.,
1996). Furthermore, in accordance with the in vitro binding
preferences of GFLs and GFRαs, mice lacking either GDNF
or NRTN display strikingly similar phenotypes to mice lacking
their cognate receptors, GFRα1 and GFRα2, respectively. For
example, both GDNF-deficient (GDNF−/−) and GFRα1−/− mice
have severe disruption of the enteric nervous system and
agenesis of kidneys (Moore et al., 1996; Cacalano et al., 1998;
Enomoto et al., 1998; Pichel et al., 1996; Sanchez et al., 1996).
Similarly, NRTN−/− and GFRα2−/− mice have comparable
defects in the fiber density of the myenteric plexus and in a
number of peripheral ganglia (Heuckeroth et al., 1999; Rossi
et al., 1999).
One of the most exciting aspects of these studies is the
finding that NRTN and GFRα2 are important for the survival
and maintenance of parasympathetic neurons (Heuckeroth et
al., 1999; Rossi et al., 1999). Adult mice lacking NRTN or
GFRα2 displayed dramatic reduction of target innervation in
the lacrimal gland by the sphenopalatine ganglion. In
GFRα2−/− mice, reduced parasympathetic innervation is also
observed in the parotid gland, a prime target of the otic
ganglion. Furthermore, significant neuronal loss is observed in
the submandibular ganglion. These analyses have established
NRTN as the first neurotrophic factor recognized as crucial for
the development and maintenance of parasympathetic neurons
in vivo.
To explore the biological importance of RET signaling and
GFL actions further in the development of the parasympathetic
nervous system, we have examined four cranial parasympathetic
ganglia (ciliary, sphenopalatine, submandibular and otic), in
RET−/−, GDNF−/−, GDNF−/−/NRTN−/− and GFRα1−/− mice.
Here we demonstrate that RET signaling is absolutely required
for the proper development of the sphenopalatine, otic and
submandibular ganglia. We further show that, in addition to
NRTN, GDNF is a crucial neurotrophic factor for the
development of these parasympathetic ganglia. Surprisingly,
neurons affected by loss of GDNF significantly overlap those
affected by loss of NRTN, revealing a requirement for two
different GFLs in the development of parasympathetic neurons.
GDNF signaling via GFRα1 is required early in development
for the formation of these ganglia, whereas NRTN becomes
important later for maintenance of postmitotic neurons,
suggesting that parasympathetic neurons switch GFL
dependency from GDNF to NRTN. Collectively these data
identify the GFLs as a family of the long sought after
neurotrophic factors crucial for parasympathetic ganglion
development.
MATERIALS AND METHODS
Animals
RET−/− and GDNF−/− mice are generous gifts from Dr Frank
Costantini and Genentech, respectively. The generation of RET−/−,
GDNF−/−, GFRα1−/− and NRTN−/− mice has been described elsewhere
(Enomoto et al., 1998; Heuckeroth et al., 1999; Moore et al., 1996;
Schuchardt et al., 1994). All studies were performed on F2-F4 mice
obtained by backcrossing original mice with C57/BL6. For
developmental analysis, embryos were obtained by overnight mating
of heterozygous animals. The date when the vaginal plug was
observed was assigned as embryonic day 0 (E0). The PCR screen was
used to determine the genotype of mutant mice. The primer
sequence and PCR condition are as follows: RET, forward
(5′-TGGGAGAAGGCGAGTTTGGAAA), reverse (5′-TTCAGGAACACTGGCTACCATG) for wild-type allele; forward (5′AGAGGCTATTCGGCTATGACTG), reverse (5′-CCTGATCGACAAGACCGGCTTC) for mutant allele. GDNF: common forward
(5′-CAGCGCTTCCTCGAAGAGAGAGGAATCGGC), reverse (5′CATGCCTGGCCTACTTTGTCA) for wild type; reverse (5′-GATGGGCGCATCGTAACCGTGCATCT) for mutant alleles. GFRα1:
common forward (5′-CTTCCAGGTTGGGTCGGAACTGAACCC),
reverse (5′-AGAGAGCTCAGCGTGCAGAGATC) for wild type; and
reverse (5′-CCAGGCAAAGCGCCATTCGCCATTCAGGCTGCG)
for mutant alleles. NRTN: common forward (5′-CCGACGCGGTGGAGCTTCGAGAACTT), reverse (5′-AAGGACACCTCGTCCTCATAGGCCGT) for wild type, and reverse (5′-GAGATCAGCAGCCTCTGTTCCACATAC) for mutant alleles. Initial 2 minutes
at 94°C, followed by 35 cycles (94°C for 30 seconds; 65°C for 1
minute; 72°C for 1 minute).
Histological analysis
Newborn animals were anesthetized and sacrificed by transcardiac
perfusion with PBS, followed by 4% paraformaldehyde/PBS or
immersion fixed in methacarn (60% methanol, 30% chloroform, 10%
acetic acid) overnight. Embryos were quickly frozen in ethanol/dryice bath or fixed by immersion. As necessary, tissues were either
embedded in paraffin or cryoprotected in 30% sucrose/PBS.
Immunohistochemistry with rabbit anti-RET antibodies (IBL) was
performed as described previously (Enomoto et al., 1998). AntiPhox2b antibodies were a kind gift from Dr Jean-François Brunet and
used for immunohistochemistry as described previously (Pattyn et al.,
1997), or at 1:5000 with tyramide signal amplification (TSA; New
England Nuclear), as described elsewhere (Enomoto et al., 1998). For
Phox2b and RET double-immunodetection, goat anti-RET antibodies
(R & D) were used at 1:50 with TSA. Immunohistochemical detection
of GFRα1, tyrosine hydroxylase (TOH) and vesicular acetylcholine
transporter (VAChT) were performed using anti-GFRα1 (R & D),
anti-TOH (Chemicon) and anti-VAChT antibodies (Chemicon) at
1:200, 1:500 and 1:5000 dilution with TSA, respectively. For in vivo
BrdU labeling, pregnant mice were injected intraperitoneally with 50
mg/kg of 5-bromo-2-deoxyuridine (BrdU; Sigma) two hours before
collecting the embryos. Sections of freshly frozen tissues were briefly
fixed with 4% paraformaldehyde, treated with 2 N HCl for 45 minutes
and neutralized in 0.1 M sodium borate for 10 minutes. Slides were
then treated with mouse anti-BrdU antibodies (1:500, Sigma) and
specific immunoreactivity was analyzed by incubation with HRPconjugated anti-mouse IgG followed by direct signal amplification
with TSA-plus (New England Nuclear) using fluorescein-tyramide as
a substrate. Cell death was analyzed by TUNEL on freshly frozen
sections, using terminal transferase (Boehringer Mannheim) and
GDNF is a parasympathetic neurotrophic factor 4879
digoxigenin-11-dUTP (Boehringer Mannheim). Specific signal was
visualized by treatment with sheep peroxidase-conjugated antidigoxigenin antibodies (1:1000, Boehringer Mannheim) followed by
direct signal amplification with TSA-plus (New England Nuclear)
using fluorescein-tyramide as a substrate. Histochemical detection of
β-galactosidase activity was performed either in whole-mount
embryos or in sections as described elsewhere (Mombaerts et al.,
1996). For in situ hybridization, embryos and newborn mice were
quickly frozen and sectioned at 12-16 µm. Radioactive in situ
hybridization was performed as described elsewhere (Golden et al.,
1999). For non-radioactive in situ hybridization, the active-DEPC
method was used (Braissant and Wahli, 1998). Digoxigenin labeled
riboprobes for GFRα1, GFRα2 and SCG10 were synthesized as
previously described (Heuckeroth et al., 1999; Stein et al., 1988).
Neuronal count and cell size analysis
Neuronal count and cell size analysis was performed on at least three
animals of each genotype except two mice with GDNF/NRTN
double mutations were used. The heads of newborn mice were
embedded in paraffin, sectioned at 6 µm thickness and stained with
thionin. For neuronal count, neuron profile numbers were
determined by counting neurons containing clear nucleoli in every
tenth section for the sphenopalatine and submandibular ganglia, and
in every fifth section for the otic ganglion. Because of the small size
of the ganglion, profile numbers of the ciliary ganglion were
determined by counting every second section. Profile numbers were
then subjected to correction according to the nucleoli diameter as
described previously (Abercrombie, 1946). For cell size analysis, the
area of 50 cells with visible nucleoli was determined using Image
Tool software.
RESULTS
RET-deficient mice display severe deficits in cranial
parasympathetic ganglia
Since RET is the receptor component shared for all GFL
signaling (Airaksinen et al., 1999; Rosenthal, 1999), mice
deficient in RET should represent pan-GFL knockout
animals. Therefore, RET−/− mice should exhibit deficits in
cranial parasympathetic ganglia at least as severe as these
observed in NRTN−/− mice (Heuckeroth et al., 1999). To
assess the role of RET in the development of the
parasympathetic nervous system, we examined the cranial
parasympathetic ganglia in RET−/− mice. Because newborn
parasympathetic neurons normally express high levels of
GFRα2 transcripts (Golden et al., 1999; Heuckeroth et al.,
1999), we searched for deficits in these ganglia by in situ
hybridization using GFRα2 riboprobes as a marker. Coronal
sections of newborn mouse head that encompassed four
cranial parasympathetic ganglia (ciliary, submandibular,
sphenopalatine and otic) were analyzed. In wild-type mice,
the majority of neurons in all four ganglia were observed to
express high levels of GFRα2 (Fig. 1A,C,E). In contrast,
analysis of RET−/− mice revealed that GFRα2 expression was
dramatically reduced in the submandibular and ciliary ganglia
(Fig. 1B,D) and undetectable in the region where the
sphenopalatine and otic ganglia are located (Fig. 1D,F). To
confirm the absence of the sphenopalatine and otic ganglia,
consecutive coronal sections of the neonatal mouse head were
hybridized with SCG10 riboprobes that detect all postmitotic
neurons. In RET−/− mice, no SCG10-labeled cells were
observed in regions where the otic and sphenopalatine
ganglia are normally located (Fig. 1G-J). Furthermore,
immunohistochemical analysis using anti-Phox2b, antiGFAP and anti-peripherin antibodies to search for aberrantly
located ganglionic remnants failed to detect any of these cells
(data not shown). These results indicate that the formation
and/or differentiation of these parasympathetic neurons are
severely impaired in RET−/− mice.
To evaluate these neuronal deficits quantitatively, paraffin
sections of the newborn mouse head were stained with thionin
and subjected to neuronal count and cell size analysis. These
studies demonstrated that the sphenopalatine and otic ganglia
were almost completely eliminated in RET−/− mice (Table 1).
There was also a significant reduction in neuron number in
the submandibular ganglion (Table 1) and, in addition, the
size of the remaining neurons was uniformly and significantly
smaller than wild-type neurons (wild type, 100±4 µm2;
RET−/−, 44±2 µm2, P<0.001). The phenotype of the
submandibular ganglion in RET−/− mice was similar to that
in NRTN−/− mice reported previously (Heuckeroth et al.,
1999). In the ciliary ganglion, neuronal number was also
decreased in RET−/− mice (Table 1), but the small size of the
ganglia, and the variability in neuronal profile number
prevented this difference from reaching statistical
significance. These results indicate that RET signaling is
required for the survival or proliferation of the vast majority
of otic and sphenopalatine parasympathetic neurons, as well
as for some submandibular neurons.
Table 1. Neuronal counts on cranial parasympathetic ganglia in newborn mice deleted of GFL ligands or GFRα1
WT
(n=3-5)
RET−/−
(n=3)
NRTN−/−
(n=3)
GDNF−/−
(n=3)
GFRα1−/−
(n=3)
G−/−N−/−
(n=2)
Neuronal counts
Ciliary
Sphenopalatine
65±16
675±40
52±12
529±35
n.d.
n.d.
428±25
Otic
361±33
39±11
6±2*
(99%)
274±8*
(36%)
50±24*
(86%)
n.d.
n.d.
Submandibular
34±19
3±1*
(99.6%)
300±15*
(30%)
2±1*
(99.4%)
287±26*
(33%)
n.d.
284±3*
(34%)
n.d.
254±25*
(41%)
309±29
Counts are reported as mean±s.e.m. At least three mice of each genotype were analyzed, except for GDNF/NRTN double mutants, two of which were used for
this study.
G−/−/N−/−, GDNF−/−/ NRTN−/−; n.d., not determined.
*A statistically significant difference (Student’s t test, P<0.05) when compared with wild type is indicated and loss of neurons is shown in parenthesis as
percentage.
4880 H. Enomoto and others
Fig. 1. Defects in cranial parasympathetic ganglia of RET−/− mice.
(A-F) Coronal sections through a wild-type (RET+/+: A,C,E) and
RET−/− (B,D,F) newborn mouse head were hybridized with GFRα2
riboprobes. In wild-type mice, strong signals were detected in
neurons of the four cranial parasympathetic ganglia including the
submandibular (A, arrow), ciliary (C, arrow), sphenopalatine (C,
arrowhead) and otic (E, arrow) ganglia. In contrast, in RET−/− mice,
GFRα2 expression was dramatically reduced in the submandibular
and ciliary (B,D, arrows) or undetectable at sites of the
sphenopalatine (D, arrowhead) and otic (E) ganglia. GFRα2expressing neurons in the trigeminal ganglion (E, arrowhead) were
also markedly decreased in RET−/− mouse (F, arrowhead). (G-I) Loss
of otic and sphenopalatine neurons was confirmed by in situ
hybridization using SCG10 riboprobes. Although ciliary ganglion
neurons were clearly identifiable in both wild-type and RET−/− mice
(G,H, arrows), no sphenopalatine or otic neurons were found in
RET−/− mice (G,H, arrowheads; I,J, arrows). cg, ciliary ganglion; og,
otic ganglion; smg, submandibular ganglion; spg, sphenopalatine
ganglion; tg, trigeminal ganglion. Scale bar: 200 µm.
GDNF is essential for the development of
parasympathetic ganglia
The defects in parasympathetic neurons present in RET−/− mice
partially overlapped with the defects found in NRTN−/− mice,
but were much more severe. For example, NRTN-deficient
mice had a reduction of neuron numbers in the submandibular
ganglion (Heuckeroth et al., 1999; Table 1), but no loss of
sphenopalatine and otic ganglion neurons (Table 1).
Sphenopalatine neurons are, however, dependent on NRTN as
demonstrated by a reduction in the size of individual neurons
(wild type, 55±2 µm2; NRTN−/−, 34±1 µm2; P<0.001, Fig. 2F).
Interestingly, neurons of the sphenopalatine and otic ganglia
eventually lose innervation of their target tissues in the adult
animal (Heuckeroth et al., 1999; see below). The complete
absence of the sphenopalatine and otic ganglia in RET−/− mice
stimulated us to explore the involvement of GFLs other than
NRTN in the formation of these ganglia.
Since GDNF has been reported to have neurotrophic activity
on cultured parasympathetic neurons (Buj-Bello et al., 1995),
we examined the cranial parasympathetic ganglia in GDNF−/−
mice. Thionin-stained serial sections of newborn head from
GDNF−/− and wild-type littermates were compared by neuronal
counting and cell size analysis. GDNF−/− mice exhibited
deficits in most of the cranial parasympathetic ganglia. The otic
ganglion could be identified in GDNF−/− mice, but was
recognized as only a small cluster of neurons located in the
vicinity of the sphenopalatine artery (Fig. 2C, arrowhead). Otic
neuron number was decreased by 86% as compared with wild
type (Table 1). Sphenopalatine ganglion neurons were almost
completely eliminated in GDNF−/− mice, a phenotype similar
to that seen in the RET−/− mice (Table 1). The virtual absence
of sphenopalatine and otic neurons was further confirmed by
SCG10 in situ hybridization as well as Phox2b and peripherin
immunohistochemistry (data not shown). In the submandibular
ganglion, neuron number was reduced by only 36% in
GDNF−/− mice (Fig. 2K; Table 1), but this was also comparable
with the cell loss in RET−/− mice. Ciliary ganglion neurons
appeared decreased when compared with wild type, but the
difference was not statistically significant. These data
demonstrate that, along with NRTN, GDNF is a crucial factor
for parasympathetic neuron development.
Because GFRα1 is the primary co-receptor responsible for
the GDNF-mediated activation of the RET tyrosine kinase
(Cacalano et al., 1998; Enomoto et al., 1998), we assessed the
requirement of GFRα1 for GDNF action during the
development of parasympathetic neurons. Analysis of the
parasympathetic ganglia in GFRα1−/− mice revealed the virtual
absence of the sphenopalatine and otic ganglia, as well as
moderate neuronal loss (33%) in the submandibular ganglia
(Fig. 2D,H,L; Table 1), a phenotype nearly identical to that of
GDNF−/− mice. These data indicate that GDNF signals through
its preferred receptor, GFRα1, in vivo to control the
development of parasympathetic neurons.
The defects observed in GDNF−/− mice largely accounted
for deficits found in RET−/− mice, which presumably
represents a pan-GFL knockout phenotype. However, in the
submandibular ganglion, we noted that the losses found in
GDNF−/−, NRTN−/− and RET−/− mice were essentially
equivalent (36%, 41% and 30%, respectively; no statistically
significant difference between these three animals). Obviously
the number of lost neurons in the RET−/− submandibular
ganglion was not equivalent to the sum of the deficits found in
mice lacking either GDNF or NRTN. This suggested that either
GDNF or NRTN recruits a receptor other than RET for its
signaling in this ganglion, or that both GDNF and NRTN are
GDNF is a parasympathetic neurotrophic factor 4881
Fig. 2. GDNF−/− and GFRα1−/− mice display severe deficits in cranial parasympathetic ganglia. Consecutive coronal sections of wild-type,
NRTN−/−, GDNF−/− and GFRα1−/− newborn mouse head were stained with thionine. (A-D) In wild-type mouse, the otic ganglion (A,
arrowhead) lies slightly medial to the sphenopalatine artery (indicated by arrows). The otic ganglion in GDNF−/− mice consisted of only a small
cluster of neurons (C, arrowhead). No discernible neurons were found at the site of the otic ganglion in GFRα1−/− mice. (E-H) The
sphenopalatine ganglion lies slightly medial to the maxillary branch of the trigeminal nerve in wild-type (E, arrowhead). Neurons in the
sphenopalatine ganglion were spared but atrophic in NRTN−/− mice (F, arrowhead). No sphenopalatine neurons were present in GDNF−/− and
GFRα1−/− mice (G,H). (I-L) The submandibular ganglion was identifiable in all genotypes examined. Note that submandibular neurons in
NRTN−/− mice display marked reduction in cell size (J). OG; otic ganglion, SPG; sphenopalatine ganglion, SMG; submandibular ganglion.
Scale bar in D, 100 µm for A-D; scale bar in H, 100 µm for E-H; scale bar in L, 50 µm for I-L
Fig. 3. GDNF signaling via GFRα1 is
required for formation of the
sphenopalatine and otic ganglia.
(A-F) RET immunohistochemistry on
parasagittal sections of wild-type,
GDNF−/− and GFRα1−/− embryos. At
embryonic day 12.5 (E12.5), strong
RET immunoreactivity was observed
in neurons of the sphenopalatine
ganglion lying beneath the opthalmic
vein (opv) in wild-type embryos
(A, blue arrow). Neurons of the otic
ganglion located ventral to the
trigeminal (v) and geniculate (vii)
ganglia were also strongly labeled in
wild-type embryos (D, blue arrow). No
RET-positive cells were detected in the
corresponding regions of GDNF−/−
(B,E) and GFRα1−/− (C,F) embryos of the same developmental stage (arrows). OG, otic ganglion; opv, ophthalmic vein; SPG, sphenopalatine
ganglion; v, trigeminal ganglion; vii, geniculate ganglion. Scale bar: 100 µm
required for the same population of submandibular neurons at
different times during development. To distinguish these two
possibilities, we counted neuronal profiles in double mutants
that lack both GDNF and NRTN. This analysis revealed no
additional neuron loss when compared with the single GDNF
or NRTN mutants (Table 1; 34% loss when compared with wild
type). This observation suggests that GDNF and NRTN are
both important for the survival of overlapping populations of
submandibular neurons, perhaps at different times during
development.
GDNF and GFRα1 are required for formation of the
sphenopalatine and otic ganglia
The data presented above suggest that GDNF and NRTN
influence parasympathetic neurons at distinct times during
development. To determine the crucial period of GDNF action
4882 H. Enomoto and others
Fig. 4. Population of sphenopalatine precursors is small and loses RET expression in GDNF−/− embryos.(A-H) Phox2b (A,B,E,F) and RET
(C,D,G,H) immunohistochemistry on parasagittal sections of developing sphenopalatine ganglion in wild-type (A-D) and GDNF−/− (E-H)
embryos. Adjacent sections were used to compare the Phox2b- and RET- expressing populations. (A-D) Phox2b-expressing precursors
dramatically increase in number in wild-type embryos between E12.0 and E12.5. The level of RET expression in these cells also increases
during this period. (E-H) Sphenopalatine precursors were identifiable in some GDNF−/− embryos in the proper location (E,F). Note that the size
of the precursor population was smaller and these cells are more sparsely distributed than in wild-type embryos. These precursors were
undetectable by RET immunohistochemistry (G,H). Scale bar: 200 µm
in the development of these parasympathetic neurons, we
focused our efforts on the development of sphenopalatine and
otic ganglia, since the deficits in these two ganglia were most
severe in GDNF−/− mice. RET immunohistochemistry was
used to identify these ganglia in consecutive parasagittal
sections of wild-type and GDNF−/− embryos at various
developmental stages. At embryonic day 12.5 (E12.5) in wildtype animals, the nascent sphenopalatine ganglion was readily
identifiable beneath the ophthalmic vein (Fig. 3A). At the same
stage, the otic ganglion was recognizable as a cluster of
relatively small RET-positive cells located slightly ventral to
the geniculate ganglion (Fig. 3D). By contrast, no RET-positive
cells were detected in the location of the sphenopalatine and
otic ganglia in GDNF−/− embryos of the same developmental
stage (Fig. 3B,E), suggesting that these ganglia fail to develop
or that the neurons lose RET expression. Further inspection of
serial Nissl-stained sections confirmed that no cells
morphologically consistent with neurons were present at these
sites (data not shown). We also examined GFRα1−/− embryos
at the same stages and observed defects identical to those found
in GDNF−/− mice (Fig. 3C,F). To determine whether these
ganglia developed later during embryogenesis, we examined
mice at E13.5 and E14.5, but delayed formation of these
ganglia in GDNF−/− or GFRα1−/− animals was never observed.
These data indicate that GDNF signaling via the RET/GFRα1
complex is essential for primary formation of the
sphenopalatine and otic ganglia.
GDNF is crucial for the proliferation of the
precursors of sphenopalatine neurons
Impaired ganglion formation in GDNF−/− or GFRα1−/− mice
suggests that GDNF is acting on neural precursors, and raised
the question of whether GDNF is important for proliferation,
migration or survival of these cells. To address this issue, we
examined formation of the sphenopalatine and otic ganglia
anlage in earlier embryos. Phox2 proteins have been reported
to be crucial for induction of RET expression in vivo, thus we
used them as markers to detect these neuronal precursors.
Indeed, in E11.5 wild-type embryos, precursors for
sphenopalatine neurons were readily recognized in the
proximity of the primitive ophthalmic vein as an elongated
array of Phox2b-positive cells (data not shown). At this time
period, these cells did not express RET (data not shown). RET
expression became detectable at E12.0, but only in a small
population of Phox2b-positive cells (Fig. 4A,C). During the
next 12 hours, the population of Phox2b-labeled precursors
dramatically increased in number and, accompanying this
change, the majority of Phox2b-positive cells also began to
express RET (Fig. 4B,D). These data are consistent with the
notion that Phox2b is an upstream regulator of RET expression
in vivo, and suggest that, during this time period, RET is
required for proper proliferation of these neural precursors.
We next examined GDNF−/− embryos of the same ages to
analyze whether neuronal precursors could reach their final
destination in the absence of GDNF. Among eight embryos
examined by Phox2b immunohistochemistry, precursors of
sphenopalatine neurons could be detected in three embryos
beneath the opthalmic vein at E12.0-12.5 (Fig. 4E,F). However,
the size of Phox2b-expressing population in GDNF−/− embryos
was always much smaller than that found in wild-type
embryos, and there was no overt expansion of the population
between E12.0 and E12.5. Surprisingly, these Phox2b-positive
cells were undetectable by RET immunohistochemistry (Fig.
4G,H), suggesting that in the absence of GDNF these cells do
not mature properly and fail to express RET. These data
suggest that at least some sphenopalatine neuronal precursors
can migrate and reach their final destination in the absence of
GDNF; however, they fail to develop further, owing to
increased apoptosis and/or impaired proliferation.
To distinguish survival- versus proliferation-promoting
effects of GDNF, we characterized proliferation and apoptotic
cell death in sphenopalatine neuron precursors on E12.0, 12.5,
E13.5 and E14.0 embryos. To visualize proliferating precursors
for sphenopalatine neurons, pregnant mice with E12.0 or E12.5
GDNF is a parasympathetic neurotrophic factor 4883
embryos were injected with a single dose of BrdU (50 mg/kg)
and the embryos were collected 2 hours after injection. This
experiment identified a population of actively proliferating
cells in the Phox2b-expressing population. In this analysis, we
observed BrdU-labeled cells until E13.5 (Fig. 5A, a and b). In
wild-type embryos (E12.0), approximately 35% of Phox2bpositive cells were also labeled by BrdU (Fig. 5B, a). In
contrast, BrdU-positive cells were observed in only 9% of the
Phox2b-expressing population in GDNF−/− embryos of the
same age (Fig. 5B, b), indicating that sphenopalatine
precursors fail to proliferate properly in the absence of GDNF.
To visualize cells undergoing apoptosis, we examined
sphenopalatine progenitors by Phox2b immunohistochemistry
combined with TUNEL. Unfortunately, this labeling method
failed to detect double-positive cells, presumably because
Phox2b expression is lost in the dying cells. Nevertheless,
Phox2b labeling was useful in identifying the locations of
sphenopalatine precursors. In wild-type embryos, a number
of TUNEL-positive cells were found in the forming
sphenopalatine ganglion at E12.0-E12.5 (Fig. 5B, c). In
contrast, no TUNEL-positive cells were observed in the
proximity of Phox2b-expressing cells in GDNF−/− embryos at
the same period (Fig. 5B, d), suggesting that accelerated
cell death does not occur in GDNF−/− sphenopalatine
precursors. Thus, we conclude that the failure of
sphenopalatine ganglion formation in GDNF−/− embryos is
attributed primarily to impaired proliferation rather than to
increased cell death.
To survey GDNF expression, we analyzed GDNF+/− or
GDNF−/− embryos by X-gal staining since these GDNF mutant
mice express lacZ under the control of the GDNF locus. This
staining clearly showed the expression of GDNF in the region
surrounding or adjacent to the forming sphenopalatine
ganglion at E12.0-12.5 (Fig. 5C, a). Although the relatively low
level of expression hampered our efforts to identify the source
of GDNF, secretion of GDNF from the precursors themselves
is unlikely since GDNF+/− and GDNF−/− embryos (which lack
most of these cells) showed the identical expression pattern.
Perhaps the source of GDNF is mesenchymal cells or Schwann
cells of the maxillary nerve that lies adjacent to the forming
Fig. 5. Impaired proliferation of sphenopalatine precursors in
GDNF−/− embryos. (A, a and b) Proliferating neuronal precursor
population (yellow) of developing sphenopalatine ganglion was
clearly visualized by BrdU labeling (green) combined with Phox2b
(red) immunohistochemistry in wild-type embryos during E12.0E13.5 (E12.0 shown in a). Most of Phox2b-expressing cells became
postmitotic at E14.0 (b). (B, a and b) Approximately 35% of
Phox2b-expressing cells (red) was labeled by BrdU (green) in wild
type E12.0 embryos (double-labeled cells shown by arrows). The
BrdU-positive population in Phox2b-expressing cells was much
smaller in GDNF−/− littermates (b). (B, c and d) A number of
apoptotic cells (green) were identified by TUNEL in developing
wild-type sphenopalatine ganglion (E12.0, visualized by Phox2b
immunohistochemistry (red)). In GDNF−/− embryos, no apoptotic
figures were detectable during E12.0 and E12.5 in the proximity of
Phox2b-expressing population (E12.5 shown in d). (C, a and b)
GDNF was expressed in tissues adjacent to sphenopalatine neuron
precursors as evidenced by X-gal staining (a, black arrowheads).
GFRα1 protein was detected in sphenopalatine neuron precursors by
immunohistochemistry (b, blue arrow). Scale bar: 130 µm in A;
50 µm in B (a,b); 80 µm in B (c,d); 200 µm in C.
sphenopalatine ganglion. The importance of GFRα1 in
mediating the action of GDNF at this time period was
supported by the expression of GFRα1 in sphenopalatine
precursors (Fig. 5C, b).
GDNF promotes migration of the precursors for otic
ganglion neurons
To understand the role of GDNF in otic ganglion formation,
we searched for the neural precursors of this ganglion by
examining consecutive parasagittal sections of wild-type and
GDNF−/− embryos using Phox2b immunohistochemistry. In
E11.5 wild-type embryos, a long array of Phox2b-expressing
cells were located between the region ventrocaudal to the
otic vesicle and the site of the otic ganglion formation (Fig.
6A, a). Slightly medial to this region, we observed the
emergence of cranial nerve IX (data not shown), thus these
cells are likely to be otic neuron precursors that are migrating
rostrally from the root of cranial nerve IX. This migratory
pathway appears to lie along the dorsal edge of the
tubotympanic recess, a derivative of the first branchial pouch
(Fig. 6A, a). These migrating precursors expressed RET and
GFRα1, and interestingly, RET expression appeared to
4884 H. Enomoto and others
Fig. 6. Precursors for otic neurons fail to migrate in the absence of
GDNF. (A, a-d) Parasagittal sections showing expression of RET
(a,b), GFRα1 (c) and GDNF (d) in otic neuron precursors and their
migratory pathway, with the rostral portion appearing at the left of
each photograph. For a and b, double-labeling was performed to
visualize RET (green) and Phox2b (red). (a-c) In wild-type E11.5
embryos, otic neuron precursors (identified by anti-Phox2b
antibodies) migrate from the region dorsal to the otic vesicle (ov).
Expression of both RET (a,b) and GFRα1 (c, arrowheads) in these
precursors was revealed by immunohistochemistry. Note that levels
of RET expression (green) were only marginal in the most caudally
located precursors (a and b, arrows), but became elevated on their
migratory route (a and b, arrowheads). The broken line delineates
the tubotympanic recess underlying the migratory pathway of the
otic precursors. (d) GDNF expression was observed throughout the
tubotympanic recess by X-gal staining of corresponding sections of
the age-matched GDNF+/− embryos. Note the stronger expression
in the rostral region (arrow) when compared with the caudal parts
(arrowheads). (B, a-d) Impaired migration and abnormal cell death
of otic precursors in GDNF−/− embryos. (a,b) In wild-type
embryos, otic neuron precursors were identified as a long array of
Phox2b-expressing cells (a, arrows). In GDNF−/− embryos, otic
neuron precursors were observed in a caudal location (b, arrow) but
not on the presumptive migratory pathway. (c,d) Phox2b
immunohistochemistry (red) with TUNEL (green) revealed
abnormal cell death occurring in migration-defective otic neuron
precursors in GDNF−/− embryos (d, arrowheads). ov, otic vesicle;
vii, geniculate ganglion, Scale bar: 100 µm in A (a-c) and B;
200 µm in A (b).
Fig. 7. Expression analysis of GDNF, NRTN, GFRα1 and GFRα2 in
developing lacrimal gland and sphenopalatine ganglion.
(A) Radioactive in situ hybridization analyses on the developing
lacrimal gland using GDNF (a) and NRTN (b) riboprobes.
Representative hybridization pattern obtained from wild-type E18.0
embryos is shown. Strong hybridization signal was detected by
NRTN riboprobes in the lacrimal gland (b, arrowhead), a major
target of the sphenopalatine neurons. No signal was observed in the
corresponding region using GDNF riboprobes (a). Note that strong
NRTN expression was also observed in the nasal mucosa (b, arrow),
another target of sphenopalatine neurons. (B) Non-radioactive in situ
hybridization analyses for expression of GFRα1 (a,c,e) and GFRα2
(b,d,f) in neurons of the sphenopalatine ganglia. Parasagittal (a-d)
and coronal (e,f) sections are shown. At E12.5, expression of both
GFRα1 and GFRα2 is low in developing sphenopalatine ganglia
(a,b; arrows). High levels of GFRα2 expression were observed at
E14.5 in these neurons (d), which continued until birth (f). GFRα1
expression was almost undetectable at P0 (e). v, trigeminal ganglion.
Scale bar: 200 µm in A; 100 µm in B.
increase as the cells progressed along their migratory
pathway (Fig. 6A, b and c). Furthermore, X-gal staining of
GDNF+/− or GDNF−/− mice revealed high levels of GDNF
expression in the tubotympanic recess (Fig. 6A, d). More
interestingly, there was an overt gradient in GDNF
expression, such that the rostral portion showed higher levels
of GDNF transcripts than the caudal part (Fig. 6A d, rostral
part indicated by an arrow). Thus, GDNF is expressed in a
GDNF is a parasympathetic neurotrophic factor 4885
Fig. 8. Developmental expression of GDNF, NRTN, GFRα1 and
GFRα2 in the parotid gland and otic ganglion. (A) Radioactive in
situ hybridization analyses on the developing parotid gland. In E18.0
embryos, NRTN was strongly expressed in the developing parotid
gland (b, arrowheads), a prime target of the otic ganglion, whereas
no GDNF expression was observed in the corresponding region (a).
(B) Non-radioactive in situ hybridization analyses for expression of
GFRα1 (a,c,e) and GFRα2 (b,d,f) in otic neurons. Expression of
both GFRα1 and GFRα2 was marginal in the nascent ganglion at
E12.5 (a,b; arrows). GFRα2 expression was detectable at E14.5 in
these neurons (d, arrow) and became robust at P0 (f, arrow). GFRα1
expression was almost undetectable (c,e, arrows) during these stages.
v, trigeminal ganglion; vii, geniculate ganglion. Scale bar: 200 µm in
A; 70 µm in B (a,b); 100 µm in B (c-f)
gradient fashion along the route of otic neuron precursor
migration, suggesting that GDNF acts as a chemoattractant
in this migratory process.
When precursors of the otic ganglion were examined in
GDNF−/− embryos at E11.5, some Phox2b-expressing cells
were detectable in the proximity of the root of cranial nerve
IX. However, these cells were much smaller and were not
positioned along the proper migratory pathway (Fig. 6B,
compare a and b). Furthermore, Phox2b and TUNEL doublelabeling revealed the existence of some dying Phox2bexpressing cells, in GDNF−/− embryos that were not present in
wild-type embryos (Fig. 6B, c and d). These results indicate
Fig. 9. Deficits in the sphenopalatine and otic neurons of adult
NRTN−/− mice. (A-D) Thionin staining of neurons in the
sphenopalatine (A,B) and otic (C,D) ganglia of adult wild-type (A,C)
and NRTN−/− (B,D) mice. Sphenopalatine neurons in NRTN−/− mice
are smaller than those in wild-type mice, whereas the size of otic
neurons is not decreased in NRTN−/− mice. (E-F) Sympathetic (E,F)
and parasympathetic (G,H) innervation of the parotid gland, shown
by tyrosine hydroxylase (TOH) and vesicular acetylcholine
transferase (VAChT) immunohistochemistry, respectively. In contrast
to the apparently normal sympathetic innervation (E,H), the number
of VAChT-positive nerve fibers and terminals is dramatically reduced
in NRTN−/− mice (G,H). Scale bar: 100 µm.
that GDNF is crucial for the proper migration of otic neuron
precursors and suggest that these non-migratory cells
eventually degenerate by apoptosis.
Developing parasympathetic neurons switch
dependency from GDNF to NRTN during
development
In contrast to the early requirement of GDNF for the formation
of the sphenopalatine and otic ganglia, NRTN appears to be
required later for maintenance, as these ganglia are present at
birth in NRTN−/− mice (Fig. 2B,F). This temporally distinct
requirement for these related neurotrophic factors is
presumably due to the regulated expression of the GFRα
receptors, as well as GDNF and NRTN themselves. To address
this, we performed a developmental survey of GFRα1 and
GFRα2 expression in parasympathetic neurons, and of GDNF
and NRTN in the lacrimal and parotid glands, major targets for
4886 H. Enomoto and others
neurons of the sphenopalatine and otic ganglia, respectively. At
E16.5, when the nascent lacrimal gland formed, NRTN mRNA
was detectable at high levels in the acini and this high level of
expression continued through postnatal day 0 (P0) (E18 shown
in Fig. 7A, b, arrowhead). No GDNF expression was detected
in the lacrimal gland at any stage (Fig. 7A, a). A high level of
NRTN expression was also detected in the nasal mucosa,
another target of the sphenopalatine neurons (Fig. 7A, b, large
arrow). Expression of both GFRα1 and GFRα2 was detectable
at low levels in the sphenopalatine ganglion at E12.5 (Fig. 7B,
a and b, arrows). However, at E14.5 and extending to P0, high
levels of GFRα2 expression were observed (Fig. 7B, d and f,
arrows). In contrast, GFRα1 mRNA levels remained low at
E12.5 and E14.5, and became almost undetectable at P0 (Fig.
7B, c and e, arrows).
Similarly, robust NRTN signals were detected in the
developing parotid gland, beginning at E12.5 and continuing
until birth (E18 shown in Fig. 8A, b, arrowheads). Again,
GDNF was not detectable in the parotid gland at any time
during this developmental period (E18 in Fig. 8A, a). Low
levels of expression of both GFRα1 and GFRα2 were
detectable in the nascent otic ganglion at E12.5 (Fig. 8B, a and
b, arrows). While a robust increase in expression of GFRα2
mRNA was observed, GFRα1 expression gradually decreased
and became undetectable at P0 (Fig. 8B, c-f). We also
examined the expression of GDNF and NRTN in the
developing submandibular gland from E14 to P0. Whereas
NRTN was highly expressed as early as E14, little or no GDNF
expression was detected in the submandibular gland during this
period (data not shown).
Virtual absence of GDNF expression in the target tissues
suggests that GDNF does not play a role as a target-derived
neurotrophic factor, but instead functions as a locally acting
factor for these neurons or their precursors. The receptor
expression pattern observed in developing sphenopalatine and
otic ganglia indicates that during the shift from neural
precursors to neurons GFRα1 expression is downregulated and
that GFRα2 becomes the predominantly expressed receptor
after ganglion formation.
Interestingly, neurons of the sphenopalatine and otic ganglia
seem to require NRTN mainly for proper differentiation and
maintenance rather than survival since they are found in
apparently normal numbers in adult NRTN−/− mice (Fig. 9AD). Nonetheless, the crucial importance of NRTN for
sphenopalatine neurons was substantiated by the significant
decrease in neuron size (wild type, 143±7 µm2; NRTN−/−, 90±4
µm2; P<0.001) and loss of innervation in their target tissue
(Fig. 9A,B; Heuckeroth et al., 1999), data not shown). In
contrast, otic neurons of NRTN−/− mice did not show an overt
decrease in size (wild type, 162±12 µm2; NRTN−/−, 145±7
µm2; P=0.13). However, immunohistochemical analysis
using anti-tyrosine hydroxylase (TOH) and anti-vesicular
acetylcholine transporter (VAChT) antibodies of parotid gland
innervation in NRTN−/− mice revealed a significant and specific
reduction of VAChT-immunoreactive nerve fibers, indicating
that otic neurons fail to initiate or maintain innervation in the
absence of NRTN (Fig. 9E-H). This result also confirms the
physiological pairing between NRTN and GFRα2 for
maintenance of otic neurons, as an identical phenotype has
been previously described in GFRα2-deficient mice (Rossi et
al., 1999). Collectively, it appears that during shift from neural
precursors to neurons, cells switch their dependency from
GDNF to NRTN.
DISCUSSION
We have investigated the requirements of GFL signaling
through RET/GFRα receptor complexes for cranial
parasympathetic neuron development, using mice deficient in
various components of this neurotrophic factor system.
Previous studies in mice with disruption of the NRTN and
GFRα2 gene identified NRTN as a neurotrophic factor
important for parasympathetic neurons in vivo. Results
presented here support several major conclusions. First, RET
is absolutely required and plays a crucial role in mediating
GFL action in the development of the sphenopalatine, otic and
submandibular ganglia. Second, GDNF is the crucial factor
that signals through RET/GFRα1 to support the proliferation
and/or migration of neuronal precursors of the sphenopalatine
and otic ganglia. Finally, the expression data and analysis of
newborn and fetal mice supports the hypothesis that there is a
switch in GFL dependency during the maturation of neuronal
precursors to neurons in these ganglia. Early on, prior to
ganglion formation, parasympathetic neuronal precursors are
crucially dependent on GDNF. Later, these cells appear to
become dependent primarily on NRTN for trophic support.
Both GDNF- and NRTN-signaling are crucial for the
development of cranial parasympathetic ganglia
The examination of RET-deficient animals has revealed the
importance of GFL-mediated signaling in the development of
the submandibular, sphenopalatine and otic ganglia. Further
investigation revealed that GDNF acts directly on the
sphenopalatine and otic neuron precursors and, that these
effects are mediated via GFRα1-RET receptor complexes. This
is contrary to results from in vitro experiments, which
demonstrated that E17.0 submandibular ganglion neurons from
GFRα1−/− mice could respond to GDNF (Cacalano et al.,
1998). Presumably this reflects GDNF signaling through the
robustly expressed GFRα2-RET complexes.
While the entire population of neurons in the otic and
sphenopalatine ganglia is dependent on RET for formation and
maintenance, only a subpopulation of neurons in the ciliary and
submandibular ganglia require RET for proper development.
This implies that factors other than GFLs are providing trophic
support for ciliary and submandibular neurons during
embryogenesis. Because of the perinatal death of the RET−/−
mice (Schuchardt et al., 1994), it is unclear whether the
parasympathetic neurons that do persist in these animals are in
the process of dying or are dependent on as yet unidentified
factors. However, the fact that remaining neurons in the RET−/−
submandibular ganglion are significantly smaller than those in
wild-type mice strongly suggests that RET signaling is
important for the maintenance of these neurons. Further
evidence for the involvement of RET at later stages has been
accumulated from studies of NRTN−/− mice, where no
significant neuronal loss in the ciliary ganglia was noted at
birth but 40% of ciliary neurons are lost in adulthood
(Heuckeroth et al., 1999). Thus, the requirement for NRTNactivated RET signaling for the survival of these neurons
appears to persist after birth.
GDNF is a parasympathetic neurotrophic factor 4887
Finally, accumulating evidence has shown the importance of
NRTN/GFRα2 in development and maintenance of other
parasympathetic systems. Expression of GFRα2 is observed in
parasympathetic neurons adjacent to the heart and trachea
(Golden et al., 1999). Mice deficient in GFRα2 exhibit loss of
NADPH diaphorase-positive nerve fibers projecting to the
penis, suggesting the impaired development or differentiation
of pelvic parasympathetic neurons (Laurikainen et al., 2000).
It will therefore be interesting to determine whether additional
GFLs can also influence the proper development and
maintenance of these neurons.
Similarities and differences in GFL and neurotrophin
regulation of neural development
Data presented here demonstrate the close similarities between
GFL- and neurotrophin-mediated influences on neuronal
development. In both systems, more than one factor is required
for the proper development of a defined neuronal population.
In the neurotrophin system, peripheral sensory neurons
expressing TrkB/TrkC and TrkA are generated in early and late
waves of neurogenesis, respectively (Huang et al., 1999; Ma et
al., 1999). Soon after neurogenesis, neurons expressing TrkB
or TrkA, as well as those expressing TrkC, initially depend on
NT3 for their survival (Farinas et al., 1998; Huang et al., 1999).
This dependency on NT3 of these neurons appears to last until
they become dependent on their cognate ligands by terminating
their axons to target tissues (Farinas et al., 1996).
The requirement of neurotrophic support by more than one
factor also appears to occur in developing parasympathetic
neurons except that these neurons are dependent on GFLs
rather than neurotrophins. The early dependence of the
sphenopalatine and otic ganglion neuron precursors on GDNF
is clearly demonstrated by the absence of these ganglia in
newborn GDNF−/−, GFRα1−/− and RET−/− mice. The
precursors of these ganglia express Phox2b before RET, and
the timing of RET expression coincides with the period of
active proliferation and/or migration of these precursors. Our
studies demonstrate that GFRα1/RET activation by GDNF is
essential for precursor proliferation and/or migration. The
expression of GDNF along the route of otic neuron precursor
migration in a gradient manner suggests that GDNF may play
a role as a chemoattractant to induce migration of neural
precursors. Supporting this possibility, it has been previously
reported that GDNF can influence the migration of MDCK
renal epithelial cells in vitro (Tang et al., 1998).
It has been shown that NT-3 can influence neuronal
precursors of peripheral sensory ganglia by preventing
premature differentiation (Farinas et al., 1996), but the action
of NT-3 appears to be indirect, since none of the TRK proteins
are expressed in these precursors (Farinas et al., 1998). In
contrast, the effect of GDNF on precursors of sphenopalatine
and otic neurons seems to be direct, as both RET and GFRα1
proteins are expressed in these cells. Another interesting
observation concerning receptor expression is that levels of
RET expression in sphenopalatine and otic neuron precursors
appear to increase as these cells enter the site of GDNF
expression, suggesting an autoregulatory mechanism for
controlling and maintaining RET expression.
After formation of the sphenopalatine and otic ganglia, and
concomitant with expression of NRTN in the anlage of their
target tissues, GFRα2 becomes the predominant receptor in
these parasympathetic neurons. Although we have not
completely excluded the possibility that GDNF could play
some biological role after ganglion formation, the requirement
of GDNF appears to be minimal since no robust GDNF
expression is detectable in the vicinity of these ganglia or in
the target organs. Thus, we propose that neurons of the
sphenopalatine and otic ganglia switch their dependency from
GDNF to NRTN during development by altering their GFRα
receptor expression.
Finally, it is intriguing that sphenopalatine and otic neurons
can survive in the absence of NRTN, but become atrophic
(small soma size) and/or fail to accomplish proper innervation
to their target tissues. This neuronal maintenance role of NRTN
stands in sharp contrast to the survival-promoting roles of
neurotrophins, where loss of these factors leads to dramatic
neuronal losses. The molecular processes mediated by NRTN
that maintain cell size and innervation remain unclear.
However, the fact that NRTN is expressed in the target tissues
of sphenopalatine and otic neurons at a period when these
neurons start to project axons implies the possibility that it acts
as a guidance cue for these axons. NRTN may also be
important for later steps including axonal arborization and
synaptic terminal formation, as well as for metabolic processes
important in maintaining normal function and cell size.
Alternatively, NRTN may be crucial for commitment to the
parasympathetic neuronal lineage, in which case NRTN
deficiency might result in altered differentiation of these
neurons along another neuronal lineage.
The timing of GDNF dependency reveals complexity
in the genetic program controlling neural
development
Several transcription factors are known to induce RET
expression, either directly or indirectly. These include Mash1
(Ascl1 – Mouse Genome Informatics), a mammalian homolog
of the Drosophila proneural gene Acheate-scute (Johnson et al.,
1990), and Phox2a (Arix – Mouse Genome Informatics) and
Phox2b (Pmx2b – Mouse Genome Informatics), two closely
related transcription factors characterized by their paired
homeodomain (Pattyn et al., 1997; Tiveron et al., 1996;
Valarche et al., 1993). Constitutive expression of Mash1 in
neural crest stem cells is sufficient to induce expression of
Phox2a, which in turn induces RET expression (Lo et al.,
1998). Consistent with this model of gene expression cascade,
Mash1 expression precedes RET in some sympathetic ganglia.
In addition, Mash1−/− mice have deficits in various peripheral
autonomic ganglia, which are accompanied by a loss of Phox2a
expression (Hirsch et al., 1998). It is noteworthy that, although
mice deficient in Mash1, Phox2a or Phox2b display loss of the
sphenopalatine and otic ganglia, these animals lose these
ganglia at different developmental stages. In Mash1−/− mice,
development of the sphenopalatine and otic ganglia proceeds
apparently normally up to E13.5. These ganglia, however, fail
to develop further and most neurons degenerate by E16.5
(Hirsch et al., 1998). In contrast, the sphenopalatine and otic
ganglia never develop in Phox2a−/− or Phox2b−/− mice (Morin
et al., 1997; Pattyn et al., 1999), similar to that observed in
RET−/−, GDNF−/− or GFRα1−/− mice. Importantly, in
Phox2b−/− mice, loss of RET expression and attenuation of
Mash1 expression was observed in the autonomic nervous
system, revealing the crucial role of Phox2b in induction of
4888 H. Enomoto and others
RET and maintenance of Mash1 expression (Pattyn et al.,
1999).
Our present data demonstrate that RET activation is required
earlier than Mash1 exerts its effects, at least in these ganglia.
This places RET, which was previously regarded as a
downstream effector of Mash1 (Lo et al., 1998), upstream to
or independent of Mash1 in controlling parasympathetic neural
development. Presumably, Phox2b, whose expression is
independent of Mash1, initially upregulates RET expression,
either directly or indirectly, to allow neuronal precursors to
respond to GDNF. Our present study provides an example of
how the hierarchy of genes controlling neuronal development
is not uniform among subdivisions of the autonomic nervous
system.
Common developmental mechanisms exist between
parasympathetic and enteric nervous systems
A number of biological characteristics are shared between the
enteric and parasympathetic nervous systems. For instance,
both arise from the neural crest; significant numbers of neurons
in both systems are cholinergic; and a subpopulation of both
neurons exhibits transiently catecholaminergic properties
during development (Blaugrund et al., 1996; Landis et al.,
1987; Leblanc and Landis, 1989; LeDouarin, 1986).
Interestingly, it has recently been shown that enteric neural
precursors (ENS) of rodents, when grafted into chicken
embryos, have the capacity to become parasympathetic, but not
sympathetic or sensory neurons (White and Anderson, 1999).
Besides these characteristics, our current study has revealed
additional common features. First, proper development of both
systems requires both GDNF and NRTN (Heuckeroth et al.,
1999; Moore et al., 1996; Pichel et al., 1996; Sanchez et al.,
1996). Second, GDNF is essential early in development for the
formation of each nervous system, whereas NRTN becomes
important later in development for the proper function and
maintenance of postmitotic neurons. In both the
parasympathetic and enteric nervous systems, this shift of GFL
dependency appears to be regulated at least in part by the
expression of GDNF, NRTN and GFRαs. Expression of GDNF
becomes detectable in the primitive gut as early as E9.0,
whereas expression of NRTN is increased in late
embryogenesis and persists into the postnatal period, a period
when GDNF expression becomes almost undetectable
(Naveilhan et al., 1998; Rossi et al., 1999). Another similarity
between parasympathetic and enteric neurons is the change in
GFRα expression, with GFRα1 expression early in
development, and GFRα2 expression increasing postnatally
(Golden et al., 1999; Rossi et al., 1999). It is also worth noting
that there is an overlap between populations of developing
enteric neurons affected by RET and Mash1 mutations. These
neurons are enteric serotonergic neurons that originate from
early migrating, transiently catecholaminergic neural
progenitors. Since expression of RET precedes that of Mash1
during development of the enteric nervous system (Lo et al.,
1994), it is likely that, similar to that observed in cranial
parasympathetic neurons, GDNF signaling via RET/GFRα1
might be required earlier than Mash1 in this specific enteric
population. The remarkable conservation of ligand dependency
in inducing survival, proliferation and differentiation of
neurons and neuronal precursors in both the parasympathetic
and enteric nervous systems implies the existence of a
common genetic program that regulates expression of RET and
GFRαs.
In summary, we have described the crucial importance of
GDNF and NRTN in controlling development of cranial
parasympathetic ganglia including the sphenopalatine, otic and
the submandibular ganglia. The establishment of GFLs as a
family of neurotrophic factors that support the development
and maintenance of parasympathetic neurons suggests that
they may be useful for treatment of autonomic nervous system
disorders.
We thank Dr F. Costantini for the RET-deficient mice and Dr JeanFrançois Brunet for providing anti-Phox2 antibodies. We also thank
K. Roth, Y. Honma, G. Garvrilina, T. Gorodinski and C. Bollinger for
expert technical assistance. We are grateful to R. Baloh and T. Araki
for helpful comments. This work was supported by National Institutes
of Health Grants R01 AG13729, R01 AG13730, KO8 HD 01166-01
and R01 01DK57038-01, Genentech and Uehara Memorial
Foundation.
REFERENCES
Abercrombie. (1946). Estimation of nuclear population from microtome
sections. Anat. Res. 94, 239-247.
Airaksinen, M. S., Titievsky, A. and Saarma, M. (1999). GDNF family
neurotrophic factor signaling: four masters, one servant? Mol. Cell.
Neurosci. 13, 313-325.
Baker, J., Liu, J. P., Robertson, E. J. and Efstratiadis, A. (1993). Role of
insulin-like growth factors in embryonic and postnatal growth. Cell 75, 7382.
Baloh, R. H., Tansey, M. G., Lampe, P. A., Fahrner, T. J., Enomoto, H.,
Simburger, K., Leitner, M. L., Araki, T., Johnson, E. M. J. and
Milbrandt, J. (1998). Artemin, a novel member of the GDNF ligand family
supports peripheral and central neurons and signals through the GFRα3RET receptor complex. Neuron 21, 1291-1302.
Barbin, G., Manthorpe, M. and Varon, S. (1984). Purification of chick eye
ciliary neurotrophic factor. J. Neurochem. 43, 1468-1478.
Blaugrund, E., Pham, T. D., Tennyson, V. M., Lo, L., Sommer, L.,
Anderson, D. J. and Gershon, M. D. (1996). Distinct subpopulations of
enteric neuronal progenitors defined by time of development,
sympathoadrenal lineage markers and Mash-1-dependence. Development
122, 309-320.
Braissant, O. and Wahli, W. (1998). A simplified in situ hybridization
protocol using non-radioactively labeled probes to detect abundant and rare
mRNAs on tissue sections. Biochemica 1, 10-16.
Buj-Bello, A., Buchman, V. L., Horton, A., Rosenthal, A. and Davies, A.
M. (1995). GDNF is an age-specific survival factor for sensory and
autonomic neurons. Neuron 15, 821-828.
Cacalano, G., Farinas, I., Wang, L.-C., Hagler, K., Forgie, A., Moore, M.,
Armanini, M., Phillips, H., Ryan, A. M., Reichardt, L. F. et al. (1998).
GFRα1 is an essential receptor component for GDNF in the developing
nervous system and kidney. Neuron 21, 53-62.
Crouch, M. F. and Hendry, I. A. (1991). Co-activation of insulin-like growth
factor-I receptors and protein kinase C results in parasympathetic neuronal
survival. J. Neurosci. Res. 28, 115-20.
D’Amico-Martel, A. and Noden, D. M. (1983). Contributions of placodal and
neural crest cells to avian cranial peripheral ganglia. Am. J. Anat. 166, 44568.
Enomoto, H., Araki, T., Jackman, A., Heuckeroth, R. O., Snider, W. D.,
Johnson, E. M., Jr. and Milbrandt, J. (1998). GFR α1-deficient mice have
deficits in the enteric nervous system and kidneys. Neuron 21, 317-324.
Farinas, I., Wilkinson, G., Backus, C., Reichardt, L. and Patapoutian, A.
(1998). Characterization of neurotrophin and Trk receptor functions in
developing sensory ganglia: direct NT-3 activation of TrkB neurons in vivo.
Neuron 21, 325-34.
Farinas, I., Yoshida, C. K., Backus, C. and Reichardt, L. F. (1996). Lack
of neurotrophin-3 results in death of spinal sensory neurons and premature
differentiation of their precursors. Neuron 17, 1065-1078.
Golden, J. P., DeMaro, J. A., Osborne, P. A., Milbrandt, J. and Johnson,
GDNF is a parasympathetic neurotrophic factor 4889
E. M., Jr (1999). Expression of neurturin, GDNF, and GDNF familyreceptor mRNA in the developing and mature mouse. Exp. Neurol. 158, 504528.
Henderson, C. E., Phillips, H. S., Pollock, R. A., Davies, A. M., Lemeulle,
C., Armanini, M., Simpson, L. C., Moffet, B., Vandlen, R. A., Koliatsos,
V. E. and Rosenthal, A. (1994). GDNF: a potent survival factor for
motoneurons present in peripheral nerve and muscle. Science 266, 1062-1064.
Heuckeroth, R. O., Enomoto, H., Grider, J. R., Golden, J. P., Hanke, J. A.,
Jackman, A., Molliver, D. C., Bardgett, M. E., Snider, W. D. et al. (1999).
Gene targeting reveals a critical role for neurturin in the development and
maintenance of enteric, sensory, and parasympathetic neurons. Neuron 22,
253-263.
Heuckeroth, R. O., Lampe, P. A., Johnson, E. M. and Milbrandt, J. (1998).
Neurturin and GDNF promote proliferation and survival of enteric neuron
and glial progenitors in vitro. Dev. Biol. 200, 116-129.
Hirsch, M. R., Tiveron, M. C., Guillemot, F., Brunet, J. F. and Goridis, C.
(1998). Control of noradrenergic differentiation and Phox2a expression by
MASH1 in the central and peripheral nervous system. Development 125,
599-608.
Huang, E. J., Wilkinson, G. A., Farinas, I., Backus, C., Zang, K., Wong,
S. L. and Reichardt, L. F. (1999). Expression of Trk receptors in the
developing mouse trigeminal ganglion: in vivo evidence for NT-3 activation
of TrkA and TrkB in addition to TrkC. Development 126, 2191-203.
Johnson, J. E., Birren, S. J. and Anderson, D. J. (1990). Two rat homologues
of Drosophila achaete-schute specifically expressed in neuronal precursors.
Nature 346, 858-861.
Kotzbauer, P. T., Lampe, P. A., Heuckeroth, R. O., Golden, J. P., Creedon,
D. J., Johnson, E. M. and Milbrandt, J. D. (1996). Neurturin, a relative
of glial-cell-line-derived neurotrophic factor. Nature 384, 467-470.
Landis, S. C., Jackson, P. C., Fredieu, J. R. and Thibault, J. (1987).
Catecholaminergic properties of cholinergic neurons and synapses in adult
rat ciliary ganglion. J. Neurosci. 7, 3574-3587.
Landmesser, L. and Pilar, G. (1974). Synaptic transmission and cell death
during normal ganglionic development. J. Physiol. 241, 737-749.
Laurikainen, A., Hiltunen, J. O., Thomas-Crusells, J., Vanhatalo, S.,
Arumae, U., Airaksinen, M. S., Klinge, E. and Saarma, M. (2000).
Neurturin is a neurotrophic factor for penile parasympathetic neurons in
adult rat. J. Neurobiol. 43, 198-205.
Leblanc, G. G. and Landis, S. C. (1989). Differentiation of noradrenergic
traits in the principal neurons and small intensely fluorescent cells of the
parasympathetic sphenopalatine ganglion of the rat. Dev. Biol. 131, 44-59.
LeDouarin, N. M. (1986). Cell line segregation during peripheral nervous
system ontogeny. Science 231, 1515-1522.
Lin, L.-F. H., Doherty, D. H., Lile, J. D., Bektesh, S. and Collins, F. (1993).
GDNF: A glial cell line-derived neurotrophic factor for midbrain
dopaminergic neurons. Science 260, 1130-1132.
Liu, J. P., Baker, J., Perkins, A. S., Robertson, E. J. and Efstratiadis, A.
(1993). Mice carrying null mutations of the genes encoding insulin-like
growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75, 59-72.
Lo, L., Guillemot, F., Joyner, A. L. and Anderson, D. J. (1994). MASH-1:
a marker and a mutation for mammalian neural crest development. Perspect.
Dev. Neurobiol. 2, 191-201.
Lo, L., Tiveron, M. C. and Anderson, D. J. (1998). MASH1 activates
expression of the paired homeodomain transcription factor Phox2a, and
couples pan-neuronal and subtype-specific components of autonomic
neuronal identity. Development 125, 609-620.
Ma, Q., Fode, C., Guillemot, F. and Anderson, D. J. (1999). Neurogenin1
and neurogenin2 control two distinct waves of neurogenesis in developing
dorsal root ganglia. Genes Dev. 13, 1717-1728.
Masu, Y., Wolf, E., Holtmann, B., Sendtner, M., Brem, G. and Thoenen,
H. (1993). Disruption of the CNTF gene results in motor neuron degeration.
Nature 365, 27-32.
Milbrandt, J., de Sauvage, F. J., Fahrner, T. J., Baloh, R. H., Leitner, M.
L., Tansey, M. G., Lampe, P. A., Heuckeroth, R. O., Kotzbauer, P. T. et
al. (1998). Persephin, a novel neurotrophic factor related to GDNF and
neurturin. Neuron 20, 245-53.
Mombaerts, P., Wang, F., Dulac, C., Chao, S. K., Nemes, A., Mendelsohn,
M., Edmondson, J. and Axel, R. (1996). Visualizing an olfactory sensory
map. Cell 87, 675-686.
Moore, M. W., Klein, R. D., Farinas, I., Sauer, H., Armanini, M., Phillips,
H., Reichart, L. F., Ryan, A. M., Carver-Moore, K. and Rosenthal, A.
(1996). Renal and neuronal abnormalities in mice lacking GDNF. Nature
382, 76-79.
Morin, X., Cremer, H., Hirsch, M. R., Kapur, R. P., Goridis, C. and
Brunet, J. F. (1997). Defects in sensory and autonomic ganglia and absence
of locus coeruleus in mice deficient for the homeobox gene Phox2a. Neuron
18, 411-23.
Naveilhan, P., Baudet, C., Mikaels, A., Shen, L., Westphal, H. and Ernfors,
P. (1998). Expression and regulation of GFRalpha3, a glial cell line-derived
neurotrophic factor family receptor. Proc. Natl. Acad. Sci. USA 95, 12951300.
Nishino, J., Mochida, K., Ohfuji, Y., Shimazaki, T., Meno, C., Ohishi, S.,
Matsuda, Y., Fujii, H., Saijoh, Y. and Hamada, H. (1999). GFR alpha3,
a component of the artemin receptor, is required for migration and survival
of the superior cervical ganglion. Neuron 23, 725-736.
Ortega, S., Ittmann, M., Tsang, S. H., Ehrlich, M. and Basilico, C. (1998).
Neuronal defects and delayed wound healing in mice lacking fibroblast
growth factor 2. Proc. Natl. Acad. Sci. USA 95, 5672-5677.
Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J. F. (1997).
Expression and interactions of the two closely related homeobox genes
Phox2a and Phox2b during neurogenesis. Development 124, 4065-4075.
Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J. F. (1999).
The homeobox gene Phox2b is essential for the development of autonomic
neural crest derivatives. Nature 399, 366-370.
Pichel, J. G., Shen, L., Hui, S. Z., Granholm, A.-C., Drago, J., Grinberg,
A., Lee, E. J., Huang, S. P., Saarma, M., Hoffer, B. J., Sariola, H. and
Westphal, H. (1996). Defects in enteric innervation and kidney
development in mice lacking GDNF. Nature 382, 73-76.
Rosenthal, A. (1999). The GDNF protein family: gene ablation studies reveal
what they really do and how. Neuron 22, 201-203.
Rossi, J., Luukko, K., Poteryaev, D., Laurikainen, A., Sun, Y. F., Laakso,
T., Eerikainen, S., Tuominen, R., Lakso, M. et al. (1999). Retarded growth
and deficits in the enteric and parasympathetic nervous system in mice
lacking GFR alpha2, a functional neurturin receptor. Neuron 22, 243-252.
Sanchez, M. P., Silos-Santiago, I., Frisen, J., He, B., Lira, S. A. and
Barbacid, M. (1996). Renal agenesis and the absence of enteric neurons in
mice lacking GDNF. Nature 382, 70-73.
Schmidt, M. F. and Kater, S. B. (1995). Depolarization and laminin
independently enable bFGF to promote neuronal survival through different
second messenger pathways. Dev. Biol. 168, 235-246.
Schuchardt, A., D’Agati, V., Larsson-Blomberg, L., Costantini, F. and
Pachnis, V. (1994). Defects in the kidney and enteric nervous system of
mice lacking the tyrosine kinase receptor Ret. Nature 367, 380-383.
Stein, R., Mori, N., Matthews, K., Lo, L. C. and Anderson, D. J. (1988).
The NGF-inducible SCG10 mRNA encodes a novel membrane-bound
protein present in growth cones and abundant in developing neurons. Neuron
1, 463-476.
Tang, M. J., Worley, D., Sanicola, M. and Dressler, G. R. (1998). The RETglial cell-derived neurotrophic factor (GDNF) pathway stimulates migration
and chemoattraction of epithelial cells. J. Cell Biol. 142, 1337-1345.
Tiveron, M. C., Hirsch, M. R. and Brunet, J. F. (1996). The expression
pattern of the transcription factor Phox2 delineates synaptic pathways of the
autonomic nervous system. J. Neurosci. 16, 7649-7660.
Trupp, M., Ryden, M., Jornvall, H., Funakoshi, H., Timmusk, T., Arenas,
E. and Ibanez, C. F. (1995). Peripheral expression and biological activities
of GDNF, a new neurotrophic factor for avian and mammalian peripheral
neurons. J. Cell Biol. 130, 137-148.
Unsicker, K., Reichert-Preibsch, H., Schmidt, R., Pettman, B.,
Labourdette, G. and Sensenbrenner, M. (1987). Astroglial and fibroblast
growth factors have neurotrophic functions for cultured peripheral and
central nervous system neurons. Proc. Natl. Acad. Sci. USA 84, 5459-5463.
Valarche, I., Tissier-Seta, J. P., Hirsch, M. R., Martinez, S., Goridis, C.
and Brunet, J. F. (1993). The mouse homeodomain protein Phox2 regulates
Ncam promoter activity in concert with Cux/CDP and is a putative
determinant of neurotransmitter phenotype. Development 119, 881-896.
White, P. M. and Anderson, D. J. (1999). In vivo transplantation of
mammalian neural crest cells into chick hosts reveals a new autonomic
sublineage restriction. Development 126, 4351-4363.