From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
IMMUNOBIOLOGY
HIV-specific effector cytotoxic T lymphocytes and HIV-producing cells colocalize
in white pulps and germinal centers from infected patients
Anne Hosmalin, Assia Samri, Marie-Jeanne Dumaurier, Yasmine Dudoit, Eric Oksenhendler, Marina Karmochkine, Brigitte Autran,
Simon Wain-Hobson, and Rémi Cheynier
Human immunodeficiency virus (HIV) infection is characterized by the massive
infiltration of secondary lymphoid organs
with activated CD8ⴙ T lymphocytes. While
converging data indicated that these cells
were HIV-specific cytotoxic T lymphocytes (CTLs) responsible for HIV spread
limitation, direct evidence was lacking.
Here, the presence of HIV-specific effector CTLs was demonstrated directly ex
vivo in 15 of 24 microdissected splenic
white pulps from an untreated patient and
in 1 of 24 tonsil germinal centers from a
second patient with incomplete viral sup-
pression following bitherapy. These patients had plasma HIV RNA loads of 5900
and 820 copies per milliliter. The frequencies of HIV-1 DNAⴙ cells in their lymphoid
organs were more than 1 in 50 and 1 in
175, respectively. Spliced viral messenger RNA (a marker for ongoing viral replication) was present in most immunocompetent structures tested. Conversely, CTL
activity was not found in spleens from 2
patients under highly active antiretroviral
therapy, with undetectable plasma viral
load. These patients had much lower
spleen DNAⴙ cell frequencies (1 in 2700
and 1 in 3800) and no white pulps containing spliced RNA. CTL effector activity as
well as spliced viral messenger RNA were
both concentrated in the white pulps and
germinal centers. This colocalization indicates that viral replication in immunocompetent structures of secondary lymphoid
organs triggers anti-HIV effector CTLs to
these particular locations, providing clues
to target therapeutic intervention. (Blood.
2001;97:2695-2701)
© 2001 by The American Society of Hematology
Introduction
During the chronic phase of infection, antigenic stimulation drives
human immunodeficiency virus (HIV) replication in vivo.1,2 Accordingly, HIV replication is mainly restricted to secondary lymphoid
organs, which are the major sites of primary and secondary immune
responses.3-11 Lymph nodes and tonsils have an organized structure
with primary follicles, germinal centers (or secondary follicles)
generated in response to antigens, surrounded by T-cell areas. The
spleen is the major secondary lymphoid organ for the defense
against bloodborne pathogens. It is divided into red pulp and white
pulps. The latter comprises periarteriolar lymphoid sheaths—made
of T lymphocytes and dendritic cells—and B-cell areas (primary
follicles and germinal centers) that contain B lymphocytes, follicular dendritic cells (FDCs), antigen-specific CD4⫹ T cells, and
dendritic cells. Among these, the CD4⫹ T-lymphocyte population
contains the majority of HIV-infected cells in the lymphoid
organ.12,13 Dendritic cells and macrophages are much less frequently infected,13 while FDCs are not productively infected by
HIV but retain large amounts of virions at their surface.5,7,14,15
Sequencing of HIV from individual white pulps suggested
bursts of local viral replication, but analysis of the viral quasi
species showed that viral replication was strongly restricted.16-19b
The best candidates to limit viral spread are the HIV–specific
CD8⫹ cytotoxic T lymphocytes (CTLs). Indeed, these cells are
found in large numbers in clinical samples from infected pa-
tients18,20 and inhibit HIV replication in vitro21 by different
mechanisms: direct lysis of infected cells or inhibition of viral
replication by interleukin or chemokine secretion.22 After peaking
at high levels during primary infection, the viral load decreases at a
time when CTL responses are high, while HIV-specific antibodies
are usually undetectable.23-26 The viral load then reaches a set point,
which is predictive of the clinical outcome.27 In this context, some
CTL responses were correlated with decreased viral loads and with
a better prognosis.27-30 More recently, CD8⫹ T-cell depletion in
simian immunodefiency virus (SIV)–infected macaques was shown
to lead to an immediate rise of the viral load, further confirming the
role of CD8⫹ T lymphocytes in limiting disease progression.31-33
At the site of HIV replication, ie, lymphoid organs, massive
infiltration of clonally expanded CD8⫹ T cells is observed.17,34,35
These lymphocytes contain TiA1⫹ granules, indicating their cytotoxic effector potential, and have a memory phenotype, especially
in the germinal centers.35 Individual white pulps from HIV patients
were found to have a discrete distribution of T-cell clones
characterized by their rearranged T-cell receptor ␤ chain.17 Some of
these sequences were found in most of the white pulps from a
patient as well as in HIV-specific CTL lines derived from bulk
spleen mononuclear cells (SMCs). This suggested indirectly the
infiltration of individual white pulps by HIV-specific CTLs. In the
present work, individual hyperplastic white pulps or germinal
From Unité INSERM 445, Institut Cochin de Génétique Moléculaire;
Laboratoire d’Immunologie Cellulaire et Tissulaire, Hôpital de la PitiéSalpêtrière; Unité de Rétrovirologie Moléculaire, Institut Pasteur; Service
d’Immuno-Hématologie, Hôpital St Louis; and Service d’Immunologie Clinique,
Hôpital Européen Georges Pompidou; all of Paris, France.
A.S. and M.-J.D. contributed equally to this work.
Submitted April 6, 2000; accepted December 10, 2000.
Supported by grants from the Institut Pasteur, the Agence Nationale de la
Recherche contre le SIDA (ANRS), and Sidaction/Ensemble contre le SIDA
(A.S.). M.J.D. was supported by an ANRS fellowship.
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
Reprints: Anne Hosmalin, Unité INSERM 445, Institut Cochin de Génétique
Moléculaire, Bâtiment Gustave Roussy, 27 rue du Faubourg St Jacques, 75014
Paris, France; e-mail: [email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2001 by The American Society of Hematology
2695
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2696
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
HOSMALIN et al
Table 1. Clinical data
Patient
R
K
Spleen, 03/97
Spleen, 12/97
Spleen, 02/98
Tonsil, 03/98
Age, sex, mo/y of diagnosis
37, male, 10/93*
35, male, 06/89
38, male, 06/86
30, male, 06/94
Plasma viral load (copies/mL)
5900
⬍50 (undetectable)
⬍500 (undetectable)
820
Blood CD4⫹ T lymphocytes per microliter
583
278
128
812
Clinical data (CDC stage)
ITP (B1)
ITP (B2)
Hodgkin’s disease (B3)
Tonsilitis (A2)
Treatment (mo/y of initiation)
None
d4T, 3TC, IDV (06/97)
d4T, 3TC, IDV (01/97)
AZT, ddI (11/95)
No. of white cells/white pulp or germinal center
1.8 ⫻ 106 ⫾ 1.0 ⫻ 106,
3.4 ⫻ 105 ⫾ 1.9 ⫻ 105,
8.1 ⫻ 104 ⫾ 5.8 ⫻ 104,
1.2 ⫻ 106 ⫾ 0.6 ⫻ 106,
Organ, mo/y of surgery
(mean ⫾ SD, range; n ⫽ 24)
HLA alleles†
B
0.4 ⫻ 106 ⫺ 4.1 ⫻ 106
C
1.2 ⫻ 105 ⫺ 8.3 ⫻ 105
2.0 ⫻ 104 ⫺ 21.3 ⫻ 104
0.2 ⫻ 106 ⫺ 2.3 ⫻ 106
A30(19) A33(19)
A1 A24
A1
A2 A3
B13 B 51(5) (autologous)
B35 B63
B8
B18 B62
ITP indicates idiopathic thrombocytopenic purpura; d4T, stavudine; 3TC, lamivudine; IDV, indinavir; AZT, zidovudine.
*Probable contamination in 1986.
†HLA alleles shared between patient and target cells are underlined.
centers from spleens or tonsils were microdissected, and their cells
assayed for CTL activity ex vivo just after surgery for therapeutic
purposes. Data provide direct evidence of HIV-specific CTL
activity in individual immunocompetent structures of secondary
lymphoid organs. In parallel, viral spliced messenger RNA (mRNA)
was polymerase chain reaction (PCR)–amplified to check whether
HIV-producing cells colocalized in these structures with antiHIV CTLs.
Materials and methods
Clinical specimens
Patients underwent surgery for the treatment of the clinical syndromes
indicated in Table 1, and their spleens and tonsils were used according to the
national ethical guidelines. Normal lymphoid organs were obtained from
organ transplant donors at the Pitié-Salpêtrière Hospital following national
ethical guidelines. Lymphoid organs were immediately cut into small pieces
and transported on ice in RPMI 1640 (Gibco, Cergy-Pontoise, France). On
the one hand, bulk mononuclear cells were obtained by mechanical and
mild enzymatic dissociation in phosphate-buffered saline (PBS) containing
20 U/mL collagenase VII (Sigma, St Quentin Fallavier, France) and 40
U/mL DNase I (Sigma) in 2% fetal calf serum for 30 minutes at room
temperature, addition of ethylenediaminetetraacetic acid to 10 mM and
agitation for 5 minutes, and then separation by centrifugation over
diatrizoate-Ficoll (Eurobio, Les Ulis, France) as described.13 On the other
hand, white pulps or germinal centers were dissected under a stereomicroscope (magnification 10 ⫻). Cell suspensions from these structures were
then made by incubation in PBS containing collagenase VII and deoxyribonuclease (DNase) for 1 hour at 37°C, followed by mechanical dissociation by repeated pipetting through 1 mL Eppendorf pipette tips. A few
days to several weeks before surgery, HLA typing was performed using
a standard complement microcytotoxicity assay (Dr I. Theodorou,
Laboratoire d’Immunologie cellulaire et tissulaire, Hôpital de la PitiéSalpêtrière, Paris, France).
Chromium release test
Cytotoxicity was assessed using a 4-hour chromium release assay.17 Target
cells were autologous or HLA-matched heterologous B-lymphoblastoid cell
lines. They were infected with a mixture of recombinant vaccinia viruses,
each at a multiplicity of infection of 5 plaque-forming units per cell,
expressing cytoplasmic glycoprotein160, reverse transcriptase (RT), or gag
of HIV-1 Lai (No. 3183, 4163, or 1144, respectively; Transgene, Strasbourg, France) for 18 hours before the assay. Control targets were infected
with wild-type Copenhagen vaccinia virus (15 plaque-forming units per
cell). Targets were then washed, incubated with 300 ␮Ci (11 000 MBq)
Na2 51CrO4 in 100 ␮L fetal calf serum (Amersham, Les Ulis, France) for 1
hour, and washed 3 times. Targets were added at 1000 cells per well to serial
dilutions of cells from the white pulps or germinal centers in triplicate.
Unlabeled targets infected with wild-type vaccinia virus were added to the
assays (10 000 cells per well) to decrease the background. In some
experiments, anticlass I major histocompatibility class (MHC) molecule
monoclonal antibody w6/32, kindly given by Dr Pierre Langlade, Institut
Pasteur, Paris, was added to the targets for 30 minutes before adding to the
effectors, and during the assay, at a final dilution of 1:50. After 4 hours
culture in 5% CO2 at 37°C, 50 ␮L of the supernatants was collected in
Lumaplate 96 solid scintillation plates (Beckman, Groningen, Netherlands),
and 10 ␮L of chlorine diluted 1:2 was added to inactivate the virus before
drying and counting on a Microbeta counter (Wallac, Turku, Finland). The
percent specific release was calculated as follows: 100 ⫻ (test cpm ⫺
minimal release)/(maximal release ⫺ minimal release). Maximal and
minimal chromium release were assessed in sextuplicate wells where
chlorine or culture medium were added to the targets, respectively. The
specific release of gag-pol-env–expressing targets was considered positive
when it was more than 10% above the release of control targets for at least 2
consecutive effector:target ratios and showed a positive correlation with the
effector:target ratio.
Flow cytometry
Flow cytometric analysis of surface markers was done on cell suspensions.
Immunostaining was performed using anti-CD3 (SK7) peridinin chlorophyll protein, anti-CD4 (SK3) fluorescein isothiocynate (FITC), anti-CD8
(Leu-2a) phycoerythrin (PE), anti-CD25 (2A3) FITC, anti-CD38 (HB7) PE,
anti–HLA-DR (L243) FITC (Becton Dickinson, Pont-de Claix, France),
anti-CD19 (J4119) PC5, anti-CD45RA (ALB11) FITC, anti-CD45RO
(UCHL1) FITC, and TiA1 (2G9) PE (Immunotech, Marseille, France),
according to the manufacturer’s instructions. For intracellular TiA1 staining, the cells were washed in PBS–bovine serum albumin 0.1% saponine
and incubated with TiA1 for 20 minutes. Flow cytometry was performed on
a FACSCalibur instrument and analyzed with the CellQuest software
(Becton Dickinson).
Nucleic acid analysis
Total RNA and DNA were extracted from individual white pulps or
germinal centers or cell pellets using Master Pure extraction kit (Epicentre,
Madison, WI). Briefly, 2 ␮g transfer RNA (Sigma) was added to each
sample as carrier, cells were lysed in the presence of proteinase K for 15
minutes, and the cell lysate was then split to purify either RNA or DNA
according to the manufacturer’s procedure. On each extract, several PCR
amplifications were performed to detect proviruses, full-length viral RNA,
and spliced RNA. To avoid contaminations, the reverse transcriptase (RT)
and PCR steps of the amplifications were performed in one tube. LV13
oligonucleotide was used as primer for complementary DNA synthesis.16
For unspliced RNA and DNA, LV13 and LV15 primers were used in the
first cycle while SK122/123 16 served as nested primers. Negative controls
without RT were performed. For spliced RNA amplification, LV15 primer
was replaced by LTR-SD: TCTCTCGACGCAGGACTCGGCTTG. Positive controls of DNA and RNA amplification were performed using the
following CD3 gene-specific primers: first cycle, for DNA, CD3A:
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
EFFECTOR CTLS COLOCALIZE WITH HIV REPLICATION
2697
Table 2. Phenotype of cells from the lymphoid organs of the patients (% positive cells)
Lymphoid organ
Patient B
Spleen
Patient C
Spleen
Patient R
Spleen
Patient mean, SD
Spleens
HIV-negative controls
Spleens
n⫽8
Patient K*
Tonsils
55
CD3⫹
68
49
82
66 ⫾ 14
36 ⫾ 18
CD19⫹
19
24
4
16 ⫾ 8
52 ⫾ 18
32
CD4⫹CD3⫹
19
16
13
16 ⫾ 2
14 ⫾ 8
27
CD8⫹CD3⫹
48
30
66
48 ⫾ 15
15 ⫾ 8
27
CD45RO⫹/CD8†
47
58
32
46 ⫾ 11
24 ⫾ 6
42
CD45RA⫹/CD8†
34
19
30
45
31 ⫾ 11
55 ⫾ 27
CD25⫹/CD8†
2
2
3
2⫾0
ND
2
CD38⫹/CD8†
34
27
63
41 ⫾ 16
28 ⫾ 14
44
HLA-DR⫹/CD8†
27
17
31
25 ⫾ 6
13 ⫾ 20
16
TiA1⫹/CD8†
33
14
42
30 ⫾ 12
76 ⫾ 23
20
*Data from the tonsils are given for information, but they were not compared with normal controls.
†CD45RO, CD45RA, CD25, CD38, HLA-DR, and TiA1 were analyzed on the CD8⫹ population.
GCCTGGCTGTCCTCATCCTGGCTATC and CD3B: TGGCCTATGCCCTTTTGGGCTGCATTC,1 for RNA, CD3OUT5: GACATGGAACAGGGGAAGGG and CD3OUT3: GAGAAAGCCAGATATGGTGG;
nested cycle, for both DNA and RNA, CD3IN5: CTTCTTCAAGGTACTTTGG and CD3IN3: ACTTCTGTAATACACTTGGAGTGG. The frequency
of HIV DNA-containing cells was determined by limiting-dilution nested
PCR as described,13,16 using noninfected B-lymphoblastoid cells as carriers.
Results
Phenotypic analysis of patient lymphoid organ bulk
cell populations
Spleens from 3 patients and tonsils from 1 patient who underwent
surgery for therapeutic reasons were collected (Table 1). The
different populations present in bulk mononuclear cells from these
lymphoid organs were analyzed by flow cytometry. Infiltration by
CD3⫹CD8⫹ cells was found in untreated (patient B) and treated
(patients C and R) HIV⫹ patient spleens, with a concomitant
decrease in the proportion of B lymphocytes compared with normal
organ donors (Table 2). In these 3 patients (Table 2), conversely to
others (data not shown), the proportion of CD4⫹ T lymphocytes
Figure 1. Detection of HIV-specific CTL effectors ex vivo from individual white
pulps from the spleen of patient B. Target cells were autologous B-lymphoblastoid
cells infected with either a mixture of recombinant vaccinia viruses expressing gag,
pol, or env (F) or wild-type vaccinia (E). Results from 11 representative white pulps of
the 24 tested and from bulk SMCs are shown.
was not decreased when compared with controls. Patient R had the
most important CD8⫹ T-cell infiltration, with signs of activation
(elevated CD38 expression) in a significant proportion of these
cells. However, in these bulk spleen cells, none of the patients had
an elevated proportion of CD25, the interleukin-2 receptor ␣ chain,
a T-cell activation marker, and the high proportion of cells bearing
TiA1, a marker of cytotoxic granules, was rather low compared
with that observed in normal spleens. In parallel, phenotypic
analysis was performed on a few microdissected splenic white
pulps from patient B. About 23% to 32% of the cells from these
white pulps were CD8⫹, most being CD45RO⫹, HLA-DR⫹ (data
not shown). Fluorescence-activated cell sorter analysis could not be
performed on microdissected structures from all of the patients, but
these data indicate that phenotypic analysis of total splenocytes
does not reflect the individual splenic white pulp populations.
Direct HIV-specific CTL effector activity in microdissected
white pulps or germinal centers
Hyperplastic white pulps or germinal centers were microdissected
from the spleen or the tonsil of the HIV⫹ patients. The cells were
extracted by mechanical disruption and collagenase-DNase treatment (as in “Materials and methods”). From these structures,
0.02 ⫻ 106 to 4.1 ⫻ 106 leukocytes were isolated (Table 1), which
was enough to perform cytotoxicity assays. Target cells consisted
of autologous or partly HLA-matched Epstein-Barr virus–
transformed B-cell lines, because HLA typing of the patients was
obtained before splenectomy. Due to the limited number of effector
cells, CTL activity was tested on targets infected with a mixture of
recombinant vaccinia viruses expressing gag, RT, or glycoprotein
160 genes of HIV-1 Lai. Control targets were infected with
wild-type vaccinia virus.
HIV-1–specific cytotoxic activity was detected ex vivo in most
splenic white pulps from patient B, who was not receiving
antiretroviral treatment and had a plasma viral load of 5900 copies
per milliliter (Figure 1 and Table 1). Fifteen of 24 white pulps
showed an HIV-specific cytotoxicity at more than one effector:
target ratio (white pulps 2, 3, 6, 9-13, 17-20, 22-24, Figure 1, Table
3, and not shown). Moreover, in some of these CTL-containing
white pulps (ie, white pulps 2, 12, 18, 19, 22), the chromium release
remained significantly positive (more than 10% of anti-HIV–
specific lysis) even at an effector:target ratio of 10:1 or less,
suggesting a high frequency of anti-HIV–specific CTLs in these
structures.
Twenty-four white pulps, microdissected from the spleen of
patients C and R, were tested for CTL activity. These patients were
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2698
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
HOSMALIN et al
Table 3. Viral particles, viral replication, and CTL activity in splenic white
pulps from patient B
White pulp
Table 4. Proviral DNA, viral RNA, and spliced viral mRNA in bulk cells and in
the white pulps and germinal centers
RNA
Spliced RNA
CTL
2
⫹
⫺
⫹
Frequency of DNA⫹ cells*
B
C
R
K
⬎1/50
1/2700
1/3800
1/175
3
⫹
⫺
⫹
Bulk cells†
4
⫹
⫹
⫺
6
⫹
⫺
⫹
DNA (env V1V2)
⫹
⫹
⫹
⫹
RNA (env V1V2)
⫹
⫹
⫹
8
⫹
⫺
⫹
⫺
Spliced RNA (env mRNA)
⫺
⫺
⫺
9
⫹
⫺
⫺
⫹
White pulps, germinal centers‡
10
11
⫹
⫹
⫹
DNA (env V1V2)
5/5
7/9
8/8
9/9
⫹
⫹
⫹
RNA (env V1V2)
5/5
0/4
2/5
2/2
12
⫹
⫹
⫹
Spliced RNA (env mRNA)
4/5
0/4
0/5
2/2
14
⫹
⫺
⫺
15
⫹
⫺
⫺
16
⫹
⫺
⫺
18
⫹
⫺
⫹
19
⫹
⫹
⫹
20
⫹
⫺
⫹
21
⫹
⫺
⫺
Bulk
⫹
⫺
⫺
efficiently treated with highly active antiretroviral therapy
(HAART), their plasma viral load being under the detection limit
(Table 1). No CTL activity was found directly ex vivo from these
structures (Figure 2). A direct CTL activity was also detected in one
tonsilar germinal center of 24 tested from patient K, who was
treated with zidovudine (AZT) and didanosine (ddI) only and
showed incomplete viral suppression and a plasma viral load of 820
copies per milliliter. In this particular germinal center (Figure 2), a
57% specific chromium release was obtained at an effector:target
ratio of 22:1 against the HIV expressing targets, while wild-type
infected targets were not recognized. MHC class I restriction could
be demonstrated by blocking the CTL activity with anticlass I
monoclonal antibodies (data not shown).
Notably, no CTL activity was detected in bulk spleen or tonsil
mononuclear cells in any of the patients (SMCs or TMCs, Figures 1
Figure 2. Chromium release assays from the lymphoid organs of patients C, R,
and K. Results from the bulk SMCs or TMCs and from one white pulp (WP) or
germinal center (GC) of the 24 tested for each patient are shown. Partially compatible
B-lymphoblastoid cell lines were infected with wild-type vaccinia (wt; E) or recombinant vaccinia viruses expressing gag, pol, and env (F) and used as targets. The HLA
molecules shared between patient and target cells are shown in Table 1.
Patient
*Limiting-dilution PCR on bulk SMCs or TMCs.
†Data are given as positive or negative PCR results from 2 ⫻ 105 cell extracts
(bulk cells).
‡Positive white pulps/total number of white pulps (or germinal centers) tested
(ND indicates not determined).
and 2). Therefore, the CTL activity found in some of the
immunocompetent structures was much higher than the global CTL
activity found in the lymphoid organs. These results point to a
concentration of anti-HIV–specific CTLs in many splenic white
pulps from the untreated patient and in one of the germinal centers
analyzed from the patient under AZT and ddI treatment, while in
the patients under efficient triple therapy no CTL activity was
detectable in the immunocompetent structures of the spleen.
Proviral DNA and HIV replication
HIV nucleic acids were detected in bulk mononuclear cells either
by limiting dilution or in fixed number cell extracts and were
detected in cells from individual white pulps or germinal centers.
PCR allows detection of HIV-1 proviral DNA, while RT-PCR
shows the presence of either unspliced RNA, which mostly
represents virions trapped on FDCs in the germinal centers, or
spliced RNA, which detects viral transcription.
HIV infiltration was analyzed by limiting-dilution PCR13,16 on
bulk lymphoid organ cells isolated from the 4 patients. As shown in
Table 4, the frequency of infected cells was 1 to 2 logs higher in the
2 patients with a detectable plasma viral load (patients B and K,
⬎ 1:50 and 1:175, respectively) than in the 2 others (patients C and
R, 1:2700 and 1:3800, respectively). When analyzed in extracts
from 2 ⫻ 105 splenic or tonsillar bulk mononuclear cells, proviral
DNA and viral RNA were found in the lymphoid organs from the 4
patients irrespective of their plasma viral load; conversely, spliced
RNA was not detected, indicating low levels of replication in all 4
patients (Table 4, bulk cells).
The presence of HIV RNA (spliced and unspliced) was
analyzed in the white pulps of patient B tested for anti-HIV CTL
activity (most of the cells were used for the CTL assay, and the
remaining cells, ie, 6% of each white pulp, were tested by PCR and
RT-PCR). Genomic (unspliced) RNA was detected in all 16
samples analyzed (Table 3). Moreover, 5 of the white pulps showed
evidence of ongoing viral replication, as determined by the
amplification of spliced viral mRNA (ie, white pulps 4, 10, 11, 12,
and 19). Of these 5 white pulps, 4 contained effector anti-HIV
CTLs (Table 3 and Figure 1).
Because the number of cells remaining for PCR after the CTL
assay was limited, HIV-DNA was amplified from 5, 9, and 8 total
white pulps from patients B, C, and R, respectively, as well as from
9 germinal centers from patient K’s tonsil (Table 4). All the samples
were positive except for 2 of 9 white pulps from patient C (Table 4),
confirming the presence of HIV-infected cells in most of the
immunocompetent structures of the secondary lymphoid organs.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
The same white pulps or germinal centers were also screened
for the presence of viral RNA and intracellular spliced mRNA.
HIV-1 RNA was found in 5 of 5 white pulps from patient B,
consistent with bulk cell data. Spliced RNA was found in 4 of 5
white pulps from this patient, in contrast to the negative result
obtained with bulk cells (Table 4). Similar results were obtained for
patient K (2 of 2 germinal centers contained both full-length and
spliced viral RNA). However, in treated patients, while all the
white pulps did contain HIV infected cells, no evidence of
sustained viral replication was observed (Table 4, 0 of 4 and 0 of 5
positive white pulps for spliced RNA).
These data show that the frequency of cells bearing HIV
proviral DNA was consistent with the level of plasma viremia.
Moreover, cells containing replicating virus (spliced RNA) were
found, as well as anti-HIV CTLs, concentrated in the white pulps or
germinal centers of patients with detectable viremia. Patients under
effective triple therapy showed neither CTL infiltration nor viral
replication within their white pulps, consistent with an efficient
control of viral replication.
Discussion
In this report, direct evidence of the HIV-specific lytic function of
the CD8⫹ lymphocytes infiltrating single white pulps or germinal
centers from infected patients is presented for the first time.
Moreover, these cells were shown to colocalize with productively
HIV-infected cells in the immunocompetent structures of secondary lymphoid organs. This had been suggested, but not demonstrated, by previous data using T-cell receptor sequence analysis in
splenic white pulps or in situ observation of CD8⫹CD45RO⫹TiA⫹
cells in lymph node germinal centers.17,35 HIV-specific memory
CTLs have been found in bulk spleen cells from infected patients,36
and SIV-specific memory CTLs have recently been observed in
lymph nodes from experimentally infected macaques.37 However,
their localization in the white pulps or germinal centers, where
most of the viral replication takes place,12,35 was not studied. In
another report, HIV epitope–specific CTLs expanded in vitro and
genetically modified were reinfused in patients and were shown to
migrate to the lymph nodes, adjacent to productively infected cells,
in the parafollicular regions.38 These regions are contained in the
immunocompetent structures that were microdissected in the
present work. Here, the CTL activity was concentrated in the white
pulps or germinal centers, because it was below detection levels in
bulk mononuclear cells isolated from the same lymphoid organs.
The presence of viral DNA or RNA was analyzed at the level of
individual white pulps or germinal centers. Proviral DNA was
detected in the tested white pulps from patients B and R, most of
those from patient C, and all germinal centers tested from patient
K, in accordance with previous results obtained in spleens or lymph
nodes.11,16,17,35 Unspliced RNA was found in all of the immunocompetent structures from the 2 patients with detectable plasma viral
loads, while it was rarely detected in the 2 other patients. Unspliced
RNA is a sign that the white pulps were, or had been, the sites of
viral replication. Indeed, most viral unspliced RNA represent viral
particles retained on the FDC surfaces.15 Viral particles in splenic
white pulps from patients B and K seemed more widespread than in
the lymph node germinal centers from asymptomatic patients
studied previously by in situ hybridization, who had detectable
virus in only 15% to 30% of their germinal centers.35 However, the
nested RT-PCR used here is much more sensitive than in situ
hybridization, because it can detect as little as one infected cell.
EFFECTOR CTLS COLOCALIZE WITH HIV REPLICATION
2699
While all the white pulps analyzed from patient B contained
viral particles (Table 3), only 15 of 24 displayed HIV-specific CTL
activity. The presence of HIV-producing cells was analyzed by
PCR amplifying spliced viral mRNA in some of the pulps. It was
detected in only 4 of 10 CTL⫹ white pulps. However, only a small
fraction (about 6%) of each white pulp was available for PCR
analysis after using cells for the CTL assay. Spliced RNA was thus
analyzed in 5 total white pulps from patient B. Viral replication was
detected in 4 of 5 white pulps, whereas it was undetectable in bulk
lymphoid organ cells, suggesting that most of the immunocompetent structures of this spleen are the site of active viral replication
despite the absence of detectable CTL activity in 9 of 24 pulps
tested. This discrepancy between the detection of viral replication
and CTL activity may have several explanations. First, the sensitivity of the chromium release assay is limited. Detection using
MHC-peptide tetramers is more sensitive and has allowed finding
SIV gag-specific CTLs in macaques and reinfused HIV-specific
clones in patient secondary lymphoid organs.37,38 However, in
natural HIV infection analyzed here, a dominant, highly represented CTL response directed against the single epitope presented
in the tetramers may not be present at the very time of splenectomy.
Lysis of target cells infected with 3 different recombinant viruses,
expressing 3 widely recognized proteins, is expected to be more
consistent. Moreover, T cells binding MHC-peptide tetramers can
be nonfunctional.39,40 Second, the epitopes presented by the targets
may be different from the variant epitopes presented by the cells of
the patient. This might formally also be a possibility for the absence
of effector CTL detection in the 2 HAART-treated patients, ie,
mutants induced by therapy; however, 3 different whole proteins
containing multiple epitopes were tested, and after stimulation in
culture anti-HIV memory CTLs were detectable on the same target
cells. Third, and more importantly, it is possible that some of the
white pulps analyzed here contained recently developed germinal
centers, where HIV replication, which mostly occurs in antigenstimulated T cells, was identified by RT-PCR but still too weak to
induce a CTL infiltration detectable using a chromium release
assay.1,41 Indeed, HIV enters the immunocompetent structures of
secondary lymphoid organs in the form of integrated proviral DNA
in CD4⫹ T lymphocytes. Antigen-specific stimulation of these
latently infected cells is necessary to initiate viral replication and
HIV protein production.1 This in turn induces HLA class
I–restricted HIV peptide presentation at the surface of infected
cells, a prerequisite to local CTL infiltration and stimulation.
Fourth, in immunocompetent structures analyzed totally for the
presence of nucleic acid, without diverting most of the cells for a
CTL assay, the presence of spliced RNA was consistent with the
plasma viral load, the frequency of DNA-positive cells in the bulk
cells, and the detection of CTLs directly ex vivo.
The detection of HIV-specific effector CTLs ex vivo in the
white pulps and germinal centers from 2 patients is consistent with
the detection of viral RNA in their plasma and with that of spliced
RNA (replicating virus) in most of the immunocompetent structures of their secondary lymphoid organs. These patients were not
treated by HAART at the time of surgery. Conversely, the 2 patients
who had no detectable CTLs in their lymphoid organs had
undetectable plasma viral loads as a result of HAART. Viral RNA
(ie, viral particles) and proviral DNA were still detectable in their
lymphoid organs, as reported for other patients42,43; however, if
viral RNA was present in bulk SMCs, no evidence of viral
replication was observed in the microdissected white pulps from
these patients. It has been shown that several months after plasma
viremia becomes undetectable under HAART, virions can still be
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2700
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
HOSMALIN et al
detected by in situ hybridization on lymph node FDCs.35,44 A better
correlation between plasma and lymphoid organ viral load is found
when plasma RNA detection thresholds are lower (⬍ 20 copies/
mL) than in the tests used here45 or when the frequency of infected
cells in the lymphoid organs is measured.46 Here, the frequencies of
HIV DNA⫹ cells in the lymphoid organs were 1 to 2 logs lower in
the patients treated with HAART than in the other patients with
detectable plasma viral loads. Therefore, HAART resulted in
undetectable plasma viremia, a decrease in lymphoid organ viral
load, and a disappearance of local cytotoxic activity. Similar
conclusions on the disappearance of CTL activity have been made
in peripheral blood.29,30,39,47-49 However, in lymph node germinal
centers and in tonsils, increased numbers of CD8⫹ T cells were still
found 3 months after viral replication was controlled in HIVinfected patients.35,50 Here CD8⫹ T cell infiltration was observed in
the lymphoid organs from the 4 patients, but the effector function
was no longer present when viral load, hence antigen production,
was reduced by HAART.
In peripheral blood, CTL activity disappears shortly after viral
load (ie, HIV antigens) is reduced to undetectable levels by
HAART30,39,47 and is absent in some long-term nonprogressors
harboring defective virus51: Chronic antigen stimulation is necessary for sustained effector CTL activity. This is probably also true
at the microanatomic level in the white pulps and germinal centers.
In contrast to the activity usually observed after in vitro culture,
the direct CTL activity in fresh individual white pulps or germinal
centers represents in vivo clonally expanded activated CTLs
responding to local HIV antigen production. Indeed, even if they
were not systematically found in the same white pulps, CTL
effectors and replicating virus were concentrated in these structures. Analysis of quasi species shows that HIV replicates locally in
individual white pulps, but this replication is strongly limited19b
(M. J. Dumaurier et al, unpublished data, June 2000). The data
presented here confirm the major role of HIV-specific CTL
effectors in this strong restriction of viral spread in vivo and can
provide clues to target therapeutic intervention.
Acknowledgments
We thank Pr Jean-Pierre Clauvel and Jean-Gérard Guiller for
support, Drs Valérie Pézo, Jean-François Desoutter, and Guislaine
Carcelain for help, Dr Marie Paule Kieny from Transgene for
vaccinia viruses, Dr Ioannis Theodorou and his team for HLA
typing, Dr Pierre Langlade for w6/32 antibody, Drs Mireille
Viguier and Marc Dalod for reading the manuscript, and Dr Rafick
P. Sekaly for helpful discussion.
References
1. Cheynier R, Gratton S, Halloran M, Stahmer I,
Letvin NL, Wain-Hobson S. Antigenic stimulation
by BCG vaccine as an in vivo driving force for SIV
replication and dissemination. Nat Med. 1998;4:
421-427.
2. Ostrowski M, Krakauer D, Li Y, et al. Effect of immune activation on the dynamics of human immunodeficiency virus replication and on the distribution of viral quasispecies. J Virol. 1998;72:
7772-7784.
3. Armstrong JA, Horne R. Follicular dendritic cells
and virus-like particles in AIDS-related lymphadenopathy. Lancet. 1984;ii:370-372.
4. Biberfeld P, Chayt KJ, Marselle LM, Biberfeld G,
Gallo RC, Harper ME. HTLV-III expression in infected lymph nodes and relevance to pathogenesis of lymphadenopathy. Am J Pathol. 1986;125:
436-442.
5. Embretson J, Zupancic M, Ribas JL, et al. Massive covert infection of helper T lymphocytes and
macrophages by HIV during the incubation period
of AIDS. Nature. 1993;362:359-362.
6. LeTourneau A, Audouin J, Diebold J, Marche C,
Tricottet V, Reynes M. LAV-like particles in lymph
node germinal centers in patients with the persistent lymphadenopathy syndrome and the acquired immunodeficiency syndrome-related complex: an ultrastructural study of 30 cases. Hum
Pathol. 1986;17:1047-1053.
7. Pantaleo G, Graziosi C, Demarest JF, et al. HIV
infection is active and progressive in lymphoid
tissue during the clinically latent stage of disease.
Nature. 1993;362:355-358.
8. Tenner-Racz K, Racz P, Dietrich M, Kern P. Altered follicular dendritic cells and virus-like particles in AIDS and AIDS-related lymphadenopathy. Lancet. 1985;i:105-106.
9. Prevot S, Fournier J, Tardivel I, Audouin J,
Diebold J. Detection by in situ hybridization of
HIV-1 RNA in spleens of HIV-1 seropositive patients with thrombocytopenic purpura. Pathol Res
Pract. 1989;185:187-193.
10. Emilie D, Peuchmaur M, Maillott M, et al. Production of interleukins in HIV-1-replicating lymph
nodes. J Clin Invest. 1990;86:148-159.
11. Fox CH, Tenner-Racz K, Racz P, Firpo A, Pizzo
PA, Fauci AS. Lymphoid germinal centers are
reservoirs of human immunodeficiency virus type
1 RNA. J Infect Dis. 1991;164:1051-1057.
12. Hufert F, van Lunzen J, Janossy G, et al. Germinal centre CD4⫹ T cells are an important site of
HIV replication in vivo. AIDS. 1997;11:849-857.
13. McIlroy D, Autran B, Cheynier R, et al. Dendritic
cell and CD4⫹ T lymphocyte infection frequency
in spleens of HIV-positive patients. J Virol. 1995;
69:4737-4745.
14. Spiegel H, Herbst H, Niedobitek G, Foss H-D,
Stein H. Follicular dendritic cells are a major reservoir for human immunodeficiency virus type 1 in
lymphoid tissues facilitating infection of CD4⫹
T-helper cells. Am J Pathol. 1992;140:15-22.
15. Schmitz J, van Lunzen J, Tenner-Racz K, et al.
Follicular dendritic cells retain HIV-1 particles on
their plasma membrane, but are not productively
infected in asymptomatic patients with follicular
hyperplasia. J Immunol. 1994;153:1352-1359.
16. Delassus S, Cheynier R, Wain-Hobson S. Nonhomogeneous distribution of human immunodeficiency virus type 1 proviruses in the spleen. J Virol. 1992;66:5642-5645.
17. Cheynier R, Henrichwark S, Hadida F, et al. HIV
and T-cell expansion in splenic white pulps is accompanied by infiltration of HIV-specific cytotoxic
T-lymphocytes. Cell. 1994;78:373-387.
18. Plata F, Autran B, Martins LP, et al. AIDS virusspecific cytotoxic T lymphocytes in lung disorders. Nature. 1987;328:348-351.
19a. Wong J, Ignacio C, Torriani F, Havlir D, Fitch N,
Richman D. In vivo compartmentalization of human immunodeficiency virus: evidence from the
examination of pol sequences from autopsy tissues. J Virol. 1997;71:2059-2071.
19b. Gratton S, Cheynier R, Dumaurier MJ, Oksenhendler E, Wain-Hobson S. Highly restricted
spread of HIV-1 and multiply infected cells within
splenic germinal centers. Proc Natl Acad Sci
U S A. 2000;97:14566-14571.
20. Letvin NL. Progress in the development of an
HIV-1 vaccine. Science. 1998;280:1875-1880.
21. Walker CM, Moody DJ, Stites DP, Levy JA. CD8⫹
lymphocytes can control HIV infection in vitro by
suppressing virus replication. Science. 1986;234:
1563-1566.
22. Yang O, Walker B. CD8⫹ cells in human immunodeficiency virus type I pathogenesis: cytolytic
and noncytolytic inhibition of viral replication. Adv
Immunol. 1997;66:273-311.
23. Koup RA, Safrit JT, Cao Y, et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J Virol. 1994;
68:4650-4655.
24. Borrow P, Lewicki H, Hahn B, Shaw G, Oldstone
M. Virus-specific CD8⫹ cytotoxic T-lymphocyte
activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. J Virol. 1994;68:6103-6110.
25. Pantaleo G, Demarest JF, Soudeyns H, et al. Major expansion of CD8⫹ T cells with a predominant
V␤ usage during the primary immune response to
HIV. Nature. 1994;370:463-467.
26. Kuroda M, Schmitz J, Charini W, et al. Emergence of CTL coincides with clearance of virus
during primary simian immunodeficiency virus
infection in rhesus monkeys. J Immunol. 1999;
162:5127-5133.
27. Mellors JW, Rinaldo CR Jr, Gupta P, White RM,
Todd JA, Kingsley LA. Prognosis in HIV-1 infection predicted by the quantity of virus in plasma.
Science. 1996;272:1167-1170.
28. Rinaldo C, Huang X, Fan Z, et al. High levels of
anti-human immunodeficiency virus type 1
(HIV-1) memory cytotoxic T-lymphocyte activity
and low viral load are associated with lack of disease in HIV-1-infected long-term nonprogressors.
J Virol. 1995;69:5838-5842.
29. Musey L, Hughes J, Schacker T, Shea T, Corey L,
McElrath J. Cytotoxic T cell responses, viral load
and disease progression in early HIV-1 infection.
N Engl J Med. 1997;337:1267-1274.
30. Ogg G, Jin X, Bonhoeffer S, et al. Quantitation of
HIV-1-specific cytotoxic T lymphocytes and
plasma load of viral RNA. Science. 1998;279:
2103-2106.
31. Schmitz JE, Kuroda MJ, Santra S, et al. Control
of viremia in simian immunodeficiency virus infection by CD8⫹ lymphocytes. Science. 1999;283:
857-860.
32. Jin X, Bauer D, Tuttleton S, et al. Dramatic rise in
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 1 MAY 2001 䡠 VOLUME 97, NUMBER 9
plasma viremia after CD8⫹ T cell depletion in
SIV-infected macaques. J Exp Med. 1999;189:
991-998.
33. Matano T, Shibata R, Siemon C, Connors M,
Lane H, Martin M. Administration of an anti-CD8
monoclonal antibody interferes with the clearance
of chimeric simian/human immunodeficiency virus during primary infections of rhesus macaques. J Virol. 1998;72:164-169.
34. Racz P, Tenner-Racz K, van Vloten F, et al. Lymphatic tissue changes in AIDS and other retrovirus infections: tools and insights. Lymphology.
1990;23:85-91.
35. Tenner-Racz K, Stellbrink HJ, van Lunzen J, et al.
The unenlarged lymph nodes of HIV-1 infected,
asymptomatic patients with high CD4 T cell
counts are sites for virus replication and CD4 T
cell proliferation: the impact of highly active antiretroviral therapy. J Exp Med. 1998;187:949-959.
EFFECTOR CTLS COLOCALIZE WITH HIV REPLICATION
39. Gray C, Lawrence J, Schapiro J, et al. Frequency
of class I HLA-restricted anti-HIV CD8⫹ T cells in
individuals receiving highly active antiretroviral
therapy (HAART). J Immunol. 1999;162:17801788.
40. Zajac A, Blattman J, Murali-Krishna K, et al. Viral
immune evasion due to persistence of activated T
cells without effector function. J Exp Med. 1998;
188:2205-2213.
41. Ehl S, Klenerman P, Aichele P, Hengartner H,
Zinkernagel R. A functional and kinetic comparison of antiviral effector and memory CTL populations in vivo and in vitro. Eur J Immunol. 1997;27:
3404-3413.
42. Wong J, Gunthard H, Havlir D, et al. Reduction of
HIV-1 in blood and lymph nodes following potent
antiretroviral therapy and the virologic correlates
of treatment failure. Proc Natl Acad Sci U S A.
1997;94:12574-12579.
36. Hadida F, Parrot A, Kieny M-P, et al. Carboxyterminal and central regions of human immunodeficiency virus-1 NEF recognized by cytotoxic T
lymphocytes from lymphoid organs. J Clin Invest.
1992;89:53-60.
43. Lafeuillade A, Chollet L, Hittinger G, Profizi N,
Costes O, Poggi C. Residual human immunodeficiency virus type 1 RNA in lymphoid tissue of patients with sustained plasma RNA of ⬍ 200 copies/mL. J Infect Dis. 1998;177:235-238.
37. Kuroda M, Schmitz J, Charini W, et al. Comparative analysis of cytotoxic T lymphocytes in lymph
nodes and peripheral blood of SIV-infected Rhesus monkeys. J Virol. 1999;73:1573-1579.
44. Zhang Z, Schuler T, Cavert W, et al. Reversibility of the pathological changes in the follicular
dendritic cell network with treatment of HIV infection. Proc Natl Acad Sci U S A. 1999;96:
5169-5172.
38. Brodie S, Lewinsohn D, Patterson B, et al. In vivo
migration and function of transferred HIV-1 specific cytotoxic T cells. Nat Med. 1999;5:34-41.
45. Perrin L, Yerly S, Marchal F, et al. Virus burden in
lymph nodes and blood of subjects with primary
2701
human immunodeficiency virus type 1 infection
on bitherapy. J Infect Dis. 1998;177:1497-1501.
46. Hockett R, Kilby J, Derdeyn C, et al. Constant
mean viral copy number per infected cell in tissues regardless of high, low, or undetectable
plasma HIV RNA. J Exp Med. 1999;189:15451554.
47. Dalod M, Harzic M, Pellegrin I, et al. Evolution of
CTL responses to HIV type 1 in patients with
symptomatic primary infection receiving antiretroviral triple therapy. J Infect Dis. 1998;178:61-69.
48. Carcelain G, Blanc C, Leibowitch J, et al. T cell
changes after combined nucleoside analogue
therapy in HIV primary infection. AIDS. 1999;13:
1077-1081.
49. Kalams S, Goulder P, Shea A, et al. Levels of
HIV-1-specific cytotoxic T-lymphocyte effector
and memory responses decline after suppression
of viremia wih highly active antiretroviral therapy.
J Virol. 1999;73:6721-6728.
50. Dyrhol-Riise A, Voltersvik P, Olofson J, Asjö B.
Activation of CD8 T cells normalizes and correlates with the level of provirus in tonsils during
highly active antiretroviral therapy in early HIV-1
infection. AIDS. 1999;13:2365-2376.
51. Binley J, Jin X, Huang Y, et al. Persistent antibody
responses but declining CTL responses to multiple HIV type 1 antigens in a long term non progressing individual with a defective p17 proviral
sequence and no detectable viral RNA expression. J Virol. 1998;72:3472-3474.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2001 97: 2695-2701
doi:10.1182/blood.V97.9.2695
HIV-specific effector cytotoxic T lymphocytes and HIV-producing cells
colocalize in white pulps and germinal centers from infected patients
Anne Hosmalin, Assia Samri, Marie-Jeanne Dumaurier, Yasmine Dudoit, Eric Oksenhendler, Marina
Karmochkine, Brigitte Autran, Simon Wain-Hobson and Rémi Cheynier
Updated information and services can be found at:
http://www.bloodjournal.org/content/97/9/2695.full.html
Articles on similar topics can be found in the following Blood collections
Immunobiology (5489 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.