From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
RAPID COMMUNICATION
Metabolic Persistence of Fetal Hemoglobin
By J a n e A. Little, Nancy J. Dempsey, Mendel Tuchman, and Gordon D. Ginder
Hereditary persistence of fetal hemoglobin (HPFH) has typically been ascribed to mutations in the p-globin
gene cluster.
Pharmacologic agents, including the short-chain fatty acid
butyrate, have been shown to upregulate fetal and embryonic globin gene expression. In this report we investigate
the possibility that metabolic derangements characterized
by an inability to metabolize another short-chain fatty acid,
propionate, could be associated with a persistence of fetal
hemoglobin unrelated to alterations in theP-globin cluster.
Embryonic globin gene upregulation in a murine adult erythroid cell culture was shown by RNase protection after induction with three short-chain fatty acids (C2-C5).Chart reviews and measurement of fetal hemoglobin in five patients
with abnormalities in propionate (C,) metabolism were un-
dertaken; SSCP/dideoxy fingerprint analysis of the y-globin
gene promoters was done in three of these five patients.
Twelve patients with other metabolic derangements served
as controls. Only the four patients with clinically severe abnormalities in propionate metabolism (ages 2 to 11). but
without anemia, showed a sustained elevation in fetal hemoglobin (3% to 10%). The level of elevation of fetal hemoglobin in these patients, who lack erythropoietic stress, suggests that propionic acid and/or its metabolites are potent
stimulators of fetal hemoglobin expression. Study of this
group of patients should allow unique insights into thelongterm effects of sustained exposure to elevations of shortchain fatty acid levels.
0 1995 by The American Societyof Hematology.
H
with abnormalities inamino acid metabolism(predominantly
branched-chain amino acids),ie, propionyl-CoA carboxylase
deficiency and methylmalonyl-CoA mutase deficiency, in
whichabnormalitiesofpropionic
acid metabolism persist
throughout life. Fetal Hb levels were elevated in four of five
children with these abnormalities; the single exception was
a child with a mildB- 12 responsive variant ofmethylmalonic
acidemia. This persistence of fetal Hb wasnotassociated
with an antecedent diagnosis in any child of significant hematologic abnormality, except for intermittent neutropenia
in one child, nor with any evidence for structural abnormalities in the P-globin genecluster. These results extend earlier
observations on the persistence of fetal Hb expression due
to abnormalities outside of theP-globingene
cluster,ie,
infants of diabetic mothers2* and HPFH linkage apart from
chromosome 1 1,'9-3' and are the first report of a sustained
elevationoffetal
Hb beyondinfancyassociatedwith
an
excess of amino acid andfatty acid intermediary metabolites.
EREDITARYPERSISTENCE
offetalhemoglobin
(Hb) hasbeen described inpatientswith&globin
disorders either as a result of point mutations proximate to
the y-globin genes,"4 or concomitant to more distant deletionsin theP-globingene
locus.5-8An elevatedfetal Hb
beyond infancy has been noted to be clinically ameliorating
for patientswith sicklecellanemiaorP-thalassemia,y"2
which has led to attempts at pharmacologic upregulation of
fetal Hb using hypomethylating and/or S-phase active agents
(5-azacytidine and hydroxyurea),""' butyric acid analogs,"
and acylating agents (phenylacetate andphenylbutyrate)."
Many of these compounds, including 5-a~acytidine,'~~''
hydroxyurea,"
and
were
acylating
first
identified in cell culture or animal models.
The reported activity of both acylating agents and butyrate
analogs in vivoand in vitroledus
to speculate that an
excessive accumulation or alteration in products of fatty acid
metabolism could result in elevated levelsof fetal Hb postnatally. In vitro detection of embryonic globin gene expression
in a murine erythroleukemia (MEL) cell line that normally
expresses only adult P-type globin genes, aftertreatment
with short-chain fatty acids (C2-C6), confirmed the activity
in vitro of propionate, butyrate, and pentanoate in reversing
developmental suppressionof embryonic globin geneexpression." Hereweextend thoseobservations to children
From the Division qf Medical Oncology, the Department qf Medicine, the Division of Genetics and Metabolism, the Department of
Pediatrics and the Department of Laboratory Medicine and Pathology; and the Institute of Human Genetics, University qf Minnesota,
Minneapolis.
Submitted November 14, 1994; accepted Januasy 23, 1995.
Supported by National Institutes of Health Grant No. DK 29902
(G.D.G.) and an award from the Cooley's Foundation (J.A.L.).
Address reprint requests to Gordon D. Ginder, MD, Professor of
Medicine and the Institute of Human Genetics, School of Medicine,
Box 286 UMHC,424 Hasvard St, SE, University of Minnesotu,
Minneapolis, MN 55455.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordunce with I8 U.S.C. section 1734 solely to
indicate this fuct.
8 1995 by The American Sociey of Hematology.
0006-497//95/K507-0040$3.00/0
1712
MATERIALS AND METHODS
In vitro culture assay. Adult phenotype MEL cells were maintained in RPMI, 10%fetal calf serum, ampicillin, and streptomycin.
Cells were inducedfor 5 days with2.0% dimethylsulfoxide (DMSO),
I mmol/L Na butyrate, or various concentrations of propionic acid.
RNAwasprecipitatedandquantitatedafter
cell lysisandRNA
extraction.RNase protection assayswereperformedasdescribed
previously.'2 using 20 yg of MEL cell RNA hybridized to uniformly
"P-labeled RNA probes. These probes were complementary to embryonicmurineP-globin(epsilonY, 6 ' ) and to aconstitutivelyexpressed murine glycolytic enzyme (triose phosphoisomerase, TPI)
that served as an internal control.
Putient unalyses. Subjects of interest were identified from a roster of patients being followedin the Metabolism Clinic at the University of Minnesota. Permission was obtained from
the Institutional
Review Board at the University of Minnesota to analyze residual
anticoagulated blood samples that remained after clinically indicated
lab tests.
Chart reviews were undertaken of all patients whose blood was
analyzed as part of this study. Note was made
of hematologic paramof the HbF assay, and the patient's clinical condition
eters at the time
during these routine clinic visits. Clinical outlines are presented in
Table I .
Hb F assay. Red blood cells (RBC) lysates were prepared from
50 yL of anticoagulated whole blood that had been treated with
potassium cyanide. Aliquots were electrophoresed through an amBlood, Vol 85, No 7 (April l ) , 1995: pp 1712-1718
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
SISTENCE
METABOLIC
Table 1. Clinical Summary
Patient ID
A.L.*
K.F.*
Age (yrs) (1994)
Diagnoses
Hb F (%)
3
Propionic acidemia
Seizures, controlled
Developmental delay, mild, stable to improved
8
3/93
4
5/94
Propionic acidemia
Precocious puberty (status post pulsatile
GnRH therapy)
Developmental delay, mild, stable
Status postgastrostomy
5
2/93
3
10
7/93
11
Date
2/94
MS.*
I.M.
M.D.
M.G.§
10
T.C.9
OTC
J.C.9
5
2
4
23
12
Propionic acidemia
Seizures, controlled
Developmental delay, mild, stable
Intermittent neutropenia
Relapsing metabolic decompensation
Methylmalonic acidemia
Methylmalonic acidemia (mild)
Homocystinuria
Blindness
Seizures
Developmental delay
Thrombocytosidintermittent neutropenia
Citrullinemia
Intermittent neutropenia
Ornithine transcarbamylase (OTC) deficiency
deficiency
4,2OO/pL
12
1/93
9
3/93
8
4/94t
6
<l
3/93
2/93
<l
3,2OO/pL
WBC 2/93
Hospitalized at
analysis with
hyperammonemia
<l
WBC
<l
1/93
1/93
Complete Blood
WBC 7,3OO/pL
Hb 13.1 g/dL
WBC 4,9OO/pL
Hb 12.9 g/dL
Plt 265,OOO/pL
WBC 4,100 JL
Hb 12.6 g/dL
Plt 336,OOO/pL
WBC 5,2OO/pL
Hb 12.2 g/dL
Plt 186,OOO/pL
WBC 4,1OO/pL
Hb 11.9 g/dL
WBC 4,700 (1,100 PMNs)
Hb 9.8 g d/L
Plts ”normal”
WBC 6,3OO/pL
Hb 11.1 g/dL
Plts “normal”
WBC 7,OOO/pL
Hb 11.6 g/dL
Plts 235,OOO/pL
Hb 12.3 g/dL
WBC4,9OO/pL
Hb 11.4 g/dL
Hb 11.7 g/dL
Plt 226,00O/pL
Hb 14.4 g/dL
Hb 12.6 g/dL
Plt 192,OOO/pL
45
B.B.5
4.5
Hyperammonemia, hyperornithinemia. 4,9OO/pL
homocitrullinuria (”HHH”) syndrome
S.C.
D.R.
A.R.
7
WBC
4/94$
13.6
Medium chain acyl-CoA dehydrogenase (MCAD)
deficiency
12.9
1 6,7OO/pL
1 WBC 1/93
MCAD
WBC
<l
1/93
WBC
<l
1/93
MCAD
7,1OO/fiL
Hb
g/dL
Plt 264,OOO/pL
Hb
g/dL
Plt 533,OOO/pL
5,20O/~L
Hb 13.2 g/dL
Plt 404,00O/pL
Hb 11.8 g/dL
Plt 422,00O/pL
All samples were obtained, except as noted, during clinic visits while patients were metabolically stable. No patients had signs/symptoms or
family historysuggestive for aconcomitant hemoglobinopathy. All patients were supplemented with multivitamins, minerals, and trace elements.
* Neither SSCP nor sequence analysis indicated known HPFH point mutations.
t Nierhaus-Betke stain: 8% to 10% cells with Hb F.
Nierhaus-Betke stain negative.
§ On acylator agents.
pholyte-imbedded polyacrylamide gel; densitometric Hb quantitations were made after Coomassie Brilliant Blue staining. The percentage of cells containing Hb F was estimatedusingamodified
Nierhaus-Betke stain, as follows: air-dried blood smears from heparinized blood were fixed in 80%alcohol eluted in hematoxylin, ferric
chloride, and alcohol at pH 1.5 and then counterstained with eosin.
Thepercentage of brightpinkto
RBCs (containingfetal Hb) in
1,000 RBCs was obtained by manual count.
DNA analysis. Thestructuralintegrity of theimmediate 5’ region of the human y-globin genes was assessed in all three patients
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
LITTLE ETAL
240nt
TPI
145nt
epsilon-y
a1pha
Fig 1. RNase protection of embryonic and adult murine globin
gene expression in MEL cells following induction, as indicated, with
DMSO (0.296).butyrate (1 mmollLI, or pentanoate (5 mmol/L). Wholecell mRNA was protected from RNase digestion with a radiolabeled
embryonic e*-globin gene probe and an adult a-globin gene probe,
in the upper and lower panels, respectively.A probe for triose phosphoisomerase (TPII sewed as an internal control. All agents induced
erythroid differentiation, but only butyrate and pentanoate upregulated embryonic globin gene expression.
with propionic acidemia using the single-stranded conformational
polymorphism (SSCP) technique on a DNA ladder generated through
dideoxy nucleotide sequencing (dideoxy fingerprinting)"; the wildtype y-globin gene promoter and two known y-globin HPFHpromoter point mutations served as controls. Using standard techniques,
DNA was isolated from peripheral blood mononuclear cells7J and
then amplified via polymerase chain reaction (PCR). The PCR products were cloned en masse into vectors; DNA for analysis was obtained from pools of clones. Control plasmids, analyzed identically,
were ' y wild-type promoter. ' y G -, A - 117 promoter, and " y
C
T -196 promoter. Human y-globin primers were designed
which spanned -268 to -62 upstream of the start site; thus, amplified sequences contained previously described sites of HPFH point
mutations between - I 17 and -202. The S' primerat -268 was
GAATCGGAACAAGGCAAAGGC; the 3' primer at -62 was
CTCACTGGATACTCTAAGAC. The S' y-globin primer was used
to generate a dideoxy nucleotide-terminated DNA sequence ladder
that was run on an acrylamide gel under nondenaturing conditions.
+
of examination, and none were experiencing acute decompensation.
Fetal Hb was elevated in four of five patients with inherited abnormalities in the metabolism of branched-chain and
other amino acids (ie, valine, isoleucine, methionine, and
threonine); the clinical history of these patients is discussed
below and outlined in Table 1. All five children were being
managed with protein restriction and L-carnitine, and none
had been treated with phenylactate or phenylbutyrate during
this investigation. All evaluations were made atroutine clinic
follow-up, when the patients were metabolically stable. Serum propionate levels were not available in these children;
the diagnoses were typically made shortly after birth through
clinical and enzymatic analyses. Glycine levels were obtained intermittently, and serve asan indirect measure of
disease severity. When drawn, glycine levels throughout
these patients' lives were typically two to three times normal
and did not change markedly over the course of this study.
K.F., 1 1 years old, was diagnosed at 3 days of age with
propionic acidemia when she presented with severe acidosis
and hyperammonemia, hyperglycinemia, and characteristic
excess urinary excretion of methylcitrate, propionylglycine,
and 3-OH propionate. Fetal Hb has ranged from 3% to 10%
(Table l ) . Of note, K.F. had been hospitalized with metabolic
decompensation 2 weeks before a clinic visit on February
21, 1993 (Hb F 5%) and again at 2 months before a February
9, 1994 visit (Hb F 10%). SSCP analysis of the y-globin
genes shows no evidence for a 5' HPFHpointmutation
(Fig 2).
M.S. is a 5-year-old child who presented at 2 days of age
withneonatal hyperammonemia, hypotonia, and acidosis.
Analysis of urinary organic acids suggested propionic acidemia, and enzymatic analysis confirmed propionyl-CoA carboxylase deficiency. Fetal Hb has ranged from 8% to 12%.
She has had a clinically difficult course characterized by
frequent metabolic decompensations, but was stable at these
analyses, except for a pneumoniabefore the March 1993
visit. She has had intermittent neutropenia, typically associated with metabolic decompensation, and was neutropenic
1::
: - 117 HPFH
1- 196 HPFH
RESULTS
In vitro cult~rreassu.~. Expression of the embryonic murine @-globingene (cy) in an adult phenotype murine erythroleukemia cell line was used to screen for agents that could
upregulate embryonic globin gene expression inan adult
phenotype erythroid cell. Both I mmol/L sodium butyrate
and 5 mmolL sodium propionate upregulated embryonic
globin gene expression in vitro (Fig l ) . Pentanoate was active in this assay system, whereas methylmalonate and acetate, at concentrations in the range of 1 to 20 mmol/L, were
not (data not shown).
Putienr undyvis. Fetal Hb was quantitated in 17 blood
samples obtained from 12 patients with metabolic abnormalities; only one patient, as noted, was hospitalized at the time
I
l
- PT. K.F.
- PT. M.S.
' -
PT. A.L.
Fig 2. SSCPldideoxy fingerprinting. A DNA sequence ladder derived from the P3' end-labeled 5' y-globin gene primer, terminated
with dideoxy nucleotides, was run under nondenaturingconditions
for DNA samples from plasmid wild-type and plasmid HPFH point
mutants, as well as three patient samples. The 5' primer shows the
-196 and -117 SSCP patterns in the control plasmids only.The three
patients with propionic acidemia and elevated fetal Hb have SSCP
analyses identical to those generated by the wild-type plasmid.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1715
METABOLIC PERSISTENCE OF FETALHEMOGLOBIN
(1,100 neutrophils/mm.') during the first analysis of fetal Hb,
but not subsequently. A Nierhaus-Betke stain from April 20,
1994, when Hb F was 8%, showed that approximately 8%
to 10% of peripheral blood cells contained acid-insoluble
Hb F (Fig 3B). SSCP analysis of genomic DNA showed a
wild-type pattern only (Fig 2).
A.L.is 3 years old. She was diagnosed with propionic
acidemia when she presented withneonatal hyperammonemia and acidosis. At 1 1 months of agc she was diagnoscd
with infantile spasms for which she receives phenobarbital.
She has been characterized as partially biotin-responsive,
and is treated with biotin. Fetal Hb levels have been 3% and
8%. y-Globin gene analysis showed a wild-type pattern on
SSCP (Fig 2).
I.M. is a 2-year-old with methylmalonic acidemia that was
diagnosed at 3 days of age when he presented with acidosis
and hyperammonemia. Molecular analyses showed a cobalamin B mutation and he receives vitamin B-l2 supplementation: however, his clinical course and biochemical parameters have not
been
characterized by significant B-l2
responsiveness. A single analysis of fetal Hb, at 1 1 months
old, showed a level of 6%. Throughout his life, I.M.'s methylmalonate levels have been elevated 1,000-fold, even when
clinically stable.
M.D. is a 5-year-old with a cobalamin C mutationand
resultant methylmalonic acidemia and homocystinuria. He
was diagnosed at 6 months of age when he presented with
developmental delay, failure to thrive, and blindness; nonetheless, his metabolic abnormality has been characterized as
being less severe clinically, because of therapeutic vitamin
B-l2 responsiveness. M.D. has had thrombocytosis throughout life, intermittent neutropenia, and epilepsy. His treatment
has included betaine, vitamin B-12, and phenobarbital. A
single fetalHb analysis on February 12, 1993 showed less
than 1% Hb F. Methylmalonate levels drawn during his life
have shown a sustained 10-fold elevation above normal.
Three patients were being observed for medium-chain
acyl-CoA dehydrogenase (MCAD) deficiency, a defect in the
,&oxidation of fatty acids manifest as fasting hypoglycemia,
hepatomegaly, a Reye-like syndrome, and, during exacerbations, by an elevation in the blood and urinary metabolites
of medium-chain fatty acids and acyl-carnitine derivatives.
Once diagnosed in infancy or early childhood, patients are
managed on a fat-restricted diet, in which fasting is avoided,
and by supplementation with L-carnitine." Four additional
patients were being observed for various defects in the urea
cycle, including citrullinemia and ornithine transcarbamylase
(OTC) deficiency. These conditions are characterized by recurrent hyperammonemia and protein intolerance. These patients received oral phenylbutyrate, an ammonia scavenger,
and L-citrulline or arginine as an adjunct to dietary restrictions.36-38 Phenylbutyrate had been prescribed for more than
I year, at 250 mg/kg/d or 5.5 g/m2/d in all ureacycle disorder
patients. Clinical data are outlined in Table 1. None of these
patients has had detectable fetal Hb above I % as determined
by isoelectric focusing. Patient B.B., 45 years old withhyperammonemia/hyperornithinemia/hypercitrullinuria("HHH"
syndrome) for which she received phenylbutyrate, showed
no elevation in Hb F on Nierhaus-Betke stain (Table 1 and
Fig 3A).
DISCUSSION
We report here a persistence of fetal Hb found in four of
five patients with an abnormality in amino acid metabolism
that is characterized by increased metabolites of propionate.
but without an associated molecular alteration in the p-globin gene cluster itself. To our knowledge, this is thefirst
report of a persistence of fetal Hb beyond infancy that is of
a genetic metabolic origin. A modified Nierhaus-Betke stain
with a value of approximately 8% to 10% in a 5-year-old
patient suggests an heterocellular persistence of fetal Hb. Hb
F levels in these children were consistently elevated and
varied over time but wereconsistently higher after metabolic
decompensation (ie, K.F. February 1994) or frequent exacerbations (ie, M.S.). Propionate levels were not available retrospectively because these children were managed clinically,
so the exact relationship between levels of propionate and
fetal Hb is not yet available. Of note, all propionate patients
had sustained twofold to threefold elevations of glycine
throughout this study, implying ongoing metabolic derangementsevenwhenthese
patients were clinically well. The
two children with methylmalonic acidemia are additionally
enlightening, as M.D.,with a relativelymild, chronic 10fold elevation in methylmalonate, showed no increased fetal
Hb at 5 years of age, whereas I.M., with a sustained 1.000fold elevation in methylmalonate, had 6% fetal Hbat 2 years
of age.
We also evaluated patients with two other types of metabolic abnormalities but with normal fetal Hb levels. Children
with MCAD deficiency would beexpected to have excessive
accumulation of C-6- and C-8-CoA derivatives during exacerbations but not when metabolically stable. At the time of
Hb F analysis, these children were in excellent metabolic
control and it is possible that results would differ during
exacerbations, or at diagnosis. Patients with enzymatic abnormalities in the urea cycle who were treated with nitrogen
scavenging agents. such as phenylacetate or phenylbutyrate,
that had been associated with an increase in F cells. showed
no detectable elevations in fetal Hb in our study. However,
those earlier reports that showed an elevation in F cells used
a highly sensitive antibody technique," whereas this study
used less sensitive but potentially more physiologically relevant methods, ie, isoelectric focusing and Nierhaus-Betke
staining. These results highlight the potency of propionate
metabolites in stimulating fetal Hb synthesis.
Fetal Hb is 50% to 90% of total Hb at birth anddecreases,
by mechanisms not yet fully characterized, to less than 1%
at 6 to 12 months postpartum, as Hb A predominates.'' A
Fig 3. Nierhaus-Betkestain for acid-insoluble fetal Hb in peripheral blood, at 105 x magnification. Sample (A), from patient B.B.,
shows less than 1% F cells; sample (B), from patient M.S., shows
approximately 8% to 10% F cells in an heterocellular pattern.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1716
persistence of fetal Hb beyond infancy has been ascribed
to mutations within the P-globin cluster itself, ie, deletions
downstream of the y-globin genes and point mutations in
the y-globin gene promoters.”’ These observations helped
to identify regions of potential developmental regulatory importance, including cis-acting sites, trans-acting factors, and
DNA secondary str~cture(s),@~~
which likely play a role in
y-globin gene regulation.
Patients with HPFH mutations have likewise been clinically illuminating, as the observation that elevated Hb F in
patients with concomitant P-thalassemia or sickle cell disease ameliorates the typical clinical sequelae of these diseases has led to ongoing pharmacologic trials in an attempt
to upregulate fetal Hb.””
Perrine et alZ8described a persistence of fetal Hb in infants
of diabetic mothers which was felt to be metabolic in origin
and was subsequently ascribed to elevated levels of butyric
acid derivative^.^^ More recently, Dover et all’ reported that
phenylacetate and phenylbutyrate upregulated F cells in patients with urea cycle disorders, for whom these agents serve
as ammonia scavengers. Neither phenylacetate nor phenylbutyrate is metabolized to butyrate or its analog^^,^'; however, both butyrate and phenylacetate are metabolized in the
mitochondria via thiol-esters with acetyl-coA, to acetate/
acetyl-coA and phenylacetylglutamine, respectively. This
common metabolic pathway for phenylacetate and butyrate
led us to investigate the possibility that propionate and other
short-chain fatty acids could upregulate embryonidfetal globin genes in vitro. Propionate, although derived predominantly from branched-chain and other amino acids rather
than odd-chain fatty acids, is also metabolized through an
acetyl-coA ester, propionyl-CoA, to succinyl-CoA and the
tricarboxylic acid cycle. Our studies showed that 5 mmol/L
propionate was capable of upregulating murine embryonic
P-globin gene expression in cell culture (Fig l), as were
butyrate and pentanoate, (data not shown) at, respectively,
1 mmol/L and 5 mmol/L concentrations. As had previously
been shown for the butyrate-induced upregulation of a
transfected avian embryonic P-type globin in MEL
this effect was not caused by terminal erythroid differentiation induced by such compounds,4’ because DMSO, which
also induces differentiation of the MEL cells to an adult
erythroid phenotype, did not upregulate eY expression.
The mechanism by which propionate, butyrate, or phenylacetate and phenylbutyrate cause elevated expression of
fetal and embryonic globin genes isnot known. We and
others have shown cis-acting sites for butyrate responsiveness in globin genes, but the specific mechanisms involved have notyetbeen
elucidated!6 It is possible that
butyrate and propionate affect the level or modification of
one or more sequence-specific trans-acting factors, perhaps
by altering acetyl-coA flux in the mitochondria.
It is expected that ongoing detailed studies of these children with metabolically mediated upregulation of fetal Hb
will offer insight into both underlying pathophysiologic
mechanisms and potential long-term clinical benefitsand
sequelae of exposure to short-chain fatty acids, such as butyrate, which are currently under study. In addition, these findings strongly support the notion that ongoing therapeutic
trials of SCFAs hold considerable promise, as the children
LllTLE ET AL
in this study had sustained Hb F elevations of 3- to 10-fold
over controls without obvious hematologic stress; it seems
likely that similar agents, applied therapeutically, would be
muchmore active in anemic patients with ongoing stress
erythropoiesis. This possibility is supported by the observation that none of the urea cycle disorder patients who received high doses of phenylbutyrate had detectable elevations of fetal Hb in our studies, whereas treatment with
similar doses has been associated with elevated Hb F in
patients with stress erythropoiesis caused by P-globin gene
disorder^.^'
None of the children with propionic acidemia or methylmalonic acidemia have had obvious progressive neurologic
deterioration beyond those changes that likely arise from a
difficult perinatal course and subsequent intermittent metabolic decompensation and protein restriction. Nonetheless,
despite reports in the literature of adolescent children with
propionic acidemia who, at diagnosis or with careful management, were of normal intelligence and without neurologic
sequelae, this is not t y p i ~ a l . ~The
” ~ presence
~
of seizures and
developmental delay in our patients, coupled with reports
by Blau et als4regarding neurologic abnormalities in baboons
infused with massive doses of sodium butyrate, do suggest
the possibility thatveryhighserum
levels of short-chain
fatty acid compounds and their metabolites could result in
neurologic toxicity.
A number of other clinical sequelae have been associated
with propionic acidemia, including cardiomyopathy, developmental delay, transient neutropenia, et^,'^,^' but similar
syndromes have not developed in patients with P-globin
gene disorders who are participating in short-term trials to
upregulate fetal Hb by treatment with short-chain fatty acids.
Nonetheless, future trials need to be structured so as to carefully define the therapeutic index of these compounds.
In summary, this report describes a metabolic persistence
of fetal Hb in patients with inherited derangements in amino
acid metabolism, as predicted in a tissue culture model. The
uniformity of this effect at the level of total fetal Hbin
nonanemic children suggests that propionate may be a potent
agent for pharmacologic stimulation of fetal Hb in patients
with P-globin gene disorders. Further study of individuals
with elevated levels of short-chain fatty acid metabolites
should afford insights into new pharmacologic therapies for
P-globin disorders that may be ameliorated by upregulation
of fetal Hb, andoffer a unique opportunity to examine potential long-term sequelae from therapy with such compounds.
ACKNOWLEDGMENT
WearegratefultoTariqEnver,LynneMaquat,andTimLey
for, respectively, the murine tY,murine triose phosphiosmerase, and
human y-globin plasmid constructs used in these experiments. Ella
Spanjers was helpful with the Nierhaus-Betke stains. Judy Goetzke
and Jolene Ludvigsen supplied expert secretarial assistance.
REFERENCES
1. Collins FS, Metherall JE, Yamakawa M, Pan J, Weissman SM,
ForgetBG: A pointmutationinthe
*y-globin gene promoter in
Greek hereditary persistence of fetal haemoglobin. Nature 313:325,
1985
2. Tate VE, Wood WG. Weatherall DJ: The British formof hered-
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
METABOLIC PERSISTENCE OF FETAL HEMOGLOBIN
itary persistence of fetal hemoglobin. Results from a single base
mutation adjacent to an S1 hypersensitive site 5’ to the Ay globin
gene. Blood 68:1389, 1986
3. Gelinas R, Endlich B, Pfeiffer C, Yagi M, Stamatoyannopoulos
G: G to A substitution in the distal CCAAT box of the Ayglobin
gene in Greek hereditary persistence of fetal haemoglobin. Nature
313:323, 1985
4. Collins FS, Boehm CD, Waber PG, Stoeckert CJ Jr, Weissman
SM, Forget BG, Kazazian HH Jr: Concordance of a point mutation
5’ to the
globin gene with
hereditary persistence of fetal
nemoglobin in the black population. Blood 64: 1292, 1984
5. Ottolenghi S, Giglioni B, Taramelli R, Comi P, Mazza U,
Saglio G, Camaschella C, Izzo P, Cao A, Galanello R, Gimferrer
E, Baiget M, Gianni AM: Molecular comparison of GP-thalassemia
and hereditary persistence of fetal hemoglobin DNAs: Evidence of
a regulatory area? Proc Natl Acad Sci USA 79:2347, 1982
6. Fritsch EF, Lawn RM, Maniatis T: Characterisation of deletions which affect the expression of fetal globin genes in man.Nature
279:598, 1979
7. Camaschella C, Serra A, Gottardi E, Alfarano A, Revello D,
Mazza U, Saglio G: A new hereditary persistence of fetal hemoglobin deletion has the breakpoint within the 3’ P-globin gene enhancer.
Blood 75:1000, 1990
8. Feingold EA, Forget BG: The breakpoint of a large deletion
causing hereditary persistence of fetal hemoglobin occurs within an
erythroid DNA domain remote from the P-globin gene cluster. Blood
74:2178, 1989
9. Noguchi CT, Rodgers GP, Serjeant G, Schechter AN: Levels
of fetal hemoglobin necessary for treatment of sickle cell disease.
N Engl J Med 318:96, 1988
10. Platt OS, Brambilla DJ, Rosse WF, Milner PF, Castro 0,
Steinberg MH, Klug PP: Mortality in sickle cell disease. Life expectancy and risk factors for early death. N Engl J Med 330:1639, 1994
11. Platt OS, Thorington BD, Brambilla DJ, Milner PF, Rosse
WF, Vinchinsky E, KinneyTR: Pain in sickle cell disease. Rates
and risk factors. N Engl J Med 325:11, 1991
12. Weatherall DJ, Clegg JB: The Thalassaemia Syndromes. Oxford, UK, Blackwell Scientific, 1981
13. Ley T, DeSimone J, AnagnouNP, Keller GH, Humphries
RK, Turner PH, Young NS, Keller P, Nienhuis AW: Sazacytidine
selectively increases gamma-globin synthesis in a patient with beta+
thalassemia. N Engl J Med 307:1469, 1982
14.Ley TJ, DeSimone J, Noguchi CT, Turner PH, Schechter
AN, Heller P, Nienhuis AW: 5-Azacytidine increases gamma-globin
synthesis and reduces the proportion of dense cells in patients with
sickle cell anemia. Blood 62:370, 1983
15. Charache S, Dover G, Smith K, Talbot CC, Moyer M, Boyer
S: Treatment of sickle cell anemia with 5-azacytidine results in
increased fetal hemoglobin production and is associated with nonrandom hypomethylation of DNA around the y-6-@globin gene complex. Proc Natl Acad Sci USA 80:4842, 1983
16. Platt OS, Orkin SH, Dover G, Beardsley GP, Miller B, Nathan
DG: Hydroxyuria enhances fetal hemoglobin production in sickle
cell anemia. J Clin Invest 74:652, 1984
17. Pemne SP, Ginder GD, Faller DV, Dover GH, Ikuta T, Witkowska HE, Cai S-p, Vichinsky EP, Olivieri N F A short-term trial
of butyrate to stimulate fetal-globin--gene expression in the P-globin
disorders. N Engl J Med 328:81, 1993
18. Dover GJ, Brusilow S, Samid D: Increased fetal hemoglobin
in patients receiving sodium 4-phenylbutyrate. N Engl J Med
327:569, 1992
19. DeSimone J, Heller P, Schimenti JC, Duncan CH: Fetal hemoglobin production in adult baboons by 5-azacytidine or by phenylhydrazine-induced hemolysis is associated with hypomethylation of
globin gene DNA. Prog Clin Biol Res 134:489, 1984
20. DeSimone J, Heller P, Hall L, Zwiers D: 5-Azacytidine stimu-
1717
lates fetal hemoglobin synthesis in anemic baboons. Proc Natl Acad
Sci USA 79:4428, 1983
21. Letvin NL, Linch DC, Beardsley GP, McIntyre DW, Nathan
DG: Augmentation of fetal hemoglobin production in anemic monkeys by hydroxyurea. N Engl J Med 3 102369, 1984
22. Ginder GD, Whitters MJ, Pohlman JK: Activation of a
chicken embryonic globin gene in adult erythroid cells by 5-azacytidine and sodium butyrate. Proc Natl Acad Sci USA 81:3954, 1984
23. Perrine S, Kan YW, Greene MF, Rubin E, Cooper S, Cohen
R, Raman C, Rudolph A, Faller DV: Inhibition of fetal globin gene
switching in vivo in human and ovine fetuses. Prog Clin Biol Res
25 1:545, 1987
24. Constantoulakis P, Papayannopoulou T, Stamatoyannopoulos
G: Alpha-Amino-N-butyric acid stimulates fetal hemoglobin in the
adult. Blood 72:1961, 1988
25. Constantoulakis P, Knitter G, Stamatoyannopoulos G: On the
induction of fetal hemoglobin by butyrates: In vivoand in vitro
studies with sodium butyrate and comparison of combination treatments with 5-AzaC and AraC. Blood 74:1963, 1989
26. Fibach E, Prasanna P, Rodgers GP, Samid D: Enhanced fetal
hemoglobin production by phenylacetate and 4-phenylbutyrate in
erythroid precursors derived from normal donors and patients with
sickle cell anemia and beta-thalassemia. Blood 82:2203, 1993
27. Little JA, Yang S, Ginder GD: Induction of embryonic globin
gene expression by short chain fatty acids (C7-C7).Clin Res 41: 132,
1993
28. Perrine SP, Greene MF, Faller DV: Delay in the fetal globin
switch in infants of diabetic mothers. N Engl J Med 3 l2:334, 1985
29. Dover GJ, Smith KD, Chang YC, Purvis S, Mays A, Meyers
DA, Sheils C, Serjeant G: Fetal hemoglobin levels in sickle cell
disease and normal individuals are partially controlled byanXlinked gene located at Xp22.2. Blood 80:816, 1992
30. Zago MA, Wood WG, Clegg JB, Weatherall DJ, O’Sullivan
M, Gunson HH: Genetic control of F-cells in human adults. Blood
53:977, 1979
31. Miyoshi K, Kaneto Y , Kawai H, Ohchi H, Niki S, Haseqawa
K, Shirakami A, Yamano T: X-linked dominant control of F cells
in normal adult life: Characterization of the Swiss type as hereditary
persistence of fetal hemoglobin regulated dominantly by gene(s) on
X-chromosome. Blood 72:1854, 1988
32. Burns LJ, Glauber JG, Ginder GD: Butyrate induces selective
transcriptional activation of a hypomethylated embryonic globin
gene in adult erythroid cells. Blood 72:1536, 1988
33. Sarkar G, Yoon HS, Sommer SS: Dideoxy fingerprinting
(ddE): A rapid and efficient screen for the presence of mutations.
Genomics 13:441, 1992
34. Billadeau D, Blackstadt M, Greipp P, Kyle RA, Oken MM,
KayN,Ban Ness B: Analysis of B-lymphoid malignancies using
allele-specific polymerase chain reaction: A technique of sequential
quantitation of residual disease. Blood 78:3021, 1991
35. Vianey-Liaud C, Divry P, Gregersen N. MathieuM: The
inborn errors of mitochondrial fatty acid oxidation. Inher Metab Dis
10:159, 1987
36. Brusilow S, Tinker J, Batshaw ML: Amino acid acylation: A
mechanism of nitrogen excretion in inborn errors of urea synthesis.
Science 207:659, 1980
37. Batshaw ML, Monahan PS: Treatment of urea cycle disorders.
Enzyme 38:242, 1987
38. Brusilow SW: Phenylacetylglutamine may replace urea as a
vehicle for waste nitrogen excretion. Perdiatr Res 29: 147, 1991
39. Bard H: The postnatal decline of hemoglobin F synthesis in
normal full-term infants. J Clin Invest 55:395, 1975
40. Martin DIK, Tsai S-G, Orkin SH: Increased y-globin expression in a nondeletion HPFH mediated by an erythroid-specific DNAbinding factor. Nature 338:435, 1989
41. Ulrich MJ, Gray WJ, Ley TJ: An intramolecular DNA triplex
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1718
is disrupted by point mutations associated with hereditary persistence
of fetal hemoglobin. J Biol Chem 267:18649, 1992
42. Jane SM, Gumucio DL, Ney PA, Cunningham JM, Nienhuis
AW: Methylation-enhanced binding of Spl tothe stage selector
element of the human y-globin gene promoter may regulate developmental specificity of expression. Mol Cell Biol 13:3272, 1993
43. Pemne SP, Miller BA, Greene MF, Cohen RA, Cook N,
Shackleton C, Faller DV: Butyric acid analogues augment gamma
globin gene expression in neonatal erythroid progenitors. Biochem
Biophys Res Commun 29:694, 1987
44. Moldave K, Meister A: Synthesis of phenylacetylglutamine
by human tissue. J Biol Chem 229:463, 1957
45. James MO, Smith RL, Williams RT. Reindenberg M: The
conjugation of phenylacetic acid in man, sub-human primates and
some non-primate species. Proc R SOCLond B 182:25, 1972
46. Glauher JG, Wandersee NJ, Little JA, Cinder GD: 5”Flanking sequences mediate butyrate stimulation of embryonic globin gene
expression in adult erythroid cells. Mol Cell Biol 11:4690, 1991
47. Leder A, Leder P: Butyric acid, a potent inducer of erythroid
differentiation in cultured erythroleukemic cells. Cell 5:319, 1975
48. Dover GJ, Brusilow S, Charache S: Induction of fetal hemo-
LITTLE ET AL
globin production in subjects with sickle cell anemia by oral sodium
phenylbutyrate. Blood 84:339, 1994
49. Surtees RAH, Matthews EE,Leonard JV: Neurologic outcome of propionic acidemia. Pediatr Neurol 8:333, 1992
50. Sethi KD,Ray R, Roesel RA, Carter AL, Gallagher BB,
Loring DW, Hommes FA: Adult-onset chorea and dementia with
propionic acidemia. Neurology 39: 1343, 1989
5 I . Wolf B, Paulsen EP, Hsia YE: Asymptomatic propionyl CoA
carboxylase deficiency in a 13-year-old girl. J Pediatr 95:563, 1979
52. Brandt IK, Hsia YE, Clement DH, Provence SA: Propionicacidemia (ketotic hyperglycinemia): Dietary treatment resulting in
normal growth and development. Pediatrics 53:391, 1974
53. Wolf B, Hsia YE, Sweetman L, Gravel R, Harris DJ, Nyhan
WL: Propionic acidemia: A clinical update. J Pediatr 99:835, 1981
54. Blau CA, Constantoulakis P, Shaw CM, Stamatoyannopoulos
G : Fetal hemoglobin induction with butyric acid; efficacy and toxicity. Blood 81:529, 1993
55. Sweetman L, Nyhan WL, Cravens J, Zomer Y, Plunket DC:
Propionic acidaemia presenting with pancytopaenia in infancy. J
Inher Metab Dis 2:65, 1979
56. Soriano JR, Taitz LS, Finherg L, Edelmann CM: Hyperglycinemia with ketoacidosis and leukopenia. Pediatrics 39:818, 1967
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1995 85: 1712-1718
Metabolic persistence of fetal hemoglobin
JA Little, NJ Dempsey, M Tuchman and GD Ginder
Updated information and services can be found at:
http://www.bloodjournal.org/content/85/7/1712.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.