Volume 15 Number 13 1987
Nucleic Acids Research
Analysis of thp repressor-operator interaction by filter binding
Lisa S.Klig, Irving P.Crawford1 and Charles Yanofsky
Department of Biological Sciences, Stanford University, Stanford, CA 94305-5020 and 1Departnent of
Microbiology, University of Iowa, Iowa City, IA 52242, USA
Received February 16, 1987; Revised and Accepted June 2, 1987
ABSTRACT
A filter binding assay was developed that allows measurement of specific
binding of trp repressor to operator DNA. The most important feature of this
procedure is the concentration and type of salt present in the binding
buffer. Using this assay the dissociation constant of the repressor-operator
complex was determined to be 2.6 x 10-9 M, and 1.34 repressor dimers were
found to be bound to each operator-containing DNA molecule. These values
agree with those obtained by more complex methods. The dissociation constant
of the repressor for the coregressor L-tryptophan in the presence of operator
DNA was shown to be 2.5 x 10- M. A synthetic 48 bp operator fragment was
used to determine the repressor-operator dissociation constant in the
presence of tryptophan or tryptophan analogs which have higher or lower
affinities for aporepressor. The rate of dissociation of repressor from
operator DNA also was determined. Our findings indicate that dissociation is
influenced bythe concentration of tryptophan or tryptophan analogs and
suggest that release of the corepressor may be the first step in dissociation
of the repressor-operator complex.
I NTRODUCTION
Protein-nucleic acid interactions are important events in gene regulation
in virtually all biological systems. Filter binding has proven to be an
extremely powerful yet simple and rapid method of analyzing these complex
events (1,2). The trp repressor of Escherichia coli, the product of the gene
trpR, binds to at least three similar operators, found in the trpEDCBA, aroH,
and trpR operons, thereby regulating transcription initiation in these
operons (3,4,5). The trp repressor polypeptide contains 107 amino acid
residues and exists as a dimer in two forms: the tryptophan-free
aporepressor, and the tryptophan-activated repressor that can bind operator
DNA (5,6). Mutational, crystallographic and biochemical studies indicate
that this repressor, like many others, has a helix-turn-helix motif (7) in
the putative DNA binding region (6,8,9).
The specific binding of trp repressor to operator DNA in vitro has been
C I RL Press Umited, Oxford, England.
5339
Nucleic Acids Research
studied previously by restriction site protection and transcription
inhibition assays (5,10,11,12). These are indirect methods of analyzing
repressor-operator interactions since they depend on competition between the
repressor and a restriction endonuclease or RNA polymerase. Filter binding
should allow measurement of trp repressor binding to operator DNA directly
and offer many advantages over existing assay methods. Previous attempts to
use filter binding to analyze trp repressor-DNA interactions were
unsuccessful (Yanofsky, unpub., 8). This report describes the development of
a filter binding assay for the trp repressor using a DNA fragment containing
the natural trpEDCBA operon operator sequence.
To develop the filter binding method, we first demonstrated that trp
repressor could bind tandemly ligated, multiple copies of a synthetic
oligonucleotide containing a symmetrical trp operator sequence. The key
observation that allowed the development of this assay was that specific
binding of operator DNA by t repressor was significant only when binding
and filtration were performed at high salt concentrations. The subject of
this report is the development and validation of the filter binding assay
with DNA fragments or synthetic DNA containing a single, natural trp
operator. Using this assay we estimate the dissociation constant of the
repressor-operator complex in the presence of tryptophan and two tryptophan
analogs, the dissociation constant for tryptophan in the presence of operator
DNA, the number of repressor dimers that bind to each operator and the off
rate (k.1) of repressor from operator DNA.
MATERIALS AND METHODS
Buffers and media
Bacterial cultures were grown in minimal medium (13) containing 0.2%
glucose, 0.1% acid casein hydrolysate, 0.1% yeast extract and 200 ig/ml
ampicillin.
The following buffers were used: standard binding buffer (10 mM
Tris-HCl, pH 7.6) containing 0.1 mM EDTA, 10 mM Mg(C2H302)2, 5% DMSO,
0.1 mM dithiothreitol and 50 uig/ml bovine serum albumin (1), and filtration
buffer which is binding buffer without dithiothreitol or bovine serum
albumin.
repressor preparations
The purity of the repressor preparations used was verified by
visualization of stained bands on polyacrylamide gels; the concentration was
determined spectrophotometrically (8). Repressor preparations were stored at
tLr2
5340
Nucleic Acids Research
-20°C at a concentration greater than 0.5 mg/ml. Dilutions were made
immediately prior to each experiment. Two separate preparations of purified
wild type trp aporepressor were used in these experiments. The aporepressor
was produced and purified as described previously (14).
Construction of trp operator plasmid
Two complementary oligonucleotides (24-mers) were synthesized using an
Applied Biosystems synthesizer. The annealed oligonucleotides contain the
trp operator sequence from positions -22 to -2 (the center of symmetry is
between position -12 and -11) and are shown below.
5' AATTCGAACTAGTTAACTAGTACG 3'
3' GCTTGATCAATTGATCATGCCTAG 5'
These oligonucleotides were annealed (90°C for 6 min., 600C for 1 hr., then
cooled slowly to 250C) generating a duplex DNA fragment with ends compatible
with EcoRI and BamHI restriction sites. This DNA fragment was then ligated
to purified plasmid pBR322 DNA from which the 377 base pair EcoRI to BamHI
fragment had been removed. To delete any tandem multiple inserts of the trp
operator containing fragment, the resultant plasmid (pBRtrpO) was digested
with EcoRI, diluted ten-fold, and religated yielding a plasmid containing a
single trp operator (pBRtrpO2).
Preparation of DNA
The 280 base pair DNA fragment containing the trp operator used in these
experiments was generated by digesting plasmid pBRtrpO2 with restriction
enzymes DdeI and SphI. The control fragment (similar size) resulted from the
digestion of pBR322 with restriction enzymes BamHI and SalI. Sodium acetate
was added to a concentration of 0.3 M and the DNA was precipitated with two
and a half volumes of ethanol. The precipitate was washed with 70% ethanol,
dried and resuspended in buffer (10 mM Tris, 1 nM EDTA, pH 7.4). The ends of
the DNA fragments were filled in using Klenow fragment, dATP, dCTP, dGTP and
32p dTTP. The sample was electrophoresed through a 5% polyacrylamide gel
and the fragments were visualized by autoradiography. The band containing
the 280 base pair fragment was cut out of the gel and the DNA was
electroeluted. After ethanol precipitation, the DNA was washed and
resuspended in 10 mM Tris-HCl, 1 mM EDTA, pH 7.4. The concentration and
purity of DNA samples was determined spectrophotomejrically by measuring
optical density at 260 and 280 nm.
Preparation of synthetic 48 bp trp operator and random sequence fragments
Two additional pairs of oligomers were synthesized. The first contained
the t operator sequence flanked by G-C rich sequences.
5341
Nucleic Acids Research
5' - AATTCCCCCCAATCGAACTAGTTAACTAGTACGCAAACCCCCCG - 3'
3'- GGGGGGTTAGCTTGATCAATTGATCATGCGTTTGGGGGGCTTAA - 5'
The second contained a random sequence with the same base composition as
the trp operator sequence, flanked by the G-C rich sequences.
5' - AATTCCCCCCAATATCAGACGTCGACGTCTGATCAAACCCCCCG -3'
3' - GGGGGGTTATAGTCTGCAGCTGCAGACTAGTTTGGGGGGCTTAA - 5'
Approximately 25 micrograms of each oligomer of a pair were annealed, and the
ends were filled in and labeled as described, but with [35S] or cold ATP.
The double stranded fragments were then electrophoresed, electroeluted and
precipitated (as described above).
DNA-repressor filter binding experiment
For a typical filter binding experiment Schleicher and Schuell PH75 0.05
micron nitrocellulose filters (13 mm. diameter) were placed in filtration
buffer containing the appropriate salt. The suspension was then brought to
boiling and cooled to room temperature. Meanwhile an appropriate
concentration of DNA, repressor and L-tryptophan were combined in a final
volume of 25 microliters in standard binding buffer (with salt added). This
mixture was incubated at room temperature for 5 minutes. A previously boiled
filter was then placed on a porous plastic filter holder to which vacuum was
applied. After the residual buffer passed through the filter (a few
seconds), the filter was washed with 30 microliters of filtration buffer
containing the appropriate salt and concentration of L-tryptophan. The
vacuum was adjusted so that the filtering rate was ca. 6 iil/sec or slower.
Ten microliters of the sample were then applied to the filter. When the
filter surface appeared dry it was washed with 30 microliters of filtration
buffer and dried under an infra-red lamp for 5 minutes. The amount of 32por 35S-labelled trp operator DNA retained on the filter was determined by
counting Cerenkov radiation (32p), or by addition of scintillation fluid
and counting (35S).
RESULTS
Filter binding with the trp repressor
To establish a filter binding assay for the trp repressor it was
necessary to optimize three factors: 1) the DNA sample (size of fragment and
location of operator), 2) the pH, and 3) the components of the buffer,
especially the type and concentration of salt. The optimal condition was
defined as that in which addition of repressor resulted in maximal specific
retention of those DNA fragments containing the operator sequence.
5342
Nucleic Acids Research
80
70
600
50-
z
404
0~
20
0.2 0.4 0.6 0.8
1.0
1.5
2.0
2.5
(NH4)2 SO4 concentration (M)
Figure 1. Bar graph representing the optimization of (NH4)2S04
concentration for specific retention of t repressor-operator complexes by
nitrocellulose filters. The % operator DNA bound (cpm retained/input cpm x
100) was corrected for the background retention of DNA (without repressor) at
each salt concentration. The DNA concentration employed was less than 9 x
10-11 M. The experiments were performed at the following repressor dimer
concentrations: 430 nM (open bars), 43 nM (striped bars), 10.75 nM (solid
bars).
Three sizes of DNA fragments were compared initially under the optimal
conditions described below: 4,200; 280; and 24 bp in length. Each fragment
contained a centrally located, single copy of the trp operator sequence. The
280 base pair fragment exhibited specific binding to the filter; we did not
observe specific retention of the 24 bp or the 4,200 bp DNA fragments above
the background retention seen without repressor present. (A 280 bp DNA
fragment with the operator near one end gave a result similar to the 280 bp
DNA fragment with the operator centrally located.) The 280 base pair DNA
fragment with the operator located 70 bp from one end was used in all
experiments unless otherwise noted.
Binding of the complex to the filter was examined in the pH range 5.5 to
7.8, in either Tris or phosphate buffer. The effect of the presence of
glycerol also was assessed. Ultimately Tris-HCl buffer at pH 7.6 without
glycerol was adopted as the optimal buffer. The effects of the following
salts were examined: potassium chloride, magnesium chloride, sodium chloride,
ammonium chloride, magnesium sulfate, sodium sulfate and ammonium sulfate.
Addition of anmnonium sulfate resulted in maximal enhancement of specific
binding of the 280 bp operator fragment. An experiment demonstrating the
5343
Nucleic Acids Research
-o
o
60
0
-Q
Z1
)
0
<50-
-o25,
40
o
10
15.
o~~~~~~
~820-
8
~30-
0
5
80I
ng repressor
10
2
4
6
8
10
12
14
ng repressor
Figure 2. Saturation of limiting DNA by increasing amounts of repressor.
Each point represents the average of duplicate samples from one experiment.
The % operator DNA bound and % control DNA bound (cpm retained/input cpm x
100) were corrected for background binding in the absence of repressor. The
DNA concentration employed was less than 9 x 10-11 M. The insert graph
depicts the binding of repressor to control (pBR322) DNA.
optimal concentration of ammonium sulfate is presented in Figure 1. At
extremely high concentrations of repressor, a wide range of salt
concentrations resulted in retention of the complex on the filter. As the
repressor concentration was decreased the optimal ammonium sulfate
concentration for specific binding was found to be 1.5 M. At this salt and
repressor concentration there was no detectable retention on the filter of
control (pBR322) DNA in the presence of repressor above the background
(control DNA without repressor).
DNA saturation
Experiments were performed to establish the workable range of repressor
concentrations, and to obtain a preliminary estimate of the dissociation
constant. In these experiments the repressor was titrated in the presence of
a constant limiting amount of DNA and an excess of L-tryptophan. The
saturation curve derived from these experiments is shown in Figure 2. Under
the experimental conditions, 76% of the DNA present in the sample was bound
to the filter by repressor. In the absence of tryptophan or repressor there
was very little binding (maximally 10% which is then subtracted as
background). Since at most 2.5% of the total repressor dimer is complexed
with DNA (due to the limiting DNA concentration) the dissociation constant is
5344
Nucleic Acids Research
0
D 20z
0
a10
/
0
2
4
6
8
lo"ThD
L-tryptophon (x 10-5M)
Figure 3. Saturation of 5.36 nM yp- repressor dimer by L-tryptophan in the
presence of operator DNA. Each point represents the average of duplicate
samples from one representative experiment. The % operator DNA bound (cpm
retained/input cpm x 100) was corrected for background binding in the absence
of repressor. The DNA concentration employed was less than 9 x 10-1 M.
At this concentration of repressor there was no detectable binding of control
DNA (pBR322) above the background (without repressor).
approximately equal to the initial repressor dimer concentration that gives
one half maximal binding. The estimated dissociation constant is 3.4 x
10-9 M. As shown on the insert (Fig. 2), a one thousand-fold increase in
repressor concentration (in the presence of tryptophan) results in
non-specific binding of DNA. Similar studies performed with three different
mutant repressor proteins, TM44, RH54, and RH84 resulted in less than 5%
binding, using 400-fold more repressor than the amount of wild type repressor
that gives maximal binding (76%).
Repressor-operator complex saturation with tryptophan
The trp repressor has two measurable activities, binding of tryptophan
and binding of DNA. Tryptophan was titrated at a repressor concentration
(5.36 nM) previously shown to give an intermediate level of complexed DNA
(32% bound). Figure 3 shows the saturation curve of the repressor-operator
complex at varying L-tryptophan concentrations in the presence of DNA. The
observed KS for L-tryptophan is 2.5 x 10-5 M. In the absence of
tryptophan there was no detectable difference between the experimental
condition (presence of aporepressor) and the control (absence of
aporepressor).
Repressor saturation
The previously described experiments were based on the assumption that
an
5345
Nucleic Acids Research
1,000
-
900
0
-D 800z
o 700
4-0
° 600
a)
o 500
LI
t
/
400,
300
2
4
6
8 l0
ng DNA
12
14
16
Figure 4. Saturation of a fixed concentration of repressor dimer (3.58 nM)
by increasing amounts of DNA. Each point represents the average of duplicate
samples of one of three similar experiments with the background retention of
DNA (without repressor) at each concentration subtracted. Control DNA
(pBR322) at each concentration in the presence or absence of repressor was
also filtered. There was no discernable retention of control DNA (pBR322)
above the background at the same concentration.
insignificant concentration of operator DNA was present relative to the
concentration of repressor. To validate this assumption a fixed
concentration of repressor was saturated by increasing concentrations of
DNA. This experiment verified our previous KD determination and allowed us
to measure the number of repressor dimers that bind to each operator. The
dissociation constant was estimated from the saturation curve obtained with
3.57 nM repressor dimer (Figure 4) using the formula KD = [R - RO] [0 - RO].
At half maximal binding this formula simplifies to KD = 10[1/2 - 1/2 [R].
Using this method KD was estimated to be 3.2 x 10-9 M.
The number of repressor dimers bound to each operator was determined in
three independent experiments. As shown in Table 1, the DNA concentration
that fully saturates a fixed amount of the repressor dimer results in a given
percentage of the DNA retained by the filters. This value must be adjusted
to take into account the maximum binding, 76%, observed under our
conditions. Analysis of the data suggests that 1.31 ± 0.3 repressor dimers
bind to each operator containing DNA molecule. The double reciprocal plot
(not shown) of these data yields a correlation coefficient of 0.953.
A Scatchard plot of binding data is shown in Figure 5. The negative
reciprocal of the slope of this line gives an accurate estimate of KD.
From the slope, -0.388, the dissociation constant of the repressor dimer for
5346
Nucleic Acids Research
Table 1
Calculation of the number of repressor dimers
bound to each operator
% bound
actual
recalibrated
[DNA] at
% bound
to 100%*
saturation [repressor]
[complex]
12.5 nM
12.5 nM
12.5 nM
*
13.3
13.3
16.0
2.68 nM
3.57 nM
2.68 nM
17.5
17.5
21.1
2.19 nM
2.19 nM
2.63 nM
dimers/
operator
1.31
1.63
1.02
assuming 76% maximum binding
operator DNA was calculated to be 2.6 x 10-9 M. The number of binding
sites for operator DNA per repressor dimer is equal to the X intercept (in nM
of DNA) divided by the concentration of repressor (in nM dimers). Using the
X intercept value of 2.68 nM (Fig. 5) at a repressor concentration of 3.58
nM, the number of operator DNA molecules bound to each repressor dimer is
1.0
0.8
z
1
0.6\
z
n 0.4
0
LD
Bound DNA(nM)
Figure 5. Scatchard plot of the saturation of trp repressor by operator
DNA. Each point was calculated from the data presented in Figure 4. The
data were corrected to 100% given that the maximum binding observed under
these conditions is 76%.
5347
Nucleic Acids Research
calculated to be 0.75. The inverse relationship indicates that 1.34
repressor dimers bind per operator.
Binding of a 48 bp synthetic operator fragment occurs at a lower salt
concentration
A synthetic 48 bp operator fragment containing flanking GC stretches (see
Materials and Methods) when mixed with trp repressor was retained on filters
in the filter binding assay. An analogous DNA fragment with the same base
composition but lacking the operator sequence (see Materials and Methods) was
not retained. Interestingly, a lower salt concentration, 0.24 M ammonium
sulfate, was optimal for maximal specific binding of this 48 bp operator
fragment. Retention of the 48 bp synthetic fragment in 0.24 M salt requires
a 2-fold higher repressor concentration (KD = 7 x 10-9 M) than retention
of the 280 bp operator fragment in 1.5 M salt (data not shown). This DNA
fragment was used to examine the effects of tryptophan analogs on the
equilibrium dissociation constant (KD) of the repressor-operator complex,
and to determine the off rate (k.1) of repressor from operator DNA.
Repressor-operator complex saturation with tryptophan analogs
The synthetic 48 bp operator-containing fragment was used to determine
the dissociation constant (KD) in the presence of saturating levels of
tryptophan, KS = 2.5 x 10-5 M, and analogs with higher and lower
affinities for aporepressor, 5-methyl tryptophan, KS = 3 x 10-6 M (17),
and 6-methyl tryptophan, KS = 6 x 10 M (16,17). The KD's estimated
from the saturation curves derived from these experiments are: 3.5 x 10-9 M
with 5-methyl tryptophan, 7 x 10-9 M with tryptophan and 1.4 x 10-8 M
with 6-methyl tryptophan.
t
of the repressor-operator complex
D
a
The dissociation rate (k-1) of the repressor-operator complex was
determined using the 48 base pair operator-containing DNA fragment in the
presence of 0.24 M ammonium sulfate and excess tryptophan. In these
experiments 2.24 x 10-8 M repressor was prebound to labeled DNA at the
following concentrations: 1.74 and 3.48 x 10-8 M. At time zero the
reaction mixtures were diluted five-fold and unlabeled operator DNA (the same
48-mer) was added to a final concentration of 10-7 M. Ten microliter
aliquots were removed at 15 or 30 second intervals, filtered, and the filters
counted. The off rate of wild type repressor under these conditions was
estimated to be 2 x 10-2/sec (t1/2 = 50 sec). Preliminary experiments
with the tryptophan analog 5-methyl tryptophan (instead of tryptophan) gave a
dissociation rate of 1 x 10-2/sec (t1/2 = 100 sec). In other experiments
5348
Nucleic Acids Research
the off rate of wild type repressor was determined following dilution of
tryptophan to 5 x 10-6M, a subsaturating concentration (Fig. 3). The off
rate was estimated to be > 5 x 10-2/sec (t1/2 = < 25 sec). Using a
transcription inhibition assay it was previously estimated that t1/2 = < 2
min in the presence of saturating levels of tryptophan in 0.12 M salt at
370 C (10).
DISCUSSION
This report describes the development and application of a filter binding
assay for the E. coli tr repressor-9p operator complex. Using a 280 base
pair DNA fragment containing a single copy of the trp operator, it was
necessary to use high salt concentrations (ca. 1.5 M) to obtain optimal
specific retention of the operator-containing DNA fragment on a
nitrocellulose filter. Further studies revealed that the use of a 48 base
pair DNA fragment containing a single copy of the trp operator permitted a
decrease in the salt concentration to 0.24 N while retaining optimal specific
binding. The other two in vitro assays of trp repressor binding (restriction
site protection and transcription initiation inhibition) do not have this
salt requirement. Therefore it appears that salt dependence is a function of
the filtration technique. Presumably the trp repressor trapped on the filter
releases the bound DNA fragment unless salt is present. The maximum of 76%
specific retention observed with one wash is consistent with similar filter
binding studies using the lac repressor (1).
Examination of the various parameters of trp repressor-trp operator
interaction using this filtering technique with the 280 bp single operator
fragment revealed the following: the KS for L-tryptophan in the presence of
operator DNA is 2.5 x 10-5 M, the KD for operator DNA is 2.6 x 10-9 M
and ca. 1.3 repressor molecules (dimers) are bound per operator molecule.
Previous equilibrium dialysis studies with t aporepressor have given a KS
value for L-tryptophan (without DNA present) of 4.8 x 10-5 M at 250C (15).
Thus our value of 2.5 x 10-5 M at 250C in the presence of operator DNA and
high salt is consistent with past findings. Restriction endonuclease
protection (competition) assays have given an estimated KD of repressor for
operator DNA of 2 x 10-9 M (37C) (8), in close agreement with our value of
2.6 x 10-9 M (25°C), again obtained in the presence of high salt. Finally,
our finding of 1.3 repressor molecules (dimers) bound per operator molecule
is in keeping with biochemical studies (8) and crystallographic studies (6)
indicating that the functional repressor is indeed a dimer.
5349
Nucleic Acids Research
Experiments using a synthetic 48 bp DNA fragment containing the natural
operator and flanking GC-rich sequences have shown specific retention of
DNA on filters to be optimal in the presence of 0.24 M ammonium sulfate.
However the KD for operator DNA using these conditions was 2-fold higher
than previously estimated. Using the filter binding assay and the 48 bp
operator fragment, dissociation of the repressor-operator complex was
determined in the presence of saturating concentrations of tryptophan or
5-methyl or 6-methyl tryptophan, analogs which have higher and lower
affinities for aporepressor, respectively. The calculated KD's reflect the
relative affinity of aporepressor for the three corepressors, i.e., the
5-methyl tryptophan-aporepressor-operator complex was most stable. We also
found that the t1/2 of the repressor-operator complex was 50 sec and 100
sec respectively, in saturating concentrations of tryptophan and 5-methyl
tryptophan. Dilution of the tryptophan-aporepressor-operator complex in the
absence of added tryptophan (to a subsaturating tryptophan concentration)
gave a t1/2 of < 25 sec. One interpretation of these findings is that the
initial step in dissociation of the ternary complex:
corepressor-aporepressor-operator, is dissociation of the corepressor. The
following diagram illustrates this hypothetical step as well as the various
relevant species that may exist in solution. (This representation is an
oversimplification since the aporepressor has two tryptophan binding sites
and we do not yet know whether aporepressor with a single bound tryptophan
has operator binding activity.)
trp
repressor + operator
tryptophan
+ aporepressor +
operator
tryptophan
M%
repressor-operator
J\1/
+ aporepressor-operator
An alternative explanation is that the analog occupying the tryptophan
binding site of the aporepressor affects the affinity of repressor and
operator. The tryptophan binding site of the trp aporepressor is formed from
amino acid residues that are in the same helical region that is presumed to
interact with the operator (6). Thus the methyl groups of the analogs may
influence the precise positioning of the DNA recognition helix, helix E (6).
These alternatives require further study but the finding that the tryptophan
and 5-methyl tryptophan aporepressor-operator complexes have different off
5350
Nucleic Acids Research
rates is most consistent with the interpretation that dissociation of a
single corepressor molecule is the initial step in dissociation of the
repressor-operator complex.
The filter binding assay, now established for the trp repressor-operator
system, will be extremely useful in further analyses of DNA-protein
interactions.
ACKNOWLEDGEMENTS
The authors are indebted to Dennis Burns, Paul Gollnick, Mitzi Kuroda,
Marc Orbach, Jan Paluh, Anne Roberts, Tom Schmidhauser, Matthew Springer, and
Chuck Staben for their conmnents on the manuscript, to Lin Yee Chang and John
Pepper for synthesizing the oligonucleotides, and to Jan Paluh for her
participation in the initial annealing and labeling of the 48 bp synthetic
operator. This work was supported by the National Science Foundation
(DMB8208866) and the American Heart Association (69-015). L.S.K. is a fellow
of the Jane Coffin Childs Memorial Fund for Medical Research. C.Y. is a
Career Investigator of the American Heart Association.
REFERENCES
T1.Riggs,
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
A.D., Suzuki, H., and Bourgeois, S. (1970) J. Mol. Biol. 48,
67-83.
Nelson, H.C.M. and Sauer, R.T. (1985) Cell 42, 549-558.
Rose, J.K., Squires, C.L. and Yanofsky, C. (1973) Nature 245, 133-137.
Zurawski, G., Gunsalus, R.P., Brown, K.D., and Yanofsky, C. (1981) J.
Mol. Biol. 145, 47-73.
Gunsalus, R.P., and Yanofsky, C. (1980) Proc. Natl. Acad. Sci. USA 77,
7117-7121.
Schevitz, R.W., Otwinowski, Z., Joachimiak, A., Lawson, C.L. and Sigler,
P.B. (1985) Nature 317, 782-786.
Takeda, Y., Ohlendorf, D.H., Anderson, W.F., and Matthews, B.W. (1983)
Science 221, 1020-1026.
Joachimiak, A., Kelley, R.L., Gunsalus, R.P., Yanofsky, C., and Sigler,
P. (1983) Proc. Natl. Acad. Sci. USA 80, 668-672.
Kelley, R.L., and Yanofsky, C. (1985) Proc. Natl. Acad. Sci. USA 82,
483-487.
Rose, J.K. and Yanofsky, C. (1974) Proc. Natl. Acad. Sci. USA 71,
3134-3138.
Squires, C.L., Lee, F.D., and Yanofsky, C. (1975) J. Mol. Biol. 92:
93-111.
Bennett, G.N., Schweingruber, M.E., Brown, K.D., Squires, C., and
Yanofsky, C. (1976) Proc. Natl. Acad. Sci. USA 73, 2351-2355.
Vogel, H.J., and Bonner, D.M. (1956) J. Biol. Chem. 218: 97-106.
Paluh, J.L. and Yanofsky, C. (1986) Nucl. Acids Res. 14, 7851-7860.
Arvidson, D.N., Bruce, C., and Gunsalus, R.P. (1986) J. Biol. Chem. 261,
238-243.
Squires, C.L., Rose, J.K., and Yanofsky, C. (1973) Nature 245, 131-133.
Marmorstein, R.Q., Joachimiak, A., Sprinzl, M., and Sigler, P.B. (1987)
J. Biol. Chem. 262, 4922-4927.
5351