Activation of Stretch-Activated Channels and Maxi-Kⴙ
Channels by Membrane Stress of Human Lamina
Cribrosa Cells
Mustapha Irnaten,1,2 Richard C. Barry,1,2,3 Barry Quill,3 Abbot F. Clark,4
Brian J. P. Harvey,1 and Colm J. O’Brien3
PURPOSE. The lamina cribrosa (LC) region of the optic nerve
head is considered the primary site of damage in glaucomatous
optic neuropathy. Resident LC cells have a profibrotic potential
when exposed to cyclical stretch. However, the mechanosensitive mechanisms of these cells remain unknown. Here the
authors investigated the effects of membrane stretch on cell
volume change and ion channel activity and examined the
associated changes in intracellular calcium ([Ca2⫹]i).
METHODS. The authors used primary LC cells obtained from
normal human donor eyes. Confocal microscopy was used to
investigate the effect of hypotonic cell membrane stretch on
cell volume changes. Whole-cell patch-clamp and calcium imaging techniques were used to investigate the effect of hypotonicity on ion channel(s) activity and [Ca2⫹]i changes, respectively. RT-PCR was used to examine for the maxi-K⫹ signature
in LC cells.
RESULTS. In this study, LC cells showed significant volume
changes in response to hypotonic cell swelling. The authors
characterized a large conductance K⫹ channel (maxi-K⫹) in LC
cells and demonstrated its increased activity during cell membrane hypotonic stretch. RT-PCR revealed the presence of
maxi-K⫹ signature in LC cells. The authors showed the [Ca2⫹]i
and maxi-K⫹ channels to be dependent on extracellular Ca2⫹
and inhibited by gadolinium, which blocks stretch-activated
channels (SACs). Pretreatment with thapsigargin, which blocks
the release of Ca2⫹ from endoplasmic reticulum stores,
showed no significant difference in [Ca2⫹]i concentration on
hypotonic swelling.
CONCLUSIONS. The results show that hypotonic stress of human
LC cells activates SAC and Ca2⫹-dependent maxi-K⫹ channels
and that the increase in [Ca2⫹]i during cell swelling was predominantly from extracellular sources (or intracellular stores
other than the endoplasmic reticulum). These findings improve the understanding of how LC cells respond to cell
From the 1Molecular Medicine Laboratories, RCSI Education and
Research Centre, Beaumont Hospital, Dublin, Ireland; 3Ophthalmology, Mater Misericordiae University Hospital and Conway Institute,
University College Dublin, Dublin, Ireland; and 4Glaucoma Research,
Alcon Research, Ltd., Forth Worth, Texas.
2
These authors contributed equally to the work presented here
and should therefore be regarded as equivalent authors.
Supported by the National Glaucoma Research (American Health
Assistance Foundation), and a Wellcome Trust Programme Grant
060809/Z/00/Z.
Submitted for publication February 26, 2008; revised August 18,
2008; accepted November 4, 2008.
Disclosure: M. Irnaten, None; R.C. Barry, None; B. Quill, None;
A.F. Clark, None; B.J.P. Harvey, None; C.J. O’Brien, None
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Corresponding author: Mustapha Irnaten, Department of Molecular Medicine, RCSI Education and Research Centre, Beaumont Hospital,
PO Box 9063, Dublin 9, Ireland; [email protected].
194
Downloaded From: http://iovs.arvojournals.org/ on 06/18/2017
membrane stretch. Further experiments in this area may reveal
future targets for novel therapeutic intervention in the management of glaucoma. (Invest Ophthalmol Vis Sci. 2009;50:
194 –202) DOI:10.1167/iovs.08-1937
G
laucomatous optic neuropathy has an estimated worldwide prevalence of 67 million, making it the second most
common form of blindness after cataract.1 Primary open-angle
glaucoma (POAG), the most common form of glaucoma, is
characterized by irreversible and progressive loss of axons of
the retinal ganglion cells (RGCs), usually in response to abnormally elevated intraocular pressure (IOP).2 The clinical hallmarks of glaucomatous optic neuropathy are excavation of the
tissues of the optic nerve head and visual field loss.3
Much work has focused on the lamina cribrosa (LC) of the
optic nerve head (ONH), and there is substantial evidence that
damage to the RGC axons occurs at this region.4 – 6 In glaucoma, cupping of the optic disc and stretching, compression,
and rearrangement of the collagenous cribriform plates occur
in response to an increase in IOP.7 Resident glial cells of the
optic nerve head, namely astrocytes and LC cells, are likely to
play a role in this remodeling of the extracellular matrix
(ECM).8 –10 These two cell types differ in that the LC cell,
unlike the astrocyte, does not express glial fibrillary acid protein (GFAP).11 In addition, their pattern of ECM and cell surface molecule expression suggest that they are a unique ONH
cell type.2 Morphologically, the LC cells are broad, flat, and
polygonal, whereas the astrocytes are star shaped and have
longer, thinner processes.12
Previous work by Kirwan et al.10,13 has demonstrated the
profibrotic nature of the LC cells when exposed to stress in the
form of cyclical stretch or TGF-␤1. Microarray analysis demonstrated the upregulation of TGF-␤2, BMP-7, elastin, collagen VI
␣1, biglycan, versican, EMMPRIN, VEGF, and thrombomodulin
in response to cyclical stretch.10 Because the LC is a compliant
tissue in normal human eyes, an alteration of the composition
of the ECM caused by this overexpression of profibrotic modulators may lead to eventual reduction in LC compliance.
Kirwan et al.,10 using microarray experiments on glaucoma
cells, revealed upregulation in certain cell membrane channels
and ECM genes that led us to investigate the fundamental
components involved in the process by which these LC cells
sense mechanical force and convert it to a biochemical response,14 that is, LC cell mechanotransduction. Among the
major cellular components of the mechanotransduction process are ion channels, including the stretch-activated ion channel (SAC).15 These SACs open in response to mechanical stimuli and allow the movement of cations, including Ca2⫹ entry
and K⫹ extrusion across the cell membrane.16 Thus any enhancement in cytosolic concentration of Ca2⫹ may result in the
activation of many physiological or pathophysiological processes that include activation of second-messenger systems,
initiation of gene transcription, release of calcium from intracellular stores, opening of calcium-dependent ion channels,
cell volume regulation, apoptosis, contraction, and differentiInvestigative Ophthalmology & Visual Science, January 2009, Vol. 50, No. 1
Copyright © Association for Research in Vision and Ophthalmology
IOVS, January 2009, Vol. 50, No. 1
Membrane Stretch and Maxi-Kⴙ in Lamina Cribrosa Cells
ation.17–19 Among the most studied of these events is the
activation of calcium-dependent potassium channels (maxi-K⫹).
Intracellular calcium is a well-characterized modulator of
maxi-K⫹ channels and is thus intimately involved in volume
regulation in a variety of cells.20,21 For example, in vascular
smooth muscle, calcium sparks (local increases in Ca2⫹) generate spontaneous transient outward currents that are produced by maxi-K⫹ channels (K⫹ efflux). This hyperpolarizes
the membrane and inhibits calcium entry through voltagegated channels, thus causing muscle relaxation.22 In many
other type of cells, the maxi-K⫹ channel is central to cell
volume regulation.17,23,24 Cell swelling (caused by hypotonic
shock) has a variety of consequences, including alterations in
morphology, membrane tension, ion content, and metabolic
state.25 Maxi-K⫹ channels are regulated by [Ca2⫹]i, voltage and
membrane tension, thus making them important cellular components in the limitation of Ca2⫹ entry.26 Maxi-K channels
have demonstrated mechanosensitive properties in skeletal
muscle, smooth muscle, and many other human tissues, including the myometrium, trabecular meshwork cells,27 renal tubular epithelium, and endothelial cells.28 –32
Indeed, no whole-cell patch-clamp studies have been performed in freshly obtained or cultured human LC cells. Thus,
the goal of the present study was to identify and characterize
ion channels that could be involved in the response to LC cell
membrane stretch and volume change, with particular emphasis on their regulation by increases in intracellular Ca2⫹. Because we believe these cells respond in a profibrotic manner to
mechanical stress, an understanding of the upstream regulatory
mechanism(s) of this response is important to further our
understanding of the pathogenesis of glaucomatous optic
neuropathy.
MATERIALS
AND
METHODS
Culture of Human LC Cells
LC cells were derived from two male donors with no evidence of
glaucoma. LC cells used were previously characterized by immunofluorescent staining for various markers, including glial fibrillary acidic
protein (GFAP), NCAM, ␣-smooth muscle actin, and a variety of ECM
proteins, including collagen types I, III, and IV, elastin, laminin, and
fibronectin.12 The LC cells used in this study were from passages 4 to
8. The cells were maintained at 37°C and 5% CO2 in Dulbecco modified
Eagle medium (DMEM; Sigma Chemical, Poole, UK), supplemented
with 10% (vol/vol) fetal calf serum (Gibco, Paisley, UK), 2 mM Lglutamine (Gibco), 2 U/mL penicillin, and 2 mg/mL streptomycin
(Gibco). When confluent, cells were subcultured onto glass coverslips
or plastic tissue culture dishes (Sarstedt, Newton, NC). For Fura-2 AM
fluorescence measurements, confluent cells were used 48 to 72 hours
after plating. For electrophysiological recordings, cells grown on sixwell plates were trypsinized (0.25% trypsin and 1% EDTA) and were
replated on 12-mm round glass coverslips before the experiment
began. Cells were then used for patch-clamp recording within 30
minutes or were maintained at room temperature up to 3 hours before
recording.
Solutions
The isotonic solution contained 120 mM NaCl, 6 mM KCl, 1 mM MgCl2,
2 mM CaCl2, 5.4 mM HEPES, and 80 mM D-mannitol, pH 7.4 adjusted with NaOH (osmolality, 323 ⫾ 6 mOsm). The hypotonic
solution (osmolarity, 232 ⫾ 8 mOsm) was prepared by omitting
D-mannitol from the isotonic solution. For patch-clamp experiments,
the patch pipette solution contained 120 mM KCl, 1 mM MgCl2, 5 mM
EGTA, and 5.4 mM HEPES, pH 7.2 adjusted with KOH (osmolality,
292 ⫾ 5 mOsm). In Ca2⫹-free conditions, Ca2⫹ was replaced by
equimolar Mg2⫹.
Downloaded From: http://iovs.arvojournals.org/ on 06/18/2017
195
Volume Change Analysis
LC cells were cultured in imaging dishes and grown to greater than
90% confluence. Cells were preloaded for 15 minutes with 5 ␮M
calcein (Sigma), dissolved in dimethyl sulfoxide, and washed with the
isotonic solution. The imaging dishes were then mounted on the
confocal microscope (LSM 510 Meta; Zeiss, Jena, Germany). Images
were acquired every 5 seconds over a period of 4 minutes and analyzed
using an image examiner software program (LSM 5; Zeiss). Calcein was
excited at 488 nm with the argon-ion laser, whereas the emitted
fluorescence was recorded at a wavelength of 530 nm. Hypotonic
solution was added after the third image in each experiment, and the
subsequent volume change was calculated using the formula:
Vc1 Cc1 ⫽ Vc2 Cc2 ,
(1)
where Vc1 and Cc1 are the volume and calcein concentration under
resting (isotonic conditions), respectively. Vc2 and Cc2 are changed cell
volume and calcein concentration, respectively. The concentration of
calcein is proportional to its fluorescence intensity; thus, the ratio of
concentrations is equal to the ratio of intensities. Assuming that Vc1 is
1, the change volume can be calculated from the changed calcein
fluorescence intensity (Fc2) and the resting intensity (Fc1) using the
formula33:
Vc2 ⫽ Fc1 /Fc2 .
(2)
Patch Clamp
Whole-cell currents were measured in ruptured patches, as described
previously.34 All experiments were performed at room temperature
(20°-22°C). Patch pipettes were prepared from capillary glass
(GC150F-10; Harvard Apparatus Ltd., Edenbridge, UK), pulled using a
programmable puller (DMZ-Universal; Zeitz-Instruments GmbH, Munich, Germany). Patch electrodes had an electrical resistance of 2 to 5
M⍀ when filled with pipette solution. An Ag-AgCl wire was used as
reference electrode. The patch-clamp apparatus consisted of a head
stage (CV-203BU; Axon Instruments, Union City, CA) connected to a
series amplifier (Axopatch 200B; Axon Instruments). Recorded membrane currents were filtered at 1 kHz and digitized at 5 kHz. In brief,
freshly prepared LC cells were allowed to attach to the bottom of the
cell chamber. Whole-cell access to the inside of the cell was obtained
by rupturing the membrane under the pipette tip. Cells were voltage
clamped at a holding potential of 0 mV, and membrane currents were
recorded in response to voltage steps (from ⫺120 mV to ⫹100 mV,
with steps of 20 mV). Average membrane capacitance of the cell was
approximately 28.5 ⫾ 6.2 pF. During experiments, whole-cell patched
cells were allowed to stabilize and dialyze for at least 5 minutes.
Currents were recorded over this time period in isotonic bathing
solution (323 ⫾ 6 mOsm) to ensure stability of the current recording.
The experiments consisted of exposing cells to hypotonic solution
(232 ⫾ 8 mOsm) and measuring the whole-cell current amplitude at
different voltage-clamp steps.
RNA Extraction and RT-PCR
Total RNA was extracted from LC cells (Tri-Reagent Kit; Molecular
Research Center, Cincinnati, OH). Total RNA (1–2 ␮g) was reverse
transcribed to obtain cDNA using a reverse transcriptase kit (ImProm
II; Promega, Southampton, UK). cDNA samples were amplified with
three primers corresponding to three different regions of maxi-K using
Taq-polymerase in a DNA thermal cycler (MJ Research, South San
Francisco, CA). Control RT-PCR reactions without reverse transcriptase
or cDNA served as negative controls and did not result in amplification
products. RT-PCR was performed with three sets of primers. Two
primer sets (accession numbers U11717 and U11058) have been previously published,23,35 and the third primer set was designed from its
cDNA sequence using a software tool (GeneFisher).36 BLASTN search
was performed on primers to confirm that the sequences were not
196
Irnaten et al.
IOVS, January 2009, Vol. 50, No. 1
TABLE 1. Oligonucleotide Sequences of Maxi-K Primers Used for RT-PCR
Accession No.
Forward Primers (5ⴕ-3ⴕ)
Reverse Primers (5ⴕ-3ⴕ)
Position
Length (bp)
U11058
U11717
ACAACATCTCCCCCAACC
ATCTCCCCCAACCTGGA
ACCAAGACGATGATGACC
TCATCACCTTCTTTCCAATTC
ACAGTAGGGAAGGACAGA
AGCAGAAGATCAGGTCCGTC
1222–1531
979–1479
2675–3154
309
500
479
shared with other known genes. PCR primers are listed in Table 1. The
RT-PCR product was analyzed on a 1% 1⫻ Tris-borate-EDTA (TBE)
agarose gel and was imaged using a UV light source.
Calcium Imaging
[Ca2⫹]i was measured using the Ca2⫹-sensitive dye Fura-2 AM (Bioscience, Molecular Probes, Dublin, Ireland). In brief, cells were preloaded with Fura 2-AM in a final concentration of 5 ␮M for 45 minutes,
rinsed twice with 1 mL isotonic solution, mounted on the stage of an
inverted epifluorescence microscope (Diaphot 200; Nikon, Toyko,
Japan) and treated with the various conditions/inhibitors (hypotonic
solution, gadolinium, or thapsigargin or maxi-K⫹ blockers). Cells were
excited alternately at wavelengths of 340 and 380 nm. The resultant
fluorescence at each excitation wavelength was measured at 510 nm
collected using a charge-coupled device camera system (Hamamatsu,
Japan). For Ca2⫹ calibration, values for [Ca2⫹]i were obtained from the
following equation:
关Ca2⫹ 兴i ⫽ Kd
F380 Ca free共R0 ⫺ Rmin兲
F380 Ca max共Rmax ⫺ R0 兲
(3)
where the dissociation constant (Kd) was assumed to be 225 nM based
on the work of Grynkyiewicz et al.37 Rmin is the ratio of fluorescence
measured at 340 nm (F340) over 380 nm (F380) in a nominally
Ca2⫹-free solution. Rmax is the ratio of fluorescence measured at 340
nm over 380 nm in the presence of saturating amounts of Ca2⫹ (10
mM) and ionomycin (10 ␮M) in the bathing solution. Drug actions
were measured only after steady state conditions were reached. All
calcium-imaging experiments were performed in dark at room temperature (20 –22°C) to minimize dye leakage. Images were digitized and
analyzed (Openlab2 software; Improvision, Coventry, UK). In all the
experiments performed using the calcium imaging technique, representative time course experiments are in [Ca2⫹]i fluorescence ratio
(340/380), and the histograms (average data) are presented as the
absolute changes in [Ca2⫹]i.
of cell volume require the participation of ion transport across
the cell membrane, including appropriate activity of Ca2⫹ and
K⫹ channels. K⫹ channel activity further maintains the cell
membrane potential that is a key determinant of Ca2⫹ entry
into the cell through Ca2⫹ channels.27 Ca2⫹ may, in addition,
enter through stretch-activated channels when hypotonic
shock is applied.
Characterization of the Outward Currents
in Human Lamina Cribrosa Cells
Hypotonic stretch has been reported in other cell types to
stretch the cell membrane.28,29,38 This procedure increases
cell membrane tension caused by cell swelling. Whole-cell
experiments were performed to evaluate outward currents in
response to hypotonic shock in LC cells. Figure 2A shows
typical traces of whole-cell currents recorded from an LC cell
under isotonic stretch (left panel), hypotonic stretch (middle
panel), and after washout (right panel). Cells displayed outward current rectification at positive membrane potentials.
The summary of whole-cell outward currents obtained from 23
cells is represented as the current-voltage (I–V) relationship
seen in Figure 2B. The reversal potential was approximately 0
mV, which is close to the theoretical Nernst potential for the
K⫹-selective channel in our experimental conditions. Wholecell mean conductance measured at ⫹100 mV was increased
from 114 ⫾ 5 pS under isotonic (control) conditions to 193 ⫾
6 pS under hypotonic conditions (n ⫽ 23; P ⬍ 0.05). Mean
maximal current density measured at Vp ⫽ ⫹100 mV was
13.3 ⫾ 11 pA/pF before and 99 ⫾ 8.5 pA/pF (at Vp ⫽ ⫹100
mV) after hypotonic stretch, and the difference was statistically
different (n ⫽ 23; P ⬍ 0.05). The current increase was reversed
Statistical Analysis
Data are presented as mean ⫾ SEM for a series of the indicated number
of experiments. Statistical analysis of the data was performed using
t-tests and one-way ANOVA followed by Tukey post hoc test to compare multiple groups, with P ⱕ 0.05 considered significant. The use of
a paired test reflected that control and experimental measurements
were obtained in the same cell.
Patch-clamp data analysis (Clampfit software of the p-clamp suite
version 9.2; Molecular Devices, Eugene, OR) and data analysis and
graphing (Origin 7.5; OriginLab, Northampton, MA) were performed.
RESULTS
Volume Change in LC Cells
The relative cell volume changes of LC cells in response to
hypotonic stretch were measured as described in Materials and
Methods. Exposure of LC cells to hypotonic solution resulted
in a marked increase in cell volume (maximum mean increase
of 30.4% ⫾ 0.4% [n ⫽ 5 experiments; 31 cells; P ⬍ 0.05]; Fig.
1) and then gradually recovered to nearly the original volume
after the return of LC cells to an isotonic solution. Alterations
Downloaded From: http://iovs.arvojournals.org/ on 06/18/2017
FIGURE 1. Regulatory volume changes in response to hypotonic
shock in LC cells. Time course of percentage of volume changes after
exposure of LC cells to a hypotonic bath solution (n ⫽ 5 experiments;
31 cells). LC cells were allowed to stabilize in isotonic solution for at
least 5 minutes before the application of hypotonic solution at room
temperature; mean cell volume promptly increased and then gradually
recovered after return to the initial isotonic solution. Arrows: time at
which osmolarity was changed to hypotonic and then back to isotonic
condition, respectively.
IOVS, January 2009, Vol. 50, No. 1
Membrane Stretch and Maxi-Kⴙ in Lamina Cribrosa Cells
197
FIGURE 2. Hypotonic-induced wholecell outward currents in LC cells.
(A) Original traces of whole-cell outward currents elicited by step voltage
increments (inset), recorded under
isotonic (iso) and hypotonic (hypo)
conditions and after a return to initial
conditions (washout). (B) Current-voltage relationship of whole-cell outward
currents recorded under isotonic, hypotonic, and after washout conditions.
Note the hypotonically induced activation of whole-cell, outwardly rectifying
currents at positive potentials from
⫹20 mV to ⫹100 mV.
on return to isotonic conditions (washout) 28.6 ⫾ 8.7 pA/pF
(at Vp ⫽ ⫹100 mV; n ⫽ 23). These current profiles resembled
maxi-K⫹ currents23,26; therefore, we used the potassium channel blocker BaCl2 to test whether the outward currents observed in LC cells were K⫹ currents and found that they were.
Tetraethylammonium (TEA) was then used to test whether the
K⫹ currents were Ca2⫹-dependent, and iberiotoxin (Ibtx) was
used to test the maxi-K⫹ signature. Comparable studies have
been reported by Fernández-Fernández et al.23 in human bronchial epithelial cells. Adding K⫹ channel blockers, TEA (5 mM;
n ⫽ 8; P ⬍ 0.02) and Ba2⫹ (5 mM; n ⫽ 8; P ⬍ 0.02) or Ibtx (100
nM; n ⫽ 12; P ⬍ 0.02) resulted in a large inhibition of the
outward current (Fig. 3), indicating that most of the outward
current in LC cells occurs through K⫹ channels.
Effect of Iberiotoxin on Hypotonic-Induced
Kⴙ Currents in Human LC Cells
The identity of the hypotonic-induced K⫹ channels was investigated by treatment of LC cells with Ibtx, a well-known specific blocker of Ca2⫹-dependent maxi-K⫹ channels. Figure 4A
shows that Ibtx blocked the outward current in all tested cells.
On average (Fig. 4B), the mean peak current density measured
at ⫹100 mV was 112 ⫾ 2.5 pA/pF before and 14.0 ⫾ 2.5 pA/pF
after 100 nM Ibtx (n ⫽ 9; P ⬍ 0.05). Thus, most of the outward
current (approximately 90%) activated in response to hypotonic stretch in LC cells was carried through Ca2⫹-dependent
maxi-K⫹ channels.
We examined the presence of maxi-K⫹ mRNA in LC cells by
RT-PCR analysis. Figure 4C shows that a single band of 309,
500, and 479 bp was obtained for each amplification product,
respectively. All the bands corresponded to the predicted size
of maxi-K⫹ mRNA amplimers. Subsequent sequencing of the
bands confirmed that they indeed corresponded to the large
conductance potassium (maxi-K⫹) sequence.
Downloaded From: http://iovs.arvojournals.org/ on 06/18/2017
Effect of Extracellular Ca2ⴙ on Maxi-Kⴙ Channels
and [Ca2ⴙ]i Increase in LC Cells during
Membrane Stretch
Because hypotonic shock increases [Ca2⫹]i and subsequently
activates maxi-K⫹ currents, whole-cell maxi-K⫹ currents were
recorded under conditions of low extracellular Ca2⫹, in which
Ca2⫹ was replaced by the same concentration of Mg2⫹. In the
presence of 2 mM extracellular Ca2⫹ (control), perfusion of
hypotonic solution induced a substantial increase of maxi-K⫹
currents from 26.3 ⫾ 5.2 pA/pF to 63.2 ⫾ 10.5 pA/pF (n ⫽ 12
cells; P ⬍ 0.02; Fig. 5A). This increase was nearly completely
prevented on removal of extracellular Ca2⫹ (Fig. 5B). These
results indicate that extracellular Ca2⫹ is required for the
activation of maxi-K⫹ channels during membrane stretch.
Parallel studies have been performed in Fura-2 AM–loaded LC
cells to examine the requirement of extracellular Ca2⫹ for the
increase of [Ca2⫹]i in response to hypotonic shock. Figure 5C
shows a representative experiment illustrating the time course of
the [Ca2⫹]i increases in response to hypotonic shock measured as
the 340/380 fluorescence ratio. In the presence of 2 mM extracellular Ca2⫹ (control), the hypotonic-induced increase in [Ca2⫹]i
levels was a transient peak followed by a gradually sustained
increase in [Ca2⫹]i with levels above the baseline. Under the
nominally extracellular Ca2⫹-free conditions (0 mM Ca2⫹), in the
presence of 0.5 mM EGTA in the bath solution, this Ca2⫹ response was almost completely blocked (7.06 ⫾ 1.12 nM; n ⫽ 11;
91 cells; P ⬍ 0.05; Figs. 5C, 5D). Taken together, these results
indicate that Ca2⫹ influx from the extracellular environment plays
an important role in hypotonic-induced [Ca2⫹]i increases.
Effect of Thapsigargin on [Ca2ⴙ]i in Human LC Cells
To examine whether intracellular stores also contribute to the
increase of [Ca2⫹]i in response to hypotonic cell membrane
198
Irnaten et al.
IOVS, January 2009, Vol. 50, No. 1
FIGURE 3. Effect of K⫹ channel blockers on whole-cell basal current in LC
cells. (A–C; left, middle) Typical traces
of whole-cell K⫹ currents obtained as
described in Figure 2 under (control)
isotonic conditions in the presence or
absence of (A) 100 nM Ibtx, (B) 5 mM
Ba2⫹, and (C) 5 mM TEA in the bath
solution. (A–C; right) Measured K⫹
current densities depicted in pA/pF
(recorded at ⫹100 mV) in the absence
of (Cont) or after treatment by (A) 100
nM Ibtx (n ⫽ 12), (B) 5 mM Ba2⫹ (n ⫽
8), or (C) 5 mM TEA (n ⫽ 8). *Values
statistically different from untreated
(cont) cells (P ⬍ 0.02). Cont, control.
stretch, we tested the effect of hypotonic stretch on [Ca2⫹]i
after treatment with 1 ␮M thapsigargin (TG), a well-known
inhibitor of the Ca2⫹-ATPase pump in endoplasmic reticulum
(Fig. 6). Treatment of LC cells with TG in Ca2⫹-free medium
produced a transient large peak increase of Ca2⫹. Readdition of
Ca2⫹ to the medium under hypotonic conditions resulted in a
normal Ca2⫹ response. The effect of TG on [Ca2⫹]i is summarized in Figure 6B. No significant difference in the hypotonic
stimulation of the [Ca2⫹]i was observed between control (untreated) and thapsigargin-treated LC cells, suggesting the
source of Ca2⫹ mobilization is mainly extracellular calcium
entry into the cell.
FIGURE 4. Effect of iberiotoxin on hypotonic-induced maxi-K⫹ currents in
LC cells. Addition of 100 nM Ibtx
blocked the hypotonic-induced maxi-K⫹
current. (A) Representative maxi-K⫹
current traces recorded under isotonic
conditions (Iso), 5 minutes after the
cell was bathed in hypotonic solution
(5 minutes Hypo), and after 3 minutes
under hypotonic conditions in the
presence of Ibtx (3 minutes Hypo ⫹
100 nM Ibtx). (B) Mean ⫾ SEM of K⫹
current densities obtained at ⫹100 mV
under isotonic (Iso) and hypotonic
(Hypo) conditions and after the addition of 100 nM Ibtx (Hypo ⫹ Ibtx) in
LC cells (n ⫽ 9). *Results are statistically different in the presence or absence of Ibtx under hypotonic conditions (P ⬍ 0.05; Hypo vs. Hypo ⫹
Ibtx). (C) RT-PCR product of three different primers coding for three distinct
regions of maxi-K⫹ channel protein. A
single band of 309, 500, and 479 bp
(lanes 1–3) was obtained for each RTPCR product, respectively. M represents a 100-bp molecular marker. All
the bands corresponded to the predicted size of maxi-K⫹ mRNA amplimers and were sequence verified.
Downloaded From: http://iovs.arvojournals.org/ on 06/18/2017
IOVS, January 2009, Vol. 50, No. 1
Membrane Stretch and Maxi-Kⴙ in Lamina Cribrosa Cells
199
FIGURE 5. Effect of extracellular Ca2⫹ concentration on cell swelling–activated maxi-K⫹ currents in LC
cells. (A) Current-voltage relationship of maxi-K⫹ current densities recorded with the voltage protocol in
the presence of extracellular Ca2⫹ under isotonic (Iso) or hypotonic (Hypo) conditions (n ⫽12 for each
condition). (B) Maxi-K⫹ current densities recorded under isotonic (Iso) or hypotonic (Hypo) conditions
in the absence of extracellular Ca2⫹ (n ⫽ 12 for each condition). (C) Time course of changes in [Ca2⫹]i
in a representative human LC cell measured as the ratio of emitted fluorescence (340/380) in response to
normal Ca2⫹-containing (2 mM Ca2⫹) and Ca2⫹-free (0 mM Ca2⫹) hypotonic solutions. First arrow: start
of the experiment. Second arrow: time at which osmolarity was changed. (D) Mean ⫾ SEM of the [Ca2⫹]i
(in nM) in Fura-2 AM–loaded LC cells from multiple experiments calculated as the maximum increase in
[Ca2⫹]i in response to hypotonic shock in the presence (2 mM) or absence (0 mM) of [Ca2⫹]o (n ⫽ 5; 45
cells). We compared the results in the presence or absence of 2 mM [Ca2⫹]o. *P ⬍ 0.05.
Effect of Gd3ⴙ on Basal and Swelling Activated
Channels and [Ca2ⴙ]i in Human LC Cells
Gadolinium is known to block stretch-activated ion channels.39
Whole-cell currents were recorded in LC cells under hypotonic
conditions in the presence or absence of Gd3⫹. Gd3⫹ did not
affect basal whole-cell current densities under isotonic conditions, but it did prevent the increase in whole-cell currents in
response to hypotonic cell membrane stretch (Fig. 7A).
The effect of Gd3⫹ was also tested on [Ca2⫹]i in Fura-2
AM–loaded LC cells (Figs. 7B, 7C). In the absence of Gd3⫹,
hypotonic cell membrane stretch induced a significant transient increase in [Ca2⫹]i (113 ⫾ 8.23 nM; n ⫽ 15; 125 cells;
P ⬍ 0.05) compared with normalized basal levels (the basal
level of [Ca2⫹]i is normalized to 0 nM). However, when cells
were preincubated with Gd3⫹, the [Ca2⫹]i increase in response to hypotonic stress was nearly completely prevented
(8.5 ⫾ 3 nM; n ⫽ 9; 84 cells; P ⬍ 0.05). The effect of Gd3⫹ on
[Ca2⫹]i is summarized in Figure 7C. Taken together, these
results suggest that the hypotonic cell membrane stretch-induced [Ca2⫹]i elevation occurs through Gd3⫹-sensitive SAC.
DISCUSSION
Increased IOP is a well-recognized risk factor for the development of glaucomatous optic neuropathy, and the LC region of
the ONH is believed to be the primary site of glaucomatous
damage in POAG.4,5 The pathogenesis of POAG is still unknown but is likely to be multifactorial, with mechanical,
vascular, and other factors influencing individual susceptibility
Downloaded From: http://iovs.arvojournals.org/ on 06/18/2017
to optic nerve damage.40 Increased IOP induces significant
deformation of the level of the LC3 and consequently the LC
cells. Among the different types of stresses experienced by
these cells are shear, compressive, and stretch.41 Different
models have been used to investigate the mechanosensitive
mechanisms in different cell types, including cyclic stretch,
hydrostatic pressure, and hypotonic stress. The hypotonic
stress model has been used in many different cell types to
stretch the cell membrane.42 Hypotonic cell swelling has also
been shown to activate a variety of ion channels, ion transporters, and their regulatory proteins.27 In addition, this model
activates various second-messenger systems, such as increases
in the intracellular levels of Ca2⫹, cAMP inositol triphosphate,
and arachidonic acid metabolites.43 We previously demonstrated the profibrotic nature of human LC cells when exposed
to stress in the form of cyclical stretch or TGF-␤.10,13 This led
us to believe that LC cells play an important role in the pathogenesis of glaucoma. Thus, to further our understanding of this
LC mechanotransduction process, our goals were to investigate the mechanism(s) by which LC cells respond to a stretch
paradigm and to identify the mechanosensitive pathway in the
LC cell.
In this study, we choose the hypotonic cell membrane
rather than the physical cell membrane as a model to stretch
the LC cell membrane because the hypotonic cell membrane
stretch model allowed us to use the same experimental conditions for the Fura-2 AM experiments (calcium imaging) and the
patch-clamp recordings. The use of different stretch models
(i.e., hypotonic stretch and mechanical cyclic stretch) would
200
Irnaten et al.
FIGURE 6. Effect of thapsigargin on [Ca2⫹]i in LC cells. (A) Representative time tracings of [Ca2⫹]i in Fura-2 AM–loaded cells resuspended in
isotonic solution under Ca2⫹-free conditions in the presence of thapsigargin (TG; 1 ␮M), followed by the removal of TG and the readdition
of Ca2⫹ to the medium under hypotonic conditions. First arrow: start
of the experiment (under isotonic conditions). Second arrow: time at
which the bath was changed to hypotonic solution. (B) Mean ⫾ SEM
of the [Ca2⫹]i (in nM) in Fura-2 AM–loaded LC cells from different
experiments calculated as the maximum increase in [Ca2⫹]i in response to hypotonic shock in the absence or presence of thapsigargin
(n ⫽ 9; 72 cells). Note that there was no significant difference between
untreated (Cont) and thapsigargin-treated LC cells.
give us data that might not be entirely compatible and might
lead to some misinterpretations.
With the use of hypotonic shock as a model to stretch the
cell membrane, we first examined the changes in cell volume.
The results showed that exposure of LC cells to hypotonic
solution resulted in a marked increase in cell volume, followed
by the return to near-original volume when the cells were
returned to isotonic conditions.
Given that it is well known that changes of cell volume
require the participation of ion transport across the cell membrane, we examined the ion channels involved in response to
hypotonic stretch in LC cells. In this study, we provide evidence that a channel exhibiting [Ca2⫹]i dependence and other
properties, similar to those of the Ca2⫹-activated maxi-K⫹
channel, is present in LC cells. To our knowledge, the presence
of maxi-K⫹ in LC cells has not previously been investigated,
and our experiments show a significant decrease in cell membrane currents when cells were treated with BaCl2, TEA, or
Ibtx, indicating that K⫹ channels play an important role in
generating cell membrane potential in LC cells. Ibtx blocked
the hypotonic-induced membrane current, indicating that most
of the outward currents activated in response to membrane
stretch are carried out by maxi-K⫹ channels. These results are
Downloaded From: http://iovs.arvojournals.org/ on 06/18/2017
IOVS, January 2009, Vol. 50, No. 1
consistent with those from previous studies on pituitary tumor
cells, trabecular meshwork cells, and parotid acinar cells.21,44,45
In addition, RT-PCR product sequencing revealed the presence
of mRNA for maxi-K⫹ channel in these LC cells, supporting the
electrophysiological data.
Although the characteristics of maxi-K⫹ currents reported
in this study (dependence on the extracellular Ca2⫹, sensitivity
to Ibtx) compare well with those reported in a number of
other cell types,28,29,38 the mechanism that mediates hypotonic-induced, [Ca2⫹]i-dependent, maxi-K⫹ activation is less defined. Our results show that in LC cells, the activity of [Ca2⫹]i
and maxi-K⫹ were increased after hypotonic challenge. These
increases were inhibited by the removal of extracellular Ca2⫹
but not by the depletion of internal [Ca2⫹]i stores (using
thapsigargin), indicating that Ca2⫹ influx through the cell
membrane plays an important role in hypotonic-induced
[Ca2⫹]i increases, though internal releases (other than the
endoplasmic reticulum Ca2⫹-ATPase pump) may also contribute at some minor level. The well-known phenomenon of
calcium-induced calcium release (CICR) through ryanodine
receptors on the endoplasmic reticulum (ER) is stimulated by
Ca2⫹ influx.46 The use of thapsigargin empties the ER, thus
preventing CICR. Hypotonic stretch in a calcium-free bath
obviously prevents calcium influx and any possible CICR.
Stretching the cells in a 2-mM Ca2⫹ bath solution, after emptying the ER stores, showed an increase in [Ca2⫹]i similar to
stretch in 2 mM Ca2⫹ without thapsigargin treatment, indicating the increase is likely to be from the extracellular environment (with a possible minor contribution from calcium-regulated store release from other intracellular stores such as
mitochondria).
It has been shown that the [Ca2⫹]i response to extracellular
stimulus is biphasic, consisting of an initial rapid, transient
increase and a slower sustained rise.24 The initial peak increase
in [Ca2⫹]i mobilization has been attributed to the release of
calcium from cytosolic stores, predominantly in the ER. The
later sustained increase in [Ca2⫹]i, however, has been attributed to the influx of extracellular calcium through the activation of Ca2⫹ channels.24,44,47 Our results are consistent with
this concept because we showed both the initial transient
spike and the subsequent slow sustained rise in [Ca2⫹]i during
membrane stretch.
We showed that the hypotonic stretch-induced [Ca2⫹]i increase and the subsequent maxi-K⫹ activation were significantly inhibited by Gd3⫹. As Gd3⫹ blocks the Ca2⫹-permeable
SAC channels, we hypothesized that Ca2⫹ influx might be
ascribed to the activation of SACs by hypotonic shock. The
primarily distinctive property of SACs is that their gating is
dependent on membrane tension. SACs are selective and permeable to various cations,48 particularly divalent cations, allowing Ca2⫹ influx during stretch. It has been proposed that
Ca2⫹ may function as a second messenger for translating mechanical perturbation to regulation of ion transport,49 which
may provide an important role in cell volume regulation. SACs
thus seem capable of mechanotransduction, transferring mechanical signals to elevations in cytosolic calcium, thereby
activating membrane kinases to specifically phosphorylate
other signaling molecules. The activation of SACs followed by
Ca2⫹ entry is the primary signal transduction for the activation
of maxi-K⫹, and elevation of maxi-K⫹ channel activity in turn
enhances further Ca2⫹ entry. In summary, these results suggest
that (i) extracellular Ca2⫹ is required for the observed [Ca2⫹]i
response and activation of maxi-K⫹ channels in LC cells and (ii)
the maxi-K⫹ channels are not directly activated by cell swelling
but are secondary to Ca2⫹ influx through SACs. Comparable
results have been obtained in the human bronchial epithelial
cell line.23
IOVS, January 2009, Vol. 50, No. 1
Membrane Stretch and Maxi-Kⴙ in Lamina Cribrosa Cells
201
FIGURE 7. Effect of gadolinium on
hypotonic-induced whole-cell currents and [Ca2⫹]i increases in LC
cells. (A) Current-voltage relationship in LC cells showing whole-cell
K⫹ currents with the voltage protocol, under isotonic (Iso) solution and
during exposure to hypotonic (Hypo;
n ⫽ 10 for each condition) solution
in the presence (Iso ⫹ Gd3⫹, Hypo ⫹
Gd3⫹) or absence (Iso, Hypo) of 100
␮M Gd3⫹ (n ⫽ 10 for each condition). (B) Representative time tracings of [Ca2⫹]i in Fura-2 AM–loaded
LC cells resuspended in isotonic solution and during exposure to hypotonic solution in the presence (E) or
absence (F) of 100 ␮M Gd3⫹. First
arrow: start of the experiment. Second arrow: time at which osmolarity
was changed.. (C) Mean ⫾ SEM of
the [Ca2⫹]i (in nM) in Fura-2 AM–
loaded LC cells from different experiments calculated as the maximum
increase in [Ca2⫹]i in response to hypotonic shock in the presence or absence of Gd.3 We have compared the
results in the presence or absence of
Gd3⫹. *P ⬍ 0.05 (n ⫽ 9; 72 cells).
Maxi-K⫹ channels were first identified and classified in
chromaffin cell membranes in 1981 by Marty et al.50 Maxi-K⫹
channels are important components of cellular systems limiting Ca2⫹ entry and cell membrane excitability. They play a key
role in the maintenance of vascular smooth muscle tone
through cell membrane potential and Ca2⫹ entry regulation,51
Maxi-K⫹ channels are believed to be sensors of intracellular
Ca2⫹ and are found to regulate membrane potential in an
intracellular Ca2⫹-dependent manner.52 The role of the
maxi-K⫹ channels described here in the extracellular Ca2⫹mediated regulation of membrane current activated by hypotonic stretch is not entirely clear. Activation of this channel
under hypotonic conditions would tend to hyperpolarize the
cell membrane. In addition to these channels, there may be
other types of channels that determine the integrated response
of membrane current to hypotonic stretch in LC cells. Further
studies will be needed to clarify more fully the relationship
between changes in Ca2⫹ entry through SAC and the regulation of maxi-K⫹ channels in LC cells.
We hypothesize that the increased IOP in ocular hypertension and glaucoma results in LC cell membrane stretch, causing
activation of the maxi-K⫹ channels because of increases in
intracellular Ca2⫹ entering by way of SACs. This alteration in
[Ca2⫹]i could influence the regulation of ECM gene transcription, as has been described,10 and subsequently the matrix
structure of the LC region of the ONH. Any change in the
compliance of the LC region caused by altered ECM deposition
in glaucoma could contribute to the vulnerability of the
RGC axons under the border of increased IOP associated with
glaucoma.
References
1. Quigley H. Number of people with glaucoma worldwide. Br J
Ophthalmol. 1996;80(5):389 –393.
2. Hernandez M. The optic nerve head in glaucoma: role of astrocytes
in tissue remodeling. Prog Ret Eye Res. 2000;19(3):297–321.
Downloaded From: http://iovs.arvojournals.org/ on 06/18/2017
3. Burgoyne C, Downs J, Bellezza A, et al. The optic nerve head as a
biomechanical structure: a new paradigm for understanding the
role of IOP-related stress and strain in the pathophysiology of
glaucomatous optic nerve head damage. Prog Ret Eye Res. 2005;
24(1):39 –73.
4. Kolker H. Primary open angle glaucoma. St. Louis: Mosby; 1983:
55– 63.
5. Quigley H, Pease ME, Thibault D. Change in the appearance of
elastin in the lamina cribosa of glaucomatous optic nerve heads.
Graefes Arch Clin Exp Ophthalmol. 1994;232(5):257–261.
6. Howell GR, Libby RT, Jakobs TC, et al. Axons of retinal ganglion
cells are insulted in the optic nerve early in DBA/2J glaucoma.
J Cell Biol. 2007;179(7):1523–1537.
7. Quigley HA, Hohman RM, Addicks EM, Massof RW, Green WR.
Morphological changes in the lamina cribrosa correlated with
neural loss in open-angle glaucoma. Am J Ophthalmol. 1983;95:
673– 691.
8. Morrison J, Dorman-Pease M, Dunkelberger G, Quigley H. Optic
nerve head extracellular matrix in primary optic atrophy and
experimental glaucoma. Arch Ophthalmol. 1990;108(7):1020 –
1024.
9. Hernandez M, Ye H. Glaucoma: changes in extracellular matrix in
the optic nerve head. Ann Med. 1993;25(4):309 –315.
10. Kirwan R, Fenerty C, Crean J, et al. Influence of cyclical mechanical strain on extracellular matrix gene expression in human lamina cribrosa cells in vitro. Mol Vis. 2005;11:798 – 810.
11. Hernandez M, Igoe F, Neufeld A. Cell culture of the human lamina
cribrosa. Invest Ophthalmol Vis Sci. 1988;29(1):78 – 89.
12. Lambert W, Agarwal R, Howe W, et al. Neurotrophin and neurotrophin receptor expression by cells of the human lamina cribrosa.
Invest Ophthalmol Vis Sci. 2001;42(10):2315–2323.
13. Kirwan R, Leonard M, Murphy M, et al. Transforming growth
factor-beta-regulated gene transcription and protein expression in
human GFAP-negative lamina cribrosa cells. Glia. 2005;52(4):309 –
324.
14. Alenghat F, Nauli S, Kolb R, et al. Global cytoskeletal control of
mechano-transduction in kidney epithelial cells. Exp Cell Res.
2004;301(1):23–30.
202
Irnaten et al.
15. Wang J, Thampatty B. An introductory review of cell mechanobiology. Biomechanics Modeling Mechanobiol. 2006;5(1):1–16.
16. Sachs F. Stretch-activated ion channels. Kidney Int. 1995;48:
1134 –1147.
17. Speake T, Douglas I, Brown P. The role of calcium in the volume
regulation of rat lacrimal acinar cells. J Membr Biol. 1998;164(3):
283–291.
18. Criddle D, Gerasimenko J, Baumgartner H, et al. Calcium signalling
and pancreatic cell death: apoptosis or necrosis? Cell Death Differ.
2007;14(7):1285–1294.
19. Morales S, Diez A, Puyet A, et al. Calcium controls smooth muscle
TRPC gene transcription via the CaMK/calcineurin-dependent
pathways. Am J Physiol Cell Physiol. 2007;292(1):C553–C563.
20. Hoyer J, Distler A, Haase W, Gögelein H. Ca2⫹ influx through
stretch-activated cation channels activates maxi-K⫹ channels in
porcine endocardial endothelium. Proc Natl Acad Sci U S A.
1994;91(6):2367–2371.
21. Nehrke K, Quinn C, Begenisich T. Molecular identification of
Ca2⫹-activated K⫹ channels in parotid acinar cells. Am J Physiol
Cell Physiol. 2003;284(2):C535–C546.
22. Orio P, Rojas P, Ferreira G, Latorre R. New disguises for an old
channel: MaxiK channel beta-subunits. News Physiol Sci. 2002;17:
156 –161.
23. Fernández-Fernández J, Nobles M, Currid A, et al. Maxi-K⫹ channel
mediates regulatory volume decrease response in a human bronchial epithelial cell line. Am J Physiol Cell Physiol. 2002;283(6):
C1705–C1714.
24. Park K, Beck J, Douglas I, Brown P. Ca(2⫹)-activated K⫹ channels
are involved in regulatory volume decrease in acinar cells isolated
from the rat lacrimal gland. J Membr Biol. 1994;141(2):193–201.
25. McCarty N, O’Neil R. Calcium signaling in cell volume regulation.
Physiol Rev. 1992;72(4):1037–1061.
26. Gribkoff VK, Starrett JE, Dworetzky SI. Maxi-K potassium channels:
form, function, and modulation of a class of endogenous regulators
of intracellular calcium. Neuroscientist. 2001;7(2):166 –177.
27. Stumpff F, Strauss O, Boxberger M, Wiederholt M. Characterization of maxi-K-channels in bovine trabecular meshwork and their
activation by cyclic guanosine monophosphate. Invest Ophthalmol Vis Sci. 1997;38:1883–1892.
28. Mallouk N, Jacquemond V, Allard B. Elevated subsarcolemmal
Ca2⫹ in mdx mouse skeletal muscle fibers detected with Ca2⫹activated K⫹ channels. Proc Natl Acad Sci U S A. 2000;97(9):
4950 – 4955.
29. Dopico A, Kirber M, Singer J, Walsh J. Membrane stretch directly
activates large conductance Ca(2⫹)-activated K⫹ channels in mesenteric artery smooth muscle cells. Am J Hypertens. 1994;7(1):
82– 89.
30. Pluznick J, Sansom S. BK channels in the kidney: role in K(⫹)
secretion and localization of molecular components. Am J Physiol
Renal Physiol. 2006;291(3):F517–F529.
31. Moczydlowski E. The maxi-K⫹ channel of human myometrium
reveals a split personality. J Physiol. 2006;573(pt 2):286.
32. Brenner R, Jegla T, Wickenden A, et al. Cloning and functional
characterization of novel large conductance calcium-activated potassium channel beta subunits, hKCNMB3 and hKCNMB4. J Biol
Chem. 2000;275(9):6453– 6461.
33. Liu R, Persson AE. Simultaneous changes of cell volume and cytosolic calcium concentration in macula densa cells caused by alter-
Downloaded From: http://iovs.arvojournals.org/ on 06/18/2017
IOVS, January 2009, Vol. 50, No. 1
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
ations of luminal NaCl concentration. J Physiol (Lond). 2005;
563(pt 3):895–901.
Irnaten M, Aicher SA, Wang J, et al. Mu-opioid receptors are
located postsynaptically and endomorphin-1 inhibits voltage-gated
calcium currents in premotor cardiac parasympathetic neurons in
the rat nucleus ambiguus. Neuroscience. 2003;116(2):573–582.
Li GR, Sun H, Deng X, Lau CP. Characterization of ionic currents in
human mesenchymal stem cells from bone marrow. Stem Cells.
2005;23(3):371–382.
Giegerich R, Meyer F, Schleiermacher C. GeneFisher—software
support for the detection of postulated genes. Proceedings/International Conference on Intelligent Systems for Molecular
Biology; ISMB International Conference on Intelligent Systems
for Molecular Biology. 1996;4:68 –77.
Grynkiewicz G, Poenie M, Tsien RY. A new generation of Ca2⫹
indicators with greatly improved fluorescence properties. J Biol
Chem. 1985;260(6):3440 –3450.
Davidson R. Membrane stretch activates a high-conductance K⫹
channel in G292 osteoblastic-like cells. J Membr Biol. 1993;131(1):
81–92.
Gustin MC, Sachs F, Sigurdson W, et al. Single channel mechanosensitive currents. Science. 1991;253:800 – 801.
Fechtner R, Weinreb R. Mechanisms of optic nerve damage in
primary open angle glaucoma. Surv Ophthalmol. 1994;39(1):23–
42.
Sigal IA, Flanagan JG, Tertinegg I, Ethier CR. Predicted extension,
compression and shearing of optic nerve head tissues. Exp Eye
Res. 2007;85(3):312–322.
Raoux M, Rodat-Despoix L, Azorin N, et al. Mechanosensor channels in mammalian somatosensory neurons. Sensors. 2007;7:1667–
1682.
Strange K, Emma F, Paredes A, et al. Osmoregulatory changes in
myo-inositol content and Na⫹/myo-inositol cotransport in rat cortical astrocytes. Glia. 1994;12(1):35– 43.
Jakab M, Schmidt S, Grundbichler M, et al. Hypotonicity and
ethanol modulate BK channel activity and chloride currents in
GH4/C1 pituitary tumour cells. Acta Physiol. 2006;187(1–2):51–
59.
Soto D, Comes N, Ferrer E, et al. Modulation of aqueous humor
outflow by ionic mechanisms involved in trabecular meshwork
cell volume regulation. Invest Ophthalmol Vis Sci. 2004;45(10):
3650 –3661.
Ohta T, Endo M, Nakano T, et al. Ca2⫹-induced Ca2⫹ release in
malignant hyperthermia-susceptible pig skeletal muscle. Am J
Physiol. 1989;256(pt 1):C358 –C367.
Kawanabe Y, Nauli SM. Involvement of extracellular Ca2⫹ influx
through voltage-independent Ca2⫹ channels in endothelin-1 function. Cell Signal. 2005;17(8):911–916.
Morris CE. Mechanosensitive ion channels. J Membr Biol. 1990;
113: 93–107.
Sackin H. Mechanosensitive channels. Annu Rev Physiol. 1995;
57:333–353.
Marty A. Ca-dependent K channels with large unitary conductance
in chromaffin cell membranes. Nature. 1981;291(5815):497–500.
Jaggar J, Porter V, Lederer W, Nelson M. Calcium sparks in smooth
muscle. Am J Physiol Cell Physiol. 2000;278(2):C235–C256.
Kawano S, Hirayama Y, Hiraoka M. Activation mechanism of
Ca(2⫹)-sensitive transient outward current in rabbit ventricular
myocytes. J Physiol. 1995;486(pt 3):593– 604.