Microbiology (2004), 150, 1869–1879
DOI 10.1099/mic.0.26785-0
The transcription of the cbb operon in
Nitrosomonas europaea
Xueming Wei, Luis A. Sayavedra-Soto and Daniel J. Arp
Department of Botany and Plant Pathology, Oregon State University, Corvallis,
OR 97331-2902, USA
Correspondence
Daniel J. Arp
[email protected]
Received 24 September 2003
Revised 30 January 2004
Accepted 5 March 2004
Nitrosomonas europaea is an aerobic ammonia-oxidizing bacterium that participates in the
C and N cycles. N. europaea utilizes CO2 as its predominant carbon source, and is an obligate
chemolithotroph, deriving all the reductant required for energy and biosynthesis from the oxidation
of ammonia (NH3) to nitrite (NO2”). This bacterium fixes carbon via the Calvin–Benson–Bassham
(CBB) cycle via a type I ribulose bisphosphate carboxylase/oxygenase (RubisCO). The
RubisCO operon is composed of five genes, cbbLSQON. This gene organization is similar to
that of the operon for ‘green-like’ type I RubisCOs in other organisms. The cbbR gene encoding
the putative regulatory protein for RubisCO transcription was identified upstream of cbbL. This
study showed that transcription of cbb genes was upregulated when the carbon source was limited,
while amo, hao and other energy-harvesting-related genes were downregulated. N. europaea
responds to carbon limitation by prioritizing resources towards key components for carbon
assimilation. Unlike the situation for amo genes, NH3 was not required for the transcription of
the cbb genes. All five cbb genes were only transcribed when an external energy source was
provided. In actively growing cells, mRNAs from the five genes in the RubisCO operon were
present at different levels, probably due to premature termination of transcription, rapid
mRNA processing and mRNA degradation.
INTRODUCTION
Nitrosomonas europaea is an aerobic ammonia-oxidizing
bacterium that participates in the C and N cycles and
hence is involved in events that affect the environment
(Bock et al., 1986). As an obligate chemolithotroph N.
europaea derives all the reductant it requires for energy and
biosynthesis from the oxidation of ammonia (NH3) to
nitrite (NO{
2 ) (Winogradsky, 1931). This bacterium is an
autotroph that utilizes CO2 as its primary carbon source
(Bock et al., 1991). Organic compounds such as acetate,
2-oxoglutarate, succinate, some amino acids, and possibly
some sugars are also taken up and metabolized by
N. europaea, albeit at low levels relative to heterotrophic
bacteria, and typically at levels insufficient to fulfil the
carbon requirement of the bacterium (Clark & Schmidt,
1966, 1967; Martiny & Koops, 1982; Wallace et al., 1970).
However, in the absence of added CO2, N. europaea can
grow with fructose or pyruvate as the sole C source
(Hommes et al., 2003).
Autotrophic nitrifiers assimilate CO2 via the Calvin–
Benson–Bassham (CBB) cycle. Genetic information about
the enzyme that catalyses CO2 fixation in N. europaea was
Abbreviations: AMO, ammonia monooxygenase; HAO, hydroxylamine
oxidoreductase; PRK, phosphoribulokinase; RubisCO, ribulose bisphosphate carboxylase/oxygenase.
0002-6785 G 2004 SGM
revealed by the sequence of its genome (Chain et al., 2003).
The DNA sequence suggests that the enzyme is a type I
ribulose bisphosphate carboxylase/oxygenase (RubisCO).
Most of the genes encoding the enzymes for a complete
CBB cycle are present in the genome. The two missing
genes are those encoding sedoheptulose 1,7-bisphosphatase
(EC 3.1.3.37) and NADPH-dependent glyceraldehyde-3phosphate dehydrogenase (EC 1.2.1.13). However, fructose
1,6-bisphosphatase (EC 3.1.3.11) in N. europaea may
function primarily for sedoheptulose 1,7-bisphosphate
hydrolysis in the CBB cycle, rather than for fructose 1,6bisphosphate hydrolysis in gluconeogenesis (Yoo & Bowien,
1995). NADPH-dependent glyceraldehyde-3-phosphate
dehydrogenase is apparently replaced by an NADHdependent enzyme (EC 1.2.1.12) (Chain et al., 2003).
There are two recent reports on the cbb genes of ammoniaoxidizing bacteria. In one, Hirota et al. (2002) cloned and
sequenced the cbbLS genes of Nitrosomonas ENI-11 and
expressed functional RubisCO activity in Escherichia coli.
In the other, Utåker et al. (2002) cloned and sequenced the
cbbLS genes of Nitrosospira sp. isolate 40KI and showed its
functionality in a cbb-deletion strain of Ralstonia eutropha.
However, to date there are no reports describing the
transcription patterns and regulation of the cbb genes in
ammonia-oxidizing bacteria. Instead, most research has
focused on the genetic makeup and the regulation for the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
Printed in Great Britain
1869
X. Wei, L. A. Sayavedra-Soto and D. J. Arp
utilization of ammonia in N. europaea and other ammoniaoxidizing bacteria (Arp et al., 2002; Hommes et al., 1998,
2001; Klotz & Norton, 1995, 1998; Norton et al., 1996). The
two key enzymes in this process, ammonia monooxygenase
(AMO) and hydroxylamine oxidoreductase (HAO), catalyse
the sequential oxidation of NH3 to NO{
2 . The genetic loci
for AMO and HAO are in multiple copies in nitrifiers. In
N. europaea there are two gene copies for AMO and three
gene copies for HAO (compared to a single gene copy for
RubisCO). Mutation of the different gene copies of AMO
and HAO indicated that no copy was indispensable,
although some phenotypes were different from the wildtype (Hommes et al., 1996, 1998; Stein et al., 2000). Transcript analysis and mutagenesis studies suggested that the
transcription of the amoCAB operon may be regulated by
more than one promoter (Hommes et al., 2002; Stein et al.,
2000). In this work, the transcription and regulation of cbb
genes in response to major nutrients and environment
factors were characterized.
METHODS
Media, bacterial cultures, determination of enzyme activities
and materials. N. europaea (ATCC 19178) was grown in batch
cultures as previously described (Ensign et al., 1993; Stein & Arp,
1998). Cells were harvested from 3-day-old or mid- to late-exponentialphase cultures by centrifugation. The cells were washed in NHz
4 free, CO2{
3 -free buffer to remove residual growth medium. The
NH3 deprivation (starvation) treatments were prepared by incubat2{
ing cells in NHz
4 -free, CO3 -free medium for 16 h in order to
deplete most mRNAs and to avoid the toxic effects of accumulated
metabolites (Stein & Arp, 1998). For the experiments where cells in
stationary phase were necessary, the cells were harvested 3 days after
reaching the maximum OD600 (~0?07). Because the pH of the
medium in the cultures decreases as nitrite accumulates, NH3
becomes limiting in stationary phase (depriving the cells of the
growth substrate). It is known that the mRNAs of AMO and HAO
are induced upon incubation in NHz
4 and decrease to negligible
amounts upon approximately 1 day of starvation (Sayavedra-Soto
et al., 1996). The induction experiments involving gases were carried
out in bottles sealed with grey butyl septa. In the O2 limitation
experiments, a vacuum gas manifold was used to replace headspace
air with N2. The intended O2 and CO2 levels were added to the
bottles through septa by injecting pure O2 and CO2 as necessary.
The headspace CO2 and O2 levels were determined using a
Shimadzu GC8A gas chromatograph equipped with a thermal conductivity detector and a 4 ft (1?2 m) Porapak Q column. In experiments requiring the inactivation of AMO, acetylene was injected at
2 % (v/v) and allowed to equilibrate with the cell suspension in
NH3-free medium for 1 h before an energy source was added.
Induction of mRNA transcription and enzyme activities was commonly done by incubation with the inducing agent at 30 uC on a
rotary shaker at 100 r.p.m. for 2 h. Nitrite concentration was determined colorimetrically using the Griess reagent (sulfanilamide and
N-naphthylethylenediamine) (Hageman & Hucklesby, 1971).
Nucleic acid manipulation and hybridization. RNA was isolated
as described by Reddy & Gilman (1993) and Vangnai et al. (2002).
Briefly, 250 ml acid phenol, 250 ml chloroform, SDS to 1 % and
sodium acetate to 0?3 M were added to 500 ml cell suspension in
buffer (2 mM MgCl2 and 50 mM NaH2PO4, pH 7?5). The cell suspension was mixed thoroughly and centrifuged for 5 min at 16 000 g.
The total RNA was precipitated with ethanol and resuspended in
1870
diethylpyrocarbonate (DEPC)-treated water. When necessary, cells
were resuspended in a solution of NaN3 (1 mM) and aurintricarboxylic acid (1 mM) (Reddy & Gilman, 1993), or in a commercial
RNA stabilizer solution (RNAlater; Ambion), to prevent mRNA
changes and degradation during sample preparation. For Northern
hybridization analysis, total RNA was resolved in denaturing 1?2 %
agarose gels (Sambrook et al., 1989). Prior to electrophoresis, RNA
was stained with ~5 mg ethidium bromide ml21 in the loading
buffer. The RNA was blotted onto Nytran membranes (Schleicher
& Schuell BioScience). Probes for hybridization were generated
by PCR with primers specific for each gene and labelled by
random priming (Prime-a-Gene Labelling System, Promega) with
[a32P]dCTP (3000 Ci mmol21, 110 TBq mmol21; ICN). Hybridization was carried out as described by Sambrook et al. (1989) and
Sayavedra-Soto et al. (1998). Images and relative signal densities
were obtained by phosphorimaging and ImageQuant softwares as
described by the manufacturer (Molecular Dynamics).
DNA preparation, restriction digestions and agarose gel electrophoresis were done as described by Sambrook et al. (1989). The recovery
of DNA fragments was carried out with a commercial kit (Qiagen).
PCR was performed with Taq DNA polymerase (Promega). RT-PCR
was done with M-MLV reverse transcriptase (Promega) according to
the manufacturer’s instructions, with a 50 uC extension temperature.
RNA templates for RT-PCR were treated with RQ1 DNase (Promega)
or ‘DNA-free’ DNase (Ambion) multiple times until no DNA product
was detected by Taq DNA polymerase in a PCR with any of the cbb
primers used. The primers used in the PCR and RT-PCR experiments
are listed in Table 1.
The start of transcription was determined using a commercial kit
(GeneRacer; Invitrogen). Briefly, the RNA oligonucleotide provided
in the kit was ligated with RNA ligase to the 59-ends of the mRNA
pool as directed by the manufacturer. The corresponding cDNA was
then made with a cbbL-specific reverse primer, followed by PCR
amplification of the chimeric DNA fragment with the cbbL reverse
primer and the kit’s forward primer. Twelve chimeric fragments
were cloned and sequenced. The start of transcription was at the
nucleotide where ligation of the 59-end of the mRNA and the
oligonucleotide occurred.
Total cell protein was estimated by the biuret method (Gornall et al.,
1949) and the protein composition was analysed by PAGE as described
by Hyman & Arp (1993).
RESULTS
N. europaea cbb operon characterization
The putative RubisCO operon in this bacterium is composed of five genes, namely cbbLSQO and a fifth gene here
designated cbbN. This composition was deduced from the
nucleotide sequence of the genome of N. europaea and gene
similarity comparisons. In this operon, cbbL and cbbS code
for the RubisCO large and small subunits respectively. The
genes cbbQ and cbbO encode proteins that are expected to
be involved in the processing, folding, assembling, activation and regulation of the RubisCO complex enzyme as in
other organisms (Baxter et al., 2002; Hayashi et al., 1997,
1999). cbbN has the same orientation as cbbLSQO. The
intergenic region between cbbO and cbbN is only 20 bp, in
which no apparent promoter could be inferred from the
sequence, implying that it is transcribed from the same
cbb promoter. cbbN encodes a hypothetical protein of 101
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
Microbiology 150
cbb operon in N. europaea
Table 1. Primers used for the amplification of cbb and other genes and for RT-PCR
Primer for
Sequence (5§–3§)
Northern hybridization probes (forward/reverse)*
cbbL
CGGATATTCTGGCTTGCTTC/ACCACGGTACCTGAGTGGAG
cbbS
AAAAGTCGTTTGAGCGATCC/TAAATCACCATTGCGGTTCC
cbbQ
TGAGCGATGTTATCGAGCAG/AAAAGTCGTTACCGCAGCAT
cbbO
CATCTGCCTGATGCCTATGA/ACGTGTCAACCCAGCATACA
cbbN
TTATTCGGGAGTCGATCAGG/TCAGGATTCGTCGCTGAGAT
cbbR
TGCTGCATATCACCTTACATCA/GTGCGGGTATTCGAGTGCTA
Carbonic anhydrase (NE1926)
CAGGCGATACAGCTGTTGAA/GCAATCACCTGACTCCGTTT
Succinate dehydrogenase
GTTCCGACGCCATGAATATC/CAGGCATCGACACAGTTCAT
Glutamate dehydrogenase
CATTCTCGTTACGCTGAGCA/GCCCGTAGAGACGATTCTTG
Phosphoribulokinase (NE1801)
GCTGAGAAGCCGTTTCAGTT/CATTCGCTTCAGCTTTACCC
Sulfate transporter (NE1927)
TTTCTCCGGGATTATTGCTG/ACCCCATCATTTTTCTCGTG
For RT-PCR (FW, forward; RVS, reverse)
cbbL-FW2
CACTGGAAGCTTGTGTGGAA
cbbS-FW2
AGGTTGGAATCCGGCTGTT
cbbQ-FW2
GATGTTCATGCAGCTTGTCG
cbbQ-RVS2
CCATGCCATGTACTCGACAA
cbbQ-RVS3
TTGTGCATCAAGCAGAAACC
cbbO-RVS2
TGACAACATCGTCACCGACT
cbbO-FW2
GTCTCGATCCTCGTGCAGAT
cbbO-RVS3
GGCGGCTGTAACAGAGGTAG
For transcript analysis
cbbL (reverse)
GTGCCGGTATTCTTTAACACCAGCGTTATAAGTCT
cbbL (reverse, nested)
TGCTGACATTTACGTAATCTCCTTG
*For amoA and hao primers, see Hommes et al. (2001).
amino acids and has no similarity to known annotated
genes. A putative regulatory gene, cbbR, was found 194 bases
upstream of the start codon of cbbL and is transcribed in
the opposite direction. The deduced amino acid sequence
of N. europaea cbbR is most similar to that of Thiobacillus
denitrificans (NCBI: AF307090) and Allochromatium vinosum (formerly Chromatium vinosum) (Viale et al., 1991). In
other species, cbbR is identified as a LysR-type regulatory
gene (Shively et al., 1998). The cbb genes, including cbbR, are
contained in a 6581 nucleotide DNA fragment (Fig. 1A). A
stem–loop structure was identified in the intergenic region
between cbbS and cbbQ with a calculated free energy (DG0)
of 2155 kJ mol21. The stem–loop is formed by 101 of the
119 nucleotides that form the intergenic region and may
have a regulatory or processing role.
The organization of the N. europaea cbb operon is similar
to that in All. vinosum (Viale et al., 1989), Acidithiobacillus
ferrooxidans (formerly Thiobacillus ferrooxidans) (Kusano
& Sugawara, 1993; Kusano et al., 1991), Methylococcus
capsulatus (Tichi & Tabita, 2002) and Rhodobacter capsulatus (Baxter et al., 2002; Paoli et al., 1998). In these
organisms, cbbLSQ is a common block, a feature of ‘greenlike’ type I RubisCO genes. The term ‘green-like’ type I
RubsiCO implies similarity to the RubisCOs in plants and
green algae (Utåker et al., 2002). The N. europaea cbbLSQO
http://mic.sgmjournals.org
block is similar to the Rb. capsulatus cbbI operon
(Vichivanives et al., 2000) and Hydrogenophilus thermoluteolus (Terazono et al., 2001). A sequence database search
revealed that N. europaea CbbL is most similar to that of
Ac. ferrooxidans (91 % amino acid sequence) (Heinhorst
et al., 2002), T. denitrificans (90 %) (Hernandez et al., 1996),
All. vinosum (87 %) (Viale et al., 1989) and Hydrogenophaga
pseudoflavas (86 %) (Lee & Kim, 1998). In contrast, the
N. europaea CbbL protein shares only 85 % amino acid
identity with that of Nitrosomonas sp. strain ENI-11 (Hirota
et al., 2002), and has much lower identity to that in other
nitrifying bacteria (e.g. ¡83 % for Nitrobacter vulgaris;
GenBank accession no. L2285) and some Nitrosospira
species (Utåker et al., 2002). N. europaea CbbS is most
similar to that of T. denitrificans (83 %) and Ac. ferrooxidans
(79 %) (Pulgar et al., 1991). As with CbbL, N. europaea CbbS
showed only 53 % amino acid sequence similarity to the
CbbS of both Nitrosomonas sp. strain ENI-11 (Hirota et al.,
2002) and Nitrobacter vulgaris. cbbQ is similar to nirQ, a
denitrification gene in Pseudomonas species (Yokoyama
et al., 1995). The N. europaea CbbO shares 50 % amino acid
identity to the putative Ac. ferrooxidans CbbO-like protein
(AJ133725.1), and 40 % to the H. thermoluteolus CbbO
(Hayashi et al., 1997). CbbO has moderate similarity to
the probable denitrification protein NorD (AE004489.1).
In H. thermoluteolus, cbbY is downstream of cbbLSQO.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
1871
X. Wei, L. A. Sayavedra-Soto and D. J. Arp
Fig. 1. The RubisCO gene organization in
N. europaea. (A) Arrows indicate the orientation of the genes. The numbers are DNA
segment lengths in bp for genes (upper)
and intergenic regions (lower). (B) Detection
of intergenic regions by RT-PCR. The bars
indicate the regions amplified by RT-PCR.
The amplified products were resolved on an
agarose gel. The ‘PCR only’ lane is a control
reaction performed without reverse transcriptase to test for RNA purity. Lanes 1 to 5
correspond to the amplified cDNA fragments
located in the areas indicated by the bars
above. The numbers below the bars are the
size of the fragments in kb. Lane 6 is a
DNA size marker.
However, H. thermoluteolus cbbY and N. europaea cbbN
are different (771 bp vs 303 bp respectively) (Hayashi &
Igarashi, 2002; Hayashi et al., 2000; Terazono et al., 2001).
It is also worth noting that cbbY in other species is not
immediately downstream of cbbQ and is in a different
transcriptional unit (Gibson & Tabita, 1997).
The predicted molecular masses for N. europaea Cbb
proteins are as follows (kDa): CbbR, 34?9; CbbL, 52?9;
CbbS, 13?8; CbbQ, 29?8; CbbO, 88?4; CbbN, 11?4. The
molecular masses of N. europaea CbbL and CbbS are typical
of those RubisCOs in most autotrophic bacteria.
Analysis of the cbb promoter and intergenic
regions
The intergenic region between cbbR and cbbL is 194 bp
in N. europaea, compared to 213 bp in Nitrosomonas sp.
strain ENI-11 (Hirota et al., 2002), 182 bp in Ral. eutropha
(Kusian et al., 1995), 226 bp in All. vinosum (Viale et al.,
1989) and 144 bp in Ac. ferrooxidans (Pulgar et al., 1991).
The nucleotide sequence upstream of cbbL in N. europaea
does not show significant similarity to those of the abovementioned species. No putative promoter between other
cbb genes could be inferred by visual inspection and
promoter predicting programs (e.g. http://www.fruitfly.
org/seq_tools/promoter.html). Furthermore, the intergenic
spaces between cbbQ and cbbO (41 bp), and between cbbO
and cbbN (20 bp), are smaller than the considered 50 bp
minimum in most promoter-predicting programs (however, the possibility of a promoter overlapping the upstream
gene cannot be discarded).
Since none of the alignments with other autotrophic
bacteria provided convincing evidence for promoter and
1872
transcriptional start sites of the N. europaea cbb operon,
we proceeded to determine experimentally the 59 end of
the cbb transcript using a commercial kit (see Methods). Of
the 12 chimeric clones sequenced, five did not contain any
cbbL sequence and seven revealed two potential transcriptional start sites: two clones showed a thymidine, 79 bases
upstream of the ATG start codon of cbbL, and five clones
showed a guanine, 83 bases upstream of the ATG start
codon of cbbL (Fig. 2). The putative promoter region at
210 (TATAGT) and 235 (TTTAAC) bases shows similarity to the E. coli s70 consensus sequence (Fig. 2). The
235 region shows similarity to that in other autotrophic
bacteria such as Xanthobacter flavus and Ral. eutropha
(TTTANN) (reviewed by Shively et al., 1998). Two possible
start sites for the transcription of the cbb genes were also
identified in Nitrosomonas sp. ENI-11 (Hirota et al., 2002).
A feature of the regulatory regions of the RubisCO genes
in other bacteria is the AT-rich boxes found upstream of
the cbb operon (Schell, 1993). In N. europaea, an AT-rich
element (50 ATs out of 56 bp) can be readily identified in
the intergenic region of cbbR and L (Fig. 2). It is known
that CbbR belongs to the LysR-type regulators. LysR
regulators bind to DNA sequences with T/A-(N)11/12-A/T
inverted repeats (Goethals et al., 1992; Schell, 1993; Xu &
Tabita, 1994). In N. europaea several such symmetrical
repeats exist in the intergenic region of cbbR and cbbL
(Fig. 2).
Gene transcription of cbb operon
We wanted to determine if all five genes for the RubisCO
operon were transcribed in N. europaea under normal
growing conditions. We detected their cDNAs using RTPCR (Fig. 1B) and their mRNAs in Northern hybridizations
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
Microbiology 150
cbb operon in N. europaea
Fig. 2. The nucleotide sequence upstream
of N. europaea cbbL. The two putative
starts of transcription are in bold (+1/+1).
The numbers ”10 and ”35 indicate the
deduced promoter region. An AT-rich region
with at least 89 % AT composition is boxed.
The T/A-N11–14-A/T symmetry sequences
match the inverted arrowheads in the lines
next to the nucleotide sequence. The ribosome-binding site for cbbL is labelled as
RBS. The cbbL and cbbR start codons
(ATG) are indicated in bold italics at both
ends of the sequence.
(Fig. 3). The cbb mRNAs were detected at higher levels in
cells in growth medium than in NH3-deprived cells (Fig. 3).
Two transcripts were detected by the cbbL probe. One
transcript was approximately 1600 bases in length, corresponding to the length of cbbL plus the putative untranslated
regions. The other was approximately 2000 bases in length,
corresponding to the total length of cbbL, cbbS and the
intergenic regions. The cbbS probe detected a clear mRNA
for cbbLS (~2000 bases) and a faint hybridization signal
that could be attributed to cbbS (~350 bases). Probes for
cbbQ, cbbO and cbbN detected lower levels of mRNA
compared to the cbbLS signal. The cbbQ probe detected
possible mRNAs of 3500, 2000, 1500 and 900 bases. The
probes for cbbO and cbbN detected fragments smaller than
1500 bases, mostly in the form of a smear. In actively
growing cells, the levels of transcript of the five genes in
the RubisCO operon were not at equivalent levels. We were
also able to detect cbbR mRNA by Northern hybridization
(Fig. 3), demonstrating that it was transcribed during
growth, but it was present at much lower levels.
We tested which of the five cbb genes were cotranscribed.
We designed oligonucleotide primers to amplify the intergenic regions by RT-PCR. All four predicted fragments
spanning the intergenic regions were obtained (Fig. 1B),
suggesting that any given pair is linked in a transcript. Yet
an mRNA long enough to include all five components of
RubisCO was not detected consistently by Northern hybridization. Again, this result suggests that the cbb mRNA is
actively processed or it degrades rapidly, if indeed it is
transcribed from a single promoter.
The transcription of the genes for RubisCO was compared
to the transcription of key genes for (a) energy-harvesting
enzymes – AMO, HAO, glyceraldehyde 3-phosphate
dehydrogenase and succinate dehydrogenase, (b) carbon
metabolism – the anion transporter NE1927 (speculated
to transport sulfate or HCO{
3 ) and phosphoribulokinase
(PRK), and (c) N metabolism – glutamate dehydrogenase
and glutamate synthase. The genes for these enzymes were
all transcribed in growing cells but not in NH3-deprived
cells (data not shown). The mRNA for AMO was detected
in low amounts in NH3-deprived cells (see below). This
result differed from a previous observation where no amo
transcript was detected in starved cells (Sayavedra-Soto
et al., 1996). The preparation of NH3-deprived cells in this
study (at 30 uC for 16 h) was different from the previous
study, in which sedimented cells were incubated for a day
at 4 uC to deplete mRNA. Apparently, incubation in NHz
4 free medium allowed the cells to keep a detectable level of
amo mRNA. In contrast, the mRNAs of cbb and all other
genes we examined were not detected either in stationary
phase cells or in NH3-deprived cells (data not shown).
Profiles of cbb mRNA induction and decay
Fig. 3. Northern hybridizations showing the level of transcription of the cbb genes in (i) induced cells (actively growing) and
(s) starved cells (ammonia-deprived). The far left lane is an
RNA ladder. The experiment was repeated in triplicate with
similar trends. Equivalent amounts of RNA were loaded in all
lanes in the gel as estimated by staining with ethidium bromide.
http://mic.sgmjournals.org
The induction profiles of cbbL and cbbS were determined
in NH3-deprived cells upon transfer to growing conditions, and were compared to the induction profile of hao.
NH3-deprived cells had low levels of detectable hao and
RubisCO mRNAs by Northern hybridization. These cells,
upon transfer to fresh medium, produced the mRNAs for
cbbL and cbbS within 0?5 h (Fig. 4A). The mRNA of hao
increased as previously reported (Sayavedra-Soto et al.,
1996). In these induction experiments, the levels of the
mRNAs of cbbL and cbbS reached a maximum level at
around 2 h and decreased by 4 h (Fig. 4A). To determine
the biological half-life of the mRNAs, time-course depletion experiments were conducted (by following the net
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
1873
X. Wei, L. A. Sayavedra-Soto and D. J. Arp
0 0.5 1 2 4
h
Percentage of initial message
100
50
amoA
10
hao
5
cbbS
cbbL
1
5
10
15
Time of incubation (h)
20
Fig. 4. Time-course for cbbL and cbbS
induction and decay. (A) Northern hybridization
showing the time-course for the induction of
cbbL, cbbS and hao. Exponential-phase
cells were washed and starved overnight,
then induced in normal culture medium.
(B) Time-course for the depletion of cbbL
(#), cbbS ($), amoA (n) and hao (m)
mRNAs. Mid-exponential-phase cells were
transferred to ammonia-free medium and
incubated at 30 6C. Transcript levels were
determined by densitometry of the signals in
the Northern blots.
decrease in mRNA in cells deprived of energy source but
with no RNA synthesis inhibitors). Messages of cbbL and
cbbS declined much faster than those of amo and hao
(Fig. 4B, and blots not shown). After 16 h starvation,
messages from cbbL and cbbS were depleted to about 5 % of
initial levels, while the mRNAs for amo and hao were more
abundant compared to those of cbbL and cbbS (Fig. 4B).
Ammonia as a signal for gene transcription
NH3 is thought to be the main signal to induce the
transcription of amo in addition to providing energy for
all cellular functions (Hyman & Arp, 1995; SayavedraSoto et al., 1996). We wanted to determine whether it is a
signal for RubisCO gene transcription as well. Exposure
of N. europaea cells to acetylene (C2H2), a potent inactivator
of AMO, prevents NH3 use as an energy source. Cells
depleted of mRNA were transferred to growth medium in
the presence of C2H2 and tested for cbbLS gene transcription. In the presence of NH3 and C2H2, the mRNAs of cbbL
and cbbS were not transcribed (Fig. 5). To ensure that
the cells had sufficient energy to carry out transcription,
hydroxylamine (HA) was supplied to the cell in the presence of C2H2 with and without NH3. When NH3 oxidation
is inhibited, HA, the product of NH3 oxidation, can be
used as energy source by N. europaea cells. In the presence
of HA, the cbbL and cbbS mRNAs were detected regardless
of the absence or presence of NH3, as is evident in the
C2H2 treatments (Fig. 5). In agreement with what previously was reported (Sayavedra-Soto et al., 1996), amo
was transcribed in media containing NH3 and C2H2 (not
shown). In these cells, NH3 served as a signal to turn on
the transcription of amo, presumably at the expense of
internally reserved energy sources. However, in our experiments with cbbL and cbbS, NH3 was not required as a signal
and internally reserved energy sources were not sufficient
for their transcription. The genes for carbon fixation were
all transcribed at detectable levels as long as an energy
supply was available. The levels of cbbL and cbbS mRNA in
1874
Fig. 5. Dependence of cbbLS genes transcription on energy
source. Late-exponential-phase N. europaea cells were washed
and starved overnight, then transferred to NH3-free medium
with or without C2H2 and allowed to equilibrate for 1 h. The
medium was then supplemented with NH+
4 (ammonium sulfate,
25 mM), or hydroxylamine (HA, 1 mM), or both. After incubation
for 2 h, cells were harvested for RNA extraction and Northern
analysis (see Methods). The bottom panel shows the rRNAs
stained with ethidium bromide to show equivalent amounts in
the samples in the analysis. The experiment was repeated three
times and yielded similar trends.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
Microbiology 150
cbb operon in N. europaea
the HA treatment were higher than those in the treatments that contained NH3. In these treatments, faint
hybridization signals were detected for transcripts long
enough to contain up to five cbb genes (Fig. 5).
Effect of CO2 levels on transcription
The transcription of cbbL, cbbS, amo and hao in response
to gaseous CO2 (no Na2CO3 added to the medium) was
studied. The cbbL and cbbS mRNAs were detected at higher
levels in the treatments with low CO2. The cbbL message
level was over five times higher at air (0?03 %) CO2 than
at 3 % CO2 (Fig. 6). In contrast, the amo and hao mRNA
levels increased as the CO2 levels increased; the message
levels were about eight- and threefold higher, respectively,
at 3 % CO2 than at 0?03 %. This response was similar when
different levels of Na2CO3 were added to the medium (not
shown). The transcription levels of cbbL and cbbS decreased
as the carbonate (Na2CO3) levels in the medium increased.
As with CO2, the amo and hao mRNA levels and those
of the anion transporter (NE1927) and PRK, increased as
the concentration of Na2CO3 increased (data not shown).
In the absence of added Na2CO3 in the medium (i.e. air
CO2 only), the levels of the cbbL and cbbS mRNAs were
approximately sevenfold higher than that in the medium
Fig. 6. Effect of CO2 levels on the transcription of amoA, hao,
cbbL and cbbS in N. europaea. Exponential-phase cells were
washed and incubated in N-free, carbonate-free medium overnight. The cells were then induced for 2 h in growth medium
with various CO2 levels, and harvested for RNA isolation and
Northern analysis (see Methods). The numbers at the bottom of
the blot are the relative signal intensities. The images shown
are representative of experiments done in triplicate with duplicate samples.
http://mic.sgmjournals.org
with full Na2CO3. These results suggest that a similar
response would be observed in the environment regardless
of whether CO2 or HCO{
3 was the predominant carbon
source.
Effect of O2 levels on cbb mRNA levels
The presence of O2 is another major factor for the growth
and metabolism of N. europaea, an aerobic chemoautotroph. Transcription of cbbL, cbbS, amoA and hao in
response to three O2 levels (0?2 %, 2 % and air) was
studied by transferring cells to fresh medium in sealed
bottles with controlled O2 levels. When the O2 level was
lower, all four genes, amo, hao, cbbL and cbbS, were
transcribed at lower levels (blots not shown). The highest
transcription was observed at 21 % O2 (air level). The
transcription of these genes could be detected even at an
O2 level as low as 0?2 %.
DISCUSSION
Six contiguous genes in N. europaea were identified as cbb
genes based on similarity to the RubisCO genes in other
organisms, of which cbbL and cbbS encode RubisCO
(Baxter et al., 2002; Hayashi et al., 1997, 1999). Five of
these genes (cbbLSQON) appear to form an operon. A
cbbLSQON operon is suggested by the production of
cDNAs containing the intergenic regions between all the
five genes (Fig. 1B) and the observed mRNA fragments
of appropriate sizes to contain any combination of contiguous genes in the cbb operon (Figs 5 and 6). Although
we were not able to detect a transcript long enough to
include all five messages, the presence of a single promoter
for all five genes in the cbb operon is not unprecedented.
For example, the transcription of the cbb operons in Ac.
ferrooxidans, X. flavus, Ral. eutropha and Rhodobacter
sphaeroides are transcribed from a single promoter
(Kusano et al., 1991; Kusian et al., 1995; Schäferjohann
et al., 1996). In Ral. eutropha, X. flavus (Meijer et al., 1991)
and Rb. sphaeroides a single promoter was demonstrated
by insertional mutations in their cbb genes. The mutations
prevented the transcription of cbb genes downstream from
the insertion, suggesting that the cbb operons in these
bacteria are indeed large (e.g. in Ral. eutropha could be
15 kb) (Gibson & Tabita, 1997; Meijer et al., 1991;
Schäferjohann et al., 1995; Windhovel & Bowien, 1990).
The mRNAs of cbbL and cbbS were the most abundant,
while the other cbb mRNAs were detected consistently at
low levels. Similar results were observed in other autotrophic bacteria (English et al., 1992; Kusano et al., 1991;
Meijer et al., 1991). In Ral. eutropha this was interpreted
as a premature transcriptional termination at a sequence
resembling a terminator structure downstream of the
cbbLS genes (Schäferjohann et al., 1996). Indeed in N.
europaea premature termination of transcription is likely
to occur, since a stem–loop structure could be formed in
the intergenic region between cbbS and cbbQ with a calculated free energy (DG0) of 2155 kJ mol21 (not shown). This
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
1875
X. Wei, L. A. Sayavedra-Soto and D. J. Arp
predicted stem–loop structure appears more stable than
that in Ral. eutropha, in which the free energy is 2102 kJ
mol21 (Schäferjohann et al., 1996). Potential hairpin structures were also identified downstream of the cbbLS genes
in T. denitrificans and X. flavus (Hernandez et al., 1996;
Pulgar et al., 1991). The spatial conformation of an mRNA
is known to affect its stability or longevity (GrunbergManago, 1999). Different structures of N. europaea cbb
mRNAs may have contributed to the different levels of
abundance that we observed.
Although a transcription terminator immediately downstream cbbL was identified in some species (Valle et al.,
1988), an examination of the intergenic sequence (63 bp)
between cbbL and cbbS in N. europaea failed to identify
a potential transcriptional terminator. This result with
N. europaea is similar to what has been reported for
Ac. ferrooxidans (Kusano et al., 1991). In support of an
mRNA processing alternative, the consensus cleavage site
sequence of RNase E, (G/A)ATT(A/T) (Ehretsmann et al.,
1992), was identified in the first three intergenic regions
in the cbb operon in N. europaea. A cleavage of the mRNA
containing cbbL and cbbS may also occur. RNA processing
in bacteria can occur by means other than RNase E (CalinJageman & Nicholson, 2003; Otsuka et al., 2003). In the
N. europaea genome sequence, a number of endoribonuclease genes were identified (Chain et al., 2003), including RNase E, RNase G and RNase III. RNase III acts on
double-stranded RNAs. These results and sequence analyses
suggest that a complex processing of the cbb mRNA may
be involved in the regulation of transcription and function,
and is affected by either excision/cleavage or differential
degradation.
The intergenic region between cbbR and cbbL should
contain promoters in opposite directions, for both cbbR
and cbbLSQON. CbbR is a LysR-type transcriptional
regulator (Schell, 1993). CbbR is believed to be involved
in autoregulation of its own transcription as in Ral.
eutropha and X. flavus (Kusian & Bowien, 1995; Shively
et al., 1998; van Keulen et al., 2003). Thus the unique
features of the intergenic region (i.e. AT-rich region and
T-(N)n-A inverted repeats) may allow binding of CbbR
and other potential regulators in both orientations, possibly with different affinities (Fig. 2). The AT-rich element
upstream of the rbc (RubisCO) gene in Synechococcus sp.
PCC 7002 was required for CO2-dependent repression
(Onizuka et al., 2002). In their mobility-shift assay, a
strong signal of a repressor binding to the AT-box was
observed in extracts from cells cultured at 15 % CO2, but
only a weak signal from cells cultured at 1 % CO2. It was
suggested that the AT-rich element was involved in the
negative regulation of the rbc transcription in response
to CO2 levels (Onizuka et al., 2002). We do not know
whether the AT box plays a similar role in the regulation of
the cbb gene transcription in N. europaea, but our results
indicate that high CO2 can repress its transcription.
In the absence of an exogenous energy source, the presence
1876
of NH3 can turn on amo transcription by using energy
reserves in the cells (Hyman & Arp, 1995; Sayavedra-Soto
et al., 1996). N. europaea preferentially directs its internal
energy reserves for the synthesis of amo mRNA in the
presence of NH3 and C2H2 included experimentally to
block oxidation of NH3 (Sayavedra-Soto et al., 1996). In
contrast, NH3 was not a signal to turn on cbbLS gene
transcription. Rather, an exogenous energy source was
required (Fig. 5). Because NH3 is the sole energy source
for ammonia-oxidizing bacteria, regulation of major pathways by NH3 is expected. However, the energy status of
the cell appeared to be the key factor for the transcription
of the cbb genes and NH3 itself was not required. N. europaea
cells did not commit their internal energy reserves to the
transcription of the cbb genes (Fig. 5). N. europaea uses
limited internal energy for the transcription of amo and
hao, which are directly involved in energy harvesting
(Hyman & Arp, 1995; Sayavedra-Soto et al., 1996). In the
absence of any exogenous energy source cbbL and cbbS
mRNAs were depleted faster than amo and hao mRNAs
(Fig. 4B), further indicating the dependence of cbb message
levels on the cellular energy status. The CBB cycle is an
intensely energy-consuming process; thus it is not surprising that transcription of the cbb operon is dependent upon
the presence of an abundant energy source.
The RubisCO gene transcription in N. europaea is responsive to the available carbon levels, with low carbon
levels resulting in the highest transcription (Fig. 6), perhaps through transcriptional derepression. Increases in
the levels of RuBisCO synthesis and activity under CO2
limitation have also been documented for other microorganisms. For example, in the facultative autotrophic
bacteria Ralstonia oxalatica (formerly Pseudomonas oxalaticus) (Dijkhuizen & Harder, 1979) and Ral. eutropha
(formerly Alcaligenes eutrophus) (Friedrich, 1982), the
Calvin cycle was less repressed with limited carbon source
(C1 compounds such as formate). Growth of the obligate
autotroph T. neapolitanus in a chemostat under CO2
limitation caused increased activity of the Calvin cycle
(Beudeker et al., 1980). However, complete carbon starvation did not induce the Calvin cycle in the facultative
autotroph Ral. eutropha (Friedrich, 1982). In other organisms such as cyanobacteria and algae, carbon-concentrating
mechanisms have been identified (Shibata et al., 2001;
Xiang et al., 2001). In contrast, PRK mRNA in N. europaea
increased with elevated HCO{
3 /CO2, presumably due to the
increase in the total carbon fixed.
In N. europaea, the highest cbb transcription levels were
observed with atmospheric levels of CO2. Atmospheric
CO2 content is about 0?03 %, which equilibrates to
approximately 9 mM CO2 in water at 30 uC. In spite of the
high cbb gene transcription, N. europaea grew poorly in
media lacking Na2CO3 and where C was available only
from the atmosphere (data not shown), and the cultures
exhibited a long lag phase (~5 days, compared to 1 day
in carbonate-containing medium). Cells incubated in such
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
Microbiology 150
cbb operon in N. europaea
medium made much more RubisCO mRNA than cells
grown in medium containing carbonate. Genes for
ammonia metabolism (amo, hao) showed the opposite
trend. T. neapolitanus had higher carbon-fixing capacity
per unit of total cell protein in chemostat cultures under
carbon-limiting conditions than under carbon-saturated
conditions (Beudeker et al., 1980). As seen in our experiments, N. europaea cells appeared to respond to carbon
limitation by prioritizing more resources for synthesizing
more RubisCO mRNA, and presumably RubisCO enzyme
as well. CO2 levels in natural habitats may fluctuate frequently, so the responsiveness of the transcription of genes
for carbon fixation to CO2 levels may have adaptive value.
The observed high cbb gene transcription with limited CO2
may be an adaptation of the cells to scavenge the limited
CO2 (0?03 % in air). Regardless of the cbb gene transcription, more efficient carbon fixation appears to be correlated with the CO2 levels in the media, as is evidenced
by higher growth rates of N. europaea in the presence of
higher available carbon in the medium (data not shown).
Carbonic anhydrase is required for Ral. eutropha to grow
at atmospheric CO2 concentrations (Kusian et al., 2002).
Genes for potential carbonic anhydrase and an anion transporter (NE1927) in N. europaea were transcribed similarly
under low- and high-carbon conditions (blots not shown),
suggesting that they may not be functioning as a CO2/
HCO{
3 -concentrating mechanism. The apparent lack of a
CO2-concentrating mechanism is supported by the observation of poor growth of N. europaea cultures in HCO{
3 free medium exposed to air. The responsiveness of cbb
gene transcription to carbon levels may also be a reflection
of the lack of a specific CO2-concentrating mechanism in
N. europaea. It will be interesting to see how other
ammonia-oxidizing bacteria, such as those with carboxysomes, respond to low C levels.
Bock, E., Koops, H. P., Harms, H. & Ahlers, B. (1991). The
biochemistry of nitrifying organisms. In Variations in Autotrophic
Life, pp. 171–200. Edited by J. M. Shively & L. L. Barton. San Diego,
CA: Academic Press.
Calin-Jageman, I. & Nicholson, A. W. (2003). RNA structure-
dependent uncoupling of substrate recognition and cleavage by
Escherichia coli ribonuclease III. Nucleic Acids Res 31, 2381–2392.
Chain, P., Lamerdin, J., Larimer, F. & 12 other authors (2003).
Complete genome sequence of the ammonia-oxidizing bacterium
and obligate chemolithoautotroph Nitrosomonas europaea. J Bacteriol
185, 2759–2773.
Clark, C. & Schmidt, E. L. (1966). Effect of mixed culture on
Nitrosomonas europaea simulated by uptake and utilization of
pyruvate. J Bacteriol 91, 367–373.
Clark, C. & Schmidt, E. L. (1967). Uptake and utilization of
amino acids by resting cells of Nitrosomonas europaea. J Bacteriol 91,
1309–1315.
Dijkhuizen, L. & Harder, W. (1979). Regulation of autotrophic and
heterotrophic metabolism in Pseudomonas oxalaticus OX1. Growth
on mixtures of acetate and formate in continuous culture. Arch
Microbiol 123, 47–53.
Ehretsmann, C. P., Carpousis, A. J. & Krisch, H. M. (1992).
Specificity of Escherichia coli endoribonuclease RNase E: in vivo and
in vitro analysis of mutants in a bacteriophage T4 mRNA processing
site. Genes Dev 6, 149–159.
English, R. S., Williams, C. A., Lorbach, S. C. & Shively, J. M. (1992).
Two forms of ribulose-1,5-bisphosphate carboxylase/oxygenase from
Thiobacillus denitrificans. FEMS Microbiol Lett 73, 111–119.
Ensign, S. A., Hyman, M. R. & Arp, D. J. (1993). In vitro activation of
ammonia monooxygenase from Nitrosomonas europaea by copper.
J Bacteriol 175, 1971–1980.
Friedrich, C. G. (1982). Depression of hydrogenase during limitation of electron donors and derepression of ribulosebisphosphate
carboxylase during carbon limitation of Alcaligenes eutrophus.
J Bacteriol 149, 203–210.
Gibson, J. L. & Tabita, F. R. (1997). Analysis of the cbbXYZ operon in
Rhodobacter sphaeroides. J Bacteriol 179, 663–669.
Goethals, K., Van Montagu, M. & Holsters, M. (1992). Conserved
motifs in a divergent nod box of Azorhizobium caulinodans ORS571
reveal a common structure in promoters regulated by LysR-type
proteins. Proc Natl Acad Sci U S A 89, 1646–1650.
ACKNOWLEDGEMENTS
This research was supported by the Office of Science (BER), US
Department of Energy grant no. DE-FG03-01ER63149 and the Oregon
Agricultural Experimental Station.
Gornall, A. G., Bardawill, C. J. & David, M. M. (1949). Determination
of serum proteins by means of the Biuret reaction. J Biol Chem 177,
751–766.
Grunberg-Manago, M. (1999). Messenger RNA stability and its role
REFERENCES
in control of gene expression in bacteria and phages. Annu Rev Genet
33, 193–227.
Arp, D. J., Sayavedra-Soto, L. A. & Hommes, N. G. (2002).
Hageman, R. H. & Hucklesby, D. P. (1971). Nitrate reductase in
Molecular biology and biochemistry of ammonia oxidation by
Nitrosomonas europaea. Arch Microbiol 178, 250–255.
Hayashi, N. R. & Igarashi, Y. (2002). ATP binding and hydrolysis
Baxter, N. J., Hirt, R. P., Bodrossy, L., Kovacs, K. L., Embley, T. M.,
Prosser, J. I. & Murrell, J. C. (2002). The ribulose-1,5-bisphosphate
carboxylase/oxygenase gene cluster of Methylococcus capsulatus
(Bath). Arch Microbiol 177, 279–289.
Beudeker, R. F., Cannon, D. C., Kuenen, J. G. & Shively, J. M. (1980).
Relations between D-ribulose-1,5-bisphosphate carboxylase, carboxysomes and CO2 fixing capacity in the obligate chemolithoautotroph
Thiobacillus neapolitanus grown under different limitations in the
chemostat. Arch Microbiol 124, 185–189.
Bock, E., Koops, H.-P. & Harms, H. (1986). Cell biology of nitrifying
bacteria. In Nitrification, pp. 17–38. Edited by J. I. Prosser. Oxford:
IRL Press.
http://mic.sgmjournals.org
higher plants. Methods Enzymol 23, 491–503.
and autophosphorylation of CbbQ encoded by the gene located
downstream of RubisCO genes. Biochem Biophys Res Commun 290,
1434–1440.
Hayashi, N. R., Arai, H., Kodama, T. & Igarashi, Y. (1997). The novel
genes, cbbQ and cbbO, located downstream from the RubisCO genes
of Pseudomonas hydrogenothermophila, affect the conformational
states and activity of RubisCO. Biochem Biophys Res Commun 241,
565–569.
Hayashi, N. R., Arai, H., Kodama, T. & Igarashi, Y. (1999). The cbbQ
genes, located downstream of the form I and form II RubisCO genes,
affect the activity of both RubisCOs. Biochem Biophys Res Commun
265, 177–183.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
1877
X. Wei, L. A. Sayavedra-Soto and D. J. Arp
Hayashi, N. R., Terazono, K., Kodama, T. & Igarashi, Y. (2000).
Structure of ribulose 1,5-bisphosphate carboxylase/oxygenase
gene cluster from a thermophilic hydrogen-oxidizing bacterium,
Hydrogenophilus thermoluteolus, and phylogeny of the fructose 1,6bisphosphate aldolase encoded by cbbA in the cluster. Biosci
Biotechnol Biochem 64, 61–71.
Heinhorst, S., Baker, S. H., Johnson, D. R., Davies, P. S., Cannon,
G. C. & Shively, J. M. (2002). Two copies of form I RuBisCO genes
in Acidithiobacillus ferrooxidans ATCC 23270. Curr Microbiol 45,
115–117.
Hernandez, J. M., Baker, S. H., Lorbach, S. C., Shively, J. M. &
Tabita, F. R. (1996). Deduced amino acid sequence, functional
expression, and unique enzymatic properties of the form I and form
II ribulose bisphosphate carboxylase/oxygenase from the chemoautotrophic bacterium Thiobacillus denitrificans. J Bacteriol 178, 347–356.
Hirota, R., Kato, J., Morita, H., Kuroda, A., Ikeda, T., Takiguchi, N.
& Ohtake, H. (2002). Isolation and characterization of cbbL and
cbbS genes encoding form I ribulose-1,5-bisphosphate carboxylase/
oxygenase large and small subunits in Nitrosomonas sp. strain
ENI-11. Biosci Biotechnol Biochem 66, 632–635.
Hommes, N. G., Sayavedra-Soto, L. A. & Arp, D. J. (1996). Muta-
genesis of hydroxylamine oxidoreductase in Nitrosomonas europaea
by transformation and recombination. J Bacteriol 178, 3710–3714.
Hommes, N. G., Sayavedra-Soto, L. A. & Arp, D. J. (1998). Muta-
genesis and expression of amo, which codes for ammonia monooxygenase in Nitrosomonas europaea. J Bacteriol 180, 3353–3359.
Hommes, N. G., Sayavedra-Soto, L. A. & Arp, D. J. (2001).
Transcript analysis of multiple copies of amo (encoding ammonia
monooxygenase) and hao (encoding hydroxylamine oxidoreductase)
in Nitrosomonas europaea. J Bacteriol 183, 1096–1100.
Hommes, N. G., Sayavedra-Soto, L. A. & Arp, D. J. (2002). The roles
of the three gene copies encoding hydroxylamine oxidoreductase in
Nitrosomonas europaea. Arch Microbiol 178, 471–476.
Hommes, N. G., Sayavedra-Soto, L. A. & Arp, D. J. (2003).
Chemolithoorganotrophic growth of Nitrosomonas europaea on
fructose. J Bacteriol 185, 6809–6814.
Hyman, M. R. & Arp, D. J. (1993). An electrophoretic study of the
thermal-dependent and reductant-dependent aggregation of the
27 kDa component of ammonia monooxygenase from Nitrosomonas
europaea. Electrophoresis 14, 619–627.
carboxylase genes and cbb promoters of Alcaligenes eutrophus.
J Bacteriol 177, 4442–4450.
Kusian, B., Sultemeyer, D. & Bowien, B. (2002). Carbonic anhydrase
is essential for growth of Ralstonia eutropha at ambient CO2
concentrations. J Bacteriol 184, 5018–5026.
Lee, S. N. & Kim, Y. M. (1998). Cloning and characterization of
ribulose bisphosphate carboxylase gene of a carboxydobacterium,
Hydrogenophagea pseudoflava DSM 1084. Mol Cells 8, 524–529.
Martiny, H. & Koops, H.-P. (1982). Incorporation of organic
compounds into cell protein by lithotrophic, ammonia-oxidizing
bacteria. Antonie van Leeuwenhoek 48, 327–336.
Meijer, W. G., Arnberg, A. C., Enequist, H. G., Terpstra, P., Lidstrom,
M. E. & Dijkhuizen, L. (1991). Identification and organization of
carbon dioxide fixation genes in Xanthobacter flavus H4-14. Mol Gen
Genet 225, 320–330.
Norton, J. M., Low, J. M. & Klotz, M. G. (1996). The gene encoding
ammonia monooxygenase subunit A exists in three nearly identical
copies in Nitrosospira sp. NpAV. FEMS Microbiol Lett 139, 181–188.
Onizuka, T., Akiyama, H., Endo, S., Kanai, S., Hirano, M., Tanaka, S.
& Miyasaka, H. (2002). CO2 response element and corresponding
trans-acting factor of the promoter for ribulose-1,5-bisphosphate
carboxylase/oxygenase genes in Synechococcus sp. PCC7002 found by
an improved electrophoretic mobility shift assay. Plant Cell Physiol
43, 660–667.
Otsuka, Y., Ueno, H. & Yonesaki, T. (2003). Escherichia coli endoribonucleases involved in cleavage of bacteriophage T4 mRNAs.
J Bacteriol 185, 983–990.
Paoli, G. C., Soyer, F., Shively, J. & Tabita, F. R. (1998). Rhodobacter
capsulatus genes encoding form I ribulose-1,5-bisphosphate carboxylase/oxygenase (cbbLS) and neighbouring genes were acquired by a
horizontal gene transfer. Microbiology 144, 219–227.
Pulgar, V., Gaete, L., Allende, J., Orellana, O., Jordana, X. &
Jedlicki, E. (1991). Isolation and nucleotide sequence of the Thio-
bacillus ferrooxidans genes for the small and large subunits of ribulose 1,5-bisphosphate carboxylase/oxygenase. FEBS Lett 292, 85–89.
Reddy, K. & Gilman, M. (1993). Preparation of bacterial RNA. In
Current Protocols in Molecular Biology, pp. 4.41–44.44.47. Edited by
F. M. Ausubel and others. New York: Wiley.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
Hyman, M. R. & Arp, D. J. (1995). Effects of ammonia on the de novo
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory.
synthesis of polypeptides in cells of Nitrosomonas europaea denied
ammonia as an energy source. J Bacteriol 177, 4974–4979.
Sayavedra-Soto, L. A., Hommes, N. G., Russell, S. A. & Arp, D. J.
(1996). Induction of ammonia monooxygenase and hydroxylamine
Klotz, M. G. & Norton, J. M. (1995). Sequence of an ammonia
monooxygenase subunit A-encoding gene from Nitrosospira sp.
NpAV. Gene 163, 159–160.
Klotz, M. G. & Norton, J. M. (1998). Multiple copies of ammonia
monooxygenase (amo) operons have evolved under biased AT/GC
mutational pressure in ammonia-oxidizing autotrophic bacteria.
FEMS Microbiol Lett 168, 303–311.
Kusano, T. & Sugawara, K. (1993). Specific binding of Thiobacillus
ferrooxidans RbcR to the intergenic sequence between the rbc operon
and the rbcR gene. J Bacteriol 175, 1019–1025.
Kusano, T., Takeshima, T., Inoue, C. & Sugawara, K. (1991).
Evidence for two sets of structural genes coding for ribulose
bisphosphate carboxylase in Thiobacillus ferrooxidans. J Bacteriol 173,
7313–7323.
Kusian, B. & Bowien, B. (1995). Operator binding of the CbbR
protein, which activates the duplicate cbb CO2 assimilation operons
of Alcaligenes eutrophus. J Bacteriol 177, 6568–6574.
Kusian, B., Bednarski, R., Husemann, M. & Bowien, B.
(1995). Characterization of the duplicate ribulose-1,5-bisphosphate
1878
oxidoreductase mRNAs by ammonium in Nitrosomonas europaea.
Mol Microbiol 20, 541–548.
Sayavedra-Soto, L. A., Hommes, N. G., Alzerreca, J. J., Arp, D. J.,
Norton, J. M. & Klotz, M. G. (1998). Transcription of the amoC,
amoA, and amoB genes in Nitrosomonas europaea and Nitrosospira
sp. NpAV. FEMS Microbiol Lett 167, 81–88.
Schäferjohann, J., Yoo, J. G. & Bowien, B. (1995). Analysis of the
genes forming the distal parts of the two cbb CO2 fixation operons
from Alcaligenes eutrophus. Arch Microbiol 163, 291–299.
Schäferjohann, J., Bednarski, R. & Bowien, B. (1996). Regulation of
CO2 assimilation in Ralstonia eutropha: premature transcription
termination within the cbb operon. J Bacteriol 178, 6714–6719.
Schell, M. A. (1993). Molecular biology of the LysR family of
transcriptional regulators. Annu Rev Microbiol 47, 597–626.
Shibata, M., Ohkawa, H., Kaneko, T., Fukuzawa, H., Tabata, S.,
Kaplan, A. & Ogawa, T. (2001). Distinct constitutive and low-CO2-
induced CO2 uptake systems in cyanobacteria: genes involved and
their phylogenetic relationship with homologous genes in other
organisms. Proc Natl Acad Sci U S A 98, 11789–11794.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
Microbiology 150
cbb operon in N. europaea
Shively, J. M., van Keulen, G. & Meijer, W. G. (1998). Something
from almost nothing: carbon dioxide fixation in chemoautotrophs.
Annu Rev Microbiol 52, 191–230.
Stein, L. Y. & Arp, D. J. (1998). Loss of ammonia monooxygenase
activity in Nitrosomonas europaea upon exposure to nitrite. Appl
Environ Microbiol 64, 4098–4102.
Stein, L. Y., Sayavedra-Soto, L. A., Hommes, N. G. & Arp, D. J.
(2000). Differential regulation of amoA and amoB gene copies in
Nitrosomonas europaea. FEMS Microbiol Lett 192, 163–168.
Terazono, K., Hayashi, N. R. & Igarashi, Y. (2001). CbbR, a LysR-
type transcriptional regulator from Hydrogenophilus thermoluteolus,
binds two cbb promoter regions. FEMS Microbiol Lett 198, 151–157.
Tichi, M. A. & Tabita, F. R. (2002). Metabolic signals that lead to
control of CBB gene expression in Rhodobacter capsulatus. J Bacteriol
184, 1905–1915.
Utåker, J. B., Andersen, K., Aakra, A., Moen, B. & Nes, I. F. (2002).
the photosynthetic bacterium Chromatium vinosum, which possesses
two complete sets of the genes. J Bacteriol 171, 2391–2400.
Viale, A. M., Kobayashi, H., Akazawa, T. & Henikoff, S. (1991). rbcR
[correction of rcbR], a gene coding for a member of the LysR family
of transcriptional regulators, is located upstream of the expressed set
of ribulose 1,5-bisphosphate carboxylase/oxygenase genes in the photosynthetic bacterium Chromatium vinosum. J Bacteriol 173, 5224–5229.
Vichivanives, P., Bird, T. H., Bauer, C. E. & Robert Tabita, F.
(2000). Multiple regulators and their interactions in vivo and in vitro
with the cbb regulons of Rhodobacter capsulatus. J Mol Biol 300,
1079–1099.
Wallace, W., Knowles, S. E. & Nicholas, D. J. (1970). Intermediary
metabolism of carbon compounds by nitrifying bacteria. Arch
Mikrobiol 70, 26–42.
Windhovel, U. & Bowien, B. (1990). On the operon structure of the
cfx gene clusters in Alcaligenes eutrophus. Arch Microbiol 154, 85–91.
Phylogeny and functional expression of ribulose 1,5-bisphosphate
carboxylase/oxygenase from the autotrophic ammonia-oxidizing
bacterium Nitrosospira sp. isolate 40KI. J Bacteriol 184, 468–478.
Winogradsky, S. (1931). The bacterial agents of nitrification – new
Valle, E., Kobayashi, H. & Akazawa, T. (1988). Transcriptional
formation of the carbon concentrating mechanism in Chlamydomonas reinhardtii. Proc Natl Acad Sci U S A 98, 5341–5346.
regulation of genes for plant-type ribulose-1,5-bisphosphate carboxylase/oxygenase in the photosynthetic bacterium, Chromatium
vinosum. Eur J Biochem 173, 483–489.
investigations. Compt Rend Acad Agr France 17, 591–599.
Xiang, Y., Zhang, J. & Weeks, D. P. (2001). The Cia5 gene controls
Xu, H. H. & Tabita, F. R. (1994). Positive and negative regulation of
Vangnai, A. S., Arp, D. J. & Sayavedra-Soto, L. A. (2002). Two
sequences upstream of the form II cbb CO2 fixation operon of
Rhodobacter sphaeroides. J Bacteriol 176, 7299–7308.
distinct alcohol dehydrogenases participate in butane metabolism in
Pseudomonas butanovora. J Bacteriol 184, 1916–1924.
Yokoyama, K., Hayashi, N. R., Arai, H., Chung, S. Y., Igarashi, Y. &
Kodama, T. (1995). Genes encoding RubisCO in Pseudomonas
van Keulen, G., Ridder, A. N., Dijkhuizen, L. & Meijer, W. G. (2003).
hydrogenothermophila are followed by a novel cbbQ gene similar to
nirQ of the denitrification gene cluster from Pseudomonas species.
Gene 153, 75–79.
Analysis of DNA binding and transcriptional activation by the LysRtype transcriptional regulator CbbR of Xanthobacter flavus. J Bacteriol
185, 1245–1252.
Viale, A. M., Kobayashi, H. & Akazawa, T. (1989). Expressed genes
for plant-type ribulose 1,5-bisphosphate carboxylase/oxygenase in
http://mic.sgmjournals.org
Yoo, J. G. & Bowien, B. (1995). Analysis of the cbbF genes from
Alcaligenes eutrophus that encode fructose-1,6-sedoheptulose-1,7bisphosphatase. Curr Microbiol 31, 55–61.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 10:46:34
1879