Arch Virol (2002) 147: 787–801
Whiteflies (Bemisia tabaci) issued from eggs bombarded with
infectious DNA clones of Tomato yellow leaf curl virus from Israel
(TYLCV) are able to infect tomato plants
V. Goldman and H. Czosnek
Department of Field Crops and Genetics and the Otto Warburg Centre
for Biotechnology in Agriculture, Faculty of Agricultural,
Food and Environmental Quality Sciences,
The Hebrew University of Jerusalem, Rehovot, Israel
Accepted September 20, 2001
Summary. We have reported previously that Tomato yellow leaf curl virus from
Israel (TYLCV) penetrates the reproductive system of its vector, the whitefly
Bemisia tabaci biotype B, and may be transmitted to progeny [9]. In order to mimic
this phenomenon and to understand how TYLCV accompanies the development
of the insect, we have bombarded B. tabaci eggs with an infectious DNA clone of
TYLCV. After a linear full-length genomic copy of TYLCV DNA was delivered to
eggs, the DpnI-sensitive DNA became circular and DpnI resistant. When a dimeric
copy of TYLCV DNA was delivered to eggs, the viral DNA was detected in all
the whitefly developmental stages. Adult insects that developed from the treated
eggs were able to infect tomato test plants with variable frequency. Viral DNA
was detected in the progeny of whiteflies that developed from eggs bombarded
with TYLCV. Similarly, when insect eggs were bombarded with a dimeric copy of
an infectious clone of the genome of Tomato yellow leaf curl virus from Sardinia,
Italy (TYLCSV), adults that eclosed from the treated eggs were able to infect
tomato test plants.
Introduction
The whitefly Bemisia tabaci affects many economically important crops worldwide. A single female lays 50 to 400 eggs in its lifetime, depending on the host
plant and the season [6]. The development of B. tabaci, from egg to adult through
four nymphal stages, lasts 2 to 3 weeks. Begomoviruses (family: Geminiviridae,
genus: Begomovirus) constitute one of the most important groups of pathogens
transmitted by this insect. Begomoviruses possess either one (monopartite) or
two (bipartite) circular single-stranded DNA (ssDNA) genomic components
788
V. Goldman and H. Czosnek
encapsidated in ∼ 20 × 30 nm geminate particles. Monopartite begomoviruses
have a ∼ 2800 nucleotide (nt) long genome encoding 6 open reading frames
(ORF). The genome of bipartite begomoviruses is split between two molecules
of ∼ 2600 nt each, DNA-A (basically similar to the genome of monopartite begomoviruses) and DNA-B encoding 2 ORFs (reviewed in [19, 24]). Begomoviruses
are transmitted by adult whiteflies in a circulative manner. Geminiviral particles
ingested with phloem sap through the stylets enter the esophagus and the filter
chamber. They subsequently translocate through the midgut into the hemocoel
and from there they reach the salivary glands. Then, particles move into the salivary duct and are egested with the saliva during feeding [2, 8, 10, 12, 13, 22].
Begomoviruses infect many important agricultural crops and ornamentals and
replicate via a double-stranded DNA (dsDNA) intermediate [11].
The Tomato yellow leaf curl viruses (TYLCVs) are a group of begomoviruses
that have the most serious economic impact [4]. The TYLCVs include closely as
well as distantly related tomato begomoviruses. TYLCVs have either monopartite (Mediterranean isolates) or bipartite (Thailand isolate) genomes (reviewed
in [4, 17, 20]). We have shown that Tomato yellow leaf curl virus from Israel
(TYLCV) has many features of an insect pathogen [23]. Young adult whiteflies that acquired virus during 48 h retained viral DNA during their entire life
span while reared on eggplants, a TYLCV non-host. These insects were able
to inoculate tomato plants for their entire life, although infectivity decreased
with time. The life-long association of TYLCV with B. tabaci was accompanied with a marked decrease in longevity and in fecundity. TYLCV DNA
was detected in ovaries and in mature eggs dissected out from the viruliferous insects, as well as in eggs after oviposition. Adult progeny of viruliferous
insects were able to inoculate tomato test plants and to cause typical disease
symptoms [9].
We do not know how TYLCV penetrates the reproductive system of female
whiteflies and how it accompanies the development of the insects up to the adult
stage. In the present investigation we have attempted to reproduce to some extent
the invasion of whitefly eggs by TYLCV. We have delivered infectious cloned
TYLCV DNA to B. tabaci eggs by bombardment to find out whether these
eggs could develop into viruliferous adults. The results showed that the TYLCV
genome was found all along the development of B. tabaci and that flying adults
were able to infect tomato plants.
Materials and methods
Maintenance of virus cultures, whiteflies and plants
Viruses were named according to [5]. Cultures of an Israeli isolate of Tomato yellow leaf
curl virus (TYLCV, [18]) were maintained in tomato plants (Lycopersicon esculentum,
cv. Daniella) and propagated by whitefly-mediated transmission. Bemisia tabaci B biotype
(synonym B. argentifolii) were reared on cotton plants (Gossypium hirsutum, cv. Akala)
grown in insect-proof wooden cages in an insect-proof growth chamber kept at 24–26 ◦ C,
with a 16/8 h light/dark regimen.
Bombardment of whitefly eggs with TYLCV DNA
789
Cloned TYLCV and TYLCSV DNA used for bombardment
Plasmid pTYH20.7 contained a head-to-tail dimeric copy of an infectious TYLCV DNA clone
from Israel ([18] GenBank accession X15656) in plasmid pTZ18R. To release a 2.8 kbp fulllength copy of the viral genome, plasmid pTYH20.7 was digested with SphI (cuts at nt 1193
of the TYLCV genome, Fig. 3, upper panel). The linear genome was purified from agarose
gels (QIAquick Gel Extraction Kit, Qiagen). Plasmid pBIN19/TYLCV-S1.8 contained a
head-to-tail 1.8 mer copy of an infectious TYLCV clone from Sardinia, Italy (TYLCSV [14]
GenBank accession X61153) in plasmid pBIN19.
Collection of eggs, preparation and delivery of microprojectiles coated with viral DNA
To restrict the leaf area to about the average gun beam size, an eggplant leaf (2 months after
seeding) was cut to provide a 3 cm diameter disc connected to the stem. All the other leaves
were discarded. Fifty to 100 adult whiteflies were caged for 5 to 7 days with the treated leaf
to obtain 100 to 300 eggs per disc. The insects were then discarded.
Macrocarriers, rupture discs, stopping screens, and macrocarrier holders were washed
for 5 min with 70% ethanol. About 60 mg of tungsten particles M5 (Bio-Rad) were vortexed
with 1 ml ethanol for 15 min, pelleted and washed extensively with sterile water. The metal
pellet was finally suspended in sterile 50% glycerol and stored at 20–25 ◦ C. The tungsten
microprojectiles were coated as follows: 25 ␮l of the tungsten suspension was mixed with
25 ␮l 1 M CaCl2 , and 0.5–1.0 ␮g/␮l of cloned viral DNA.After 5 min at room temperature and
with occasional vortexing, the coated microprojectiles were washed once with 70% ethanol,
once with 100% ethanol and resuspended in 30 ␮l of 100% ethanol. The mixture was deposed
on the middle of three macrocarrier discs, and dried under laminar flow. The tungsten particles
were delivered to the eggplant leaf using the Bio-Rad Helium Biolistic Particle Gun Delivery
System PDS-1000. Rupture discs of 450 psi and helium pressure of 650 psi with a vacuum of
710 mm Hg were used. Target distance from the rupture disc was between 2 to 5 cm, ensuring
minimal damage to the plant leaf and to the insect eggs.
After bombardment of eggs, each eggplant was kept in a 1.5 litre plastic bottle covered
with an insect-proof net and reared in insect-proof cages at 24–26 ◦ C with a photoperiod
of 16 h daylight. Following eclosion, adults were collected, caged with untreated eggplant
seedlings and reared in insect-proof cages.
Detection of TYLCV DNA in plants and in insects
Total DNA extracted from plants [1] was analyzed for the presence of viral DNA by Southern blot hybridization using either plasmid pTYH20.7 [18] or plasmid pBIN19/TYLCV-S1.8
[14] as probe [1]. DNA extracted from tomato plants and from developing whiteflies was
subjected to PCR [9]. TYLCV DNA was amplified using primers V61 (nt 61–80, viral strand,
5ATACTTGGACACCTAAT GG3 ), C473 (nt 473–457, complementary strand, 5AGTCAC
GGGCCCTTACAA3 ), and C1256 (nt C1256–1229, complementary strand, 5TTAATTTGA
TATTGAATCATAGAA ATAG3 ). TYLCSV DNA was amplified using primers VS2308
(nt 2308–2333 viral strand, 5TATAGGA CTTGACGTCGGAGCTCGAT3 ) and CS2698
(nt 2698–2670, complementary strand, 5 GGGGGCATCATATATATTGCCCCCC AATT3 ).
The PCR products were subjected to 1% agarose gel electrophoresis and stained with ethidium bromide.
Transmission of TYLCV to tomato test plants by whiteflies
emerging from bombarded eggs
Insects were caged with tomato test plants, one month after seeding. Disease symptoms and
viral DNA were monitored as described [1].
790
V. Goldman and H. Czosnek
Results
Whitefly eggs subjected to bombardment
Examination of whitefly eggs under the light microscope 24 h after oviposition
suggests that they are laid at or immediately before the blastulation stage. Freshly
oviposited eggs are very sensitive to any manipulation, probably because the
chorion shell is not sufficiently developed. One to two days later, the eggs are robust enough to be manipulated. At this stage the egg has a cellular blastoderm surrounding an internal yolk mass and the embryo cells are dividing asynchronously.
Efficiency of bombardment and viability of whitefly eggs
bombarded with cloned TYLCV DNA
Efficiency of bombardment was estimated by determining the proportion of eggs
in which viral DNA could be detected. Eggs oviposited on an eggplant leaf disc
were bombarded with microprojectiles coated with a head-to-tail dimeric copy
of an infectious TYLCV DNA clone (plasmid pTYH20.7). In two independent
trials, DNA isolated from ten eggs randomly chosen from the leaf areas within a
1.5 cm diameter circle (20 to 40% of the eggs) and in the area comprised between
circles of 1.5 and 3.0 cm diameter (60 to 80% of the eggs) were subjected to PCR
using primers V61 and C473 (Fig. 3, upper panel). Viral DNA was amplified from
40 to 60% of the eggs located in the first area, and from 50 to 100% of the eggs
located in the second area.
The effect of bombardment on egg development was investigated. In fourteen
independent trials (an average of 130 eggs were bombarded in each trial), approximately 20% of the B. tabaci eggs bombarded with DNA-coated microprojectiles
developed into adults. In two additional trials approximately 30% of the eggs
treated with uncoated microprojectiles developed into adults. For a comparison,
adults developed from about 60% of untreated eggs.
Capacity of whiteflies that developed from eggs bombarded
with cloned TYLCV and TYLCSV DNA to transmit
the virus to tomato test plants
Eggs bombarded with plasmid pTYH20.7 were left to develop on the eggplant
leaf until adults hatched. DNA from individuals at different stages of development
was subjected to PCR using primers V61 and C473. Viral DNA was amplified
from crawlers, second instars, third instars and pupae (Fig. 1, left panel). Viral
DNA was amplified from 4 of the 30 adults tested (Fig. 1, right panel, A).
Adult whiteflies that developed from bombarded eggs were caged with tomato
plants to establish their capacity to transmit TYLCV. Eleven independent experiments were performed. Each time the whiteflies that developed from a single
bombardment event were collected and caged with 1 to 4 plants (variable numbers of insects were caged with each plant). Each plant was tested by PCR for the
presence of TYLCV DNA, 4 to 5 wks after caging, using primers V61 and C473
(Fig. 1, right panel, B). The results are summarized in Table 1. Viral DNA was
Bombardment of whitefly eggs with TYLCV DNA
791
Fig. 1. Association of TYLCV DNA with whiteflies that developed from eggs bombarded
with plasmid pTYH20.7 (left panel), and ability of adults to inoculate tomato test plants (right
panel). The presence of TYLCV DNA is assessed by PCR using primers V61 and C473 (left
panel and right panel, A and B), and by Southern blot hybridization with a virus-specific probe
(right panel, C). The PCR reaction products were subjected to agarose gel electrophoresis and
stained with ethidium bromide. Left panel: PCR-amplification of viral DNA from individual
crawlers (1), second and third instars (2, 3) and pupae (4); input plasmid (P) and untreated
egg (0). Right panel: A PCR-amplification of viral DNA from input plasmid (1), viruliferous
whitefly (2) and whitefly that developed from bombarded egg (3); B PCR-amplification of
viral DNA from a plant inoculated with whiteflies that emerged from bombarded eggs (1),
inoculated with viruliferous whiteflies (2), and naturally infected (3); the arrow points to the
amplified viral DNA fragment. C Southern blot hybridization of non-inoculated tomato plant
(1), plant inoculated with whitefly that developed from bombarded egg (2), plant agroinoculated (3) and plant naturally infected (4); the position of the virus genomic DNA (ss) and its
replicative form (ds) are indicated
found in 13 of the 23 plants tested. In some trials, tomato plants were inoculated
by a single whitefly (trials 1 to 3); in other trials, 10 insects or more were insufficient to inoculate plants. As a comparison, 100% inoculation is routinely
achieved following caging of a tomato plant with three insects previously fed
on an infected plant. Some but not all of the PCR-positive plants exhibited clear
disease symptoms. Southern blot hybridization confirmed that the symptomatic
plants contained the TYLCV genomic DNA and its replicative form, as in naturally infected tomato plants (Fig. 1, right panel, C). These results demonstrated
that adult whiteflies that developed from eggs bombarded with a virulent DNA
clone of TYLCV were able to infect tomato plants.
To exclude a possible contamination and to show that TYLCV from Israel
does not have a peculiar behavior, a similar experiment was conducted with an
infectious clone of TYLCSV, a virus isolate from Sardinia, Italy, that shares 76%
nucleotide identity with TYLCV. Long before and at the time these experiments
were performed, no tomato plants have been inoculated in our laboratory with
TYLCSV that could have served as a contaminating inoculum for escaped whiteflies. The primer pair VS2308 and CS2698 was designed to amplify a 390 bp
DNA fragment of TYLCSV (Fig. 2, upper panel). These primers differ sufficiently from the homologous region in the genome of TYLCV to allow amplification of TYLCSV DNA from plasmid pBIN/TYLCV-S1.8, but not from the
792
V. Goldman and H. Czosnek
Table 1. Inoculation of tomato test plants by whiteflies that eclosed from
eggs bombarded with plasmid pTYH20.7
Trial no.a
1
2
3
4
5
6
7
8
9
10
11
Plant no.
No. of whiteflies caged
with each plant
Detection of
TYLCV DNA
1
2
3
4
1
2
3
4
1
2
3
1
2
1
2
1
2
1
2
1
1
1
1
1
2
6
14
1
1
1
1
1
11
17
2
10
3
4
10
50
30
50
5
1
10
60
+b,d
−
−
+b
+b
+b
+b
+b
+b
+b,d
+b
−b
−b
+b,d
−b
−b
+b,d
−b
+c
−b
−b
−b
+b,c
a
Between 50 and 250 eggs were treated in each of the 11 independent trials
Viral DNA detected by PCR
c
Viral DNA detected by Southern blot hybridization
d
Viral DNA detected by PCR following incubation with DpnI (all the plants
tested contained DpnI-resistant TYLCV DNA)
b
TYLCV-containing plasmid pTYH20.7. Conversely the TYLCV specific primer
pair V61 and C473 amplified a 412 bp viral DNA fragment from plasmid
pTYH20.7, but not from plasmid pBIN/TYLCV-S1.8 (Fig. 2, lower panels A
and B).
Whitefly eggs were bombarded with microprojectiles coated with plasmid
pBIN19/TYLCV-S1.8. The adults that eclosed were caged with tomato test plants
(about 50 adults per plant, 15 plants). TYLCSV DNA was detected in tissue prints
of leaves sampled 3 wks after inoculation, using the TYLCSV plasmid as the hybridization probe (Fig. 2, lower panel, C). PCR confirmed that these plants were
indeed infected by TYLCSV (Fig. 2, lower panel, A). The TYLCSV primer pair
Bombardment of whitefly eggs with TYLCV DNA
793
Fig. 2. Ability of whiteflies eclosed from eggs bombarded with TYLCSV (plasmid
pBIN19/TYLCV-S1.8) to infect tomato test plants. Upper panel: PrimersVS2308 and CS2698
(in bold), and their flanking sequences, used to amplify TYLCSV DNA, compared with the
homologous region of TYLCV (boxed); the non-homologous nucleotides are underlined.
Lower panel: Detection of TYLCSV in tomato plants inoculated with whiteflies eclosed
from the treated eggs. A PCR-amplification of TYLCSV using primers VS2308 and CS2698;
0 no template, 1 plasmid pTYH20.7, 2 plasmid pBIN19/TYLCV-S1.8, 3 tomato infected
by whiteflies eclosed from eggs bombarded with plasmid pBIN19/TYLCV-S1.8, 4 plasmid pBIN19/TYLCV-S1.8, 5 non-infected tomato. B PCR-amplification of TYLCV using
the primers V61 and C473; 6 plasmid pTYH20.7, 7 tomato infected by whiteflies eclosed
from eggs bombarded with pBIN19/TYLCV-S1.8 DNA, 8 tomato infected by whiteflies
eclosed from eggs bombarded with pTYH20.7. The arrow points to the amplified viral
DNA fragments. C Hybridization of leaf tissue prints (P print; A autoradiogram) and DNA
from leaves (L) and roots (R) of tomato plants infected by progeny of eggs bombarded
with pBIN19/TYLCV-S1.8 DNA. D Southern blot hybridization of DNA from two tomato
plants (1, 2) naturally infected with TYLCSV (S) and with TYLCV (I ) probed with plasmid
pBIN19/TYLCV-S1.8 DNA following high stringency wash (0.1×SSC, 70 ◦ C). The position
of the virus genomic DNA (ss) and its replicative form (ds) are indicated
VS2308/CS2698 allowed amplification of a 390 bp viral DNA fragment from
these plants and from the input plasmid, but not from DNA from plants infected
by TYLCV. When the TYLCV primer pair V61/C473 was used, no PCR product was obtained. Primers V61/C473 did allow amplification of viral DNA when
DNA from plants infected by TYLCV was used as PCR template (Fig. 2, lower
panel, B). Southern blot hybridization with the TYLCSV probe showed that a
symptomatic plant inoculated with whiteflies that developed from eggs bombarded with TYLCSV DNA contained viral genomic ssDNA, in both leaves and
roots (Fig. 2, lower panel, C). Following a high stringency wash (0.1 × SSC at
70 ◦ C), the TYLCSV DNA probe detected TYLCSV-infected plants but not plants
794
V. Goldman and H. Czosnek
infected with TYLCV (Fig. 2, lower panel, D). These results showed that, as in
the case of TYLCV, whiteflies that eclosed from eggs bombarded with the cloned
TYLCSV DNA were able to infect tomato test plants.
Circularization and demethylation of TYLCV DNA in insects
that developed from eggs bombarded with a linear copy
of the cloned viral genome
The fate of cloned TYLCV DNA in the bombarded eggs was studied. A full-length
copy of the TYLCV genome was released by digesting plasmid pTYH20.7 with
SphI (Fig. 3, upper panel) and purified following gel electrophoresis. Eggs were
bombarded with microprojectiles coated with the linear TYLCV genomic DNA;
Bombardment of whitefly eggs with TYLCV DNA
795
insects that reached the third instar developmental stage 18 days after bombardment were analyzed individually by PCR (Fig. 3, lower panel). Amplification of
viral DNA using primers V61 and C1256 (encompassing the SphI site) indicated
circularization. Amplification of viral DNA from DpnI-treated DNA (three DpnI
sites are located between primers V61 and C1256, Fig. 3, upper panel) indicated
demethylation.
A 412 bp viral DNA was amplified by PCR in 10 of the 16 larvae tested using
primers V61 and C473. The DNA from these 10 individuals was incubated with
DpnI before performing the PCR test using primers V61 and C1256. A 1195 bp
viral DNA fragment was amplified from these 10 DNA samples at the time when
viral DNA could not be amplified from the DpnI-treated input DNA (Fig. 3, lower
panel, B and C). These results indicated that, following bombardment of whitefly
eggs with the dam methylated linear TYLCV cloned genome, the viral DNA
becomes demethylated and circular during the development of the whitefly egg.
Passage of TYLCV DNA to the progeny of whiteflies that developed
from eggs bombarded with cloned viral DNA
Transovarial transmission of TYLCV [9] was confirmed. Whiteflies that fed on
TYLCV-infected tomato plants were let to oviposit on a young eggplant leaf.
DNA extracted from four groups of adults that developed from the treated eggs
was subjected to PCR using primers V61 and C473. Analysis of the PCR products
followed by Southern blot hybridization with a TYLCV-specific probe revealed
that adults that developed from these eggs did contain TYLCV DNA (Fig. 4, left
panel). Transovarial transmission of TYLCV DNA to progeny of whiteflies that
developed from eggs bombarded with plasmid pTYH20.7 was studied during two
consecutive generations.
䉳
Fig. 3. Circularization and dam demethylation of TYLCV DNA, 18 days after bombardment
of eggs with a full-length SphI/SphI linear copy of the viral genome. Upper panel: Genetic
map of TYLCV; nucleotide corresponding to gene start and end points are mentioned [23].
Treatment of plasmid pTYH20.7 with SphI released a linear full-length genomic copy. PCR
primers used to demonstrate circularization and demethylation are indicated. Grey bars: DpnI
sites. Amplification of viral DNA using primers V61 and C1256 indicates circularization.
Amplification of viral DNA from DpnI-treated DNA using primers V61 and C473 (or C1256)
indicates demethylation. Lower panel: DNA from individuals that reached the third instar
(numbered 1 to 16 or 1 to 10) was analyzed by PCR. The reaction products were subjected to
agarose gel electrophoresis and stained with ethidium bromide. A Amplification of viral DNA
using primers V61 and C473. B Amplification of viral DNA using primers V61 and C1256; 0
no DNA template; P input plasmid treated (+) and untreated (−) with DpnI. C Amplification
of circularized viral DNA using primers V61 and C1256. C Amplification of circular genome
from DNA previously incubated with the dam methylation-dependent enzyme DpnI using
primers V61 and C1256. P Plasmid pTYH20.7. M1 1 kbp DNA ladder marker; M2 100 bp
DNA ladder (Biolabs); numbers on the side indicate marker size in kbp. The amplified viral
DNA fragments are indicated by an arrow
796
V. Goldman and H. Czosnek
Fig. 4. Passage of TYLCV DNA to progeny of whiteflies that eclosed from eggs bombarded with plasmid pTYH20.7. Left panel: transovarial transmission of TYLCV DNA by
viruliferous whiteflies. DNA extracted from four groups of 20 whiteflies (1–4) that developed from eggs laid by viruliferous insects was subjected to PCR using primers V61 and
C473; the reaction products were subjected to agarose gel electrophoresis and stained with
ethidium bromide (a), blotted, hybridized with a virus-specific DNA probe and visualized by
autoradiography (b), Right panel: transovarial transmission of TYLCV DNA by whiteflies
that developed from eggs bombarded with plasmid pTYH20.7. Transmission to first generation progeny (I ): Groups of 60–70 eggs laid by whiteflies that emerged from eggs bombarded
during three independent trials (1–3) were collected and pooled. Egg DNA was subjected to
PCR using primers V61 and C473. The reaction products were subjected to agarose gel electrophoresis and stained with ethidium bromide. Transmission to second-generation progeny
(II, II’): Bombarded eggs were left to develop on the eggplant leaf; the whiteflies that eclosed
were let to oviposition on new untreated eggplants and cucumbers. DNA from five groups
(1–5) of twenty 3rd instars that developed on eggplant (II) and of 20 adults that developed
on cucumber (II’) was subjected to PCR using primers V61 and C473. The reaction products
were subjected to agarose gel electrophoresis and stained with ethidium bromide. P: plasmid
pTYH20.7; 0: eggs bombarded with particles in buffer as a control. The arrow points to the
amplified viral DNA fragment
Whitefly eggs were bombarded with microprojectiles coated with plasmid
pTYH20.7. In three independent trials, the adults that developed during a 3 to
5-day period were collected and reared on eggplants. Groups of 60–70 eggs laid
by these whiteflies were collected and pooled. PCR analysis of DNA from these
eggs with primers V61 and C473 indicated that they contained TYLCV DNA
(Fig. 4, right panel, I).
Adult whiteflies that eclosed from bombarded eggs were collected and let
to oviposition on eggplants and cucumbers. DNA samples from five groups of
20 third instar that developed on eggplant and five groups of 20 adults that
developed on cucumber were subjected to PCR using primers V61 and C473.
Analysis of the PCR products revealed that TYLCV DNA was present in the
nymphs and in the adults (Fig. 4, right panel, II and II’). These results demonstrated that viral DNA was able to pass to the progeny of whiteflies that
Bombardment of whitefly eggs with TYLCV DNA
797
Fig. 5. Association of TYLCV DNA with eggs laid on eggplant leaf previously bombarded
with plasmid pTYH20.7. Whiteflies were allowed to lay eggs on a leaf bombarded the previous
day. Ten eggs collected during the first 24 h were analyzed individually (1 to 10) by PCR using
primers V61 and C473, without (upper panel) or with (lower panel) previous incubation of
the insect DNA with DpnI. P: plasmid pTYH20.7 (not treated with DpnI in both panels)
developed from treated eggs, as did viral DNA to the progeny of viruliferous
insects.
Is the TYLCV DNA associated with eggs originating
from the bombarded leaf?
Adult whiteflies were caged with eggplants one day after the leaves have been
bombarded with plasmid pTYH20.7. The DNA from eggs collected the following
day was analyzed by PCR for the presence of TYLCV DNA using primersV61 and
C473. Viral DNA was amplified from 6 of 10 eggs analyzed (Fig. 5, upper panel).
However, viral DNA was not detected when the DNA from these eggs was treated
with DpnI prior to PCR (Fig. 5, lower panel). In a similar experiment, the eggs
oviposited on the bombarded leaf were let to develop. Crawlers were collected
and analyzed individually. Viral DNA was amplified from 5 of the 10 instars
tested; DpnI treatment prior to PCR abolished amplification (not shown).
These results indicated that the TYLCV DNA associated with the eggs that
developed on a leaf bombarded prior to oviposition was not demethylated, as
was the viral DNA associated with eggs bombarded with cloned TYLCV DNA
(Fig. 3). Hence, the only TYLCV DNA detected was the dam methylated input
plasmid cloned in E. coli. Furthermore, viral DNA was not found associated with
crawlers caged for 5 days with a bombarded eggplant leaf (not shown), indicating
that these crawlers have not internalized viral DNA or that the internalized viral
DNA has been digested.
Discussion
We have reported previously that TYLCV DNA was found in eggs of viruliferous
B. tabaci, both in the ovaries and after oviposition [9]. Furthermore some of these
eggs developed into viruliferous whiteflies. The goal of the present investigation
was to find out whether we could mimic the virus invasion of the whitefly reproductive system by bombarding eggs with microprojectiles coated with infectious
798
V. Goldman and H. Czosnek
TYLCV DNA clones. Although viral DNA can be introduced into hundreds of
eggs in a single bombardment event, we cannot predict the number of adult insects
that will be able to transmit the viral disease (Table 1). In this regard, the situation
is comparable to that of the early days of microinjection of exogenous DNA into
mouse eggs. However microprojectiles caused egg injury as well as necrosis of
the leaf tissue the eggs feed on. The presence of the viral DNA by itself seemed to
inhibit egg development, beyond the damage due to mechanical injury. Likewise
we have found that the long-term association of TYLCV with adult whiteflies
affected insect vital parameters such as fecundity and life expectancy [23].
For these studies we have bombarded B. tabaci eggs with infectious DNA
clones of TYLCV [18] and TYLCSV [14]. We used TYLSCV to ensure that our
observations were not limited to TYLCV and to eliminate a possible contamination by the local virus. In both cases, adult whiteflies that developed from treated
eggs were able to inoculate tomato test plants (Figs. 1 and 2). From the inoculated leaf, the virus spread systemically and was readily detected in the roots.
Symptomatic plants contained the viral DNA species normally found in naturally
infected tomato [1]. These observations imply that the input DNA is the precursor
of a virus likely identical to that acquired and transmitted naturally by B. tabaci.
The fate of the viral DNA from the moment it is delivered to the egg until an adult
insect ecloses from the pupal case is unclear. We attempted to study the first steps
of this path by bombarding B. tabaci eggs with different configurations of cloned
TYLCV (Fig. 3).
Following delivery of a linear DpnI-sensitive TYLCV genomic clone, the
input viral DNA became DpnI resistant. Moreover, PCR analyses implied that the
linear viral DNA was converted into a circular molecule. These results suggested
dam demethylation accompanying replication of the circularized viral genome in
the insect tissues. A similar change in DpnI susceptibility occurred after delivering
a head-to-tail dimeric copy of the TYLCV genome cloned in an E. coli plasmid.
Viruliferous adult whiteflies developed from these eggs implying that these insects
contained and were able to transmit an infectious virus entity similar to the one
that can be acquired from and transmitted to tomato plants. It is possible that
during replication in the developing egg, an infectious genomic monomer was
released from the virus dimeric clone by homologous recombination between the
two viral copies, similarly to the replication-release model proposed to occur when
plants are agroinoculated with dimeric copies of geminiviral genomes [25]. Once
released, we assume that the viral genome remained episomal and self-replicating.
Similarly to virus ingested by whiteflies during access to infected tomato plants
[1], the viral DNA could be transmitted to progeny of insects emerging from eggs
that have acquired viral DNA by bombardment (Fig. 4).
We have excluded the possibility that viruliferous whiteflies could develop
from eggs that were associated with TYLCV DNA as the result of a fortuitous
contact with coated microprojectiles disseminated on the target leaf. Indeed when
whiteflies oviposited on an eggplant leaf previously bombarded with TYLCV
DNA, viral DNA was associated with the eggs and the first instars, however
this DNA remained DpnI-sensitive, indicating that the eggs were soiled with the
Bombardment of whitefly eggs with TYLCV DNA
799
microprojectiles. Moreover, TYLCV DNA was not detected in crawlers caged
with a bombarded leaf, indicating that crawlers did not collect the microprojectiles
while moving on the treated leaf or when phloem-feeding on the leaf with it
stylets [21].
The questions of how an infectious TYLCV molecule accompanies egg
development, how it becomes an infectious particle and how it finds its way
in the organs involved in geminivirus transmission by adults, remains mysterious. We postulate that the path of the viral DNA is similar to that followed by
TYLCV during transovarial transmission [8]. In order to be carried through the
development pathway, it is likely that the delivered viral DNA has to penetrate
the right cells. Based on our knowledge on the tissues and organs involved in the
circular transmission of begomoviruses [2, 8, 10, 12, 13, 22], we speculate that
the recipient cells need to be precursors of either the digestive tract or the salivary
glands. It is not likely that the viral DNA will survive if it reaches the body fluids
as nucleic acids may be destroyed by nucleases. Only encapsidated virions seem
to be able to endure the hostile environment of the haemolymph by interacting
with GroEL-like chaperonins produced by endosymbionts [15, 16]. Although endosymbionts are present in the whitefly egg [3], we do not know whether or not
they produce GroEL at this stage of the insect development. Although not demonstrated we postulate that at a given stage, the input viral DNA was expressed, capsid monomers were produced which encapsidate single-stranded genomic DNA
molecules, engendering a virulent virion. Indeed, in our hands, the capacity of
TYLCV to be translocated and transmitted was always associated with the presence of viral DNA coupled with the capsid protein [7, 8]. This hypothesis is under
investigation.
Acknowledgements
Supported by a grant from the Israeli Ministry of Agriculture to H. Czosnek. The authors
thank Drs. Bruno Gronenborn and Ahmed Kheyr-Pour for the TYLCSV clone.
References
1. Ber R, Navot N, Zamir D, Antignus Y, Cohen S, Czosnek H (1990) Infection of tomato
by the Tomato yellow leaf curl virus: susceptibility to infection, symptom development
and accumulation of viral DNA. Arch Virol 112: 169–180
2. Cicero JM, Hiebert E, Webb SE (1995) The alimentary canal of Bemisia tabaci and
Trialeurodes abutilonea (Homoptera, Sternorrhynchi): histology, ultrastructure and correlation to function. Zoomorphology 115: 31–39
3. Costa HS, Toscano NC, Henneberry TJ (1996) Mycetocyte inclusion in the oocytes of
Bemisia argentifollii (Homoptera: Aleyrodidae). Ann Entomol Soc Am 89: 694–699
4. Czosnek H, Laterrot H (1997) A worldwide survey of Tomato yellow leaf curl viruses.
Arch Virol 142: 1391–1406
5. Fauquet CM, Maxwell DP, Gronenborn B, Stanley J (2000) Revised proposal for naming
geminiviruses. Arch Virol 145: 1743–1761
6. Gerling D, Mayer RT (eds) (1995) Bemisia 1995. Taxonomy, biology, damage, control,
and management. Intercept, Andover
800
V. Goldman and H. Czosnek
7. Ghanim M, Czosnek H (2000) Tomato yellow leaf curl geminivirus (TYLCV-Is) is
transmitted among whiteflies (Bemisia tabaci) in a sex-related manner. J Virol 74:
4738–4745
8. Ghanim M, Morin S, Czosnek H (2001) Rate of tomato yellow leaf curl virus (TYLCV)
translocation in the circulative transmission pathway of its vector, the whitefly Bemisia
tabaci. Phytopathology 91: 188–196
9. Ghanim M, Morin S, Zeidan M, Czosnek H (1998) Evidence for transovarial transmission
of Tomato yellow leaf curl virus by its vector the whitefly Bemisia tabaci. Virology 240:
295–303
10. Ghanim M, Rosell RC, Campbell LR, Czosnek H, Brown JK, Ullman DE (2001)
Digestive, salivary and reproductive organs of Bemisia tabaci (Gennadius) (Hemiptera:
Aleyrodidae) biotype B. J Morphol 248: 22–40
11. Hanley-Bowdoin L, Settlage SB, Orozco BM, Nagar S, Robertson D (1999) Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation. Crit
Rev Plant Sci 18: 71–106
12. Harris KF, Pesic-Van Esbroeck Z, Duffus JE (1996) Morphology of the sweet potato
whitefly, Bemisia tabaci (Homoptera, Aleyrodidae) relative to virus transmission.
Zoomorphology 116: 143–156
13. Hunter WB, Hiebert E, Webb SE, Tsai JH, Polston JE (1998) Location of geminiviruses in the whitefly Bemisia tabaci (Homoptera: Aleyrodidae). Plant Dis 82:
1147–1151
14. Kheyr-Pour A. Bendahmane M, Matzeit V, Accotto GP, Crespi S, Gronenborn B (1991)
Tomato yellow leaf curl virus from Sardinia is a whitefly-transmitted monopartite geminivirus. Nucleic Acids Res 19: 6763–6769
15. Morin S, Ghanim M, Sobol I, Czosnek H (2000) The GroEL protein of the whitefly
Bemisia tabaci interacts with the coat protein of transmissible and non-transmissible
begomoviruses in the yeast two-hybrid system. Virology 276: 404–416
16. Morin S, Ghanim M, Zeidan M, Czosnek H, Verbeek M, van den Heuvel JFJM (1999)
A GroEL homologue from endosymbiotic bacteria of the whitefly Bemisia tabaci is
implicated in the circulative transmission of Tomato yellow leaf curl virus. Virology 30:
75–84
17. Nakhla MK, Maxwell DP (1998) Epidemiology and management of tomato yellow leaf
curl disease. In: HadidiA, Khetarpal RK, Koganezawa H (eds) Plant virus disease control.
APS Press, St Paul, pp 565–583
18. Navot N, Pichersky E, Zamir D, Czosnek H (1991) Tomato yellow leaf curl virus,
a whitefly-transmitted geminivirus with a single genomic component. Virology 185:
151–161
19. Padidam M, Beachy RN, Fauquet CM (1995) Classification and identification of geminiviruses using sequence comparisons. J Gen Virol 76: 249–263
20. Picó B, Diez MJ, Nuez F (1996) Viral diseases causing the greatest economic losses
to tomato crop. II. The tomato yellow leaf curl virus – a review. Sci Horticult 67:
151–196
21. Pollard DG (1955). Feeding habits of the cotton whitefly. Ann Appl Biol 43:
664–671
22. Rosell RC, Torres-Jerez I, Brown JK (1999) Tracing the geminivirus-whitefly transmission pathway by polymerase chain reaction in whitefly extracts, saliva, hemolymph, and
honeydew. Phytopathology 89: 239–246
23. Rubinstein G, Czosnek H (1997) Long-term association of tomato yellow leaf curl virus
(TYLCV) with its whitefly vector Bemisia tabaci: effect on the insect transmission
capacity, longevity and fecundity. J Gen Virol 78: 2683–2689
Bombardment of whitefly eggs with TYLCV DNA
801
24. Rybicki EP (1994) A phylogenetic and evolutionary justification for three genera of
Geminiviridae. Arch Virol 139: 49–77
25. Stenger DC, Revington GN, Stevenson MC, Bisaro DM (1991) Replication release of
geminivirus genomes from tandemly repeated copies: evidence for rolling-circle replication of a plant viral DNA. Proc Natl Acad Sci USA 88: 8029–8033
Author’s address: Dr. H. Czosnek, Faculty of Agricultural, Food & Environmental
Quality Sciences, Department of Field Crops, Vegetables & Genetics, Laboratory of Plantvirus-vector interactions, The Hebrew University of Jerusalem, Rehovot 76100, Israel;
e-mail: [email protected]
Received February 19, 2001