Supplementary Materials List of Supplementary materials: Supplementary Figures: Supplementary Figure 1: Strategy for inducible recombination in the prostate Supplementary Figure 2: Analyses of tumor regression following castration Supplementary Figure 3: Gene Set Enrichment Analysis (GSEA) Supplementary Tables: Supplementary Table 1: List of the primers used in this study Supplementary Table 2: List of antibodies for used in this study Supplementary Table 3: Summary of phenotypic analyses Supplementary Table 4: Differentially expressed genes between Nkx3.1CE2/+; Ptenf/f; BrafCA/+ and Nkx3.1CE2/+; Ptenf/f mouse prostate tumors (p-value<0.01) (included as a separate Excel file) Supplementary Table 5A: Pathway enrichment analysis for differentially expressed genes between Nkx3.1CE2/+; Ptenf/f; BrafCA/+ and Nkx3.1CE2/+; Ptenf/f mouse prostate tumors (positive enrichment) (included as a separate Html file) Supplementary Table 5B: Pathway enrichment analysis for differentially expressed genes between Nkx3.1CE2/+; Ptenf/f; BrafCA/+ and Nkx3.1CE2/+; Ptenf/f mouse prostate tumors (Negative enrichment) (included as a separate Html file) Supplementary Table 6A: Myc pathway enrichment analysis for differentially expressed genes between Nkx3.1CE2/+; Ptenf/f; BrafCA/+ and Nkx3.1CE2/+; Ptenf/f mouse prostate tumors. (included as a separate Html file) Supplementary Table 6B: Myc pathway enrichment analysis for differentially expressed genes between RAP+PD treated and Vehicle treated Nkx3.1CE2/+; Ptenf/f; BrafCA/+ mouse prostate tumors. (included as a separate Html file) 1 Supplementary Table 7: Summary of preclinical data Supplementary Table 8: List of differentially expressed genes between RAP+PD treated and Vehicle treated Nkx3.1CE2/+; Ptenf/f; BrafCA/+ mouse prostate tumors (p-value<0.01) (included as a separate Excel file) 2 Supplementary Figure 1 Supplementary Figure S1. Strategy for inducible recombination in the prostate. Relevant mice have an Nkx3.1CreERT2 allele as well as Ptenflox/flox allele, in which loxp sites flank Exon 5 and/or a lox-stop-lox activatable oncogenic BrafV600E allele. Recombination is induced by delivery of tamoxifen at 2-3 months of age. Note that the Nkx3.1CreERT2 allele is null for Nkx3.1, such that the experimental mice are heterozygous for Nkx3.1. 3 Supplementary Figure 2 Supplementary Figure 2. Analyses of response to castration. NPB Mice were induced to form tumors at 2 months of age and then castrated (or left intact) 1 month later. Shown are whole mount images of the urogenital regions including prostate (A, B) and H&E images of the tumor (C, D). The scale bar represents 100 m. 4 Supplementary Figure 3 Supplementary Figure S3. Gene Set Enrichment Analysis (GSEA) of genes differentially regulated between the NPB (Nkx3.1CE2/+; Ptenf/f; BrafCA/+) and NP (Nkx3.1CE2/+; Ptenf/f) mouse prostate tumors. For pathway analysis, genes comprising the mouse signature genes (i.e., NPB versus NP) were mapped to their human orthologs and annotated to biological processes. The positive enrichment scores for the curve of the pathways indicate an enrichment of the overexpressed part of the malignancy signature in the genes that belong to a given pathway. 5 Supplementary Table 1: List of the primers used in this study Purpose and name of primers Genotyping Allele Nkx3.1CreERT2/+ Ptenflox/lox Sequences CAGATGGCGCGGCAACACC ACTCAAGGCAGGGATGAGC BrafLSL-V600E/+ TGAGTATTTTTGTGGCAACTG GCGCGGTCTGGCAGTAAAAAC GTCATCTTCACTTAGCCATTG G CTCTGCTGGGAAAGCGGC Real time q-PCR MYC CCND1 CCND2 CCNB1 GLRX3 EEF1E1 β-ACTIN Forward TCCTGTACCTCGTCCGATTC AGTGCGTGCAGAAGGAGATT GAGTGGGAACTGGTAGTGTTG AAGGTGCCTGTGTGTGAACC CAGTGGTGGAAGTCGGCTC ACTGAAGCCGGGGAATAAGTA TCATGAAGTGTGACGTTGACAT CCGT Reverse GGTTTGCCTCTTCTCCACAG CACAACTTCTCGGCAGTCAA CGCACAGAGCGATGAAGGT GTCAGCCCCATCATCTGCG GCCATGACATCGTTCATCTGT GCCTGCTTGACTAGATGGGTG CCTAGAAGCACTTGCGGTGCA CGATGGAG Forward Reverse 6 Supplementary Table 2: List of antibodies for used in this study Antibody Company Catalog # Type Phospho 4E-BP1(Ser65) Total 4E-BP1 β -Actin Androgen Receptor Phospho Akt (Ser473) Phospho Akt (Ser473) Total Akt Cyclin D1 Cytokeratin 5 Cytokeratin 8 Ki67 Pan Cytokeratin Phospho eIF4E (Ser209) Total eIF4E Phospho p44/42 MAPK (Erk1/2) (Thr202/Tyr204) Phospho p44/42 MAPK (Erk1/2) (Thr202/Tyr204) Total p44/42 MAPK (Erk1/2) Phospho GSK-3α/β (Ser21/9) Total GSK-3α Phospho MEK1/2 (Ser217/221) Total MEK1/2 c-Myc Phospho p38 MAPK (Thr180/Tyr182) RalA Phospho S6 Ribosomal Protein (Ser235/236) Total S6 Ribosomal Protein Synaptophysin Cell Signaling Cell Signaling Cell Signaling Santa Cruz Cell Signaling Cell Signaling Cell Signaling Zymed Covance Covance Novacastra Dako Cell Signaling Cell Signaling 9451 9452 4970 SC-816 3787 4060 9272 13-4500 PRB-160P MMS-162P NCL-Ki67p Z0622 9741 9742 4376 Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit Mouse Rabbit Mouse Rabbit Rabbit Rabbit Rabbit Cell Signaling Cell Signaling 9101 Rabbit Use and dilution IF IHC Western 1:500 1:1000 1:3000 1:500 1:500 1:500 1:1000 1:500 1:500 1:500 1:2000 1:200 1:500 1:1000 1:100 Rabbit 1:500 Cell Signaling 9102 Rabbit 1:1000 Cell Signaling 9331 Rabbit 1:1000 Cell Signaling 9338 Rabbit 1:1000 Cell Signaling 9121 Rabbit 1:500 Cell Signaling Epitomics 9122 1472-1 Rabbit Rabbit 1:1000 1:500 Cell Signaling 4511 Rabbit 1:1000 Cell Signaling 3526 Rabbit 1:1000 Cell Signaling 2211 Rabbit Cell Signaling Zymed 2217 18-0130 Rabbit Rabbit 7 1:100 1:1000 1:1000 1:300 Supplementary Table 3: Summary of phenotypic analyses Genotype(s) Nkx3.1CreERT2/+; Pten+/+; Braf+/+ Na Ageb Phenotypec Survivald Weight (gms) % KI67 cells Metastasese Lymph node 0/5 Lung DTCs 0/5 0/5 9 8 Within normal limits 100% 0.19 0.07 2.661 0.16 5 8 Within normal limits 100% 0.28 0.05 P=0.413f 12.08 1.3 P<0.0001 0/5 0/5 0/5 20 9-12 Extensive PIN III and PIN IV, with some areas of squamous papilloma 100% 0.35 0.07 P=0.1458 22.33 1.22 P<0.0001 0/5 0/10 1/11 21 2-7 Microinvasive adenocarcinoma with areas of adenomatous, squamous, and solid spindle cell components; other areas of complex papillar tumor with adenosquamous and goblet cell components 1.8 0.3 P<0.0001 36.25 3.36 P<0.0001 3/5 3/10 2/10 (N) Nkx3.1CreERT2/+; Pten+/+; BrafCA/+ (NB) Nkx3.1CreERT2/+; Ptenflox/flox; Braf+/+ (NP) Nkx3.1CreERT2/+; Ptenflox/flox; BrafCA/+ (NPB) 4 mths 0.8 P<0.0001 NOTES: a) N is the total number of mice analyzed b) Age refers to the time of analyses after induction with Tamoxifen (or treatment with corn oil); mice were induced at 2 months of age. c) Phenotype refers to the pathological description of this histological phenotype according to the classification of Park et al. 2002. d) Survival refers either to the % of mice alive at the time of analyses or to the average age of lethality represented in months. e) Tissue metastases were scored by analyses of H&E and with two IHC markers (AR and Pan-Cytokeratin); Disseminated tumor cells (DTCs) were evaluated from bone using a PCR based assay. f) All P values compare the experimental group (as indicated) to the control group. 8 Supplementary Table 7: Preclinical treatment data Proliferation Genotype Treatment N Weight (grams) (%) CreERT2/+; Nkx3.1 Ptenflox/flox; BrafCA/+ (NPB) Vehicle 10 RAP 6 PD 6 RAP + PD 10 0.43 0.18 0.60 0.08 P = 0.50 0.74 0.08 P = 0.22 0.09 0.02 P<0.0001 9 Lung Mets 36 3.3 3/10 Disseminated Tumor Cells 2/10 23 2.7 P = 0.02 ND ND 13 1.03 P = 0.0003 ND ND 10 1.12 P<0.0001 1/10 0/10
© Copyright 2024 Paperzz