[CANCER RESEARCH 50, 4830-4838. August 15, 1990|
Special Lecture
The Final Common Pathway of Cancer: Presidential Address1
Harris Busch
Department of Pharmacology, Baylor College of Medicine. Houston, Texas 77030
The "final common pathway of cancer" has been known for
many years to result in clinical aberrations including (a) organ
failure, (b) cachexia, and (c) death. These clinical effects result
from the biological characteristics of cancer which include (a)
growth of cells and masses without control, (b) invasiveness,
(c) metastasis, and (d) nucleolar pleomorphism (1).
These effects are best exemplified in patients with cutaneous
malignancies which are surgically removed and, as with internal
malignancies, the patients are told the major lesions have been
successfully resected. Unfortunately, with time, there is not
only recurrence but also spread of the lesions with local inva
sion, regional metastasis, and then involvement of vital organs.
One of the most notable features of cancer is its heterogeneity
(2). This heterogeneity exists with respect to virtually all fea
tures of cancers including the biology noted above with respect
to growth rate, invasiveness, and metastasis. Phenotypically,
cancers vary with respect to the surface markers which are
important in leukemia and also with respect to other surface
markers. Skin cancers produce varying amounts of melanin,
pancreatic cancers such as insulinomas produce varying
amounts of insulin, and lung cancers may produce a variety of
hormones. The heterogeneity extends to a broad array of chro
mosomal variants, differentiation markers, secreted products,
and drug resistance.
In previous addresses, other presidents have educated us
about DNA, the genetic substance to which Virchow (3) and
Thiersch (4) were alluding directly and indirectly when they
noted from the cell theory not only "Omnìscellula e cellula,"
that all cells come from cells but also "Omnis cellulae e cellula
ejusdem generis" that all cells come from cells of the same type.
In the case of cancer, as Ishabashi (5) and Furth and Kahn (6)
noted, a single cancer cell could be the genesis of the whole
process. If that is the case, then cancer is a genetic problem,
but what genetics?
Oncogenes
Part of the heterogeneity in neoplasia is increasingly dem
onstrated with studies on the over 30 oncogenes that are ex
pressed in human cancers (Table 1). These oncogenes differ
functionally and in cellular localization (7). Their expression in
cancer cells does not seem to be completely random, yet no
statistically consistent relationship has been demonstrated
either for cell surface, cytoplasmic, or nuclear oncogenes. The
variation of types and expression of the oncogenes regardless
of their localization and tumor type reflects the underlying
heterogeneity of chromosomal and metabolic changes in cancer.
The cancer problem is unfortunately associated with a vast
number of potential mutations within the genome including
both the reading frames of coding regions and control sites such
as promoter sites. Table 2 indicates the total number of poten
tial variants is 410'. Although it is fortunate that only a few
variants occur in individual cancers, the total population of
cancer cells in individuals may exhibit a large number of poten
tial variants and recombinants. It is as if the fidelity of DNA
replication has become unhinged. The primary, metastatic, and
successive resistant tumors may differ markedly in their DNA
variants and their derived biological properties.
Attention has focused on the last few years on the mitogenic
cascade (8). Since it is obvious for many years that DNA
synthesis was an essential element of all kinds of growth in
cluding that of cancer cells, comparative studies were made. It
is clear that at least the overall pathway of DNA synthesis is
essentially the same in cancer cells and other growing and
dividing cells. Since M and G2 phases of the cell cycle generally
involve the same types of events in normal and cancer cells, the
keys to the cancer problem are clearly in the G0/G, junction or
in the Gìphase of the cell cycle. However, the multiplicity of
oncogenes makes it likely that there are many types of events
involved in carcinogenic mechanisms and in oncogene activa
tion and control.
To attack cancer cells, it is necessary to define common
critical targets in the "final common pathway." Accordingly,
we have searched for the elements in the Gìphase that exhibit
commonality, in the sense that such common features of cancers
should be present in a very large percentage of human tumors.
In our studies on nuclear and nucleolar antigens, we have begun
to define early G, antigens that are present in a broad range of
human cancers.
To reach this point, we have gone through a lengthy devel
opmental process. Van Potter said that research consists of a
series of tracks with switches at critical points that provide new
paths and opportunity for continuation along these for a time.
"The moving finger points and have pointed, moves on again."
My paths are examples, (a) I started with Van Potter and
Jim Miller on the problem of carcinogenesis, where I learned
about azo dyes and watched the evolution of the Miller's studies
on protein binding, (b) I learned about blocking the Krebs cycle
with malonate and fluoroacetate and the double blocking tech
niques that had some usefulness in combination therapy (9). (c)
On my own at Yale, from 1952 to 1955, I expanded the
relationship of the Krebs cycle to proteins through the rapid
interactions with glutamic and aspartic acid, demonstrated by
the ion exchange methods derived from the Atom Bomb project
(10). (d) At Illinois, from 1955 to 1960, we analyzed what
proteins were rapidly produced in cancer cells compared to
other cells and learned of the intensity of histone and other
nuclear protein synthesis in cancer cells (11). (e) We also found
that the pleomorphic nucleoli of cancer cells were amazingly
rapidly labeled with nucleic acid precursors and began our
Received 5/16/90.
studies on nucleolar isolation which became practical in 1963
1Presented at the 81st Annual Meeting of the American Association for Cancer
(12). (/) With improved terminal labeling methods, we found
Research, Washington, DC, May 24. 1990. These studies were supported by
Cancer Research Grant CA-10893. PI, awarded by National Cancer Institute,
that nonhistone, acidic proteins were very diverse as compared
Department of Health and Human Services; the DeBakey Medical Foundation;
to
histones, which led to our idea that these were the gene
H. Leland Kaplan Cancer Research Endowment; Linda and Ronny Finger Cancer
Research Endowment Fund; and the William S. Parish Fund.
control proteins ( 13). (g) Analysis of the RN A of isolated nuclei
4830
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.
FINAL COMMON PATHWAY OF CANCER
Table 1 Known oncogena
ablargAC/-Ibcl-2blymcrkerbAerbBerbB-2erketsfafafmsfosfpsfumhfr-2hst-2int-lint-2junkitmetmosmybc-mycL-mycN-mycneupirnraf/melras-Hras-K.ras-NravSÙskisrcyes-\
Table 2 Cancer problem
1. Promoter she rearrangements = IO7variants proportional to Ig-Ig receptors.
2. Mutational variants = 4/site.
3. Potential variants = 4'°'.
4. Fortunately: a few variants only/cancer cell.
led to demonstration of the U-small nuclear RNAs (U-rich in
uridylic acid) (14); the first was nucleolar U3 RNA, the function
of which is still being worked out. We isolated and sequenced
Ul and U 2 RNAs and discovered "the RNA cap" and a fasci
nating family of small nuclear and cytoplasmic RNAs that had
not been discovered previously (15). Strangely, this work was
not greeted with enthusiasm or accolades but rather with great
skepticism, negativism, and hostility. Among the reasons were:
(/) the conviction that only tRNA, mRNA, and rRNA existed;
(//) the prior reports on other small RNAs had been squelched
by evidence that they were breakdown products; and (///')
strangely, some negativism existed about novel studies emerg
ing from as humble a place as Baylor College of Medicine.
Interestingly, down the hall, Guillemin and Schally earned the
Nobel Prize in the 1960s for studies on pituitary hormones.
When our studies on sequences showed that these U-RNAs
were unique and fascinating molecules, others not only found
them but also confirmed and improved our work and then
extended these studies to demonstration of the critical roles of
these molecules in processing of pre-mRNA, pre-rRNA, protein
transport, and a host of other cellular functions (16). Because
we did not find differences between cancer cells and other cells
with respect to these molecules, we turned to other fields.
One exciting area of work had been the sequencing of histones. Although we initially competed with large and more
efficient groups, our work was facilitated by gram quantities of
two histones provided by Kai Mauritzen, on sabbatical from
Australia (17). These histones were the same in tumors and
nontumorous tissues. The technology led us forward with stud
ies of nonhistone proteins, which we had suggested were the
real gene controls. To study these, we developed our own 2dimensional "Blue Tornado" gel method, which was superceded
by the better O'Farrel method. However, the "Blue Tornado"
technique had some real virtues, among which was the discovery
that some histones were modified by covalent linkage to another
protein, ubiquitin (18). This was the first demonstration of a
protein-protein modification.
Nucleolar Pleomorphism
The high order of nucleolar variation that characterizes can
cer cells was described in the 1930s by the Mayo group (19)
and in the Karolinska Institute (20). Many attempted to isolate
and identify nucleoli from cancer cells and in 1963 we developed
a simple, efficient, and relatively large scale isolation method
(14), which permitted a broad range of studies to be done on
Fig. 1. Immunodiffusion plate which contains 0.6 M NaCI extracts of tumor
nuclear chromatin (TCAg) in the top left well and liver nuclear chromatin (LCAg)
in the top right well (300-400 pg). The tumor chromatin antigen formed a
precipitation band with the tumor nucleolar antiserum ( TnAb). The LCAg antigen
formed at least three precipitation bands with the liver nucleolar antibodies
(LnAb). The antibody wells contain 33 ¿il.
nucleolar constituents including the rDNA,' polymerase I,
small nucleolar RNAs, and more recently on promoters, cisacting and irons-acting elements that control the rDNA.
These studies have shown there are many common elements
in the rDNA of cancer cells and other cells as might be expected
from the fact that all cells need the ribosomes produced in the
nucleoli for protein synthesis and for cell growth.
Nuclear Proteins
A very large number of nuclear proteins exist in cancer cells
and other cells. In our laboratory, Takami et al. (21, 22)
established that there were over 900 proteins visible by Coomassie blue staining in 2-dimensional gels of Novikoff hepatoma
and normal liver. These proteins were initially characterized by
their solubility, isoelectric points, and electrophoretic mobility.
Proteins in sparse copy numbers were undetectable, i.e.,
amounts range from 10 to 100 copies per cell, so it was clear
that most trans-acting factors consequential to the control of
genes could not be identified with this technique. It is possible
that there may be another 1000 proteins in the nucleus that
may be important in gene control. The key question that arose
was how we could begin to approach such control elements in
the cell nucleus.
Nuclear Immunology
With the very large number of potential gene control proteins
that might impinge on the cancer process, it seemed essential
to find approaches that could more effectively differentiate
events in cancer cells from those in other cells than the gel
systems available.
As one approach, using isolated nucleoli as immunogens,
Busch and Busch (23) immunized rabbits and cross-absorbed
the antisera to the point where they no longer produced crossed
immunofluorescence.
Ouchterlony gels (Fig. 1) demonstrated that the Novikoff
hepatoma nucleoli contained antigens that were undetectable
in the liver nucleoli and also that liver nucleoli contained
antigens that were not present in the tumor nucleoli. When
2The abbreviations used are: rDNA. ribosomal DNA: cDNA, complementary
DNA; MAb. monoclonal antibody.
4831
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.
FINAL COMMON
PATHWAY OF CANCER
these studies on rat tissues were confirmed, similar studies were
carried out with human tumor nucleoli (24-26). Rabbit antisera
to HeLa cell nucleoli were absorbed with as many nontumor
tissues as we could obtain from postmortem and surgical spec
imens. The absorbed antisera immunoreacted with a broad
range of human cancers including carcinoma of the lung, gas
trointestinal tract, genitourinary tract, etc. (Table 3). On the
other hand, they did not immunoreact with normal human
liver, kidney, and a variety of other tissues including embryonic
tissues (Table 4). In studies on a number of benign tumors, Dr.
Gyorkey at the V. A. Hospital reported they had negative
fluorescence.
Because of the limitations of the techniques and perhaps
because of the characteristics of the tumors, only 94% of human
cancers reacted with these human tumors induced rabbit antisera.
Monoclonal Antibodies
Because of the difficulties associated with rabbit antibodies
in terms or reproducibility, titer, bleeding number, and individ
ual variations, attempts were made to produce monoclonal
antibodies (27) which were unsuccessful for several years despite
intense efforts.
Freeman et al. (28) utilized the previously developed antiliver antibodies to block the nontumor antigens in HeLa nucleolar preparations and utilized this mixture as the immunogen. With that technology, a series of monoclonal antibodies
were developed that reacted with HeLa cells but not with human
Table 3 Bright nucleolar immunofluorescence in human tumors
I. Carcinomas
1. Bladder
2. Brain, glioblastoma
3. Colon
Adenocarcinoma (4)°
Metastasis, liver (1)
Transplantable carcinoma (GW-39)
4. Eccrine gland, carcinoma (GW-39)
5. Esophagus, squamous cell carcinoma
6. Liver, primar)' carcinoma
7. Lung
Adenocarcinoma (2)
Oat cell (2)
Squamous cell (5)
8. Melanoma, malignant, cerebral métastases
9. Prostate, adenocarcinoma (4)
10. Skin
Basal cell carcinoma (2)
Squamous cell carcinoma (7)
Metastasis, lymph node
11. Stomach
Adenocarcinoma
Metastasis, liver
12. Thyroid, carcinoma (2)
II. Sarcomas
1. Myoblasloma, malignant of lip; metastasis to cervical lymph node
2. Osteogenic sarcoma (3), biopsy, tissue culture
3. Synovial sarcoma
III. Hematological neoplasms
1. Hodgkin's disease (Reed-Sternberg, lymphocytes)
2. Leukemia: chronic lymphocytic, hairy cell (spleen)
3. Lymphoma, lymphocytic, spleen
4. Multiple myeloma (2)
IV. Cultures
1. Breast carcinoma
2. Colon adenocarcinoma
3. HeLa
4. HEp-2
5. Prostate, carcinoma (3)
6. Squamous cell carcinoma (3)
°Numbers in parentheses, number of cases.
Table 4 Negative immunofluorescence in human tissues
I. Normal tissue
1. Bladder
2. Bone marrow (hemoblastic lines) (5)°
3. Breast
4. Buffy coat, blood (3)
5. Intestine, small, crypts of Lieberkuhn
6. Intestine, large
7. Kidney
8. Liver
9. Lung (adjacent to tumor)
10. Lymph node
11. Lymphocytes, normal (2)
12. Pancreas
13. Placenta
14. Prostate gland
15. Skin
16. Stomach
17. Thyroid gland
II. Benign growing tissues
1. Breast, adenoma
2. Parathyroid, adenomas (2)
3. Prostate gland, hyperplasia (2)
4. Thyroid
Adenomas (3)
Nodular goiters (2)
III. Inflammatory diseases
1. Chronic ulcerative colitis
2. Glomerulonephritis
3. Granuloma and fibrosis of lung
4. Liver: cirrhosis, hepatitis
5. Lupus profundus (mammary gland and skin)
6. Pemphigus: bullous
7. Ulcer, gastric
IV. Cultures
1. Breast fibroblasts
2. Lymphocytes, phytohemagglutinin-stimulated
" Numbers in parentheses, number of cases.
liver. These highly specific monoclonal antibodies identified
individual bands as might have been expected (29-31). It was
of particular interest that some of these antibodies identified
antigens that were expressed at highly specific time points in
the GI phase. As shown in Fig. 2, the G, phase has a timetable
for appearance of specific nucleolar antigens which reflect early,
middle, and late appearing antigens over an approximate 8-h
period. On refeeding prestarved cells, the antigens were first
expressed in the nucleus and then were localized to the nucleolus (30).
The G, phase is the period from the termination of G0 or
interphase to the initiation of the S phase or DNA synthesis
which may be divided into three phases of "entry," "cascade,"
and "preDNA synthesis."
Much attention has been focused on the various hormones,
phosphorylation reactions, and other events that set the G,
phase into motion. Epidermal growth factor, insulin growth
factors, and others start the process which "turns on" critical
machinery involved in activation of various types of "protooncogenes" that are normal elements of cell response. The ap
pearance of fas, myc, and other nuclear proteins is part of the
reaction sequence in the timetable of GI.
The middle of GI is associated with a variety of nuclear and
nucleolar events which have been identified in part with the aid
of autoimmune techniques and with the aid of monoclonal
antibodies. Our work has centered on the role of such events in
the nucleolus.
Late G, is characterized by production of special elements
responsible for DNA synthesis and the best studied example of
this is "cyclin" which has been sequenced and characterized as
DNA polymerase o. The exact role of this factor is still uncertain
but it appears in both nuclear and nucleolar regions and pre
sumably exerts a similar role in both sites.
4832
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.
FINAL COMMON PATHWAY OF CANCER
B23
P120
P86
P40
P85
C-FÃœS C-MYC
1 '
C-MYB
2
3
EARLY
Fig. 2. Gìmarker
MAbs (23).
antigens detected
P53
4
5
6
MIDDLE
P21
7
S
DNA
HISTONES
LATE
"RESTRICTION
POINT"
P68
by
BORDER
B¿RDER
Nucleolar Antigen PI 20
nucleolar antigen P120. With these clones, nucleotide se
quences were obtained for most of the structure. Despite all the
libraries utilized, we were unable to find a full length cDNA
(35). Jeff Hazlewood, a medical student, and Orly Janssen, a
summer student from Rice University, searched genomic li
braries and found a PI20 gene by hybridization with the P120
cDNA clones (36). The sequence of the missing cDNA portion
was then inserted into the cDNA to obtain a complete coding
sequence. The overall restriction map is shown in Fig. 4. The
sequences (Fig. 5) were obtained for the nucleotides and the
amino acids (35).
The P120 protein consists of four major domains (Fig. 6): a
basic domain; an acidic domain; a hydrophobic and methioninerich domain; and a domain rich in cysteine and proline residues.
One of the most notable regions is the series of acidic clusters
in the amino-terminal portion of the molecule. Glutamic acid
sequences up to six residues long flanked by two aspartic acid
residues were identified. Some of these sequences are possible
"nucleolus recognition signals" since they are also present in
In the course of development of antinucleolar antibodies,
several identified proteins that appeared in the nucleolus during
the GÌ
phase but were not found in normal resting cells.
Of greatest interest was the nucleolar antigen P120 (32) the
properties of which are indicated in Table 5. This antigen was
detected between 5 and 30 min in refed cells and was found in
most malignant tumor specimens including cancers of the
breast, liver, gastrointestinal tract, genitourinary tract, blood,
lymphatic system, lung, and brain. Nucleolar immunofluorescence was not detected in most normal tissues including normal
bone marrow and colon epithelium. Weak nucleolar fluores
cence was detected in some proliferating nonmalignant tissues
including testes spermatogonia, some ductal regions of hypertrophied prostate, and phytohemagglutinin-stimulated
lympho
cytes. The P120 antigen was not detected in 48-h serumdeprived HeLa cells but was readily detectable within 30 min
following serum refeeding. The P120 antigen was not detected
in retinoic acid-treated HL-60 cells following morphological
differentiation but was detected in rapidly growing undifferentiated HL-60 cells. These studies indicated that the P120 anti
gen is a proliferation-associated nucleolar antigen which plays
a role early in the d phase of the cell cycle (Fig. 2; Table 5).
Ochs et al. (33) found that the P120 antigen was localized by
immunostaining to be a beaded microfibrillar structure which
had not been described previously. It was noteworthy that the
"beads" were decorated with the antibodies (Fig. 3). The fila
ments are apparent only because of the necklace-like character
of the beaded filaments. This structure may function in nucleo
lar synthetic reactions or as a structural entity which is neces
sary for nucleolar organization in dividing cells. It may be part
of the "contractile element" that accounts for nucleolar pleomorphism in cancer cells which may reflect an intense to-andfro rocking activity of the nucleolar mass in G, phase.
Molecular Biology of the PI 20 Antigen. With the method of
Young and Davis (34), cDNA clones were identified for the
nucleolar proteins B23 and C23. The center of the molecule is
rich in aromatic amino acid and methionine residues. The Cterminal portion of the molecule is notable for the relatively
'>•
*
'•'•'V
».."'.;¿£,y
" ". '
TableS P120 properties
1. Proliferation cell nucleolar antigen expressed early in ( ;,.
2. Broadly expressed in cancer specimens.
3. Absent from benign tumors.
4. Absent from normal resting tissues.
5. "Death marker"—breast cancer.
6. "DNA-associated" in the nucleolar residue.
7. Responsive to nutrient replenishment and mitogen-induced proliferation.
8. Specific perinucleolar fibril association in drug-segregated nucleoli.
9. Fluorescence is enhanced in nuclease treated cells.
Fig. 3. Immunoelectron microscopy of a HeLa cell nucleolus labeled with
antibody to protein P120. a, low magnification view of P120 labeling illustrates
the network of tortuous beaded microfibrils (arrowheads) which appear in various
profiles. Bar, 0.5 itm. b, the monoclonal antibody to protein PI20 labels beaded
filaments 20-30 nm in diameter and 1-2 um long (arrowheads). Bar, 0.25 /¿m
(33).
4833
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.
FINAL COMMON
Ico
E>
co<
. . .EAAAG1QWSEEETEDEEE..
_co
IE
« E o
o^
> t
to
n E
co > co
C0<
CO1
1 1IE
Ã-rt
coMïinM
CD
SiI
1 kb
PATHWAY OF CANCER
i
co
co1E•oC
X1=a£W
H
Fig. 4. Sequencing strategy of PI20 clones. The rightmost line shows the
restriction map of the 2565-nucleotide cDNA-coding sequence of PI20. The
regions of each cDNA clone and genomic clone that have been sequenced are
darkened. Xgtl 1 human cDNA libraries were screened with monoclonal antibody
and hybridization. T2 and F2 are cDNA clones from the testis and fetal liver
libraries, respectively; they have overlapping sequences in subclones. A human
genomic (lymph node, chronic myelogenous leukemia) clone, 16 kilobases (kb)
long, provided 30 nucleotides at the 5' end to the translation initiator ATG and
2 nucleotides at the 3' end to the stop codon. EcoRi digests were subcloned into
pGEM-3Z vectors, and deletions were made on both strands. Appropriate syn
thetic oligonucleotides were used to confirm the sequence; arrow, one oligonucleotide used with a Kpnl/Sacl subclone from the phage containing the internal
EcoRl site («-•).
G, genomic clone (35).
large number of cysteine residues and the presence of cysteine
dimers. In addition, this portion of the molecule is rich in
proline.
A feature of the molecule is the Pro-Ala-Lys-Lys-Ala-Lys
which is a nuclear recognition signal. A search for homologies
to the P120 antigen has not found any molecule in the protein
bank with a similar overall sequence. However, very limited
homologies were identified for N-myc and c-myc as well as two
virion proteins. It bears some resemblance in organization to
the "tat-protein" which localizes to the nucleolus in AIDSinfected individuals. A protein Nil kinase site identified by Dr.
Egon Durban is
.
t
PI20 mRNA. To determine whether the mRNA level for this
protein was elevated in cancer cells as compared with other
cells, slot blot studies were done (37). The level of the rRNA
was essentially the same in a variety of human cells. However,
the level of P120 mRNA was 60 times higher in the HeLa cells
than in the human placenta. Accordingly, the P120 protein and
its mRNA would seem to be targets for a quantitative attack
on cancer. The kinetics of the P120 mRNA was analyzed by
Jhiang et al. (38). In phytohemagglutinin-treated
lymphocytes,
the P120 mRNA increased slightly earlier than the message for
c-myc and much earlier than the message for (listone H2B.
When HL-60 cells were treated with 12-0-tetradecanoylphorbol-13-acetate, there was a notable decrease in the P120 mRNA
as well as the P120 protein (38).
PI 20 Gene. The P120 gene (36) was shown to contain 15
exons (Fig. 7), which account for the various domains of the
proteins. The gene spans 12 kilobase pairs and is composed of
15 exons and 14 introns. The 5'-flanking region contained a
TATA-like sequence and the CCAAT box (36).
PI20 Upstream Region. The gene was sequenced approxi
mately 2.5 kilobases upstream of the ATG site. A number of
putative c/5-acting regions were identified including a TATAA
box, CCAAT boxes, etc. In an effort to define the precise
upstream regions involved in gene activation, CAT constructs
were made and it was shown that critical regions for gene
activation were the -400 and -1400 bases upstream (39).
Of these regions, the —¿400
contained a SPl-like site, al
though it is not precisely a SP1 site. At —¿1400,
there was an
AP2-like site. The precise sequence involved in gene activation
requires clarification, and various mutant constructs are being
made for this purpose.
CAT assays indicate that the region -2532/+102 is necessary
I ATCGCCCCC
150
180
L 210
CTC
H 260
U
S
S
V
Y
L
N
R
L
E
L
V
E
F
270
ÃŽOO
Q
A
l
l
N
130
C
A
T
P
E
360
E
R
l
L
D
390
620
KTKQQLQKQQH
2UM
2161
R
A
K
C
V
E
K
Q
2361
2631
Fig. S. Nucleotide sequence of PI 20 cDNA and the deduced amino acid sequence (35).
4834
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.
FINAL COMMON PATHWAY OF CANCER
1
-
- 230
BASICACIDIC
231
Hydrophobie, Methionine Rich —¿460
461
690
Proline, Cysteine Rich
691
H
—¿856
H
H
P 120
Amino Acid Number
Fig. 6. Domains of protein P120.
EXON
E E
•¿I'II
iil
1.8t_
IIÉI
III!
J.
.6.
II ! I
111 i •¿
'
>•«
6
8
10
12
Fig. 9. Immunoblots of one-dimensional gels of the P12 isolated from E. coli
(E) and HeLa cells (//) in decreasing amounts. The migration of the two proteins
is essentially the same.
>-
h-~A>1
16
14
Nucleotide Number (kb)
Fig. 7. Map of the human proliferating cell nucleolar protein P120 gene. E,
exon; kli. kilobase.
SB
-2524
-2000
-1500
-1000
-500
X
N P CAT RELATIVE
ACTIVITY
+1+106
-2524
(4)
Fig. 8. Effect of internal deletions on transcription efficiency. CAT assays of
the internal deletion mutants and a few 5' deletion mutants were done after
correcting for transfection efficiency. Numbers in parentheses, average of four
independent experiments, en, P120 promoter; mi CAT coding sequence. Arrow,
major transcription initiation site. •¿.
•¿,
TATAA box and ATG, respectively. X,
Xbal, S, Smal, Xh, Xhol, N, Ncol, P. Pstl (39).
(Fig. 8) for optimum transcription (39). Two specific areas at
-1418/-1215
and -529/-270
have been shown to be impor
tant for transcription. To define c/s-acting elements, chimeric
CAT constructs were used. Transfection of these constructs
into HeLa cells indicated that —¿2184
base pairs upstream of
the initiation site is necessary for optimal transcription. Con
structs with —¿566
and —¿272
base pairs transcribed at 30 and
2% efficiency. Internal deletions of the 5'-flanking sequence
suggested there are two important c/s-acting regions, iransacting factor binding to these two regions was studied by gel
retardation and DNase I footprinting assays. Within the —¿529/
—¿270-base
pair region, a 17-base pair AGGAAGAGGCGGG-
GCCG (—421to —¿405)
is protected from DNase digestion by
binding of a frans-acting factor from HeLa nuclear extract.
Synthetic oligonucleotides to the 17-base pair region and a SP1
binding consensus sequence compete with this binding. Another
frans-acting factor binding site is on the -1418/—1215 region.
The binding region is a 22-base pair-long sequence AAAGAGGAGGAGGTAAGTGGCA
(-1345 to -1324), a novel binding
site.
To define the /raws-acting factors, gel retardation studies
have been initiated. For this purpose, various probes have been
used and in the —¿1400
region, it would appear that there are at
least two and possibly three frans-acting factors involved.'
Expression of Protein PI 20. Valdez et al. (40) have described
procedures for construction of clones containing the entire
P120 cDNA sequence. In isopropyl-/3-D-galactoside-stimulated
Escherichia coli, the PI20 protein was expressed and compared
to HeLa nucleolar P120 for migration on one-dimensional gels.
The immunoblots shown in Fig. 9 indicate the similarity of
migration; the partial digests shown in Fig. 10 indicate the
similarity of partial cleavage products.
The PI 20 Epitope. It is notable that the P120 epitope is a
human epitope. It has not been found in other species including
mouse, rat, hamster, or COS cells. An expression system was
used to identify more precisely the epitope-containing peptide
of protein P120. Fig. 11 shows the cloning and expression of
the epitope region in the pT25Al vector. Mutations and com
petition assays showed that residues 173-180 (EAAAGIQW)
were an important part of the epitope (40). A series of peptides
were synthesized in Dr. Cook's laboratory at Baylor College of
Medicine to define the precise amino acid sequence of the
epitope. Incubation of the synthetic peptide EAAAGIQW with
the anti-Pi 20 M Ab completely blocked the binding of the antiP120 MAb to both the E. «»//-expressed
P120 and the isolated
HeLa nucleolar P120 protein on Western blots and enzymelinked immunosorbent assays. The glutamyl and tryptophanyl
residues in this region are essential for binding of P120 to its
antibody since synthetic peptides lacking either residue did not
3 W-W. Zhang, J. Farres, A. Chatterjee, D. Henning, M. Haidar. and H.
Busch, rrans-acting factors for the P120 upstream promotors. manuscript in
preparation.
4835
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.
FINAL COMMON PATHWAY OF CANCER
120
H
Epitope peptide
Signal peptide
100
Triple E peptide
e
o
U
e
u
O)
30 min
15
Fig. 10. Peptide mapping using /V-chlorosuccinimide/urea. Lanes: (//) HeLa
nucleolar P120; (E) E. col¡-expressedP120. Extracts from HeLa nucleoi and
from E. coli expressing P120 (unpublished data) were analyzed on sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (8%). A band corresponding to a mo
lecular mass of 120 kDa was cut and partially digested with 0.015 M /V-chlorosuccinimide for 15 min. The peptide fragments were separated on sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (12%) and immunoreactive bands were
visualized by an immunostaining procedure (35).
20
O
50
100
150
nM of peptide added
Fig. 12. Competition assay analysis by enzyme-linked immunosorbent assay
(40). Synthetic oligopeptides were used to compete binding of anti-Pi 20 antibody
to HeLa nucleolar PI20 protein.
BamHI
Sail
binding of the P120 protein to its antibody. On the other hand,
peptides from different portions of the molecule did not inhibit.
Inasmuch as high specificity of antibody binding was evident,
it was of interest to determine what structural changes would
be tolerated by the antibody. Since no modifications made to
date were tolerated, it is clear that this epitope is remarkably
specific. Moreover, since as noted above, it is a human epitope,
a drug fashioned for it would not be detected with animal
tumors. Perhaps such a drug is "on the shelf!"
The question arose as to whether "blocking" of this epitope
Sail
Sspl
CEco
0
(fiLULJ>^=fSall
r-
.
ocO
Où.JC
U
LU
X(/)1
«
Smal
|_JI—Sali—
LÃ-gate
Xhol
EcoRI
Kpnl/Asp 718
Sacl
EcoRI
Fig. 11. Cloning of the cDN A fragment that codes for the epitope-containing
region of PI 20. All cloning strategies were done as described earlier (40).
could inhibit growth or DNA synthesis in tumor cells. Freeman
and Bondada (41) microinjected the P120 antibody by scrape
loading and decreased the number of viable cells (Fig. 13).
Microinjection of the B23 monoclonal antibody had a small
effect at 24 h but no notable change at 48 h (Fig. 13). Microin
jection of the P120 antibodies reduced thymidine incorporation
to approximately 25% of the controls with undiluted antibody;
the B23 antibody produced little, if any, change in thymidine
incorporation (Fig. 14).
Antisense Constructs. Several approaches to antisense mole
cules were attempted including synthesis of oligonucleotides
and expression vectors. In preliminary experiments, a marked
decrease in nucleolar fluorescence was found with the P120
antibody in phytohemagglutinin-stimulated
lymphocytes.
Moreover, the structure of the nucleolus underwent marked
change as shown in phase contrast by loss of nucleolar refractility.
PI20 Oncogene? In an attempt to discern if P120 constructs
might serve as oncogenes, the P120 cDNA was cloned into an
expression vector which was transfected into 3T3 cells and the
protein was expressed; moreover, the nucleoli of these cells
appeared to be pleomorphic.
block the M Ab binding to the P120 antigen. Peptides lacking
the glycine or one alanine residue also did not block, which
suggests that the M Ab binding residues are on one side of an a Approaches to Therapy
helix.
Competitive enzyme-linked immunosorbent assays (Fig. 12)
These studies provide the hope that development of proper
indicated that the P120 epitope peptide markedly inhibited the molecular species can provide a means for distortion of the
4836
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.
FINAL COMMON PATHWAY OF CANCER
ro
I
O
80 -
and the chemical residues of this region. Specific therapeutic
modalities can be developed if the interactions between reactive
and binding groups on drugs and binding elements on targets
can be specifically defined. We hope that an attack on protein
P120 will be chemotherapeutically useful, for this protein ap
pears to be part of the "final common pathway" in many
O - O control
•¿
»B23
AAP120
X
o
cancers.
Importantly, other opportunities will clearly be forthcoming
to produce drugs on the basis of currently evolving sequence
data on "suppressors" and on emerging data on "differentiation
genes" and factors as well as G0/G, inhibitors. Hopefully this
.o
new science of pharmacotherapy based on rational design of
drugs binding to or mimicking sequences derived from DNA
sequencing will bear a rich harvest in treatment of cancer.
24
time(hrs)
Fig. 13. Effects of microinjection of monoclonal antibodies to protein PI20
and B23 on numbers of viable HeLa cells (41).
150
to
I
O
120--
90-0.
O
O
60 +
rr
z
o
30--
P120
B23
ANTIBODY
Fig. 14. Effects of microinjection of monoclonal antibodies to protein B23
and P120 on thymidine incorporation into HeLa cells (41).
PI20 epitope. It is notable that the epitope has three domains,
an amino-terminal acidic residue, a central hydrophobic region,
and a carboxyl-terminal indole. It is likely that a basic group
will interact with carboxyl-terminal glutamic acid. Moreover,
the central three alanines each have a hydrophobic methyl
which could interact with a hydrophobic drug as could the
branched terminus of the isoleucine and the glutamine. Inas
much as the carboxyl-terminal tryptophan contains an indole
structure, it seems possible that indole-binding compounds
could provide specific binding of this region. Proper threedimensional spatial relationships for drugs with a basic, hydrophobic, and indole-binding domain may be developed with
three-dimensional modeling techniques.
It is not possible to predict the experimental or clinical
success of agents that could specifically attack the epitope of
the P120 molecule. Inasmuch as this protein is expressed more
than 60-fold more in growing and dividing cancer cells than in
most resting cells and blocking the epitope has important
inhibitory effects on cell function, it is reasonable that an attack
on this molecule could offer a novel approach to cancer therapy.
Studies like this offer a basis for a new type of synthetic
chemistry, which links the tidal wave of developments in mo
lecular biology and recombinant technology to drug design and
drug development. This small epitope of the P120 protein may
be a critical target for chemical attack because of its uniqueness,
its availability in space, and the generality of its presence in
human cancer. This approach calls for the rational design of
new drugs based on the interaction between organic molecules
References
1. Busch, H. An Introduction to the Biochemistry of the Cancer Cell. New
York: Academic Press, 1962.
2. Busch, H. The complexity of the cancer problem. Fed. Proc., 38: 94-96,
1979.
3. Virchow, R. Cellularpathologie. Arch. Pathol. Anat., 8: 1-39, 1855.
4. Thiersch. C. Der epithelial Krebs. Leipzig, Germany: Egelmann, 1865.
5. Ishibashi, K. Studies on the number of cells necessary for the transplantation
of the Yoshida sarcoma. Gann. 41: 1-14, 1950.
6. Furth, J., and Kahn, M. C. The transmission of leukemia of mice with a
single cell. Am. J. Cancer, 31: 276-282. 1937.
7. Druker, B. J., Mamón, H. J.. and Roberts, T. M. Oncogenes, growth factors
and signal transduction. N. Engl. J. Med., 321: 1383-1391, 1989.
8. Weinstein, I. B. The origins of human cancer: molecular mechanisms of
carcinogenesis and their implications for cancer prevention and treatment.
Twenty-seventh G. H. A. Clowes Memorial Lecture. Cancer Res., 48: 41354143, 1988.
9. Busch. H., and Potter. V. R. Studies on tissue metabolism by means of in
vivo metabolic blocking techniques. II. Metabolism of acetate-I-C'4 in maionate treated rats. Cancer Res., 13: 168-173, 1953.
10. Busch, H., and Baltrush. H. A. Isotropie equilibration between the citric acid
cycle and glutamic acid. ///. B. Glass (ed.). Symposium on Amino Acid
Metabolism, pp. 291-299. Baltimore, MD: Johns Hopkins Press, 1955.
11. Busch. H., and Davis, J. R. Nuclear proteins of tumors and other tissues: a
review. Cancer Res., IS: 1241-1256. 1958.
12. Muramatsu. M..Smetana, K.. and Busch. H. Quantitative aspects of isolation
of nucleoli of Walker carcinosarcoma and liver of the rat. Cancer Res., 23:
510-518. 1963.
13. Steele, W. J.. and Busch, H. Studies on the acidic nuclear proteins of the
Walker tumor and liver. Cancer Res., 23: 1153-1163, 1963.
14. Muramatsu, M., Hodnett, J. I ., and Busch, H. Base composition of fractions
of nuclear and nucleolar RNA obtained by sedimentation chromatography.
J. Biol. Chem., 241: 1544-1550, 1966.
15. Hodnett, J. I... and Busch, H. Isolation and characterization of the uridylic
acid-rich RNA of rat liver nuclei. J. Biol. Chem., 243: 6334-6342, 1968.
16. Busch. H.. Reddy, R., Rothblum. L., and Choi, Y. C. snRNA's snRNP's and
RNA processing. Annu. Rev. Biochem., 51: 617-654, 1982.
17. Mauritzen, C. M., Starbuck, W. C., Saroja. I. S., Taylor. C. W., and Busch,
H. The fractionation of arginine-rich histones from fetal calf thymus by
exclusion chromatography. J. Biol. Chem.. 242: 2240-2245, 1967.
18. Busch. H. Ubiquitination of proteins. Methods Enzymol., 106: 238-262,
1984.
19. MacCarty, W. C., and Haumeder, E. Has the cancer cell any differential
characteristics? Am. J. Cancer, 20: 403-407, 1934.
20. Caspersson, T. O. Cell Growth and Cell Function. A Cytochemical Study.
New York: Norton. 1950.
21. Takami, H.. and Busch. H. Two-dimensional gel electrophoretic comparison
of proteins of nuclear fractions of normal liver and Novikoff hepatoma.
Cancer Res., 39: 507-518, 1979.
22. Takami. H., Busch, F. N., Morris, H. P., and Busch, H. Comparison of saltextractable nuclear proteins of regenerating liver, fetal liver and Morris
hepatomas 9618A and 3924A. Cancer Res., 39: 2096-2105, 1979.
23. Busch, R. K., and Busch, H. Antigenic proteins of nucleolar chromatin of
Novikoff hepatoma ascites cells. Tumori, 63: 347-357, 1977.
24. Busch, R. K., Reddy, R. C., Henning, D. H., and Busch, H. Liver antigens
detected by liver antinucleolar antibodies. Proc. Soc. Exp. Biol. Med., 160:
185-191, 1979.
25. Davis, F. M., Gyorkey. F., Busch, R. K., and Busch, H. A nucleolar antigen
found in several human tumors but not in nomumor tissues. Proc. Nati.
Acad. Sci. USA. 76: 892-896, 1979.
26. Busch, H., Gyorkey, F., Busch. R. K., Davis, F. M., Gyorkey, P., and
Smetana. K. A nucleolar antigen found in a broad range of human malignant
tumor specimens. Cancer Res.. 39: 3024-3030. 1979.
27. Kohler, G., and Milstein, C. Continuous cultures of fused cells secreting
antibody of predefined specificity. Nature (Lond.), 256: 495-497, 1975.
4837
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.
FINAL COMMON
PATHWAY OF CANCER
28. Freeman, J. W., Busch, R. K.. Ross, B. E., and Busch. H. Masking of
nontumor antigens for development of human tumor nucleolar antibodies
with improved specificity. Cancer Res., 45: 5637-5642, 1985.
29. Freeman, J. W., McRorie, D. K.. Busch, R. K.. Gyorkey, F., Gyorkey, P.,
Ross, B. E., Spillili. W. H., and Busch. H. Identification and partial charac
terization of a nucleolar antigen with a molecular weight of 145.000 found
in a broad range of human cancers. Cancer Res.. 46: 3593-3598, 1986.
30. Chatterjee, A., Freeman, J. W., and Busch. H. Identification and partial
characterization of a M, 40,000 nucleolar antigen associated with cell prolif
eration. Cancer Res.. 47: 1123-1129, 1987.
31. Chatterjee, A., Freeman. J. W.. and Busch, H. Identification and partial
characterization of a U, 105,000 nucleolar antigen associated with cell
proliferation. Cancer Res., 47: 6329-6334, 1987.
32. Freeman, J. W.. Busch. R. K., Gyorkey, F., Gyorkey, P., Ross. B. E., and
Busch. H. Identification and characterization of a human proliferationassociated nucleolar antigen with a molecular weight of 120,000 expressed
in early G, phase. Cancer Res., 48: 1244-1251, 1988.
33. Ochs, R. L., Reilly, M. T., Freeman, J. W., and Busch, H. Intranucleolar
localization of human proliferating-cell nucleolar antigen P120. Cancer Res.,
¥«.•6523-6529,
1988.
34. Young, R. A., and Davis, R. W. Efficient isolation of genes by using antibody
probes. Proc. Nati. Acad. Sci. USA, 80: 1194-1198, 1983.
35. Fonagy, A., Henning. D., Jhiang, S., Haidar. M., Busch, R. K., Larson, R.,
Valdez. B., and Busch, H. Cloning of the cDNA and sequence of the human
proliferating-cell nucleolar protein P120. Cancer Commun., /: 243-251,
1989.
36. Larson, R. G.. Henning, D., Haidar, M. A., Jhiang. S., Lin, W. L.. Zhang,
W-W., and Busch, H. Genomic structure of the human proliferating cell
nucleolar protein P120. Cancer Commun., 2: 63-71, 1990.
37. Hazlewood, J., Fonagy, A., Henning. D., Freeman, J. W., Busch, R. K., and
Busch, H. inli NA levels for human nucleolar protein P120 in tumor and
nontumor cells. Cancer Commun., /: 29-34, 1989.
38. Jhiang, S. M., Yaneva, M., and Busch. H. Expression of human proliferationassociated nucleolar antigen P120. Cell Growth Differentiation, in press.
1990.
39. Haidar, M. A., Henning. D., and Busch. H. The upstream sequence —¿529
to
—¿270
is necessary for transcription of early Gl cycle expressing human
proliferating cell nucleolar antigen P120 gene. Mol. Cell. Biol., 10: 32533255, 1990.
40. Valdez, B. C., Busch, R. K., Larson, R. G., and Busch, H. Identification of
an epitope region of a human proliferation-associated nucleolar antigen PI 20.
Cancer Res., 50: 2704-2707, 1990.
41. Freeman, J. W., and Bondada, V. Inhibition of cell proliferation by microin
jection of antibodies to nucleolar antigen PI20. Proc. Am. Assoc. Cancer
Res., 31: 261, 1990.
4838
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.
The Final Common Pathway of Cancer: Presidential Address
Harris Busch
Cancer Res 1990;50:4830-4838.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/50/16/4830.citation
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1990 American Association for Cancer Research.