ORIGINAL RESEARCH ARTICLE
Journal of
The Transient Receptor
Potential Channel TRPV6 Is
Dynamically Expressed in Bone
Cells But Is Not Crucial for Bone
Mineralization in Mice
Cellular
Physiology
BRAM C.J. VAN DER EERDEN,1 PETRA WEISSGERBER,2 NADJA FRATZL-ZELMAN,3
JENNY OLAUSSON,2 JOOST G.J. HOENDEROP,4 MARIJKE SCHREUDERS-KOEDAM,1
MARCO EIJKEN,1 PAUL ROSCHGER,3 TEUN J. DE VRIES,5 HIDEKI CHIBA,6
KLAUS KLAUSHOFER,3 VEIT FLOCKERZI,2 RENÉ J.M. BINDELS,4 MARC FREICHEL,2
1
AND JOHANNES P.T.M. VAN LEEUWEN *
1
Department of Internal Medicine, Erasmus MC, Rotterdam, The Netherlands
2
Experimentelle und Klinische Pharmakologie und Toxikologie, Universität des Saarlandes, Homburg, Germany
3
Ludwig Boltzman Institute of Osteology at the Hanusch Hospital of WGKK and AUVA Trauma Centre Meidling,
1st Medical Department, Hanusch Hospital, Vienna, Austria
4
Department of Physiology, Nijmegen Centre for Molecular Life Sciences, Radboud University Nijmegen Medical Centre,
Nijmegen, The Netherlands
5
Department of Periodontology, Oral Cell Biology, Academic Center of Dentistry Amsterdam (ACTA),
Universiteit van Amsterdam and Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
6
Department of Basic Pathology, Fukushima Medical University, Fukushima, Japan
Bone is the major store for Ca2þ in the body and plays an important role in Ca2þ homeostasis. During bone formation and resorption Ca2þ
must be transported to and from bone by osteoblasts and osteoclasts, respectively. However, little is known about the Ca2þ transport
machinery in these bone cells. In this study, we examined the epithelial Ca2þ channel TRPV6 in bone. TRPV6 mRNA is expressed in human
and mouse osteoblast-like cells as well as in peripheral blood mononuclear cell-derived human osteoclasts and murine tibial bone
marrow-derived osteoclasts. Also other transcellular Ca2þ transport genes, calbindin-D9k and/or -D28K, Naþ/Ca2þ exchanger 1, and
plasma membrane Ca2þ ATPase (PMCA1b) were expressed in these bone cell types. Immunofluorescence and confocal microscopy on
human osteoblasts and osteoclasts and mouse osteoclasts revealed TRPV6 protein at the apical domain and PMCA1b at the osteoidal
domain of osteoblasts, whereas in osteoclasts TRPV6 was predominantly found at the bone-facing site. TRPV6 was dynamically expressed
in human osteoblasts, showing maximal expression during mineralization of the extracellular matrix. 1,25-Dihydroxyvitamin D3
(1,25(OH)2D3) did not change TRPV6 expression in both mineralizing and non-mineralizing SV-HFO cultures. Lentiviral
transduction-mediated overexpression of TRPV6 in these cells did not alter mineralization. Bone microarchitecture and mineralization
were unaffected in Trpv6D541A/D541A mice in which aspartate 541 in the pore region was replaced with alanine to render TRPV6 channels
non-functional. In summary, TRPV6 and other proteins involved in transcellular Ca2þ transport are dynamically expressed in bone cells,
while TRPV6 appears not crucial for bone metabolism and matrix mineralization in mice.
J. Cell. Physiol. 227: 1951–1959, 2012. ß 2011 Wiley Periodicals, Inc.
Additional Supporting Information may be found in the online
version of this article.
Contract grant sponsor: Forschungsausschuss der Universität des
Saarlandes.
Contract grant sponsor: Dutch Organization of Scientific
Research;
Contract grant number: Zon-Mw 902.18.298.
Contract grant sponsor: European Science Foundation (EURYI);
Contract grant number: Zon-Mw 916.56.021.
Contract grant sponsor: Deutsche Forschungsgemeinschaft.
Contract grant sponsor: Fonds der Chemischen Industrie and
Sander-Stiftung.
Contract grant sponsor: Forschungsausschuss, the ‘‘HOMFOR’’
Program.
*Correspondence to: Johannes P.T.M. van Leeuwen, Department
of Internal medicine, Erasmus MC, room Ee585d, PO Box 2040,
3000 CA Rotterdam, The Netherlands.
E-mail: [email protected]
ß 2 0 1 1 W I L E Y P E R I O D I C A L S , I N C .
Received 23 June 2011; Accepted 24 June 2011
Published online in Wiley Online Library
(wileyonlinelibrary.com), 5 July 2011.
DOI: 10.1002/jcp.22923
1951
1952
VAN DER EERDEN ET AL.
Maintenance of body calcium (Ca2þ) is of crucial importance for
many physiological functions including neuronal excitability,
muscle contraction, and bone formation. Bone is the
major Ca2þ store of the body and contributes, together with
kidney and intestine, to the overall Ca2þ balance. Mineralization
of bone requires serum/plasma Ca2þ and resorption
liberates Ca2þ from bones in a balanced manner in healthy
individuals. A number of proteins have been implicated in
osteoblast and osteoclast-mediated Ca2þ transport. The
intracellular Ca2þ-binding proteins, calbindin-D9K and -D28K,
are expressed in osteoblasts, depending on the species studied
(Berdal et al., 1996; Faucheux et al., 1998). Furthermore,
two Ca2þ extruding proteins, that is, NCX1 and PMCA1b were
shown to be present in osteoblasts and osteoclasts (Stains and
Gay, 1998; Stains et al., 2002). NCX1 was implicated in the
mineralization and resorption process in vitro (Moonga et al.,
2001; Stains and Gay, 2001). At the apical side of osteoblasts
(marrow facing side), so far only the voltage-gated L-type Ca2þ
channel was described being associated with mechanical strain
(Walker et al., 2000). Nevertheless, little is known about Ca2þ
channels in bone cells and how they eventually participate in the
actual flow of Ca2þ within bone, thereby contributing to
mineralization and Ca2þ homeostasis.
Recently, TRPV6 has been described in intestinal epithelial
cells to selectively transport Ca2þ (Hoenderop et al., 1999;
Peng et al., 1999; Zhuang et al., 2002). TRPV6 is a member of the
transient receptor potential channel superfamily (Montell,
2001) and is considered to be the gatekeeper of selective Ca2þ
absorption in the small intestine (Van Cromphaut et al., 2001;
Hoenderop et al., 2002; van de Graaf et al., 2004). Together
with other Ca2þ transport proteins, such as calbindin-D9K and
PMCA1b, it constitutes the transcellular Ca2þ transport
mechanism directed towards the blood compartment (Montell,
2001; Hoenderop et al., 2002). We and others have shown that
these proteins including TRPV6, are upregulated by 1,25dihydroxyvitamin D3 (1,25(OH)2D3) in intestine (Nijenhuis
et al., 2003; Hoenderop et al., 2003a, 2005; Nakano et al., 2004).
This calciotropic hormone is established as a regulator of
osteoblast mineralization in vitro and in vivo (Chattopadhyay
et al., 2004; Dvorak et al., 2004).
TRPV6 transcripts are expressed in bone to a similar level as
its structurally closest homolog TRPV5 (Nijenhuis et al., 2003)
which we found in bone exclusively expressed in osteoclasts
(van der Eerden et al., 2005). It was demonstrated that TRPV5
is crucial for proper osteoclastic bone resorption, indicating
functionality of the epithelial Ca2þ channels in bone (van der
Eerden et al., 2005).
In the present study, we aimed to investigate the expression
and regulation of TRPV6 in human and murine bone cells to
analyze its contribution to bone formation/mineralization and
resorption as well as the bone microarchitecture and bone
matrix mineralization. To this end, we analyzed mice in
which the negatively charged aspartate in position 541 in the
pore-forming region was replaced with an uncharged alanine
(Trpv6D541A/D541A) which renders TRPV6 channels nonfunctional and results in a marked reduction of Ca2þ uptake by
epidiymal epithelial cells, in Ca2þ accumulation in the
epididymal fluid, and, consequently, in impaired male fertility
(Weissgerber et al., 2011).
Materials and Methods
Human femoral head biopsies and mouse femurs
Human bone material was obtained from two femoral head
biopsies (of osteoarthritic bone). These have been collected within
a clinical study approved by the medical ethical commission (MEC
No. 204.287). Furthermore, three B6.129 mice were sacrificed to
dissect femurs, from which the bone marrow was removed. Both
biopsy samples and mice femurs were homogenized, using a Mikro
JOURNAL OF CELLULAR PHYSIOLOGY
Dismembrator S (Sartorius, Goettingen, Germany). The resulting
powder was further processed for RNA isolation as described
below.
Human osteoblast cultures
A simian virus immortalized human fetal osteoblast-like (SV-HFO)
cell line was seeded at a density of 5,500 cells/cm2 (Chiba et al.,
1993; Janssen et al., 1999; Eijken et al., 2005). Cells were cultured as
has been extensively described in previous studies (Eijken et al.,
2005; van Driel et al., 2006). At different time points during the
cultures (days 5, 7, 9, 12, 14, 16, 19, 21, and 23), cells and matrix
were collected and scraped in PBS containing 0.1% (v/v) TritonX100 and stored at 808C for DNA, alkaline phosphatase and
mineralization assays. These assays have been described elsewhere
(Eijken et al., 2005; van Driel et al., 2006). Alternatively, cells were
washed with phosphate-buffered saline (PBS) followed by total
RNA isolation using RNA-Bee solution (Tel-Test, Friendswood,
TX). In a separate experiment, 108 M 1,25(OH)2D3 was included
in the culture medium at every medium substitution and cells were
processed for RNA isolation described below. In the culture
experiments with varying calcium concentrations, calcium-free
medium was used, to which different amounts of CaCl2 were
added.
Normal human osteoblast-like cells (NHOst; Cambrex Bio
Science, East Rutherford, NJ) were seeded at a density of
5,000 cells/cm2 and cultured in a-MEM containing 10% (v/v)
charcoal-treated heat-inactivated FCS in the presence of 107 M
dexamethasone and 108 M 1,25(OH)2D3. At day 8 of culture, cells
were washed with PBS and total RNA was isolated using RNA-Bee
solution (Tel-Test) and processed further as described below.
Mouse osteoblast cultures
KS483 murine osteoblast-like cells have been shown to
differentiate and form mineralized nodules in a 3-week period (van
Driel et al., 2004). The cDNAs from different time points during
these cultures were generously provided by Dr. M. Karperien
(TU Twente, Enschede, the Netherlands).
Human osteoclast cultures
Peripheral blood mononuclear cells (PBMCs) were obtained from
healthy donors and isolated by density centrifugation with
Lymphoprep (Oslo, Norway). Briefly, the buffy coat preparations
were diluted 1:1 with Hanks’ buffered saline solution. Twenty
milliliters of diluted PBMCs were layered onto 15 ml of
Lymphoprep and centrifuged at 1,000g for 30 min at ambient
temperature. PBMCs were recovered from the interface and
washed twice with HBSS supplemented with 2% (v/v) FCS. PBMCs
were separated on a Percoll gradient (Pharmacia, Uppsala, Sweden)
consisting of three density layers (1.076, 1.059, and 1.045 g/ml).
The fraction present in the middle layer, which contained
predominantly monocytes was either co-cultured with osteoblasts
or cultured without osteoblasts to obtain conditioned medium.
Monocytes were seeded in 96-well culture plates at a density
of 105 cells/well and cultured for 3 weeks in DMEM supplemented
with 10% (v/v) FCS and 1% (v/v) antibiotic–antimyotic solution
containing 30 ng/ml human macrophage-colony stimulating factor
(M-CSF; R&D systems, Minneapolis, MI) and 20 ng/ml human
recombinant murine receptor-activated nuclear factor kB
(RANKL; Peprotech, London, UK), which was replaced twice a
week. After 3 weeks of culture, cells were washed with PBS and
collected for RNA isolation as outlined below. Human osteoclasts
cultured on cortical bone slices were kindly donated by Dr. B.
Nicholls (Bone and Mineral Centre, University College London,
London, UK).
Murine osteoclast cultures
Murine bone marrow cultures have previously been described in
detail (de Vries et al., 2005; van der Eerden et al., 2005). After 6 days
1953
TRPV6 IS DYNAMICALLY EXPRESSED IN BONE
of culture, cells were washed with PBS, fixed in 4% (v/v) PBS
buffered paraformaldehyde and stored at 48C for TRAP staining
(van der Eerden et al., 2005) or immunofluorescence. The murine
osteoclast-like cell line RAW264.7 (kindly donated by A. Teti,
University of L’Aquila, L’Aquila, Italy) was differentiated towards
osteoclasts in DMEM (Gibco BRL, Paisley, UK) with or without
20 ng/ml RANKL-TEC (R&D systems). After 7 days of culture, cells
were fixed for TRAP staining. At 3, 5, and 7 of culture, cells were
washed with PBS and total RNA was isolated using RNA-Bee
solution (Tel-Test).
RNA isolation, cDNA synthesis, and real-time PCR
Total RNA was isolated as described before (van der Eerden et al.,
2005) from the human osteoblast cell lines, the murine osteoclasts
and RAW264.7 cells as well as the resultant powder from the
human femoral head biopsy and mice femurs. Human osteoclasts
cultured for 21 days were treated as described earlier (de Vries
et al., 2005). After RNA quantification and cDNA synthesis, mRNA
expression levels of TRPV6, calbindin-D9K, calbindin-D28K, NCX1,
and PMCA1b were quantified by real-time PCR, using an ABI Prism
7700 sequence detection system (PE Biosystems, Rotkreuz,
Switzerland). The different primers and probes (Table 1) validated
by an alignment tool (http://www.ncbi.nlm.nih.gov/BLAST) as well
as the real-time PCR reaction were performed as described before
(van der Eerden et al., 2005). Data were presented as relative
mRNA levels calculated by the equation 2DCt (DCt ¼ Ct of gene of
interest Ct of housekeeping gene).
Immunofluorescence
Human osteoblast-like cells and murine osteoclasts were cultured
as described above. The immunofluorescence procedure for bone
cells has been described in detail (van der Eerden et al., 2005).
Human trabecular bone sections (6 mm) were routinely processed,
deparaffinized, and hydrated through graded ethanols. The primary
antibodies included polyclonal antibodies raised in rabbit directed
against TRPV6 (MO3; 1:100–1:800; Nijenhuis et al., 2003) or
against PMCA1b (1:500; Swant, Bellinzona, Switzerland). The
human trabecular bone sections were incubated with a biotinylated
goat-anti-rabbit second antibody (1:300; DAKO, Carpinteria, CA)
followed by incubation with a Qdot 655 Streptavidin Conjugate
(1:200; Quantum Dot Corp, Hayward, CA). Finally, the cultures
were washed in PBS and H2O and mounted in Vectashield
containing DAPI (Vector Laboratories, Burlingame, CA) for
nuclear counterstaining. The human osteoclasts on bone slices
were stained as described before (Nesbitt and Horton, 1997) but
the first antibody was the MO3 antibody (1:50). Pictures were
taken using a Zeiss Axioplan 2 microscope (Zeiss, Sliedrecht, The
Netherlands). The murine osteoclast stainings were analyzed using
a Leica DM IRB microscope or a Leica TCS-SP2 laser scanning
confocal microscopic (LSCM) system (Leica Microsystems,
Rijswijk, The Netherlands). Digital cross-sectioning of the X–Y
plane generates images in the X–Z and Y–Z plane, thereby
providing information with regard to subcellular localization. The
human osteoclasts were analyzed using a Zeiss LSM510 Meta
confocal microscope (Zeiss).
Overexpression of TRPV6 in human osteoblasts
Full-length human TRPV6 containing a V5 tag, was cloned into a
pLenti6.3 vector, using Gateway Cloning (Life Technologies, Breda,
the Netherlands). Green fluorescent protein (GFP) or dsRed were
cloned in an identical fashion and used as controls. SV-HFO cells
were transduced with the TRPV6 overexpressing and control
vectors. TRPV6 mRNA expression in osteoblasts was assessed at
day 5 (compared to GFP-transduced cells) and mineralization was
monitored at days 10 and 17 after transduction (compared to
dsRed-transduced cells as control), using procedures mentioned
above. Western blotting was performed as previously described
(van der Eerden et al., 2005), using an antibody directed against the
V5 epitope tag, which was cloned behind the C-terminus of TRPV6.
Microcomputed tomography
Femurs from 6-month-old male mice with replacement of
aspartate 541 with alanine within the pore region (Trpv6D541A/
D541A
; Weissgerber et al., 2011) and littermatched controls
obtained from Trpv6þ/D541A intercrosses were scanned at a
resolution at 9 mm, using a SkyScan 1172 system (SkyScan, Kontich,
Belgium). The animal ethics board of the Universität des Saarlandes
(Homburg, Germany) approved all experimental procedures.
According to guidelines recently published (Bouxsein et al.,
2010), the following settings were used: X-ray power and tube
current were 40 kV and 0.25 mA, respectively. Beam hardening was
reduced using a 1 mm aluminum filter, exposure time was 5.9 sec,
and an average of three pictures was taken at each angle (0.98) to
generate final images. Using different software packages from
SkyScan (NRecon, CtAn and Dataviewer), bone
microarchitectural parameters were assessed in trabecular and
TABLE 1. Sequences of primers and Taqman probes for real-time PCR
Gene
Forward primer
HPRT
M
GAPDH
TRPV6
H
M
H
CaBP-D9K
M
H
CaBP-D28K
M
H
NCX1
M
H
PMCA1
M
H
Reverse primer
Probe
TTATCAGACTGAAGAGCTACTGTAATGATC
ATGGGGAAGGTGAAGGTCG
TTCCAGCAACAAGATGGCCTCTACTCTGA
GCTTTGCTTCAGCCTTCTATATCAT
TTACCAGTGTCAATTATATCTTCAACAATC
TAAAAGCAGCCCTGGTGACC
ATCCGCCGCTATGCACA
TGAGAGATCATCTCCACCAATAACTTTTATGTCCC
CGCCCAATACGACCAAATCCGTTGAC
AGTTTTTCTCCTGAATCTTTTTCCAA
TGGTAAGGAACAGCTCGAAGGT
CCTGCAGAAATGAAGAGCATTTT
AATGAGTACTAAAAGTCTCCTGAGGAACT
AACTGACAGAGATGGCCAGGTTA
CTCCATCGCCATTCTTATCCA
AGGGTGTTTGGACCTTTGAGTAAA
CCTAATGCTGAAACTATTTGATTCAAATAA
TCCCTACAAAACTATTGAAGGCACA
TCTTTCCCACACATTTTGATTCC
CAAAACAATATCAGTCAAGGTAATTGATG
CGCCATCTTCTGCACCATT
CAACAATTCCAACTAGCCGTTTAA
CCTCACGGTCAAATATTCTAATGGT
AGGAGCTAGGCCACTTCTACGACTACCCCA
CAAAAATATGCAGCCAAGGAAGGCGA
TCTGGATCACCTTCTTTGGCTGCATATTTTTC
ACCAGTGCAGGAAAATTTCCTTCTTAAATTCCA
CCAGGTTACTACCAGTGCAGGAGAATTTTCTTCTTAA
ACCTTGACTGATATTGTTTTGACTATTTCATCATTCTGGA
AAGACCTTCTTCCTTGAGATTGGAGAGCCC
CAGCTGAAAGGCTTCCCGCCAAA
CCTTTTGTGTTCCATGACCAGCTTCTTTGA
TGAACTCTTTCCCACACATTTTGAT
TTTCTCATACTCCTCGTCATCGATT
CAGCCATTGCTCTATTGAAAGTTC
GGCCACGCCGCAACT
PCR primers and fluorescent probes (50 -6-carboxyfluorescein and 30 -6-carboxytetramethylrhodamine labeled) were designed using the computer program Primer Express (Version 1.5) and
were purchased from Applied Biosystems (GAPDH), Eurogentec (other human sequences) or Biolegio (Malden, the Netherlands), the Netherlands (mouse sequences).
HPRT, hypoxantine-guanine phosphoribosyl transferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TRPV, transient receptor potential channel (vanilloid type); CaBP, calbindin;
NCX1, Naþ/Ca2þ exchanger; PMCA1b, plasma membrane Ca2þ-ATPase; M, murine; H, human.
JOURNAL OF CELLULAR PHYSIOLOGY
1954
VAN DER EERDEN ET AL.
cortical bone of all mice (n ¼ 14 for both genotypes). The
trabecular bone parameters trabecular tissue volume, bone
volume, trabecular volume fraction (BV/TV), trabecular thickness,
trabecular number, and trabecular patterning factor (connectivity
of trabeculae) were determined in the distal metaphysis of the
femur (scan area of 3.15 mm from distal growth plate towards
femoral center). In the mid-diaphysis (scan area of 0.9 mm in the
femoral center), cortical volume, cortical thickness, moment of
inertia (proxy for bone strength), and perimeter were analyzed.
Quantitative backscattered electron imaging
The distal half of femoral bone samples were fixed in 70% (v/v)
ethanol, dehydrated in ethanol, and embedded in
polymethylmethacrylate. In order to determine the mineralization
density distribution in bone, the quantitative backscattered
electron imaging (qBEI) technique is well established and validated
and the details of the method have been published elsewhere
(Roschger et al., 2008). Following grinding and polishing, samples
underwent qBEI as extensively described before (Roschger et al.,
1998). Subsequently, bone mineral density distribution (BMDD)
was determined from the metaphyseal trabecular bone
compartment and cortical bone. The following BMDD parameters
were calculated: (1) CaMean is the weighted average Ca
concentration of the mineralized tissue area, obtained from the
integrated area under the BMDD curve; (2) CaPeak is the peak
position of the BMDD histogram showing the most frequently
occurring wt.% Ca of the measured areas; (3) CaWidth is the width
at half-maximum of the BMDD histogram curve indicating the
heterogeneity of mineralization; and (4) CaLow is the percentage of
bone which is mineralized below 17.68 wt.% Ca. The latter
parameter corresponds to the amount of bone passing primary
mineralization.
Statistics
In all experiments values were expressed as mean SEM. Differences
between groups were tested for significance using the Student’s
t-test. Values were considered significantly different at P < 0.05.
Results
Expression in bone cells
TRPV6, calbindin-D9K, calbindin-D28K, NCX1, and PMCA1b
mRNA were detected in human femoral head biopsy samples
(Supplementary Fig. 1A). In human osteoblast-like cells SVHFO, TRPV6 mRNA was expressed, along with calbindin-D28K,
NCX1, and PMCA1b (Supplementary Fig. 1B). Calbindin-D9K
mRNA was not present in these cells. Transcripts for TRPV6
together with the other four genes involved in Ca2þ transport
were also found in cultured human osteoclasts (Supplementary
Fig. 1C).
Similar to the human femoral head, all five genes were
detected in the mouse femurs (Supplementary Fig. 1D). As in
the human osteoblast-like cells, TRPV6, NCX1, and PMCA1b
mRNA were expressed in murine KS483 osteoblast-like cells
(Supplementary Fig. 1E). In addition, calbindin-D9K mRNA but
not calbindin-D28K was found, which is opposite to the
expression pattern observed in human osteoblast-like cells.
TRPV6 was also present in mouse osteoclasts derived from MCSF and RANKL-treated tibial bone marrow cells
(Supplementary Fig. 1F). Moreover, calbindin-D28K, NCX1, and
PMCA1b mRNA were expressed in these cells, whereas
calbindin-D9K was undetectable (Supplementary Fig. 1F).
Next, we performed immunofluorescence for TRPV6 and
PMCA1b. TRPV6 (Fig. 1A,B) and PMCA1b (Fig. 1C) were
visualized in cultured human osteoblast-like cells.
Immunostainings of human trabecular bone sections showed
TRPV6 predominantly at the apical domain of osteoblasts
(Fig. 1D), whereas PMCA1b was located exclusively at the
JOURNAL OF CELLULAR PHYSIOLOGY
osteoidal domain of most osteoblasts (Fig. 1F). Negative
controls in these sections including incubation with preimmune serum or omission of the first antibody (Fig. 1E,G,
respectively) did not show specific staining. When culturing
mouse tibial bone marrow cells with M-CSF and RANKL for
6 days on cortical bone slices, most of the multinucleated cells
were strongly TRAP positive (Fig. 2H). TRPV6 and PMCA1b
were clearly visible in the murine osteoclasts (Fig. 1I,J,
respectively) as assessed by conventional microscopy. When
analysing TRPV6 staining using LSCM on human resorbing
osteoclasts (staining for actin ring) plated on bone slides,
staining was concentrated at the site of the resorption front
(arrows in Fig. 1K). Moreover, in the murine osteoclasts
seeded on bone, confocal analyses showed that staining was
predominantly confined to the site where the osteoclasts face
the bone surface (Fig. 1L).
Gene expression during differentiation and
mineralization of osteoblast-like cells
We studied whether expression of the genes encoding the
different Ca2þ transport proteins are associated with
osteoblast differentiation and the process of mineralization
using an in vitro human osteoblast-like culture model (SVHFO). In the 1st week of culture, the cells proliferated and
started to produce extracellular matrix. During the second
week, this matrix matures and there is a peak in alkaline
phosphatase activity (Eijken et al., 2005; van Driel et al., 2006).
At that moment mineralization is initiated, which continues
into the 3rd week of culture, resulting in a mineralized matrix
(Eijken et al., 2005; van Driel et al., 2006). These steps of
differentiation and mineralization are dependent on the
presence of dexamethasone. From here on, these conditions
are defined as mineralizing and non-mineralizing, respectively.
We observed TRPV6 mRNA to be expressed at
progressively increasing levels during osteoblast-like cell
differentiation and mineralization (Fig. 2A). At day 21 of culture,
TRPV6 expression was significantly increased in mineralizing
compared to non-mineralizing cultures (Fig. 2B). CalbindinD28K showed a similar expression pattern as TRPV6 mRNA,
with a sharp rise in expression during mineralization (Fig. 2C).
Moreover, in mineralizing cultures calbindin-D28K abundance at
day 21 was significantly elevated relative to non-mineralizing
cultures (Fig. 2D). NCX1 mRNA was also expressed at all time
points during culture but in contrast to TRPV6 and calbindinD28K no differences in expression were observed between the
stages of osteoblast differentiation (Fig. 2E). However, at day 21
of culture, NCX1 mRNA levels were significantly increased
in cultures that mineralize compared to cultures that do
not (Fig. 2F). PMCA1b mRNA was highly abundant in the
osteoblast-like cultures and increased moderately during
culture time (Fig. 2G). In contrast to TRPV6, calbindin-D28K
and NCX1, PMCA1b expression was not different between
mineralizing and non-mineralizing conditions at day 21 of
culture (Fig. 2H).
To investigate whether the upregulation of TRPV6 and
calbindin-D28K mRNA expression during mineralization is
caused by dexamethasone rather than the differentiation
process itself, non-mineralizing cultures at day 12 were
analyzed following dexamethasone or vehicle treatment up
to 24 h. Dexamethasone did not significantly regulate TRPV6
and calbindin-D28K mRNA expression at 3, 6, and 24 h after
treatment (Supplementary Fig. 2A,B).
Gene expression during osteoclast differentiation
Induction of osteoclast formation from murine bone marrow
cells by M-CSF and RANKL caused an increase in calbindin-D28K
expression compared to treatment with M-CSF alone
(Supplementary Fig. 3B). In contrast, TRPV6, NCX1, and
TRPV6 IS DYNAMICALLY EXPRESSED IN BONE
Fig. 1. TRPV6 and PMCA1b are present in human osteoblasts and murine osteoclasts. SV-HFO and MG-63 (osteosarcoma-derived) osteoblasts
were cultured for 7 days were immunostained with specific antibodies for TRPV6 or PMCA1b followed by a fluorescent detection. Immunostaining
for TRPV6 was observed in SV-HFO (A) and MG63 osteoblasts (B), whereas PMCA1b was observed in SV-HFO osteoblasts (C). Inset in A
represents negative control (pre-immune serum). In human trabecular bone sections, TRPV6 staining was shown predominantly at the apical
domain of osteoblasts (D). PMCA1b was found along the osteoidal domain of osteoblasts (F). White lines indicate the bone surface for orientation in
D and F. Incubation with pre-immune serum in sections or omission of the first antibody resulted in absence of staining (E,G). Arrows indicate
osteoblasts and arrowheads osteocytes (D–G). Murine multinuclear osteoclasts derived from bone marrow were cultured on bone slices in the
presence of M-CSF and RANKL during 6 days and are TRAP positive (H). TRPV6 and PMCA1b staining was found in these osteoclasts (I and J,
respectively). Insets show negative control (I, pre-immune serum; J, no first antibody). LSCM on human osteoclasts seeded on bone showed TRPV6
staining (green) in the osteoclast predominantly at the site where bone resorption takes place (arrows), characterized by actin ring (red) staining
(K). In murine osteoclasts, staining of TRPV6 was primarily located at the bone-facing site, where bone resorption takes place. Nuclei are blue (K,L).
Bar represents 10 mm. [Color figure can be seen in the online version of this article, available at http://wileyonlinelibrary.com/journal/jcp]
JOURNAL OF CELLULAR PHYSIOLOGY
1955
1956
VAN DER EERDEN ET AL.
differentiation (Supplementary Fig. 4A). Similarly, in nonmineralizing cultures, 1,25(OH)2D3 did not significantly alter
TRPV6 mRNA expression, irrespective of culture period
(Supplementary Fig. 4B). In support of this, short-term
incubations with 1,25(OH)2D3 in mineralizing osteoblast-like
cells demonstrated that transcription of both TRPV6 and
calbindin-D28K were not affected. In addition to SV-HFO cells,
another human osteoblast-like cell line was used to investigate
the effect of 1,25(OH)2D3 on TRPV6 expression. NHOst cells
are primary osteoblasts isolated from the spongy section of the
skull and similarly to SV-HFO cells can be induced to further
differentiate and mineralize by glucocorticoids. Similar to
SV-HFO osteoblast-like cells, 10 nM 1,25(OH)2D3 did not
regulate TRPV6 expression in NHOst cells in the early
mineralizing stage (day 8 of culture) (Supplementary Fig. 4C).
In contrast to TRPV6, 24-hydroxylase (CYP24) was strongly
stimulated in both SV-HFO and NHOst osteoblast-like cells,
respectively (Supplementary Fig. 4D).
TRPV6 overexpression does not enhance osteoblast
mineralization
Lentiviral transduction with full-length TRPV6 caused a 1,000fold increase in expression as compared to control transduced
cells (Fig. 3A). Nevertheless, TRPV6 overexpression did not
Fig. 2. Expression of TRPV6, calbindin-D28K, NCX1 increases during
mineralization of human osteoblast-like cells. SV-HFO cells were
cultured during 23 days and at different time points total RNA was
isolated and mRNA expression was studied of TRPV6 (A),
calbindin-D28K (C), NCX1 (E), and PMCA1b (G). During the last week
of culture, expression was compared between the mineralizing and
non-mineralizing cultures (B: TRPV6, D: calbindin-D28K; F: NCX1;
H: PMCA1b). Values are presented as mean W SEM (A,C,E,G, n U 4;
B,D,F,H, n U 7). MP < 0.05 compared to non-mineralizing cultures;
MM
P < 0.001 compared to non-mineralizing cultures.
PMCA1b expression was not significantly different between
the M-CSF and the differentiated RANKL/M-CSF condition
(Supplementary Fig. 3A,C,D, respectively). We also studied an
osteoclast-like cell line, RAW264.7, which can be differentiated
towards osteoclasts following RANKL treatment. At day 7
of culture, expression of TRPV6 and NCX1 was increased
in RANKL-treated osteoclast-like cells compared to
undifferentiated cell cultures (Supplementary Fig. 3E,F,
respectively), whereas PMCA1b expression was not
significantly different between these conditions
(Supplementary Fig. 3G). The chloride channel CLC-7 and the
vacuolar proton pump Hþ-ATPase were abundantly expressed
in mature osteoclast-like cells (Supplementary Fig. 3H,J,
respectively) compared to immature cells.
1,25(OH)2D3 does not regulate TRPV6 expression in
human osteoblast-like cells
In mineralizing cultures, no effect of continuous treatment
with 1,25(OH)2D3 was observed at any time point during
JOURNAL OF CELLULAR PHYSIOLOGY
Fig. 3. Overexpression of TRPV6 nor non-functional TRPV6 affect
osteoblast mineralization at ambient and low calcium concentrations
in vitro. TRPV6 was overexpressed in human osteoblasts by lentiviral
transduction. A: TRPV6 gene expression; B,C: representative graphs
for calcium incorporation into the osteoblast extracellular matrix
corrected for protein at days 10 (B) and 17 (C) of osteoblast cultures
(n U 4); D: SV-HFO osteoblast mineralization at day 19 in the
presence of low calcium concentrations in the medium (n U 4).
E: Bone marrow-derived osteoblast mineralization at day 21 from
wild-type and Trpv6D541A/D541A mice in the presence of low calcium
concentrations in medium. TRPV6 KI U TRPV6D541A/D541A (n U 3–6).
Values are presented as mean W SEM.
TRPV6 IS DYNAMICALLY EXPRESSED IN BONE
TABLE 2. Bone size, but not microarchitecture, is affected by TRPV6
deficiency
TRPV6D541A/
Wild-type
(n U 14)
Mean
Metaphyseal trabeculae
Femur length (mm)
16.7
6.3
Tissue volume (mm3)
3
Bone volume (mm )
0.7
Bone volume fraction (BV/TV; %)
11.8
Trabecular thickness (mm)
0.05
Trabecular spacing (mm)
0.3
1
2.4
Trabecular number (mm )
Trabecular patterning factor (mm1) 12.7
Diaphyseal cortex
0.5
Cortical volume (mm3)
Cortical thickness (mm)
0.13
4
Moment of inertia (mm )
0.6
Perimeter (mm)
6.9
SEM
D541A
(n U 14)
Mean
SEM
P-value
0.1
16.0
0.3
5.4
0.1
0.6
1.2
9.9
0.001 0.05
0.01
0.3
0.2
2.1
2.0
17.0
0.1
0.2
0.1
1.0
0.001
0.02
0.2
2.0
0.0002
0.02
0.1
0.2
0.2
0.4
0.3
0.1
0.01
0.004
0.03
0.2
0.01
0.004
0.04
0.1
0.003
0.3
0.3
0.1
0.4
0.13
0.5
6.6
Indicates significant differences between wild type and TRPV6.
lead to enhanced mineralization compared to controls, both at
the onset of (day 10) and during full mineralization (day 17) of
osteoblast cultures (Fig. 3B,C, respectively). Besides ambient
calcium concentrations (1.8 mM), we also performed TRPV6
gain-of-functions and loss-of-function experiments in the
presence of low calcium (Fig. 3D,E, respectively). Mineralization
by osteoblasts overexpressing TRPV6 in medium containing
lower Ca2þ levels (1.2 and 1.5 mM) was similar to control
osteoblasts (Fig. 3D). Mineralization was also assessed in bone
marrow-derived osteoblasts from wild-type and Trpv6D541A/
D541A
mice in which TRPV6 channels are non-functional. In the
Trpv6D541A/D541A mice osteoblast mineralization seemed to be
affected at low calcium conditions but it was not significantly
different from wild-type mice (Fig. 3E).
Trpv6D541A/D541A mice have unaffected bone
microarchitecture and bone matrix mineralization
Mice lacking functional TRPV6 did not have altered bone mass
(Table 2). All parameters associated with trabecular and
cortical bone microarchitecture were similar in wild-type and
Trpv6D541A/D541A mice. However, bone size was affected in
TRPV6-deficient mice as shown by reductions in femoral length
as well as femoral head, cortical bone and endocortical bone
volumes (Table 2). The qBEI of femurs demonstrated that bone
matrix mineralization was not different between wild-type and
Trpv6D541A/D541A mice (Table 2). All BMDD parameters
measured were identical in Trpv6D541A/D541A and wild-type
littermates both at the trabecular and cortical bone
compartment (Table 3).
TABLE 3. Mineralization of bone is not affected by TRPV6 deficiency
Wild-type
(n U 14)
Trabecular bone
CaMean (wt.% Ca)
CaPeak (wt.% Ca)
CaWidth (Dwt.% Ca)
CaLow (%)
Cortical bone
CaMean (wt.% Ca)
CaPeak (wt.% Ca)
CaWidth (Dwt.% Ca)
CaLow (%)
TRPV6D541A/
(n U 14)
D541A
Mean
SEM
Mean
SEM
P-value
24.2
25.2
3.2
6.2
0.6
0.6
0.3
1.3
24.2
25.2
3.1
6.2
0.6
0.6
0.3
1.1
1.0
0.9
0.2
1.0
26.2
26.6
3.1
1.9
0.5
0.6
0.2
0.3
26.1
26.5
3.1
1.8
0.5
0.5
0.2
0.3
0.5
0.5
0.4
0.6
JOURNAL OF CELLULAR PHYSIOLOGY
Discussion
Ca2þ transport is a crucial process in bone metabolism for bone
formation as well as for resorption but the molecular
mechanism, by which this occurs, remains largely unsolved. To
shed more light on this important process, we studied the role
and regulation of Ca2þ-selective transient receptor potential
channel TRPV6 in osteoblasts and osteoclasts. This channel has
been shown to be crucial in transepithelial Ca2þ absorption in
the intestine (Peng et al., 2003; Van Abel et al., 2003) and in the
epididymis (Weissgerber et al., 2011). In this study, we showed
that TRPV6, along with the other intestinal and renal Ca2þ
transporter proteins is present in human and murine bone
tissue and in osteoblast-like cells and osteoclasts from both
species. However, Trpv6D541A/D541A mice in which Ca2þ
uptake by the epididymal epithelium is markedly reduced,
displayed unaffected bone microarchitecture and bone matrix
mineralization, and TRPV6 overexpression in osteoblasts does
not affect differentiation and mineralization in vitro. This
demonstrates that despite the presence of the
transcellular Ca2þ transport machinery in bone cells, TRPV6
does not play a vital role in bone metabolism.
Recently, we have shown that TRPV5, a close homolog of
TRPV6, is expressed and functional in osteoclasts but is absent
in osteoblasts (van der Eerden et al., 2005). This implicates that
for transcellular Ca2þ transport in osteoblasts TRPV6 would be
the only candidate, which is in contrast to osteoclasts, where
both TRPV5 and TRPV6 are expressed. Using LSCM on human
and murine osteoclasts cultured on cortical bone slices, the
majority of the resorbing osteoclasts revealed the presence of
TRPV6, similar as for TRPV5 (van der Eerden et al., 2005),
predominantly along the bone-facing plasma membrane. In
addition, the expression patterns of TRPV6, calbindin-D28K and
NCX1 mRNA in primary differentiated (M-CSF þ RANKL)
osteoclasts and RAW264.7 cells further substantiate a role for
these proteins in Ca2þ transport by mature osteoclasts. At this
stage of osteoclast differentiation, characteristic proteins
required for bone resorption, such as CLC-7 and Hþ-ATPase
are highly expressed. The localization and expression studies in
osteoclasts suggest that the Ca2þ being liberated in the
resorption pit during bone resorption can be sequestered at the
resorption site by TRPV6. Then, possibly, the calbindins
transport Ca2þ through the osteoclast, where NCX1 and
PMCA1b extrude it into the circulation. However, at a
functional level TRPV6 seemed not to be able to compensate
for the reduced bone resorption occurring in mice lacking
TRPV5 (van der Eerden et al., 2005). We have demonstrated
that TRPV5 and TRPV6 have a tetrameric stoichiometry and
can combine with each other to form heteromultimeric
channels with novel properties (Hoenderop et al., 2003b).
These findings implicate that heterodimers exist in vivo but
whether these are required for optimal TRPV function in
osteoclasts, remains elusive.
A process with a great Ca2þ demand is mineralization in
which large amounts of Ca2þ have to be present at the osteoid
surface. To assess whether the expression of the transport
proteins coincides with mineralization, we used a human
osteoblast differentiation model that mineralizes during culture
(Chiba et al., 1993; Eijken et al., 2005; van Driel et al., 2006).
TRPV6, calbindin-D28K, and NCX1 expression strongly
increased during mineralization, while no alteration of PMCA1b
transcription was observed. Direct comparison of mineralizing
and non-mineralizing cultures demonstrated that the
expression of TRPV6, calbindin-D28K, and NCX1 are
significantly higher expressed in the mineralizing condition.
As human osteoblast differentiation and mineralization is
induced by glucocorticoid treatment (Eijken et al., 2006), we
investigated whether the increase in expression was due
to a direct dexamethasone effect instead of being related to
1957
1958
VAN DER EERDEN ET AL.
differentiation and the mineralization process. Short-term
dexamethasone treatment demonstrated that it is the
differentiation of the cells rather than dexamethasone itself,
which initiates upregulation of TRPV6 expression. This is
further supported by the observations using differentiating
murine osteoblast-like cells. Differentiation of murine
osteoblast-like cells occurs independent of dexamethasone
(van der Horst et al., 2002) and likewise the human osteoblastlike cultures, TRPV6 expression also increases during mouse
osteoblast differentiation with TRPV6 mRNA being
upregulated at the initiation of the mineralization process. Most
interestingly, in relation to the increased TRPV6 expression
during mineralization, in human bone sections TRPV6 was
found predominantly at the apical domain of osteoblasts,
whereas PMCA1b was localized along the osteoidal domain,
suggesting a transport route for Ca2þ towards bone. The
subcellular localization of PMCA1b in human osteoblasts is
reminiscent of that reported by Nakano et al. (2004) showing
the presence of this ATPase at the osteoidal domain of rat
osteoblasts. Taking these findings together, it is tempting to
speculate that these proteins are involved in Ca2þ transport
during mineralization. In this model, Ca2þ is taken up in the
osteoblast through TRPV6, intracellular transported by
calbindin-D28K, and released at the bone-facing side by NCX1
and PMCA1b. However, our TRPV6 overexpression studies
showing unaltered mineralization argue against a major role in
mineralization. This is supported by the observation that our
Trpv6D541A/D541A mice have unaffected femoral bone
mineralization and by the bone marrow-derived osteoblast
cultures in which mineralization in the presence of low Ca2þ in
the culture medium was not different between wild-type and
Trpv6D541A/D541A mice.
Recently, Lieben et al. (2010) showed that bone mass and
microarchitecture was not affected by TRPV6-deficient mice. In
these mice only differences in serum ostocalcin levels and
osteoid formation as markers for bone turnover were reported
under circumstances when the mice were held on a low (0.02%)
calcium diet, but this difference was not observed in mice on a
regular (1%) calcium diet. The model was different from ours in
two ways: (1) Lieben et al. used a knockout mouse whereas we
used a knock-in mouse with replacement of one amino acid
(D541A), that impairs the permeability of TRPV6 channels
for Ca2þ without affecting channel architecture and interaction
with associated proteins and (2) in the Trpv6 knockout model
used by Lieben et al. also parts of the EphB6 gene were deleted
(Bianco et al., 2007), which is a kinase-defective member of the
EphB kinase family. However, additional analyses on the EphB6
knockout mouse did not indicate that calcium homeostasis is
affected (Bianco et al., 2007). Despite the genotypic differences
of the TRPV6-deficient mice models, our study reports a similar
phenotype with respect to bone microarchitecture, being not
different from wild-type mice. Nevertheless, parameters
describing bone size were significantly lower compared to wildtype mice, including femoral length and cortical bone volume,
whereas the increase in body weight is unaltered compared to
littermatched controls during the first 19 weeks of postnatal
development (Weissgerber et al., 2011). These results suggest
that growth defects only become evident thereafter or that the
reduction in bone size in Trpv6D541A/D541A mice is masked by
other variables in the weight gain analysis but most likely the
contribution of the modest changes in bone volume to body
weight is too small to measure.
Examples of diseases related to longitudinal growth
disturbances following defective cartilage mineralization
include vitamin D resistance and hypophosphatasia
(Anderson et al., 1997; Amling et al., 1999; Liberman, 2007).
Whether TRPV6 affects mineralization by chondrocytes in the
growth plates leading to stunted bone growth is currently
unclear.
JOURNAL OF CELLULAR PHYSIOLOGY
1,25(OH)2D3 is a stimulator of human osteoblast-mediated
mineralization (Gardiner et al., 2000; van Leeuwen et al., 2001;
van Driel et al., 2004, 2006). Interestingly, it was recently
demonstrated that the promoter of TRPV6 contains five
functional vitamin D responsive elements (VDREs; Meyer et al.,
2006). Therefore, we studied the effect of 1,25(OH)2D3 on
TRPV6 expression in two human osteoblast cell lines, SV-HFO
and NHOst. Both osteoblasts are 1,25(OH)2D3 responsive as
shown by strong upregulation of CYP24. In contrast, TRPV6
expression was not changed by long-term as well as short-term
treatment with 1,25(OH)2D3 in both osteoblast cell lines. This
contrasts the strong TRPV6 upregulation by 1,25(OH)2D3 in
intestinal epithelial cells (Peng et al., 1999; Hoenderop et al.,
2003a). Thereby the current data demonstrate a tissue-specific
regulation of TRPV6. Future studies are needed to elaborate
the transcriptional regulation of TRPV6 and to assess the
determinants of tissue-specific control. Interestingly also for
CYP27B1, the gene coding for the enzyme 1a-hydroxylase
crucial for 1,25(OH)2D3 synthesis, tissue-specific regulation by
parathyroid hormone has been shown (van Driel et al., 2006).
Whether this reflects a more general tissue-specific
transcriptional control of Ca2þ homeostasis-related genes
remains to be assessed.
Apart from bone resorption, two other mechanisms have
been described for bone to aid in rapid restoration of Ca2þ
homeostasis in the past decades, both of which have been
recently revisited (Talmage and Mobley, 2008; Teti and Zallone,
2009). Firstly, a process involving bone-lining cells on quiescent
bone surfaces has been described (Parfitt, 1989). Among
others, Parfitt concluded that renal and intestinal Ca2þ
transport as well as bone remodeling are not capable of
restoring alterations in serum Ca2þ rapid enough following
parathyroid hormone-induced hypocalcemia (Parfitt, 1989;
Talmage and Mobley, 2008). Parfitt (1981, 1989) previously
demonstrated that large amounts of Ca2þ are transported in
and out of bone by an efflux system during hypocalcemia.
Secondly, osteocytic osteolysis has been proposed as a
mechanism to contribute to mineral homeostasis by
demineralization of lacunae surrounding the osteocytes
(Tazawa et al., 2004; Lane et al., 2006). Whether TRPV6 and
transcellular Ca2þ transport are involved in these mechanisms,
remains to be investigated.
In conclusion, the dynamic expression pattern of TRPV6,
calbindin-D28K, and NCX1 suggests that this Ca2þ transport
system is operational in osteoblast-mediated mineralization,
while overexpression of TRPV6 in vitro does not enhance
osteoblast mineralization. In addition, bone microarchitecture
and bone matrix mineralization were not affected in TRPV6
pore mutant mice, strongly implicating that although the Ca2þ
transcellular transport machinery is present in bone cells,
TRPV6 seems to lack a primary role in bone metabolism and
mineralization in mice.
Acknowledgments
We thank Bianca Boers-Sijmons, Anke van Kerkwijk, Halima
Charif, Michael Snel, Tanja Volz, and Christin Matka for their
technical assistance. We acknowledge Dr. M. Karperien (Tissue
Engineering, TU Twente, Enschede, the Netherlands) for
providing us with human trabecular bone sections. We are
grateful to Dr. B. Nicholls and Dr. M. Horton (The Bone and
Mineral Centre, University College London, UK) for providing
us with human osteoclasts seeded on bone. This work was
supported by grants from the Dutch Organization of Scientific
Research (Zon-Mw 902.18.298), European Science Foundation
(EURYI, Zon-Mw 916.56.021), the Deutsche
Forschungsgemeinschaft (M.F., V.F., and P.W.), Fonds der
Chemischen Industrie and Sander-Stiftung (V.F.),
Forschungsausschuss, the ‘‘HOMFOR’’ Program, and
TRPV6 IS DYNAMICALLY EXPRESSED IN BONE
Forschungsausschuss der Universität des Saarlandes (M.F., V.F.,
and P.W.).
Literature Cited
Amling M, Priemel M, Holzmann T, Chapin K, Rueger JM, Baron R, Demay MB. 1999. Rescue
of the skeletal phenotype of vitamin D receptor-ablated mice in the setting of normal
mineral ion homeostasis: Formal histomorphometric and biomechanical analyses.
Endocrinology 140:4982–4987.
Anderson HC, Hsu HH, Morris DC, Fedde KN, Whyte MP. 1997. Matrix vesicles in
osteomalacic hypophosphatasia bone contain apatite-like mineral crystals. Am J Pathol
151:1555–1561.
Berdal A, Hotton D, Saffar JL, Thomasset M, Nanci A. 1996. Calbindin-D9k and calbindin-D28k
expression in rat mineralized tissues in vivo. J Bone Miner Res 11:768–779.
Bianco SD, Peng JB, Takanaga H, Suzuki Y, Crescenzi A, Kos CH, Zhuang L, Freeman MR,
Gouveia CH, Wu J, Luo H, Mauro T, Brown EM, Hediger MA. 2007. Marked disturbance of
calcium homeostasis in mice with targeted disruption of the trpv6 calcium channel gene.
J Bone Miner Res 22:274–285.
Bouxsein ML, Boyd SK, Christiansen BA, Guldberg RE, Jepsen KJ, Muller R. 2010. Guidelines
for assessment of bone microstructure in rodents using micro-computed tomography.
J Bone Miner Res 25:1468–1486.
Chattopadhyay N, Yano S, Tfelt-Hansen J, Rooney P, Kanuparthi D, Bandyopadhyay S, Ren X,
Terwilliger E, Brown EM. 2004. Mitogenic action of calcium-sensing receptor on rat
calvarial osteoblasts. Endocrinology 145:3451–3462.
Chiba H, Sawada N, Ono T, Ishii S, Mori M. 1993. Establishment and characterization of a
simian virus 40-immortalized osteoblastic cell line from normal human bone. Jpn J Cancer
Res 84:290–297.
de Vries TJ, Schoenmaker T, Beertsen W, van der Neut R, Everts V. 2005. Effect of CD44
deficiency on in vitro and in vivo osteoclast formation. J Cell Biochem 94:954–966.
Dvorak MM, Siddiqua A, Ward DT, Carter DH, Dallas SL, Nemeth EF, Riccardi D. 2004.
Physiological changes in extracellular calcium concentration directly control osteoblast
function in the absence of calciotropic hormones. Proc Natl Acad Sci USA 101:5140–5145.
Eijken M, Hewison M, Cooper MS, de Jong FH, Chiba H, Stewart PM, Uitterlinden AG, Pols
HA, van Leeuwen JP. 2005. 11beta-Hydroxysteroid dehydrogenase expression and
glucocorticoid synthesis are directed by a molecular switch during osteoblast
differentiation. Mol Endocrinol 19:621–631.
Eijken M, Koedam M, van Driel M, Buurman CJ, Pols HA, van Leeuwen JP. 2006. The essential
role of glucocorticoids for proper human osteoblast differentiation and matrix
mineralization. Mol Cell Endocrinol 248:87–93.
Faucheux C, Bareille R, Amedee J. 1998. Synthesis of calbindin-D28K during mineralization in
human bone marrow stromal cells. Biochem J 333:817–823.
Gardiner EM, Baldock PA, Thomas GP, Sims NA, Henderson NK, Hollis B, White CP, Sunn
KL, Morrison NA, Walsh WR, Eisman JA. 2000. Increased formation and decreased
resorption of bone in mice with elevated vitamin D receptor in mature cells of the
osteoblastic lineage. FASEB J 14:1908–1916.
Hoenderop JG, Van Der Kemp AW, Hartog A, van de Graaf SF, Van Os CH, Willems PH,
Bindels RJ. 1999. Molecular identification of the apical Ca2þ channel in 1, 25dihydroxyvitamin D3-responsive epithelia. J Biol Chem 274:8375–8378.
Hoenderop JG, Nilius B, Bindels RJ. 2002. ECaC: The gatekeeper of transepithelial Ca2þ
transport. Biochim Biophys Acta 1600:6–11.
Hoenderop JG, van Leeuwen JP, van der Eerden BC, Kersten FF, van der Kemp AW, Merillat
AM, Waarsing JH, Rossier BC, Vallon V, Hummler E, Bindels RJ. 2003a. Renal Ca2þ wasting,
hyperabsorption, and reduced bone thickness in mice lacking TRPV5. J Clin Invest
112:1906–1914.
Hoenderop JG, Voets T, Hoefs S, Weidema F, Prenen J, Nilius B, Bindels RJ. 2003b. Homoand heterotetrameric architecture of the epithelial Ca2þ channels TRPV5 and TRPV6.
EMBO J 22:776–785.
Hoenderop JG, Nilius B, Bindels RJ. 2005. Calcium absorption across epithelia. Physiol Rev
85:373–422.
Janssen JM, Bland R, Hewison M, Coughtrie MW, Sharp S, Arts J, Pols HA, van Leeuwen JP.
1999. Estradiol formation by human osteoblasts via multiple pathways: Relation with
osteoblast function. J Cell Biochem 75:528–537.
Lane NE, Yao W, Balooch M, Nalla RK, Balooch G, Habelitz S, Kinney JH, Bonewald LF. 2006.
Glucocorticoid-treated mice have localized changes in trabecular bone material properties
and osteocyte lacunar size that are not observed in placebo-treated or estrogen-deficient
mice. J Bone Miner Res 21:466–476.
Liberman UA. 2007. Vitamin D-resistant diseases. J Bone Miner Res 22:V105–V107.
Lieben L, Benn BS, Ajibade D, Stockmans I, Moermans K, Hediger MA, Peng JB, Christakos S,
Bouillon R, Carmeliet G. 2010. Trpv6 mediates intestinal calcium absorption during
calcium restriction and contributes to bone homeostasis. Bone 47:301–308.
Meyer MB, Watanuki M, Kim S, Shevde NK, Pike JW. 2006. The human transient receptor
potential vanilloid type 6 distal promoter contains multiple vitamin D receptor binding sites
that mediate activation by 1,25-dihydroxyvitamin D3 in intestinal cells. Mol Endocrinol
20:1447–1461.
Montell C. 2001. Physiology, phylogeny, and functions of the TRP superfamily of cation
channels. Sci STKE 2001:re1.
JOURNAL OF CELLULAR PHYSIOLOGY
Moonga BS, Davidson R, Sun L, Adebanjo OA, Moser J, Abedin M, Zaidi N, Huang CL,
Zaidi M. 2001. Identification and characterization of a sodium/calcium exchanger, NCX-1,
in osteoclasts and its role in bone resorption. Biochem Biophys Res Commun 283:
770–775.
Nakano Y, Beertsen W, VanDenBos T, Kawamoto T, Oda K, Takano Y. 2004. Site-specific
localization of two distinct phosphatases along the osteoblast plasma membrane: Tissue
non-specific alkaline phosphatase and plasma membrane calcium ATPase. Bone 35:1077–
1085.
Nesbitt SA, Horton MA. 1997. Trafficking of matrix collagens through bone-resorbing
osteoclasts. Science 276:266–269.
Nijenhuis T, Hoenderop JG, Van Der Kemp AW, Bindels RJ. 2003. Localization and
regulation of the epithelial Ca2þ channel TRPV6 in the kidney. J Am Soc Nephrol 14:2731–
2740.
Parfitt AM. 1981. Integration of skeletal and mineral homeostasis. In: De Luca HF, Frost HM,
Jee W, Johnston C, Parfitt AM, editors. Osteoporosis: Recent advances in pathogenesis
and treatment. Baltimore: University Park Press. p 115–126.
Parfitt AM. 1989. Plasma calcium control at quiescent bone surfaces: A new approach to the
homeostatic function of bone lining cells. Bone 10:87–88.
Peng JB, Chen XZ, Berger UV, Vassilev PM, Tsukaguchi H, Brown EM, Hediger MA. 1999.
Molecular cloning and characterization of a channel-like transporter mediating intestinal
calcium absorption. J Biol Chem 274:22739–22746.
Peng JB, Brown EM, Hediger MA. 2003. Epithelial Ca2þ entry channels: Transcellular Ca2þ
transport and beyond. J Physiol 551:729–740.
Roschger P, Fratzl P, Eschberger J, Klaushofer K. 1998. Validation of quantitative
backscattered electron imaging for the measurement of mineral density distribution in
human bone biopsies. Bone 23:319–326.
Roschger P, Paschalis EP, Fratzl P, Klaushofer K. 2008. Bone mineralization density
distribution in health and disease. Bone 42:456–466.
Stains JP, Gay CV. 1998. Asymmetric distribution of functional sodium–calcium exchanger in
primary osteoblasts. J Bone Miner Res 13:1862–1869.
Stains JP, Gay CV. 2001. Inhibition of Naþ/Ca2þ exchange with KB-R7943 or bepridil
diminished mineral deposition by osteoblasts. J Bone Miner Res 16:1434–1443.
Stains JP, Weber JA, Gay CV. 2002. Expression of Na(þ)/Ca(2þ) exchanger isoforms (NCX1
and NCX3) and plasma membrane Ca(2þ) ATPase during osteoblast differentiation. J Cell
Biochem 84:625–635.
Talmage RV, Mobley HT. 2008. Calcium homeostasis: Reassessment of the actions of
parathyroid hormone. Gen Comp Endocrinol 156:1–8.
Tazawa K, Hoshi K, Kawamoto S, Tanaka M, Ejiri S, Ozawa H. 2004. Osteocytic osteolysis
observed in rats to which parathyroid hormone was continuously administered. J Bone
Miner Metab 22:524–529.
Teti A, Zallone A. 2009. Do osteocytes contribute to bone mineral homeostasis? Osteocytic
osteolysis revisited. Bone 44:11–16.
Van Abel M, Hoenderop JG, Van Der Kemp AW, van Leeuwen JP, Bindels RJ. 2003. Regulation
of the epithelial Ca2þ channels in small intestine as studied by quantitative mRNA
detection. Am J Physiol Gastrointest Liver Physiol 285:G78–G85.
Van Cromphaut SJ, Dewerchin M, Hoenderop JG, Stockmans I, Van Herck E, Kato S, Bindels
RJ, Collen D, Carmeliet P, Bouillon R, Carmeliet G. 2001. Duodenal calcium absorption in
vitamin D receptor-knockout mice: Functional and molecular aspects. Proc Natl Acad Sci
USA 98:13324–13329.
van de Graaf SF, Boullart I, Hoenderop JG, Bindels RJ. 2004. Regulation of the epithelial
Ca(2þ) channels TRPV5 and TRPV6 by 1alpha,25-dihydroxy vitamin D(3) and dietary
Ca(2þ). J Steroid Biochem Mol Biol 89–90:303–308.
van der Eerden BC, Hoenderop JG, de Vries TJ, Schoenmaker T, Buurman CJ, Uitterlinden
AG, Pols HA, Bindels RJ, van Leeuwen JP. 2005. The epithelial Ca2þ channel TRPV5 is
essential for proper osteoclastic bone resorption. Proc Natl Acad Sci USA 102:17507–
17512.
van der Horst G, van Bezooijen RL, Deckers MM, Hoogendam J, Visser A, Lowik CW,
Karperien M. 2002. Differentiation of murine preosteoblastic KS483cells depends on
autocrine bone morphogenetic protein signaling during all phases of osteoblast formation.
Bone 31:661–669.
van Driel M, Pols HA, van Leeuwen JP. 2004. Osteoblast differentiation and control by vitamin
D and vitamin D metabolites. Curr Pharm Des 10:2535–2555.
van Driel M, Koedam M, Buurman CJ, Hewison M, Chiba H, Uitterlinden AG, Pols HA, van
Leeuwen JP. 2006. Evidence for auto/paracrine actions of vitamin D in bone: 1-Hydroxylase
expression and activity in human bone cells. FASEB J 20:2417–2419.
van Leeuwen JP, van Driel M, van den Bemd GJ, Pols HA. 2001. Vitamin D control of
osteoblast function and bone extracellular matrix mineralization. Crit Rev Eukaryot Gene
Expr 11:199–226.
Walker LM, Publicover SJ, Preston MR, Said Ahmed MA, El Haj AJ. 2000. Calcium-channel
activation and matrix protein upregulation in bone cells in response to mechanical strain.
J Cell Biochem 79:648–661.
Weissgerber P, Kriebs U, Tsvilovskyy V, Olausson J, Kretz O, Stoerger C, Vennekens R,
Wissenbach U, Middendorff R, Flockerzi V, Freichel M. 2011. Male fertility depends
on Ca2þ absorption by TRPV6 in epididymal epithelia. Sci Signal 4:ra27.
Zhuang L, Peng JB, Tou L, Takanaga H, Adam RM, Hediger MA, Freeman MR. 2002. Calciumselective ion channel, CaT1, is apically localized in gastrointestinal tract epithelia and is
aberrantly expressed in human malignancies. Lab Invest 82:1755–1764.
1959