MEC953.fm Page 935 Thursday, June 1, 2000 1:55 PM
Molecular Ecology (2000) 9, 935 – 948
Microdiversity of uncultured marine prokaryotes:
the SAR11 cluster and the marine Archaea of Group I
Blackwell Science, Ltd
J . G A R C Í A - M A RT Í N E Z and F. R O D R Í G U E Z - VA L E R A
División de Microbiología, Universidad Miguel Hernández, Campus de San Juan, 03550 San Juan, Alicante, Spain
Abstract
The SAR11 cluster and the Group I of marine Archaea represent probably the best two
examples of uncultured marine prokaryotes of widespread occurrence. To study their
microdiversity and distribution, a total of 81 and 48 clones, respectively, were sequenced
from Mediterranean and Antarctic waters at different locations and depths. The DNA
regions chosen for the analysis were the last third, approximately, of the 16S rRNA
gene and the 16S–23S intergenic spacer (also known as internal transcribed spacer
[ITS]). There was a high concordance in both, even with the extremely variable ITS,
where potential probes have been proposed for the identification and isolation of these
micro-organisms. In terms of community structure, our results show that although depthrelated factors seem to be predominant in the final associations of the clones, geography also plays a significant role. A major group of surface-associated sequences
was found in both SAR11 and marine Archaea. In both cases this group was relatively homogeneous containing little diversity in terms of sequence, while sequences
retrieved from deep samples and some surface clones contained much more heterogeneity.
As a whole, both groups of prokaryotes seem to fall within the limits of well-defined
taxonomic units.
Keywords: 16S rDNA, 16S-23S rDNA spacer, marine archaea, marine assemblages, microbial
diversity, SAR11
Received 9 October 1999; revision received 2 February 2000; accepted 2 February 2000
Introduction
The use of polymerase chain reaction (PCR) amplification to study bacterial biodiversity allows identification of
new groups of bacteria or other micro-organisms without the requirement of culture (Giovannoni et al. 1990;
Borneman & Triplett 1997). Application of this technique
to the marine environment has revealed the presence and
relative abundance of certain groups that have never been
retrieved by culture. The SAR11 cluster of α-Proteobacterial
16S ribosomal DNA (rDNA) sequences is a paradigm for
such groups. These sequences have been amplified from
most marine samples studied, regardless of location or
research group involved (Field et al. 1997; Fuhrman &
Campbell 1998; Acinas et al. 1999) and constitute a significant proportion of the bacterial population (Fuhrman
Correspondence: F. Rodríguez-Valera, División de Microbiología, Universidad Miguel Hernández, Campus de San Juan,
Carretera de Valencia Km 87, Apartado 18, 03550 San Juan,
Alicante, Spain. Fax: +34-6591-9457; E-mail: [email protected]
© 2000 Blackwell Science Ltd
& Ouverney 1998). Recently, a related cluster of similarly
widespread distribution has been described in freshwater
lakes (Zwart et al. 1998). Both groups are distantly related
to other α-Proteobacteria and therefore there is no indication of their ecological or physiological characteristics.
One critical issue regarding these phylotypes, as they
are often called (Pace 1997), is the extent of diversity
contained within one of these clusters of 16S rDNA
sequences. They might represent large groups equivalent
to the families or genera of cultured micro-organisms, or
highly coherent groups, such as one homogeneous species
(Fox et al. 1992; Staley & Gosink 1999). This approach is
important to evaluate their potential ecological roles. The
existence of different ecotypes has been postulated on the
basis of certain depth-distribution patterns of 16S rDNA
variants (Field et al. 1997). However, the 16S molecule is
not ideal for these microdiversity studies owing to its low
level of variation. Two strains with identical 16S rDNA
sequences can be widely divergent at the level of physiology, and even more so in their ecological niche (Fox et al.
MEC953.fm Page 936 Thursday, June 1, 2000 1:55 PM
936 J . G A R C Í A - M A RT Í N E Z and F. R O D R Í G U E Z - VA L E R A
1992; Stackebrandt & Goebel 1994). The spacer sequence
located between the 16S rRNA and 23S rRNA genes,
sometimes called the internal transcribed spacer (ITS),
can be easily amplified using PCR. This region is highly
variable, permitting discrimination of species and even
strain clusters (Normand et al. 1996; Roth et al. 1998;
Vinuesa et al. 1998). Here we have studied diversity at
the level of the ITS and a section of the 16S rRNA gene
of sequences belonging to the SAR11 cluster and to the
marine Crenarchaea from a number of samples from
distant marine environments. Our purpose was to investigate whether the pattern of variation, i.e. the evolutionary
relationships, found for these groups of micro-organisms
matched that found for other groups of well-known
prokaryotes, such as the Enterobacteriaceae. This way, the
taxonomic expanse of each group could be judged. Some
authors suggest that even the physiological diversity
could be theoretically estimated (Medlin et al. 1995; Stein &
Simon 1996). On the other hand, studying sequences of
highly variable regions, such as the ITS, of micro-organisms
originating from distant areas of the world, might identify
the presence of geographical patterns, an issue of great
relevance to bacterial biogeography and population biology in general (Staley & Gosink 1999; Staley 1999).
Materials and methods
Sampling and DNA extraction
All samples used in this study were taken using Niskin
bottles at different dates and locations, as indicated in
Table 1. A minimum volume of 15 L was processed in all
cases, and the DNA was extracted either using modified
phenol–chloroform methods (Fuhrman et al. 1988; Sambrook
et al. 1989) or with Sterivex® filters (Millipore™), according
to (Massana et al. 1997, 1998).
PCR, cloning and sequencing
Primers used in this study (Table 2) were ordered from
and synthesized at Gibco BRL® Life Technologies. As indicated, many were designed in our laboratory from known
representative sequences (Leffers et al. 1987; Ludwig et al.
1995; Stein et al. 1996; Field et al. 1997; Schleper et al. 1998).
PCR reactions were performed with 1 µL of the extracted
DNA (used at a final concentration of 100 – 250 ng/µL) in
a total reaction volume of 50 µL, with the Taq DNA polymerase (Gibco), under the following conditions: preheat
at 98 °C for 1 min; 25 cycles at 93 °C for 10 s, 50 °C for
15 s and 72 °C for 2 min; and a final extension at 72 °C
for 10 min. All reactions were carried out in a DNA Thermal
Cycler 480 (Perkin-Elmer Cetus; Applied Biosystems).
PCR fragments were purified using the QIAquick
PCR Purification Kit (QIAGEN™), and then cloned and
transformed using the TA Cloning® Kit (INVITROGEN™). Cloned DNA from Escherichia coli colonies was
extracted by boiling in sterile distilled water for 10 min
and reamplified using the original primers. It was then
purified, as described above, prior to sequencing in an
ABI 377 automated sequencer (Applied Biosystems).
Table 1 Samples used in this study
Sample
Origin
Date
Location
Prokaryote-Depth (m)
Max Z (m)
A1
Jan 20 1998
Feb 4 1998
M1
Mediterranean off Blanes (Spain)
Dec 22 1997
Archaea-10
SAR11–10, -450
Archaea-200
SAR11–21, -200
Archaea-5
M2
Mediterranean off Almuñécar (Spain)
Apr 11 1997
M3
Mediterranean off Málaga (Spain)
Nov 9 1997
M4
Mediterranean off Almería (Spain)
Nov 10 1997
M5
Transect from Barcelona to Majorca
(Spain) Platform
Transect from Barcelona to Majorca
(Spain) Slope
Transect from Barcelona to Majorca
(Spain) Abyssal plain
Gulf of Biscay off Cudellero (Spain)
June 18 1995
60°31.111′ S
48°18.788′ W
63°24.500′ S 56°
40.717′ W
41°39.900′ N
02°48.030′ E
36°42.904′ N
03°44.444′ W
36°14.610′ N
04°15.260′ W
36°12.662′ N
01°32.951′ W
41°21.070′ N
02°17.870′ E
41°08.760′ N
02°28.010′ E
40°40.270′ N
02°51.980′ E
43°42.000′ N
06°09.000′ W
1914
A2
Antarctic ocean, near the ice shelf between
Scotia and Weddell seas
Antarctic ocean off the Antarctic Peninsula
M6
M7
B
June 20 1995
June 22 1995
Jan 17 1998
Archaea-25
SAR11–25
Archaea-50, -150, -450
SAR11–5, -50, -150, -450
Archaea-5
Archaea-50
Archaea-50
SAR11–5
Archaea-50, -400
SAR11–5, -50, -400
SAR11–15
Archaea-15
750
20
65
941
2125
72
972
2082
132
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935 – 948
MEC953.fm Page 937 Thursday, June 1, 2000 1:55 PM
M I C R O D I V E R S I T Y O F U N C U LT U R E D M A R I N E P R O K A RY O T E S 937
Table 2 Primers used in this study
Sequence* (5′–3′)
Gene
Position (E. coli numbering)
Application
Source/reference
CGATGTGTGYTAGACGTTGGAAATTTA
AGGTGGGTTTCCCCATTC
TTCCGGTTGATCCTGCCGGA
TCGCAGCTTRSCACGYCCTTC
AAAGGAATTGGCGGGGGAGCAC
16S
23S
16S
23S
16S
818–844
117–134
7–26
51–71
912–933
PCR (SAR11)
PCR (α-Proteobacteria), sequencing
PCR (Archaea)
PCR (Archaea), sequencing
Sequencing (Archaea)
This work
This work
Acinas et al. (1997)
This work
This work
*Base codes: R, A or G; S, G or C; Y, C or T.
E. coli, Escherichia coli; PCR, polymerase chain reaction.
Sequence analyses
Raw sequence data was edited using seqed, version 1.0.3
(Applied Biosystems) and stored in editseq (DNAStar®)
format. blast was used to search for similar sequences
submitted to the EMBL-GenBank database (Altschul et al.
1997). Sequence alignments were performed using clustal
w in the megalign program (DNAStar). Phylogenetic
analyses were carried out using mega (version 1.02, the
Pennsylvania State University). Regions of DNA forming
potentially secondary structures were predicted using
rnastructure, version 3.21 (Mathews et al. 1999) and
trnascan-se, version 1.11 (Lowe & Eddy 1997).
Sequence accession numbers
All new sequences used in this work were submitted
to the EMBL-GenBank sequence database (accession nos:
AF151220–AF151348). Reference sequences from previous
literature corresponded to the following accession numbers:
U75253–U75258 and U75649 (Field et al. 1997); Z99997
(Zwart et al. 1998); AF083071 and AF083072 (Schleper
et al. 1998); D26490 (Kurosawa et al. 1995); M21087 (Kaine
et al. 1989); U39635, U40238 and U40240 (Stein et al. 1996);
U71112, U71113, U71115 and U71116 (M. Mullarkey et al.,
unpublished); U78199 (Massana et al. 1997) and Z11573
(Fuhrman et al. 1992).
Results
The SAR11 cluster
A total of 81 clones (at least five from each sampling
point) were amplified (using the SAR11-specific primers)
from the Mediterranean (55 clones), the Gulf of Biscay,
Atlantic Ocean (five clones), and the Antarctic Ocean (21
clones). Total sizes for the amplicons were c. 1200 bp,
summing up to 97.2 kb. The specific primers designed for
the SAR11 group worked as expected, as the analysis of
the 16S portion of the amplicon (nearly 700 bp) showed
that all the clones amplified, except one, gave the closest
blast matches with SAR11 members. The single clone not
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935–948
belonging to the SAR11 cluster (M3-005-1) was related
(89.83% similarity in 639 out of its 699 nucleotides) to a
marine isolate belonging to the genus Magnetospirillum,
included also in the α-Proteobacteria, and was subsequently used as outgroup. The addition of the cultured
Magnetospirillum sp. sequence did not alter the topology
in any way but compressed excessively the resulting figure
and was not included in the tree. Figure 1 shows the
dendrogram of the comparison of the 16S rDNA section
of the SAR11 clones sequenced in this work plus some
SAR11 sequences published previously (Field et al. 1997).
Clone M2-025-5 appeared as borderline in the tree. Previous
work on freshwater lakes in North America and Europe
detected the presence of several clones related to SAR11
(Zwart et al. 1998). When one of these clones (LD12) was
included in the tree, it located midway between M3-005-1
and M2-025-5 without altering its topology (results not
shown). Hence, clone M2-025-5 could be considered either
as a divergent member of SAR11, somewhat in-between
the marine and fresh water phylotypes. We have demarcated
in Fig. 1 some clusters corresponding to groups of related
sequences that seem to reflect the existence of ecotypes
within the group. Some of the clusters detected here were
associated with certain previously described sequences,
showing the abundant sampling existing already for this
group. A very large group of clones (SAR11-S1) with high
within-cluster similarity (in most cases < 1% of nucleotide
differences in the > 680 bp analysed) was that including
the upper 33 clones in Fig. 1. It mainly comprised clones
obtained from surface samples (all taken at ≤ 50 m except
for M7-400-5), from the Mediterranean and the Atlantic.
Another closely associated cluster (SAR11-A) included
clones from the Antarctic. In fact, it could be considered
as a subcluster of the first. For these Antarctic clones,
depth distribution appeared to be mostly irrelevant, as
the sequences were very similar regardless of the depth of
the sample (the mean variation of 0.37% was even smaller
than in SAR11-S1). Both groups had reference sequence
SAR407 in relative proximity, although this clone stands
out as a kind of outgroup, and the same applied to our
clones M6-005-1, M2-025-3, M3-150-1 and M3-150-5.
These two clusters may overlap with group A2, as
MEC953.fm Page 938 Thursday, June 1, 2000 1:55 PM
938 J . G A R C Í A - M A RT Í N E Z and F. R O D R Í G U E Z - VA L E R A
Fig. 1 Phylogenetic relationships of the partial 16S sequences of the SAR11 group. The tree was built with the neighbour-joining method
using the Jukes– Cantor distance estimation. Bootstrap values higher than 50% are indicated at the main nodes. The different clusters are
indicated at the right of the figure. Reference sequences are in bold. Clones showing the eight-nucleotide insertion are marked (•).
Lighter lines to the right define the probable groupings based on reference sequences according to Field et al. (1997).
defined by Field et al. (1997), based on the hybridization
with oligonucleotide probes. This group A2 was shown to
be more abundant in surface waters (Field et al. 1997).
However, owing to the nature of our amplicons, we did
not have information about the section of the gene at
which oligonucleotide A2 was designed to hybridize. A
second, less numerous (10 clones), surface cluster was
SAR11-S2, with sequences showing a higher degree of
variability (mean variation 1.97 ± 0.89%). This cluster contained the reference sequence SAR193. Eight of 11 clones
within it were retrieved from samples taken from ≥ 50 m
and therefore it can be considered also as representative
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935 – 948
MEC953.fm Page 939 Thursday, June 1, 2000 1:55 PM
M I C R O D I V E R S I T Y O F U N C U LT U R E D M A R I N E P R O K A RY O T E S 939
of organisms that live preferentially in surface waters.
According to Field et al. (1997), SAR193 belongs to a
group of sequences that hybridize with oligonucleotide
A1 but not with A2 (A1-A2). Oligonucleotide A1 also
gave a stronger hybridization signal in samples isolated
from surface waters. A third cluster (SAR11-D) contained
sequences retrieved from deep-water samples (all > 50 m
and most from 400 to 450 m) in the Mediterranean and a
surface sample from the Atlantic (B-015-5). This cluster
might correspond to clusters B2 and G1 (or, alternatively,
to B3 and D4) of Field et al. (1997), clusters that were
identified by these authors as deep dwellers. There was a
new cluster of sequences (not containing any previously
described sequence), with high within-cluster similarity (mean variation of 1.62 ± 0.64%), that included five
clones all obtained from a shallow sample (21 m) off
the Antarctic Peninsula. We designated it as SAR11-A21,
although it can be considered as a subcluster of SAR11-D.
Remarkably, the clones obtained from the same site, but
at deeper waters, clustered with the other Antarctic group
SAR11-A. Regarding this group of sequences, an 8-bp
insertion that corresponds to a loop at positions 1447–
1454 (Escherichia coli numbering) was present in only
nine clones: all five SAR11-A21 clones, M3-050-10 and
M7-400-2 (both in SAR11-D), and the outgroup clones
M2-025-5 and M3-005-1. This insertion, with the consensus CCTTCGGG, is found also in E. coli and other
Proteobacteria, indicating that it is probably an ancestral
trait in the Proteobacteria, still preserved in the most
divergent clusters of the SAR11 group, but lost in most
of its members, probably as a derived character produced
during their differentiation. The majority of changes found
over the 16S rDNA section were compensatory, not altering the secondary structure of the 16S rRNA, and therefore
it is not likely that they were the result of PCR errors.
When the comparison was carried out using the ITS,
the results were confirmed to a remarkable degree (Fig. 2).
Of the clusters described above, all the clones grouped by
the 16S rDNA appeared to be grouped by the alignable
positions in the ITS. The only exceptions were M6-005-1
and M2-025-3, which appeared as outgroups in the 16S
rDNA tree but clustered with the S1 group by the ITS,
and M7-400-5, which appeared within S1 by 16S rDNA
and by the ITS clusters within the S2 group. M2-025-5 and
M3-005-1 were still kept apart as outgroups from the
rest of clones in the tree. The Antarctic cluster SAR11-A
stood out much more sharply from the main body of
sequences from the surface Mediterranean samples.
The deep Mediterranean cluster, SAR11-D, appeared also
as a coherent group representing a rather consistent
operational taxonomic unit (OTU). A similar situation was
found in the Antarctic group SAR11-A21 of superficial
clones described above. The alignment presented in Fig. 3
shows some of the most divergent ITS found for the
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935–948
SAR11 cluster (two representatives from each group),
M3-005-1 and M2-025-5 excluded. They all contained
tRNA genes for isoleucine (Ile) and alanine (Ala), a common feature of Gram-negative bacteria in general and
Proteobacteria in particular (Gürtler & Stanisich 1996).
The ITS was widely variable, as expected in a sequence
stretch that is variable often within the limits of a welldefined species (Antón et al. 1998). Mean variation for 16S
was 4.43 ± 3.15%, with a maximum of 12.33%, and for the
ITS, there was a mean variation of 11.75 ± 6.43%, maximum 24.74%. These data are consistent with a group of
entity equivalent to a genus or family, as found for cultured α-Proteobacteria such as acetobacteria (4.01 ± 1.56%
for the 16S rDNA and 29.5 ± 9.55% for the ITS in seven
species from genera Acetobacter and Gluconobacter,
micro-organisms that also contain spacers with tRNA
genes for Ile and Ala exclusively; Sievers et al. 1994, 1996;
Kishimoto et al. 1995; J. Trcek and M. Teuber, unpublished)
or the Rhizobiaceae (2.91 ± 2.03% for the 16S from two
species of Agrobacterium and 2.28 ± 1.19 for the 16S in
several strains from three Rhizobium spp.; Otten & De
Ruffray 1996; Sawada et al. 1993; Yanagi & Yamasato
1993; Otten et al. 1996; van Berkum et al. 1996; 1998). The
data found for SAR11 remain also within the ranges
found for the Enterobacteriaceae (9.8% mean variation
for the ITS of Salmonella enterica and 2.6% for E. coli; Luz
et al. 1998). The most conserved regions were those close
to the rRNA genes, a region of ≈ 20 nucleotides located
upstream of the tRNA-Ile and an alleged box complex
located midway between the tRNA-Ala and the 5′ end
of the 23S rRNA gene, as predicted by analysis of the
potential secondary structure (Fig. 3). The size of the
SAR11 spacer is conserved, varying only between 389
and 425 bp. Within the Enterobacteriaceae the range of
size variation is much higher, even considering only the
spacers that have genes for tRNA-Ile and tRNA-Ala
(García-Martínez et al. 1996, 1999; Antón et al. 1998).
The aligned sections of the spacer regions do not
include insertions and deletions, which are frequent and
significant in the evolution of spacers (Antón et al. 1998).
Therefore, some organisms that appear to have identical
sequences in Fig. 2 only do so throughout the aligned sections. Given the complexity of the variation at this level in
the SAR11 spacers sequenced, these data are not fully
shown. Instead, pairwise mean similarity values from those
sequences, identical under a complete-deletion analysis
(mega), have also been indicated in Fig. 2.
Marine Archaea of Group I
Forty-eight clones (at least three from each sampling
point) of marine Archaea Group I (crenarchaeote) were
sequenced from approximately the same set of samples.
With an average size of ≈ 800 bp per clone, the resulting
MEC953.fm Page 940 Thursday, June 1, 2000 1:55 PM
940 J . G A R C Í A - M A RT Í N E Z and F. R O D R Í G U E Z - VA L E R A
Fig. 2 Neighbour-joining tree of the internal transcribed spacer (ITS) region of the SAR11 group, using the p-distance estimation
(complete-deletion parameter), with bootstrap values above 50% indicated. The resulting clusters are shown at the right of the figure.
Mean similarity values of pairwise comparisons for ‘identical’, and some similar, sequences, as shown in the tree, are also presented at
the right, revealing more discriminating relationships among the clones.
body of sequences for this phylogenetic group summed
up to 38.4 kb. In this case, no amplicon could be obtained
from some samples, particularly from superficial waters
(a common occurrence for Archaea; Murray et al. 1998),
and alternative stations were used (Table 1). Although
our oligonucleotides may also amplify some cultured
euryarchaeota, no such clones could be retrieved, indicating
that they are far less common than marine crenarchaeota,
as pointed out by other authors (DeLong et al. 1994;
Bintrim et al. 1997; Fuhrman & Davis 1997; MacGregor
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935 – 948
MEC953.fm Page 941 Thursday, June 1, 2000 1:55 PM
M I C R O D I V E R S I T Y O F U N C U LT U R E D M A R I N E P R O K A RY O T E S 941
Fig. 3 Alignment of representative internal
transcribed spacer (ITS) sequences of the
SAR11 clones used in this study. Dots
indicate identity of sequence with the
first clone. Dashes are gaps. The tRNA
stretches are represented as solid boxes.
The putative boxA regions are underlined. Contiguous putative boxB regions
are shadowed.
et al. 1997; Massana et al. 1998), and restricted to particular
habitats (Van der Maarel et al. 1998). As listed in Table 2,
an internal 16S rDNA primer was used to sequence the
crenarchaeal clones in order to yield a 600-nucleotide
fragment from this gene, which was estimated to be more
than sufficient for phylogenetic analyses in the region
(Schmidt et al. 1991). The 23S and ITS regions contributed
to the total size of the amplicon with 54 bp and some
135 bp each. blast searches of the 16S sequences obtained
for this group confirmed that all were related to the marine
Archaea Group I. The results from comparing the clones
are remarkably reminiscent of those found for SAR11. For
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935–948
the 16S region, most of the clones retrieved from superficial
waters clustered in a large group (Crena-S1) in the upper
part of the dendrogram (Fig. 4) together with a set of
clones described by other authors, obtained from
North Atlantic waters (M. Mullarkey et al., unpublished).
Although almost all clones came from the Mediterranean,
two (B-015-1 and B-015-2) were Atlantic, and there were
also clones from Antarctic waters, all with a high degree
of similarity and the majority almost identical. An Antarctic
group, Crena-A, closely associated with Crena-S1, was
also evident, with the inclusion of one clone from the
Mediterranean (M3-050-6). The two sequences available
MEC953.fm Page 942 Thursday, June 1, 2000 1:55 PM
942 J . G A R C Í A - M A RT Í N E Z and F. R O D R Í G U E Z - VA L E R A
Fig. 4 Phylogenetic tree of the partial 16S sequences (600 bp) of the marine crenarchaeota as inferred by neighbour-joining analysis, with
distances estimated using the Jukes-Cantor parameters. Bootstrap values above 50% are included. The different clusters are indicated at
the right of the figure. Reference sequences are in bold. Shorter reference sequences (< 600 bp) are placed near their assigned clusters.
Pyrodictium occultum was used as the outgroup.
of Cenarchaeum symbiosum, a symbiont of a sponge from
temperate Pacific waters (Preston et al. 1996), were somewhat
related to these groups. The second cluster, which included
reference sequence 4B7 (Stein et al. 1996) (Crena-S2), contained clones predominantly from surface waters, except
M3-150-4 and M7-400-2. Finally, the last cluster (Crena-D)
came exclusively from deep samples. Sequence analysis
of the ITS tended to confirm the same groupings (Fig. 5).
The only changes were two sequences from the Antarctic
sites, A1-010-4 and A2-200-1, that in the 16S rDNA tree
appeared in the S1 group cluster here with the Antarctic
group A; and sequence M7-400-1 that appeared in the D
(deep) group by the 16S rDNA and in the S1 group by the
ITS. In contrast to SAR11, no tRNA gene could be detected
in the ITS, a feature common in cultured and uncultured
crenarchaea (Achenbach-Richter & Woese 1988; Gürtler &
Stanisich 1996), and the length of the ITS was only 135
nucleotides. As expected, the 16S rDNA and ITS of the
marine crenarchaea were much less variable than in the
case of SAR11. The 16S rDNA had a mean variation of
3.83 ± 2.97% and a maximum of 8.51%; the mean values
for the spacer were 14.2 ± 5.25%. It should be noted that the
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935 – 948
MEC953.fm Page 943 Thursday, June 1, 2000 1:55 PM
M I C R O D I V E R S I T Y O F U N C U LT U R E D M A R I N E P R O K A RY O T E S 943
Fig. 5 Phylogenetic relationships of the internal transcribed spacer (ITS) region of the marine crenarchaeota, with Sulfolobus solfataricus as
the outgroup. The p-distances (complete-deletion parameter) were used to build a neighbour-joining tree, with bootstrap values greater
than 50% shown for the main nodes. Clusters are indicated at the right of the figure. Reference sequences and numbers indicating the
presence of characteristic deletions (see Fig. 6) are in bold.
slightly lower variation values for SAR11 than for marine
crenarchaeota at the ITS level were a result of the presence
of the highly conserved tRNA genes in their sequence
(Fig. 3). When the tRNAs were removed from the analysis,
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935–948
the ITS of the SAR11 sequences studied here showed a
mean variation of 17.13 ± 9.58%. There is little information
regarding the range of variation of 16S rDNA or the ITS in
Archaea and even less so in Crenarchaea (in fact, ours might
MEC953.fm Page 944 Thursday, June 1, 2000 1:55 PM
944 J . G A R C Í A - M A RT Í N E Z and F. R O D R Í G U E Z - VA L E R A
Fig. 6 Clustal alignment of representative internal transcribed spacer (ITS)
sequence clones of the marine Archaea
of Group I obtained in this work, plus
some reference sequences. Dots indicate
sequence identity and dashes are gaps.
Putative boxB regions are shadowed.
Potential boxA regions are underlined.
*Numbered insertion/deletion areas of
widespread occurrence among the clones.
be the first systematic attempt to do so). Nevertheless, the
ranges of variation found for these sequences are consistent
with a closely related set of organisms, probably belonging
to a single species or to closely related species.
The insertions and deletions present within the ITS
region in the sequences of the marine Crenarchaea (much
less frequent in size and number than in SAR11) are indicated as numbers in Figs 5 and 6. It is apparent that they
also follow a pattern consistent with the clusters demarcated
by the aligned sequence. Outgroup strains such as M7400-3 and C. symbiosum have intermediate combinations.
In this phylotype, the existence of identical ITS sequences
is much more extensive and some occur in clones from
vastly distant samples such as M1-005-1 (Mediterranean),
B-015-1 (Atlantic) and A-010-2 (Antarctic).
Discussion
The two phylotypes studied here are known only by
sequencing of clones obtained directly by PCR amplification of environmental samples, which may be viewed as a
limitation. However, as the viability of marine bacteria in
culture is often poor, this type of study is justified. Both
SAR11 and marine crenarchaeota of Group I form coherent
clusters, as the analysis of two of their ribosomal regions
indicate. As pointed out, the greater variability in the ITS
region might be useful for better discrimination of closely
related clones (while maintaining the same clone associations) than the 16S gene. Some regions, such as the boxA–
boxB complex, might even be useful targets for specific
probes (Figs 3 and 6). The well-conserved boxA seems a
good candidate for phylotype-specific oligonucleotide
probes, whereas the adjacent, more variable, boxB could
be used for finer (‘ecotype-specific’) discriminations. On
the other hand, sequencing of a sufficient number of clones
allowed us to unveil interesting aspects, even in the 16S
gene. In this respect, the lack of an 8-bp stem–loop in a
particular position of its molecule for the large majority
of the SAR11 clones reinforces their uniqueness and
coherence compared with other groups of Proteobacteria,
as the absence of this (probably) ancient trait could have
occurred during their differentiation as a taxon. It is
precisely in some clones of SAR11-D and in all of SAR11A21 subclusters, the two that show most divergence,
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935 – 948
MEC953.fm Page 945 Thursday, June 1, 2000 1:55 PM
M I C R O D I V E R S I T Y O F U N C U LT U R E D M A R I N E P R O K A RY O T E S 945
where this character still remains. Regarding the amount
of diversity contained within each of these two globally
widespread phylotypes, the results show two quite
different situations. The SAR11 α-Proteobacteria corresponds
to what might be a genus, or even a family, with a
considerable degree of intracluster variation. On the other
hand, the marine crenarchaeota, including C. symbiosum,
show a remarkably low range of sequence variation, even
when considering sequences retrieved by different authors,
and from different locations and environmental conditions
(see below). Although there are no fixed rules regarding the level of variation expected for different taxons
in bacteria (or Archaea) (Fox et al. 1992; Stackebrandt &
Goebel 1994), and even less so for different ecotypes
(Palys et al. 1997; Fuhrman & Campbell 1998; Moore et al.
1998), the data indicate that in both phylotypes there are a
number of ecotypes, associated particularly with different
water depths. One of the most remarkable results found
is the discovery in the two groups of prokaryotes studied
here, SAR11 and the marine Archaea of Group I, although
there is no relationship whatsoever between them, of clusters
of sequences present in superficial waters regardless of
the ocean basin and climatic conditions. In both cases, the
diversity of these superficial clusters is in the expected
range of a highly homogeneous species, and they probably
have similar ecological features (ecotypes). For both
phylotypes, the Antarctica representatives are clustered
together and may reveal a subspecies or OTU with an
optimum lower temperature. However, differences between
them are smaller than between SAR11-S2 and SAR11-D
(Fig. 3), or Crena-S2 and Crena-D (Fig. 4), reflecting that
geography or temperature (the minimum temperature
throughout the water column in the Mediterranean is
rarely below 13 °C, while in the Antarctic would not rise
over 1 or 2 °C) may not be the main factor influencing the
differentiation of marine prokaryotes (although it can still
be noticeable). Groups S2 are smaller in terms of number
of clones but, in contrast, their diversity is greater than in
S1 and A (for both SAR11 and Crena). The same principle
would apply to the equally high diversity found in groups
D. It might even be worthwhile speculating whether this
model could be exported to related, but different, habitats.
Having both SAR11 and marine Archaea Group I close,
but separated, relatives in freshwater lakes distributed
around the world (MacGregor et al. 1997; Ovreas et al.
1997; Zwart et al. 1998) raises the question of whether
their population structures will follow similar patterns.
Indeed, because this design is consistently found for both
SAR11 and the marine crenarchaeote, two unrelated
groups of micro-organisms (α-Proteobacteria and Archaea),
this might be a rather common feature for other groups of
prokaryotes. It is also noteworthy that although some
clones retrieved from deepwater samples clustered in
superficial groups (for example M7-400-5 and M3-450-4 in
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935–948
SAR11 or M7-400-5 and M3-150-2 in the marine Archaea
Group I; Fig. 4) the reverse does not occur, probably
reflecting the relative isolation of deep waters, i.e.
superficial organisms are sometimes found in deep water
but deep ecotypes are not found at the surface. Another
interesting issue to be taken into account when dealing
with ribosomal environmental sequences is operon heterogeneity (Pukall et al. 1999), providing an alternative (or
complementary) explanation for the diversity found in the
ITS region. We know that there is indeed such genomic
microheterogeneity in Cenarchaeum symbiosum (Schleper
et al. 1998), with a 9.8% difference between the two operons,
while 16S sequences only account for 0.5%. Were this the
case for the free-living crenarchaeote, this might partly
explain the differences between S1 and S2 groups, as
well as the considerable heterogeneity found within D group
and some of the clone relocations when considering any
one of the two regions. However, some of the greatest
differences found between some clones, much higher
than within any known species, cannot be supported by
only using this model. As per the SAR11 cluster, the differences in sequence observed in Fig. 2 for several ITS
with almost identical alignable regions showed the usefulness of this marker for unveiling this microdiversity.
Very little is known in regard to the biogeography of
free-living bacteria. We know the geographical distribution and specialization to ecological niches of many plant
and animal species and this knowledge has been one of the
keystones of modern evolutionary synthesis, as indeed
was in the very roots of Darwin’s thought (Darwin 1964).
The epidemiology of some pathogenic bacteria shows a
global distribution of some clones (Selander et al. 1987)
while others present strong geographical association (Wong
et al. 1998). However, in pathogenic or saprophytic bacteria,
the host geographical distribution and the mode of transmission among hosts are critical in this respect. For freeliving bacteria it is generally considered that owing to the
ease of transport of microscopic organisms among different
locations, geographical barriers are nonexistent or negligible, as illustrated by the Baas-Becking axiom: ‘Everything
is everywhere but the environment selects’ (Staley & Gosink
1999). However, this view has recently been challenged.
For example, ice bacteria from the North and South poles
seem to be sufficiently different to be assigned to different species, although their habitat (selective pressure)
is virtually identical. Along these lines, our finding of
almost identical sequences of ITS, a highly variable region,
in vastly distant locations seems to favour the view of
extremely ineffective geographical barriers. One example
is the almost identical spacer sequences found for the
marine Crenarchaea, represented by the fosmid 4B7 obtained
from a sample from the eastern North Pacific, with one
of our clones from the Mediterranean and another from
the Gulf of Biscay (Fig. 5). The presence of identical
MEC953.fm Page 946 Thursday, June 1, 2000 1:55 PM
946 J . G A R C Í A - M A RT Í N E Z and F. R O D R Í G U E Z - VA L E R A
spacers can be considered as a strong indication of very
close relationships, i.e. a common ancestor within less
than a few hundred generations, and reinforces the view
of prokaryotic ecotypes of global distribution. On the
other hand, the geographical element does not seem to be
irrelevant. Most of the clusters of clones with identical
spacers come from exactly the same geographical location, including different samples from the Mediterranean
that have very similar environmental conditions. Also,
the existence of the cluster of sequences SAR11-A21
seems to represent an endemism of the sampling site A2,
although the conditions at this site cannot be very different from those at the A1 site, and many other sequences
are present at both sampling sites. As others authors
have pointed out (Staley & Gosink 1999), much more
work must be conducted along these lines prior to
assessing the significance of geographical barriers in the
evolution of free-living micro-organisms.
Acknowledgements
This work was supported by a European Commission Grant
MAS3-CT-97-0154, UMH.DCET.DM.B, MIDAS project. We are
grateful to Dr Ramón Massana for kindly providing many of the
DNA samples used in the study and to Stuart Ingham for technical assistance in graphics. Manuel Mata carried out part of the
sequencing work.
References
Achenbach-Richter L, Woese CR (1988) The ribosomal gene spacer
region in Archaebacteria. Systematic and Applied Microbiology,
10, 211– 214.
Acinas SG, Rodriguez-Valera F, Pedrós-Alió C (1997) Spatial and
temporal variation in marine bacterioplankton diversity as
shown by RFLP fingerprinting of PCR amplified 16S rDNA.
FEMS Microbiology Ecology, 24, 27 –40.
Acinas SG, Antón J, Rodríguez-Valera F (1999) Diversity of freeliving and attached bacteria in offshore Western Mediterranean
waters as depicted by analysis of genes encoding 16S rDNA.
Applied and Environmental Microbiology, 65, 514 – 522.
Altschul SF, Madden TL, Schäffer AA et al. (1997) Gapped blast
and psi-blast: a new generation of protein database search
programs. Nucleic Acids Research, 25, 3389–3402.
Antón AI, Martínez-Murcia AJ, Rodríguez-Valera F (1998) Sequence
diversity in the 16S –23S intergenic spacer region (ISR) of the
rRNA operons in representatives of the Escherichia coli ECOR
collection. Journal of Molecular Evolution, 47, 62 – 72.
van Berkum P, Beyene D, Eardly BD (1996) Phylogenetic relationships among Rhizobium species nodulating the common bean
(Phaseolus vulgaris.). International Journal of Systematic Bacteriology,
46, 240 – 244.
van Berkum P, Beyene D, Bao G, Campbell AT, Eardly BD (1998)
Rhizobium mongolense sp. nov., is one of three rhizobial genotypes identified which nodulate and form nitrogen-fixing
symbioses with Medicago ruthenica. International Journal of
Systematic Bacteriology, 48, 13 – 22.
Bintrim SB, Donohue TJ, Handelsman J, Roberts GP, Goodman RM (1997) Molecular phylogeny of Archaea from soil.
Proceedings of the Natural Academy of Sciences of the USA, 94,
277–282.
Borneman J, Triplett EW (1997) Molecular microbial diversity in soils
from Eastern Amazonia: evidence for unusual microorganisms
and microbial population shifts associated with deforestation.
Applied and Environmental Microbiology, 63, 2647–2653.
Darwin C (1964) On the Origin of Species. Harvard University
Press, Cambridge, Massachusetts.
DeLong EF, Wu KY, Prézelin BB, Jovine RV (1994) High abundance of Archaea in Antarctic marine picoplankton. Nature, 371,
695–697.
Field KG, Gordon D, Wright T et al. (1997) Diversity and depthspecific distribution of SAR11 cluster rRNA genes from marine
planktonic bacteria. Applied and Environmental Microbiology, 63,
63–70.
Fox GE, Wisotzkey JD, Jurtshuk P Jr (1992) How close is close:
16S rRNA sequence identity may not be sufficient to guarantee
species identity. International Journal of Systematic Bacteriology,
42, 166–170.
Fuhrman JA, Davis AA (1997) Widespread Archaea and novel
bacteria from the deep sea as shown by rRNA gene sequences.
Marine Ecology Progress Series, 150, 275 – 285.
Fuhrman JA, Campbell L (1998) Microbial microdiversity.
Nature, 393, 410–411.
Fuhrman JA, Ouverney CC (1998) Marine microbial diversity
studied via 16S rRNA sequences: cloning results from coastal
waters and counting of native archaea with fluorescent single
cell probes. Aquatic Ecology, 32, 3–15.
Fuhrman JA, Comeau DE, Hagström A, Chan AM (1988) Extraction from natural planktonic microorganisms of DNA suitable
for molecular biological studies. Applied and Environmental
Microbiology, 54, 1426–1429.
Fuhrman JA, McCallum K, Davis AA (1992) Novel major archaebacterial group from marine plankton. Nature, 356, 148 –149.
García-Martinez J, Martínez-Murcia AJ, Rodriguez-Valera F,
Zorraquino A (1996) Molecular evidence supporting the existence
of two major groups in uropathogenic Escherichia coli. FEMS
Immunology and Medical Microbiology, 14, 231– 244.
García-Martínez J, Acinas SG, Antón AI, Rodríguez-Valera F (1999)
Use of the 16S–23S ribosomal genes spacer region in studies of prokaryotic diversity. Journal of Microbiological Methods, 36, 55 –64.
Giovannoni SJ, Britschgi TB, Moyer CL, Field KG (1990) Genetic
diversity in Sargasso Sea bacterioplankton. Nature, 345, 60 – 63.
Gürtler V, Stanisich VA (1996) New approaches to typing and
identification of bacteria using the 16S– 23S rDNA spacer
region. Microbiology, 142, 3–16.
Kaine BP, Schurke C, Stetter KO (1989) Genes for the 16S and 5S
ribosomal RNAs and the 7S RNA of Pyrodictium occultum.
Systematic and Applied Microbiology, 12, 8 –14.
Kishimoto N, Kosako Y, Wakao N, Tano T, Hiraishi A (1995)
Transfer of Acidiphilium facilis and Acidiphilium aminolytica
to the genus Acidocella gen. nov. and emendation of the genus
Acidiphilium. Systematic and Applied Microbiology, 18, 85 – 91.
Kurosawa N, Ohkura K, Horiuchi T, Itoh YH (1995) Characterization of the 16S ribosomal RNA genes and phylogenetic relationships of sulfur-dependent thermoacidophilic archaebacteria.
Journal of General and Applied Microbiology, 41, 75 – 81.
Leffers H, Kjems J, Ostergaard L, Larsen N, Garret RA (1987)
Evolutionary relationships among Archaebacteria. A comparative study of 23S rRNAs of a sulphur-dependent thermophile,
an extreme halophile and a thermophilic methanogen. Journal
of Molecular Biology, 195, 43–61.
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935 – 948
MEC953.fm Page 947 Thursday, June 1, 2000 1:55 PM
M I C R O D I V E R S I T Y O F U N C U LT U R E D M A R I N E P R O K A RY O T E S 947
Lowe T, Eddy SR (1997) trnascan-se: a program for improved
detection of transfer RNA genes in genomic sequence. Nucleic
Acids Research, 25, 955 – 964.
Ludwig W, Roselló-Mora R, Aznar R et al. (1995) Comparative
sequence analysis of 23S rRNA from Proteobacteria. Systematic
and Applied Microbiology, 18, 164 –188.
Luz SP, Rodriguez-Valera F, Lan R, Reeves PR (1998) Variation of
the ribosomal operon 16S–23S gene spacer region in representatives of Salmonella enterica subspecies. Journal of Bacteriology,
180, 2144– 2151.
MacGregor BJ, Moser DP, Alm EW, Nealson KH, Stahl DA
(1997) Crenarchaeota in Lake Michigan sediment. Applied and
Environmental Microbiology, 63, 1178 –1181.
Massana R, Murray AE, Preston CM, DeLong EF (1997) Vertical
distribution and phylogenetic characterization of marine
planktonic Archaea in the Santa Barbara channel. Applied and
Environmental Microbiology, 63, 50 – 56.
Massana R, Taylor LT, Murray AE et al. (1998) Vertical distribution and temporal variation of marine planktonic Archaea in
the Gerlache strait, Antarctica, during early spring. Limnology
and Oceanography, 43, 607– 617.
Mathews DH, Sabina J, Zuker M, Turner DH (1999) Expanded
sequence dependence of thermodynamic parameters improves
prediction of RNA secondary structure. Journal of Molecular
Biology, 288, 911– 940.
Medlin LK, Lange M, Barker GL, Hayes PK (1995) Can molecular techniques change our ideas about the species concept?
In: Molecular Ecology of Aquatic Microbes (ed. Joint I), Vol. G 38,
pp. 133–152. Springer-Verlag, Berlin Heidelbert.
Moore LR, Rocap G, Chisholm SW (1998) Physiology and
molecular phylogeny of coexisting Prochlorococcus ecotypes.
Nature, 393, 464.
Murray AE, Preston CM, Massana R et al. (1998) Seasonal and
spatial variability of bacterial and archaeal assemblages in the
coastal waters near Anvers island, Antarctica. Applied and
Environmental Microbiology, 64, 2585 – 2595.
Normand P, Ponsonnet C, Nesme X, Neyra M, Simonet P (1996)
ITS analysis of prokaryotes. In: Molecular Microbial Ecology
Manual (eds Akkermans ADL, Elsas JDV, Bruijn FD), Vol. 3.4.5,
pp. 1–12. Kluwer Academic Publishers, the Netherlands.
Otten L, De Ruffray P (1996) Major differences between the
rRNA operons of two strains of Agrobacterium vitis. Archives of
Microbiology, 166, 68 –70.
Otten L, De Ruffray P, Lajudie P, Michot B (1996) Sequence and
characterisation of a ribosomal RNA operon from Agrobacterium
vitis. Molecular and General Genetics, 251, 99–107.
Ovreas L, Forney L, Daae FL, Torsvik V (1997) Distribution of
bacterioplankton in meromictic Lake Saelenvannet, as determined by denaturing gradient gel electrophoresis of PCRamplified gene fragments coding for 16S rRNA. Applied and
Environmental Microbiology, 63, 3367– 3373.
Pace NR (1997) A molecular view of microbial diversity and the
biosphere. Science, 276, 734 – 740.
Palys T, Nakamura LK, Cohan FM (1997) Discovery and classification of ecological diversity in the bacterial world: the role of DNA
sequence data. International Journal of Systematic Bacteriology,
47, 1145 –1156.
Preston CM, Wu KY, Molinski TF, DeLong EF (1996) A psychrophilic crenarchaeon inhabits a marine sponge: Cenarchaeum
symbiosum gen. nov., sp. nov. Proceedings of the National Academy
of Sciences of the USA, 93, 6241– 6246.
Pukall R, Buntfeuss D, Fruhling A et al. (1999) Sulfitobacter
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935–948
mediterraneus sp. November, a new sulfite-oxidizing member
of the alpha-proteobacteria. International Journal of Systematic
Bacteriology, 49, 513–519.
Roth A, Fischer M, Hamid ME et al. (1998) Differentiation of
phylogenetically related slowly growing mycobacteria based
on 16S –23S rRNA gene internal transcribed spacer sequences.
Journal of Clinical Microbiology, 36, 139–147.
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: a
Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York.
Sawada H, Ieki H, Oyaizu H, Matsumoto S (1993) Proposal for
rejection of Agrobacterium tumefaciens and revised descriptions
for the genus Agrobacterium and for Agrobacterium radiobacter
and Agrobacterium rhizogenes. International Journal of Systematic
Bacteriology, 43, 694–702.
Schleper C, DeLong EF, Preston CM et al. (1998) Genomic analysis
reveals chromosomal variation in natural populations of
the uncultured psycrophilic archaeon Cenarchaeum symbiosum.
Journal of Bacteriology, 180, 5003–5009.
Schmidt TM, DeLong EF, Pace NR (1991) Analysis of a marine
picoplankton community by 16S rRNA gene cloning and
sequencing. Journal of Bacteriology, 173, 4371– 4378.
Selander RK, Cougant DA, Whittam TS (1987) Genetic structure
and variation in natural populations of Escherichia coli. In:
Escherichia Coli and Salmonella Typhimurium. Cellular and Molecular
Biology (eds Neidhardt F, Ingraham J, Brooks LK, Magasanik B,
Schaechter M, Umbarger H), pp. 1625 –1648. American Society
for Microbiology, Washington, DC.
Sievers M, Ludwig W, Teuber M (1994) Phylogenetic positioning
of Acetobacter, Gluconobacter, Rhodopila and Acidiphilium species
as a branch of acidophilic bacteria in the alpha-subclass of Proteobacteria based on 16S ribosomal DNA sequences. Systematic
and Applied Microbiology, 17, 189–196.
Sievers M, Alonso L, Gianotti S, Boesch C, Teuber M (1996) 16S–
23S ribosomal RNA spacer regions of Acetobacter europaeus
and A. xylinum, tRNA genes and antitermination sequences.
FEMS Microbiology Letters, 142, 43–48.
Stackebrandt E, Goebel BM (1994) Taxonomic note: a place for
DNA–DNA reassociation and 16S rDNA sequence analysis
in the present species definition in bacteriology. International
Journal of Systematic Bacteriology, 44, 846 – 849.
Staley JT (1999) Bacterial biodiversity: a time for place. ASM News,
65, 681–687.
Staley JT, Gosink JJ (1999) Poles apart: biodiversity and biogeography of sea ice bacteria. Annual Reviews of Microbiology, 53,
189–215.
Stein JL, Simon ML (1996) Archaeal ubiquity. Proceedings of the
Natural Academy of Sciences of the USA, 93, 6228 – 6230.
Stein JL, Marsh TL, Wu KY, Shizuya H, DeLong EF (1996)
Characterization of uncultivated prokaryotes: isolation and
analysis of a 40-kilobase-pair genome fragment from a planktonic marine archaeon. Journal of Bacteriology, 178, 591– 599.
Van der Maarel MJ, Artz RR, Haanstra R, Forney LJ (1998) Association of marine archaea with the digestive tracts of two
marine fish species. Applied and Environmental Microbiology, 64,
2894–2898.
Vinuesa P, Rademaker JLW, Bruijn FJD, Werner D (1998) Genotypic characterization of Bradyrhizobium strains nodulating
endemic woody legumes of the Canary Islands by PCRrestriction fragment length polymorphism analysis of genes
encoding 16S rRNA (16S rDNA) and 16S– 23S rDNA intergenic spacers, repetitive extragenic palindromic PCR genomic
MEC953.fm Page 948 Thursday, June 1, 2000 1:55 PM
948 J . G A R C Í A - M A RT Í N E Z and F. R O D R Í G U E Z - VA L E R A
fingerprinting, and partial 16S rDNA sequencing. Applied and
Environmental Microbiology, 64, 2096–2104.
Wong BC, Ching CK, Lam SK et al. (1998) Differential north to
south gastric cancer-duodenal ulcer gradient in China. China
ulcer study group. Journal of Gastroenterology and Hepatology,
13, 1050 –1057.
Yanagi M, Yamasato K (1993) Phylogenetic analysis of the family
Rhizobiaceae and related bacteria by sequencing of 16S rRNA
gene using PCR and DNA sequencer. FEMS Microbiology Letters,
107, 115 –120.
Zwart G, Hiorns WD, Methé BA et al. (1998) Nearly identical 16S
rRNA sequences recovered from lakes in North America and
Europe indicate the existence of clades of globally distributed
freshwater bacteria. Systematic and Applied Microbiology, 21,
546 – 556.
We are interested in exploring bacterial biodiversity in natural
environments, specifically aquatic marine environments such as
the sea, coastal lagoons and hypersaline environments derived
from the evaporation of seawater. The use of molecular identity
markers allows us to establish relationships among bacterial
cells with certainty and rapidity. Furthermore, PCR techniques
permit the description of bacterial diversity in a given sample
without pure culture, and probably with very little bias. We
are particularly interested in using new techniques to retrieve,
in culture, new organisms with potential in biotechnology. We
have funding from the European Union, through its Environment
and Marine Science and Technology (MAST) programmes, to work
along these lines.
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 935 – 948