From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
IMMUNOBIOLOGY
Living T9 glioma cells expressing membrane macrophage colony-stimulating
factor produce immediate tumor destruction by polymorphonuclear leukocytes
and macrophages via a “paraptosis”-induced pathway that promotes systemic
immunity against intracranial T9 gliomas
Yijun Chen, Thomas Douglass, Edward W. B. Jeffes, Qingcheng Xu, Christopher C. Williams, Neary Arpajirakul, Christina Delgado,
Michael Kleinman, Ramon Sanchez, Qinghong Dan, Ronald C. Kim, H. Terry Wepsic, and Martin R. Jadus
Cloned T9-C2 glioma cells transfected with
membrane macrophage colony-stimulating
factor (mM-CSF) never formed subcutaneous tumors when implanted into Fischer
rats, whereas control T9 cells did. The T9-C2
cells were completely killed within 1 day
through a mechanism that resembled paraptosis. Vacuolization of the T9-C2 cell’s mitochondria and endoplasmic reticulum started
within 4 hours after implantation. By 24
hours, the dead tumor cells were swollen
and terminal deoxynucleotide transferasemediated dUTP nick-end labeling (TUNEL)–
positive. Bcl2-transduced T9-C2 cells failed
to form tumors in rats. Both T9 and T9-C2
cells produced cytokine-induced neutrophil
chemoattractant that recruited the granulocytes into the tumor injection sites, where
they interacted with the tumor cells. Freshly
isolated macrophages killed the T9-C2 cells
in vitro by a mechanism independent of
phagocytosis. Nude athymic rats treated
with antiasialo GM1 antibody formed T9-C2
tumors, whereas rats treated with a natural
killer cell (NK)–specific antibody failed to
form tumors. When treated with antipolymorphonuclear leukocyte (anti-PMN) and antimacrophage antibodies, 80% of nude rats
formed tumors, whereas only 40% of the
rats developed a tumor when a single antibody was used. This suggests that both
PMNs and macrophages are involved in the
killing of T9-C2 tumor cells. Immunocompetent rats that rejected the living T9-C2 cells
were immune to the intracranial rechallenge
with T9 cells. No vaccinating effect occurred
if the T9-C2 cells were freeze-thawed,
x-irradiated, or treated with mitomycin-C
prior to injection. Optimal tumor immunization using mM-CSF–transduced T9 cells requires viable tumor cells. In this study optimal tumor immunization occurred when a
strong inflammatory response at the injection of the tumor cells was induced. (Blood.
2002;100:1373-1380)
© 2002 by The American Society of Hematology
Introduction
In some tumor models the way tumor cells die, either by apoptosis or
necrosis, provides a critical dichotomy that determines whether or not
the induction of lasting tumor immunity occurs. When tumor cells are
killed via apoptosis by the use of ultraviolet light, chemotherapy, or
x-irradiation, the immune response is not stimulated, despite a massive
release of tumor-derived material. Several groups have shown that
macrophages or dendritic cells that phagocytize apoptotic cells increase
their synthesis of antiinflammatory cytokines such as prostaglandin E
(PGE), transforming growth factor–␤ (TGF-␤), platelet activating factor
(PAF), or interleukin (IL) 10,1-3 or there is a down-regulation of the
expression of costimulatory molecules.4 This results in the induction of
immune tolerance or anergy toward the tumor. In contrast, when
antigen-presenting cells (APCs) are stimulated with necrotic tumor cells
or tumor cells expressing heat shock proteins, there is lasting antitumor
immunity.5 APCs activated by necrotic cells are more effective,6,7
express more costimulatory molecules,2 and produce more inflammatory cytokines.3 Macrophages stimulated with necrotic cells display
better antitumor activities than those stimulated by apoptotic cells.8
A third way that cells die, called paraptosis, has been reported.9
Paraptosis is a form of programmed cell death that does not involve
DNA fragmentation and traditional apoptotic body formation. This
killing resists various caspase inhibitors and bcl-xL treatment, which
distinguishes it from apoptosis. Paraptotic death is characterized by
cytoplasmic vacuolization, which begins with progressive swelling of
the mitochondria and endoplasmic reticulum. Little is known of the
evolution of this process in vivo and nothing is known of the manner in
which this form of cell death affects the immune system.
Our previous in vitro studies showed that bone marrow–derived
macrophages directly kill living malignant T9 glioma cells (T9-C2)
transduced with the membrane form of macrophage colonystimulating factor (mM-CSF) via direct phagocytosis.10,11 This
macrophage-mediated process is independent of the Fas–Fas ligand
pathway, because macrophages that do not express Fas ligand also
kill these cells in vitro.12 T9 cells expressing the secreted form of
macrophage colony stimulating factor (sM-CSF) are not killed in
vitro. When mM-CSF–transfected T9 cells are injected either
subcutaneously or intracranially they are rejected, while the
sM-CSF–transduced cells form tumors.13 Rats that spontaneously
reject mM-CSF also generate lasting immunity in the form of
CD3⫹ T cells. The mM-CSF–transfected cells therefore lead
From the Diagnostic and Molecular Health Care Group and the Dermatology
Service, Veterans Affairs Medical Center, Long Beach, CA; the Pathology
Department, the Department of Community and Environmental Medicine, and
the Department of Dermatology, University of California, Irvine; and the
Biological Sciences Department, California State University, Long Beach.
the University of California at Irvine Cancer Research Program; and the Chiron
Corporation, Emeryville, CA.
Submitted January 24, 2002; accepted April 4, 2002. Prepublished online as
Blood First Edition Paper, July 5, 2002; DOI 10.1182/2002-01-0174.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
Supported in part by grants from the Veterans Affairs Medical Center; the
National Institutes of Health (grant CA77802 R01); the Avon Foundation, via
BLOOD, 15 AUGUST 2002 䡠 VOLUME 100, NUMBER 4
Reprints: Martin R. Jadus, Box 113, Diagnostic and Molecular Health Care
Group, Veterans Affairs Medical Center, 5901 E 7th St, Long Beach, CA 90822;
e-mail: [email protected] or [email protected].
© 2002 by The American Society of Hematology
1373
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1374
BLOOD, 15 AUGUST 2002 䡠 VOLUME 100, NUMBER 4
CHEN et al
to both spontaneous destruction of the vaccinating tumor and
the development of lasting tumor immunity. The T9 glioma cell
line, also called 9L,14 is one of the most widely used gliomas
in experimental neuro-oncology. T9 glioma cells are considered
an immunogenic glioma cell line.15,16 We have obtained similar
results using either weakly immunogenic rat MADB106 breast
cancer17 or nonimmunogenic mouse Hepa1-6 hepatomas18 transduced with mM-CSF. Both of these nongliomatous tumors are
rejected in vivo and immunize the animals against their parental
tumor. These results with 3 different tumor cells show that cloned
mM-CSF–transfected tumor cells can successfully stimulate a
strong immune response.
Large numbers of the mM-CSF–transfected T9-C2 cells (eg, 107
cells) can be injected subcutaneously into rats without forming tumors.13
Even though cloned mM-CSF–transfected MADB106 and Hepa1-6
tumors express amounts of mM-CSF as T9-C2 tumor cells, we did
occasionally (10% of the time) observe that these 2 tumors did grow.
These observations suggest that some unique properties of the mM-CSF–
transduced T9 glioma cells allow them to be rejected rapidly without
forming tumors, while other such cells can sometimes form tumors even
when smaller numbers are injected.
In this report, we show that the rat T9 glioma cells expressing
mM-CSF do have some intrinsic properties that make them more
susceptible to in vivo rejection, and this perhaps contributes to
making these cells more immunogenic. These observations may
have important ramifications for developing better tumor vaccines.
First, the T9 tumors make cytokine-induced neutrophil chemoattractant (CINC, the rat IL-8 equivalent) that allows polymorphonuclear
leukocytes (PMNs) to be recruited into the freshly implanted
tumor. This influx of PMNs helps macrophages establish a
microenvironment in which the T9-C2 tumor is destroyed, leading
to the development of anti-T9 immunity. Second, the combined
effects of PMNs and macrophages destroy the T9-C2 cells within a
single day in vivo, via a swelling and vacuolization process that
resembles paraptosis. Third, intact living T9-C2 cells are required
to induce immunization, because x-irradiation, mitomycin-C, or
freeze-thawing prior to injection does not vaccinate against the
tumor cells. Thus, the development of tumor immunity requires
active interaction between the tumor and the immune system.
Materials and methods
Cell lines and cell culture
The derivation of the mM-CSF–transduced T9-C2 and sM-CSF–transduced
T9-H1 cells has been previously described.10 The cells were grown in
RPMI-1640 media supplemented with 5% fetal bovine serum (Gemini
Bioproducts, Calabassas, CA). All culture supplies were screened and
selected on the basis of being endotoxin-free. All cells were routinely
determined to be mycoplasma-free with the aid of the Stratagene (San
Diego, CA) polymerase chain reaction (PCR) detection kit.
Reverse transcriptase–PCR
Total RNA was isolated with Tri-Reagent (Sigma Chemical, St Louis, MO)
from tumor cells that had been refed 4 hours earlier. The rat CINC primers
5⬘CTCCAGCCACACTCCAACAGA3⬘ and 5⬘CACCCTAACACAAAACACGAT3⬘ and ␤-actin primers were synthesized by MWG Biotech (High
Point, NC). One microgram of total RNA was incubated with the primers
and incubated in the Life Technologies (Grand Island, NY) One Step
RT-PCR mix. The PCR was performed with a Techne Progene (Princeton,
NJ) Thermal Cycler according to the methods described by Mawet et al.19
After the 20 cycles were completed, the PCR products were electrophoresed on a 2% agarose gel. The gel was visualized and the PCR products
were confirmed to be the correct size (670 base pairs) for CINC and for
␤-actin (764 base pairs).
Intracellular flow cytometry staining of CINC-producing cells
CINC-positive cells were identified by previously described methods.20 The cells
were fixed in 4% paraformaldehyde/phosphate-buffered saline (PBS) solution,
washed, and permeabilized in 0.1% saponin/PBS solution for 1 hour at room
temperature. The antibodies (rabbit antirat CINC antibody [Assays Designs, Ann
Arbor, MI] or a control rabbit serum) were added. The cells were washed twice
with PBS, followed by the application of a fluorescein isothiocyanate (FITC)–
labeled antirabbit antibody (Vector Labs, Burlingame, CA) in permeabilization
buffer. Data from 104 cells were collected on an EPICS Profile flow cytometer
(Beckman-Coulter, Miami, FL) and analyzed with the Phoenix Flow Systems
(San Diego, CA) Multi2D program.
Animals
Female Fischer-344 (F344) rats were obtained from Charles River (Wilmington, MA). Nude athymic rats were purchased from Harlan Sprague Dawley
(Indianapolis, IN).
Tumor growth in animals
The rats were injected subcutaneously on the ventral side with the tumor
cells in a volume of 50 ␮L. Palpable tumors were measured with metric
calipers for length, width, and height. Tumor volume was calculated as
height ⫻ width ⫻ length ⫻ ␲/6. The data are expressed as mean tumor
volume ⫾ SEM.
Adoptive transfer studies
Rats that had been immunized subcutaneously with 3 ⫻ 105 T9-C2 cells 2
weeks earlier were killed and their spleens were removed. The splenocytes
(one spleen equivalent) were injected intraperitoneally into naive rats that
were intracranially implanted with 104 T9 cells.
In vivo leukocyte depletion
Nude athymic rats were used for these experiments. Natural killer (NK)
cells were depleted with either antiasialo GM1 antibody (Wako Biochemicals, Richmond, VA) or an NK cell–specific monoclonal ascites antibody
generously provided by Dr William Chambers (University of Pittsburgh,
Pittsburgh, PA). The 100-g rats were injected 4 times intraperitoneally with
50 ␮L of the antiasialo GM1 antibody or 12.5 ␮L of the anti-NK antibody
over a 2-week period. This procedure eliminated more than 95% of NK
activity against the NK-sensitive YAC cells in a 6-hour 51Cr release–based
cytotoxicity assay. Granulocytes and macrophages were eliminated with
polyclonal rabbit antirat PMN or antirat macrophage antiserum (Accurate
Scientific and Chemical, Westbury, NY). Preliminary tests using these
antibodies confirmed that the circulating levels of granulocytes and
macrophages were markedly reduced by 4 intraperitoneal injections with
their respective antibodies over a 7-day period.
Differences in tumor growth were determined by one-tailed Fisher exact
test, and analysis of variance was used to analyze the data at each time point
(P ⬍ .05 was considered significant).
Bcl2 transduction of T9-C2 cells
To prevent the T9-C2 cells from dying of apoptosis, we transduced the
antiapoptotic gene, bcl2, into the T9-C2 cells. The retroviral transfection of the
bcl2 gene into T9-C2 cells was achieved with a retroviral construct, AM12-bcl2,5
generously supplied by Dr Richard Vile (Mayo Clinic, Minneapolis, MN). After
the transfection, the cells were selected in 5 ␮g/mL of puromycin. Cells were
tested immunohistochemically to ensure that they were expressing the bcl2
transgene by using an anti-bcl2 antibody (Santa Cruz Antibodies, Santa Cruz,
CA). These cotransduced cells also proved to be resistant to apoptosis-inducing
drugs such as staurosporine and camptothecin.
Immunohistology
Tumor tissue was excised from the killed animals and sectioned in a
cryostat as previously described.14 The various antirat primary antibodies
were obtained from Pharmingen (San Diego, CA); these included CD4,
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 AUGUST 2002 䡠 VOLUME 100, NUMBER 4
IMMUNITY AGAINST GLIOMAS INDUCED BY MEMBRANE M-CSF
1375
CD8, NKRP-1, HIS48 (granulocytes), 1C7 (mononuclear phagocytespecific), and antidendritic cell antibodies. The rabbit anti-iNOS antibody
was purchased from Affinity BioReagents (Golden, CO). The rabbit
anti–heat shock protein-70 antibody was obtained from Chemicon International (Temecula, CA). Rabbit anti-bcl2 antibody was obtained from Santa
Cruz Antibodies (Santa Cruz, CA). Biotinylated goat antiprimary antibody
(Pharmingen) and Strept-avidin conjugated peroxidase (DAKO, Carpinteria, CA) were also used.
TUNEL staining
The terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) was performed with Promega’s Death-End Colorimetric
Apoptosis Detection kit (Madison, WI) according to the manufacturer’s
instructions.
Figure 1. Fisher 344 rats will reject the mM-CSF bearing T9-C2 cells. Tumor cells,
T9 parental, T9 viral vector, and T9-C2 (2 ⫻ 105) were injected subcutaneously and
monitored for the next 3 weeks. An asterisk indicates that the P value between the
rats injected with the T9-C2 cells and the other rats treated with the T9 cells was less
than or equal to .01.
Electron microscopic studies
Tissues taken at 2, 4, and 20 hours after injection were fixed for 1 to 2 hours
with 2.5% glutaraldehyde at pH 7.3 in either 0.1 M Sorensen phosphate
buffer or 0.1 M sodium cacodylate buffer. The tissues were then rinsed,
postfixed for 1 hour in 1% OsO4, and rinsed again. Following dehydration
with cold ethanol and subsequent transfer to propylene oxide, the tissues
were infiltrated with Spurr resin over a period of 36 hours. Sections were
stained with uranyl acetate and lead citrate and then observed with a
JEOL-1200EX II transmission electron microscope (Peabody, MA).
Freshly isolated macrophages and PMNs
Macrophages were collected from the rats that had been injected with 2 mL of a
sterile 3% thioglycolate solution 3 days earlier. The animals were killed and the
peritoneum was washed out. Alveolar macrophages were obtained by standard
lavage techniques.21 Endotoxin-free PBS was used throughout all the procedures.
By flow cytometry, these macrophage preparations were more than 92% Ox-41,
Ed1, and CD18, consistent with a macrophage phenotype.
Cytotoxicity studies
Macrophage-mediated cytotoxicity studies were carried out according to
methods previously described.14,15 Cytotoxicity data from triplicate cultures
at each effector cell:tumor cell ratio are presented as specific killing ⫾ SD.
Values were considered significantly different if P was less than .05.
Results
Several types of leukocytes are present within the
subcutaneous T9-C2 rejection site
When 2 ⫻ 105 T9-C2 cells were injected subcutaneously into the
syngeneic F344 rats, they did not form tumors, while the viral
vector T9 and parental T9 cells consistently formed tumors in all
rats (Figure 1). This experiment confirms previous work showing
that T9-C2 cells never grow at subcutaneous sites, even when
concentrations as high as 107 cells are used.13 Over the last 5 years
in our facility, none of the Fischer rats (n ⬎ 200) injected with
living T9-C2 cells have ever developed a subcutaneous tumor.
Three days after subcutaneous injection of viable T9-C2 cells,
only eosinophilic tumor cell remnants were seen histologically. In
contrast, the corresponding T9 and T9–viral vector cells were
relatively easy to find after 3 days, because these cells were actively
growing. We therefore examined the histology at earlier time points
to determine the kinetics of the mM-CSF–transfected tumor
destruction. Within 20 hours of injection, numerous mature polymorphonuclear cells (PMNs) and macrophagelike cells were seen
in close proximity to the tumor cells. Tumor cells were observed
dying as individual cells and were not actively phagocytized by
macrophages. PMNs were also seen with the T9 gliomas, but never
to the same extent as was seen with the T9-C2 tumors.
Immunohistology confirmed that granulocytes were present
within the leukocytic infiltrate. Figure 2A shows numerous HIS48⫹
stained granulocytes. Immunohistochemical analysis revealed that
1C7⫹ staining macrophages also infiltrated the T9-C2 tumor cells
(data not shown). The PMNs and macrophages were present in
greater quantities (25%-50%) in the T9-C2 tumors in the T9 tumor
(data not shown). A few NK cells were observed within the T9-C2
cell mass, but they were more commonly seen along the margins.
Dendritic cells were present only in scattered regions at a low
density. Immunostaining labeled the inducible form of nitric oxide
synthase (iNOS) in some leukocytes (Figure 2B). Staining of the
tissue with the antinitrotyrosine antibody revealed that the dead
T9-C2 cells were heavily stained, suggesting that these cells
interacted with peroxynitrite (Figure 2C). T9-C2 cells were also
stained with a HSP-70 antibody (Figure 2D). The expression of the
last 3 antibodies was 10% to 25% greater than that found in
association with T9 cells implanted under identical conditions.
T9 and T9-C2 cells produce CINC, the rat IL-8 equivalent, which
recruits PMNs
The neutrophil infiltrate within both the T9 and the T9-C2 tumors
suggested that a soluble mediator attracted the granulocytes to the
tumor injection site. Our previous work (C.D., M.R.J., unpublished
data, May 2001) failed to detect any colony-stimulating factor (eg,
granulocyte (G)-CSF or granulocyte-macrophage (GM)-CSF) made
by T9 or T9-C2 cells in vitro that could account for the presence of
the granulocytes in vivo. This prompted us to examine possible
chemokines, because human gliomas22 and rat C6 gliomas23
produce IL-8 and the rodent IL-8 equivalent known as CINC,
respectively. By RT-PCR, both T9 and T9-C2 cells produced
CINC-specific mRNA (Figure 3). To confirm the RT-PCR data, we
stained permeabilized T9 and T9-C2 cells with anti-CINC antibody. Nonpermeabilized tumor cells failed to stain (Figure 4A,B),
whereas permeabilized cells displayed positive fluorescence (Figure 4C,D). This finding is consistent with CINC’s secretory
properties. Both the T9 and T9-C2 cells possessed the same amount
of intracellular CINC, as quantitated by identical mean peak
channel numbers.
Electron microscopy reveals that the T9-C2 cells are killed
through a pathway that resembles paraptosis
Two hours after subcutaneous injection of tumor cells, PMNs and
monocytes were found within blood vessels immediately adjacent
to the tumor. At this time these leukocytes were beginning to
invaginate through the endothelial cells lining the venule but were
not infiltrating the tumor cells. The tumor cells appeared healthy
and viable (data not shown).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1376
CHEN et al
BLOOD, 15 AUGUST 2002 䡠 VOLUME 100, NUMBER 4
Figure 2. Immunohistology of the T9-C2 injection site in a subcutaneous site. Five million T9-C2 cells were injected in a subcutaneous site for 20 hours. The T9-C2 cells
were excised and frozen sections were prepared. (A) Cells stained for granulocytes; (B) cells stained for iNOS; (C) cells stained with antinitrotyrosine; (D) cells stained for
anti–HSP-70. All micrograms are ⫻ 200.
By 4 hours, many PMNs physically contacted the tumor cells.
In regions where there was a high density of PMNs, the tumor cells
were usually dying. We estimate that 50% to 75% of the T9-C2
cells were either dead or dying. T9-C2 cells immediately adjacent
to the granulocytes and macrophages showed morphologic changes.
Frequently, there appeared to be a lowered content of primary
granules within the PMNs adjacent to the tumor cells. Tumor cells
displayed swelling and vacuolization, with distention of the
mitochondria and the endoplasmic reticulum (ER). Figure 5A
shows a central granulocyte physically adjacent to 3 tumor cells in
various stages of cell death. Tumor cell A is swollen and nonviable,
with numerous vacuoles. Tumor cell B is also in the process of
dying but shows less severe cellular pathology than cell A. Tumor
cell C is just beginning to show signs of pathology; at higher
magnification many clathrin-coated pits are visible immediately
adjacent to the granulocyte (Figure 5B). Such a response was often
observed in viable tumor cells that were in contact with PMNs and
macrophages. An increase in the number of clathrin-coated pits was
seen only in cells that had not begun to swell. This observation
suggests pinocytosis by tumor cells of something being released by
myeloid cells. Both tumor cells and granulocytes showed swelling
of mitochondria. Similar results were noted in some of the control
Figure 3. T9 and T9-C2 cells produce CINC (IL-8) mRNA as detected by RT/ PCR.
The T9 and T9-C2 cells were refed with fresh tissue culture media and after 4 hours’
incubation the total RNA was isolated. One microgram of total RNA was incubated
with the CINC primers and was amplified.
T9 tumor cells, except that the damage done to the T9 cells was
never as severe or complete.
By 20 hours, all the T9-C2 cells were dead, swollen, and
vacuolated, with rare membrane blebbing (zeiosis). The T9-C2
cells seldom possessed nuclear crescents, fragments, or the heavy
condensation of nuclear chromatin that is characteristic of apoptotic cells. These dead tumor cells rarely formed smaller apoptotic
bodies. The electron micrographs suggest that the process of tumor
cell death most closely resembled paraptosis9 rather than apoptosis
or necrosis (data not shown).
Killed T9-C2 cells were TUNEL-positive at 20 hours
We performed a TUNEL assay to determine whether DNA
fragmentation had occurred within these dead T9-C2 tumor cells.
Figure 4. Intracellular flow cytometry of T9 and T9-C2 cells making CINC (IL-8).
One million T9 and T9-C2 cells were allowed to react with the anti–IL-8 antibody or
isotypic control antibody. Nonpermeabilized cells are shown in panels A (T9) and B
(T9-C2) and permeabilized cells in panels C (T9) and D (T9-C2). Ten thousand cells
were analyzed on the flow cytometer.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 AUGUST 2002 䡠 VOLUME 100, NUMBER 4
IMMUNITY AGAINST GLIOMAS INDUCED BY MEMBRANE M-CSF
1377
Figure 5. Electron micrographs examined of the T9-C2 cells after 4 hours’ subcutaneous implantation. Five million T9-C2 cells were injected in a subcutaneous site
for 4 hours. Panel A shows 3 tumor cells, labeled A, B, and C, in various stages of swelling and death. Panel B shows a higher magnification of the central granulocyte and cell
C. The arrows indicate clathrin-coated pits in cell C. Panels stained with uranyl acetate and osmium tetroxide. Original magnifications: Panel A, ⫻ 3100; Panel B, ⫻ 12 500.
The T9 cells failed to show any TUNEL staining (data not shown),
whereas the T9-C2 injection site exhibited strong brown staining
localized to the cell nucleus (not shown). No TUNEL staining was
observed in T9-C2 cells sampled 4 hours after injection, when
morphologic changes were documented by electron microscopy.
Bcl2-transduced T9-C2 cells also fail to form tumors in vivo
Disruption of mitochondria liberates cytochrome-c, which activates the
effector caspases that translocate into the nucleus, where DNA cleavage
occurs and initiates apoptosis. To study whether or not the presence of
bcl2 could prevent apoptosis and thereby inhibit the killing of cells by
the PMNs and macrophages, we transduced T9-C2 cells retrovirally
with the bcl2 gene and then selected for optimal bcl2 expression. The
bcl2-transduced cells showed growth rates and mM-CSF levels identical
to those of the original T9-C2 cells. When these cells were injected into
rats, these tumor cells failed to grow even after 3 months. Thus, this
work eliminates the possibility that the killing process requires an
apoptosis-dependent pathway.
Freshly isolated macrophages can kill the T9-C2 cells
The immunohistology and electron microscopy findings suggested
that the mechanism of killing of the T9-C2 cells in vivo was
different from the mechanism in previous studies done with bone
marrow–derived macrophages, where direct phagocytosis of living
T9-C2 cells occurred.10,11 To reconcile the differences between
these in vivo and in vitro assays, we used freshly isolated
macrophages, which we speculated might have different killing
properties than bone marrow–derived macrophages. Thioglycolateelicited peritoneal macrophages and alveolar macrophages both
specifically killed the mM-CSF–transduced T9-C2 cells but not the
parental T9 or the secreted M-CSF–producing T9-H1 cloned cells
(Table 1). Upon visual inspection of the macrophage-tumor cultures after 24 hours’ incubation, it appeared that the tumor cells
were not disappearing as we had previously seen with bone
marrow–derived macrophages. Instead, numerous dead unattached
cells were floating in the tissue culture media.
Thioglycolate-elicited macrophages cultured with the T9-C2
cells produced a respiratory burst, as detected by the luminol
technique. This respiratory burst occurred within 30 minutes, and it
was about 10% the strength of the burst produced by phorbol
myristate acetate (PMA)–stimulated macrophages. No respiratory
burst occurred when the macrophages were cultured with the T9
cells. Thus, freshly isolated macrophages are specifically able to kill the
mM-CSF–transduced cells via reactive oxygen intermediates.
T9-C2 cells can grow in nude athymic rats only when certain
leukocyte subsets are depleted
To prove which cell types are responsible for mM-CSF tumor
destruction in vivo, we used athymic nude rats depleted of their
various leukocyte subsets. When antiasialo GM1 antibody was
used, 7 of 8 antiasialo GM1–treated rats formed T9-C2 tumors
(Figure 6A), while only 1 of 8 nude rats treated with normal rabbit
serum formed a tumor. Starting at day 20, these 2 groups of animals
were statistically significant (P ⬍.05) . This experiment shows that
the T9-C2 cells can grow in vivo under the right conditions. The
data also indicate that some leukocytes were actively inhibiting the
growth of the T9-C2 cells in rats.
When the normal rabbit serum–treated control athymic rats that
rejected the T9-C2 cells were rechallenged with the parental T9 gliomas,
all the rats developed subcutaneous T9 tumors (Figure 6B). Therefore,
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1378
BLOOD, 15 AUGUST 2002 䡠 VOLUME 100, NUMBER 4
CHEN et al
Table 1. Freshly isolated rat peritoneal and alveolar macrophages kill mMCSF-transfected T9-C2 cells but not T9 or T9-H1 (sM-CSF)-transfected cells
Specific release, %, ⫾ SD
Macrophage:T9 ratio
T9 parental
cells
sM-CSF T9-H1 clone mM-CSF T9-C2
Peritoneal macrophages
10:1
10 ⫾ 0
Not tested
32 ⫾ 0*
5:1
6⫾0
Not tested
22 ⫾ 1*
2.5:1
5⫾0
Not tested
18 ⫾ 0*
10:1
8⫾1
2⫾1
23 ⫾ 5*
5:1
5⫾0
1⫾2
21 ⫾ 6*
2.5:1
4⫾2
0⫾1
16 ⫾ 0*
Alveolar macrophages
Freshly isolated rat macrophages were added to the T9, T9-H1, and T9-C2 target
cells and the assay was harvested after 24 hours.
*These values were significantly different (P ⬍ .05) from the results of the T9
tumor cell killing.
there is no inherent immune memory response generated against the T9
glioma in athymic rats that reject T9-C2 cells.
Besides being able to bind NK cells, the antiasialo GM1 antibody
can bind to granulocytes, activated T cells, and activated macrophages.24-27 Thus, it was possible that the antiasialo GM1 antibody may
have depleted the nude rat’s NK cells, PMNs, and macrophages and
therefore allowed the T9-C2 cells to grow. We next used more restricted
antibodies against NK cells, granulocytes, and macrophages specifically
to deplete these leukocytes. None of the rats treated with a control
antibody or with the anti-NK antibody formed a T9-C2 tumor after 45
days (Table 2). Of the rats treated with either anti-PMN or antimacrophage antibodies, 2 (40%) of the 5 in each group formed T9-C2 tumors.
Of the nude rats that simultaneously received both the anti-PMN and
antimacrophage antibodies, 80% formed T9-C2 tumors. By Fisher exact
test, these results were significantly different from the results for the
normal rabbit serum–treated rats (P ⫽ .015). This work demonstrates
that both macrophages and granulocytes are required to kill the T9-C2
cells in vivo.
Immunocompetent rats that reject the living
mM-CSF–transfected T9-C2 tumor cells resist an intracranial
rechallenge with parental tumor T9 cells
Fully immunocompetent F344 rats that rejected the subcutaneous
T9-C2 cells were intracranially rechallenged with the parental T9
tumor cells to assess the immunization status of the rats. Seventyone percent of the immunized rats rejected the intracranial tumor
(Figure 7A), while none of the control rats implanted with the same
inoculum of T9 cells survived. Adoptive transfer of the splenocytes
from rats that were immunized subcutaneously with the T9-C2
cells protected 70% of the naive rats against a lethal intracranial
challenge of the T9 tumor. If rats had been immunized 2 weeks
earlier with 3 ⫻ 105 T9-C2 cells that were x-irradiated, mitomycinC–treated, or freeze-thawed, no protective immunity was generated
(Figure 7B). Thus, living mM-CSF expressing T9-C2 cells that are
killed via paraptosis by the innate immune system generates
protective immunity against an intracranial glioma.
Discussion
Our previous in vitro studies showed that bone marrow–derived
macrophages directly killed living malignant T9 glioma cells
(T9-C2) transduced with mM-CSF, but not sM-CSF, via direct
phagocytosis.10,11 Preliminary in vivo studies confirmed the results
of the in vitro work.13 Not only were these mM-CSF–transfected
T9 cells prevented from growing in vivo, both subcutaneously and
intracranially, but the rats generated lasting immunity in the form of
CD3⫹ T cells against the parental T9 gliomas.13 The use of
mM-CSF–transfected cells therefore led to both spontaneous
destruction of the vaccinating tumor and the development of lasting
tumor immunity. We have seen similar results when weakly
immunogenic rat MADB106 breast cancer or nonimmunogenic
mouse Hepa1-6 hepatomas were used. This work showed that
mM-CSF–transfected tumor cells can be used successfully to
stimulate an immune response against a variety of cancer cells.
One distinguishing feature of our tumor models is that PMNs
heavily infiltrated the T9-C2 tumor cells within 1 day. Previously,
we had not seen these inflammatory cells, because we failed to look
at earlier times.13 Their presence within both T9 and T9-C2 tumors
results from the production of CINC (Figures 7 and 8), the rat IL-8
equivalent, a chemokine that attracts both PMNs and T cells.28
Lejeune et al29 have reported that CINC possesses antitumor
properties against rat colon cancer, but it was not directly associated with PMN cytotoxicity in vivo. PMNs can kill some tumor
cells through the release of several mediators, such as reactive
oxygen species, defensins, or other soluble factors.30,31 Peripheral
blood PMNs did not kill the T9 or T9-C2 cells, so the precise
antitumor properties that the PMNs have in the T9 tumor model are
still unknown. Graf et al32 reported that PMNs helped reject
subcutaneously injected IL-6–transduced T9 cells in situ through
an unknown mechanism. PMNs have the ability to attract various T
Table 2. Treatment of nude athymic rats with antigranulocyte and
antimacrophage antibodies allows some T9-C2 tumors to grow
Treatment
Figure 6. mM-CSF–transfected T9-C2 cells will grow in nude athymic rats
previously treated with antiasialo GM1 antibody. Rats (8 per group) were injected
with either the antiasialo GM1 antibody or normal rabbit serum (NRS) 4 times, 2
weeks prior to subcutaneous injection with 2 ⫻ 105 T9-C2 cells on day 0. Tumors
were measured for the next 27 days (panel A). Panel B shows the growth of 2 ⫻ 105
T9 cells within all the NRS-treated rats that rejected the T9-C2 cells.
No. with tumors/total no. of rats
injected (% with tumors)
Normal rabbit serum
0/6 (0)
Anti-NK antibody
0/5 (0)
Anti-PMN antibody
2/5 (40)*
Antimacrophage antibody
2/5 (40)*
Anti-PMN and antimacrophage
4/5 (80)†
The rats were injected 5 times over a 10-day period. Two injections occurred
following subcutaneous injection of 105 T9-C2 cells. After 30 days, the presence or
absence of T9-C2 tumors was noted.
*The result was not significantly different (by Fisher exact test) from the results for
rats injected with normal rabbit serum (P ⫽ .182).
†The result was significantly different (by Fisher exact test) from the results for
rats injected with normal rabbit serum (P ⫽ .015) or anti-NK antibody (P ⫽ .048).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 AUGUST 2002 䡠 VOLUME 100, NUMBER 4
IMMUNITY AGAINST GLIOMAS INDUCED BY MEMBRANE M-CSF
cells and dendritic cells via the release of defensins.33 PMNs also
act as antigen-presenting cells to preactivated T cells.34 Thus,
PMNs can produce a Th1 T cell immune response against some
tumors and intracellular bacteria.35,36 These findings may help to
explain why T9 cells are considered to be immunogenic.
Macrophages were seen among the dead T9-C2 cells after 18
hours, because mM-CSF was made by the T9-C2 cells. The
histology of the T9-C2 tumor cells revealed that macrophages were
not killing the tumor cells via phagocytosis. Soluble cytotoxic
factors released by the macrophages include reactive oxygen
intermediates, nitric oxide (NO) or peroxynitrite. We saw that
freshly isolated peritoneal macrophages produced a respiratory
burst when cultured with T9-C2 cells but not with T9 cells.
Immunohistology revealed more iNOS staining in response to the
T9-C2 cells. The antinitrotyrosine antibody staining indicated that
peroxynitrite was generated. Xia and Zweier37 showed that iNOS
catalyzes the production of NO when high concentrations of
arginine are present, but with low concentrations of arginine, iNOS
forms both NO and superoxide molecules. When the superoxide
anions combine with NO, it forms peroxynitrite, which becomes
more toxic than NO.38
The end result of the coordinated attack by the PMNs and
macrophages is that the T9-C2 cells died through a pathway that
resembled paraptosis.9 Here the tumor cell mitochondria began to
swell and form vacuoles. These organelles resembled megamitochondria, previously described in several cells responding to
various free radicals, including reactive oxygen intermediates and
hydrogen peroxide.39,40 Eventually, the entire tumor cell becomes
swollen, as evidenced by the loss of ground substance by electron
microscopy. Some cells had condensed chromatin, but the dying
cells rarely formed nuclear crescents or exhibited membrane
blebbing. After 20 hours, but not after 4 hours, the cells displayed a
TUNEL-positive phenotype. Positive TUNEL staining has been
considered to be evidence of apoptosis, although nonapoptotic
pathways can result in a positive TUNEL stain and DNA fragmen-
tation does not necessarily equal apoptosis.41,42 To eliminate the
possibility that the mM-CSF-transduced cells were dying of
apoptosis, we cotransduced the T9-C2 cells with the anti–apoptosisinducing gene, bcl2. Bcl2-cotransfected T9-C2 cells were still
prevented from growing in the skin. It is possible to stimulate
apoptosis via a bcl2-independent pathway via Fas-Fas ligand and
tumor necrosis factor (TNF) binding via tumor necrosis factor–
related apoptosis-inducing ligand (TRAIL). We have shown in
unpublished studies that T9 cells are Fas and Fas ligand–negative
by flow cytometry and that recombinant TNF will not kill the T9
cells in vitro. This macrophage-mediated process is independent of
the Fas–Fas ligand pathway, because macrophages that do not
express Fas ligand also kill these cells in vitro.12 Thus, we have
eliminated this non–bcl2-related apoptosis route.
Once the T9-C2 cells were killed in the immunocompetent F344
rats, the rats resisted lethal intracranial challenge by the T9 cells.
Adoptive transfer of the immunized splenocytes also protected the
naive rats against a lethal intracranial challenge. This work shows
that protective cellular immunity was generated and that immunized splenocytes protected naive rats against the T9 tumor. If the
rats were vaccinated with x-irradiated, mitomycin-C–treated, or
freeze-thawed T9-C2 cells 2 weeks prior to intracranial challenge,
no protective immunity was generated. Therefore, something
within the treated T9-C2 cell has changed, making these cells less
immunogenic. Mitomycin-C cross-links DNA, preventing the
DNA from separating during DNA replication. X-irradiation induces DNA damage, culminating in apoptosis. Freeze-thawing
immediately killed the tumor cells. These treatments probably
modified the T9-C2 cells, rendering them incapable of making
either mRNA or protein and preventing any intracellular responses
by the T9-C2 cells. We speculate that living mM-CSF–transduced
cells must be injected into the animal to induce the PMN and
macrophage responses that generate the intracellular signals necessary to generate the optimal immunization conditions. By electron
microscopy, we saw that the T9-C2 cells responded to the
granulocytes and macrophages by forming clathrin-coated pits,
suggesting that the living tumor cells are reacting to some
leukocyte-derived product. This tumor response is consistent with
the hypothesis that paraptosis is also a type of programmed cell
destruction that requires intracellular signaling and that leads
toward vacuolization of the killed tumor cell.9
The mechanism of killing of mM-CSF–transduced tumor cells
is extremely important for therapeutic purposes. In a recent study,20
we have seen that rats immunized with T9-C2 cells also produce
immunity against other syngeneic gliomas, such as RT2 and F98.
We believe that the best clinical use of mM-CSF would be as an
allogeneic transfected tumor vaccine. After the tumor has been
surgically resected and radiation has been given, when the tumor
burden is at its least, would be the best time to be vaccinated. A
subcutaneous injection would be the best strategy, because it allows
the immune system to be fully exposed to the tumor antigens. By
the time an autologous tumor was established, transfected, and
cloned, the primary tumor would have recurred and any immunotherapy would be useless. We have seen a similar phenomenon
when we injected a mM-CSF–transduced human MG-U251 glioma
into either nude or NIH-bg-nu-xid mice. The viral vector tumor
cells grew as subcutaneous tumors, while 3 ⫻ 106 cloned mM-CSF–
transfected cells failed to form tumors in all immunodeficient mice
(Y.C. et al, manuscript in preparation). Additionally, human
monocytes specifically killed the mM-CSF–transfected cells in
vitro. If our hypothesis that paraptosis occurs is correct, then this
killing process should lead toward tumor immunity. Thus methods
that lead toward tumor cell killing by paraptosis should be
Figure 7. Rats that spontaneously reject mM-CSF T9-C2 cells are immune to
intracranial T9 gliomas. Rats were immunized for 2 weeks with 3⫻105 living T9-C2
cells and then implanted with 104 T9 cells intracranially (A). Data are also shown from
rats that were immunized with living T9-C2 cells for 2 weeks, after which they were
killed. Splenocytes were then removed and adoptively transferred into naive rats that
were implanted with 104 T9 cells intracranially. (B) Rats were injected with 3⫻105
T9-C2 cells that were untreated (n ⫽ 20), x-irradiated with 10G (n ⫽ 7), treated with
mitomycin-C (n ⫽ 6), or killed by freeze-thawing (n ⫽ 9). As a comparison, T9 cells
treated with mitomycin-C were injected into 9 rats. After 2 weeks, the various
immunized rats were implanted with 104 T9 cells intracranially. The rats that had been
immunized with the living T9-C2 cells were significantly different (P ⬍ .001) from all
other groups.
1379
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1380
BLOOD, 15 AUGUST 2002 䡠 VOLUME 100, NUMBER 4
CHEN et al
investigated and used. Not only will the tumor be killed, but the
killing process could lead to conditions that generate stronger
immunity against the tumor.
Acknowledgments
We appreciate Dr Maria DaCosta-Iyer’s helpful suggestions of
ways to improve the immunohistochemical staining. We thank
Sundra Crooms and Lynn Carmon (Diagnostic and Molecular
Medicine, Histology Section) for their help in cutting the various
histology samples. We thank Walt Thill (Medical Media, Veterans
Affairs Medical Center, Long Beach, CA) for his help with
photography. We also thank Dr Michael Selsted (Department of
Pathology, University of California, Irvine) for his helpful discussions regarding neutrophils and the antitumor properties of defensins. We also deeply appreciate the help of Ms Terri Bondy, who
proofread our paper.
References
1. Fadok VA, Bratton DL, Konowaal A, Freed PW,
Westcott JY, Henson PM. Macrophages that have
ingested apoptotic cells in vitro inhibit proinflammatory cytokine production through autocrine/
paracrine mechanisms involving TGF-beta,
PGE2, and PAF. J Clin Invest. 1998;101:890-898.
2. Barker RN, Erwig L, Pearce WP, Devine A, Rees
AJ. Differential effects of necrotic or apoptotic cell
uptake on antigen presentation by macrophages.
Pathobiology. 1999;67:302-305.
3. Voll RE, Herrmann M, Roth EA, Stach C, Kalden
JR. Immunosuppressive effects of apoptotic cells.
Nature. 1997;390:350-351.
4. Gallucci S, Lolkema M, Matzinger P. Natural adjuvants: endogenous activators of dendritic cells.
Nature Med. 1999;5:1249-1255.
5. Melcher A, Todryk S, Hardwick N, Ford M, Jacobson M, Vile RG. Tumor immunogenicity is determined by the mechanism of cell death via induction of heat shock protein expression. Nat Med.
1998;4:581-587.
able genes does not require drug selection. Proc
Natl Acad Sci U S A. 1994;91:8185-8189.
monoclonal antibody. J Immunol. 1991;147:21962201.
16. Barba D, Hardin J, Sadelain M, Gage FH. Development of anti-tumor immunity following thymidine kinase-mediated killing of experimental brain
tumors. Proc Natl Acad Sci U S A. 1994;91:43484352.
29. Lejeune P, Reisser D, Onier N, Lagadec P, Lindley I, Jeannin JF. Interleukin-8 has antitumor effects in the rat which are not associated with polymorphonuclear leukocyte cytotoxicity. Cancer
Immunol Immunother. 1994;38:167-170.
17. Williams CC, Trinh H, Tran TV, et al. Membrane
expression of macrophage colonystimulating factor on MADB106 breast cancer cells is not associated with in vitro cytotoxicity by macrophages
but is associated with the induction lasting tumor
immunity against syngeneic breast cancer cells in
vivo. Mol Ther. 2001;3:216-224.
30. Di Carlo E, Forni G, Lollini P, Colombo MP, Modesti A, Musianni P. The intriguing role of polymorphonuclear neutrophils in antitumor reactions.
Blood. 2001;97:339-345.
18. Dan Q, Sanchez R, Delgado C, et al. Non-immunogenic murine hepatocellular carcinoma
Hepa1–6 cells expressing the membrane form of
macrophage colony stimulating factor are rejected in vivo and lead to CD8⫹ T-cell immunity
against the parental tumor. Mol Ther. 2001;
4:427-437.
31. Fossati G, Ricevuti G, Edwards SW, Walker C,
Dalton A, Rossi ML. Neutrophil infiltration into human gliomas. Acta Neuropathol. 1999;98:349354.
32. Graf MR, Prins RM, Merchant RE. IL-6 secretion
by a rat T9 glioma clone induces a neutrophildependent antitumor response with resultant cellular, antiglioma immunity. J Immunol. 2001;166:
121-129.
19. Mawet E, Shiratori Y, Hibiba Y, et al. Cytokineinduced neutrophil chemoattractant release from
hepatocytes is modulated by Kupffer cells. Hepatol. 1996;23:353-358.
33. Yang D, Chen Q, Chertov O, Oppenheim JJ. Human neutrophil defensins selectively chemoattract naive T and immature dendritic cells. J Leukoc Biol. 2000;68:9-14.
20. Sanchez R, Williams CC, Daza JL, et al. T9
glioma cancer cells expressing membrane macrophage colony stimulating factor produce CD4⫹
associated protective immunization against different syngeneic glioma cells. Cellular Immunol. In
press.
34. Radsak M, Iking-Konert C, Stegmaier S, Andrassy K, Hansch GM. Polymorphonuclear neutrophils as accessory cells for T-cell activation:
major histocompatibility complex class II restricted antigen-dependent induction of T-cell proliferation. Immunology. 2000;101:521-530.
8. Reiter I, Krammer B, Schwamberger G. Differential effect of apoptotic versus necrotic tumor cells
on macrophage antitumor activities. J Immunol.
1999;163:1730-1732.
21. Ziegler B, Bhalla DK, Rasmussen RE, Kleinman
MT, Menzel DB. Inhalation of resuspended road
dust, but not ammonium nitrate, decreases the
expression of the pulmonary macrophage Fc receptor. Toxicol Lett. 1994;71:197-208.
9. Sperandio S, de Belle I, Bredesen DE. An alternative, nonapoptotic form of programmed cell
death. Proc Natl Acad Sci U S A. 2000;97:1437614381.
22. Tada M, Suzuki K, Yamakawa Y, et al. Human
glioblastoma cells produce 77 amino acid interleukin-8 (IL-877). J. Neurooncol. 1993;16:25-34.
35. Giovarelli M, Cappello P, Forni G, et al. Tumor
rejection and immune memory elicited by locally
released LEC chemokine are associated with an
impressive recruitment of APCs, lymphocytes
and granulocytes. J Immunol. 2000;164:32003206.
6. Steinman RM, Turley S, Mellman I, Inaba K. The
induction of tolerance by dendritic cells that have
captured apoptotic cells. J Exp Med. 2000;191:
411-416.
7. Sauter B, Albert ML, Francisco L, Larsson M,
Somersan S, Bhardwaj N. Consequences of cell
death: exposure to necrotic tumor cells, but not
primary tissue cells or apoptotic cells, induces the
maturation of immunostimulatory dendritic cells.
J Exp Med. 2000;191:423-433.
10. Jadus MR, Irwin MCN, Irwin MR, et al. Macrophages can recognize and kill tumor cells bearing
the membrane isoform of macrophage colony
stimulating factor. Blood. 1995;87:5232-5241.
11. Jadus MR, Williams CC, Avina MD, et al. Macrophages kill T9 glioma tumor cells bearing the
membrane isoform of macrophage colony stimulating factor through a phagocytosis-dependent
pathway. J Immunol. 1998;160:361-368.
12. Jadus MR, Wepsic HT, Jeffes EW. The biology
and potential anti-cancer uses of membrane macrophage colony stimulating factor. Recent Res
Devel Immunol. 1999;1:263-281.
13. Graf MR, Jadus MR, Hiserodt JC, Wepsic HT,
Granger GA. Development of systemic immunity
to glioblastoma multiforme using tumor cells genetically engineered to express the membraneassociated isoform of macrophage colony-stimulating factor. J Immunol. 1999;163:5544-5551.
14. Barth RF. Rat brain tumor models in experimental
neuro-oncology: the 9L, C6, T9, F98, RG2 (D74),
RT-2 and CNS-1 gliomas. J Neurooncol. 1998;36:
91-102.
15. Tapscott SJ, Miller AD, Olson JM, Berger MS,
Groudine M, Spence AM. Gene therapy of rat 9L
gliosarcoma tumors by transduction with select-
23. Uehara T, Baba I, Nomura Y. Induction of cytokine-induced neutrophil chemoattractant in response to various stresses in rat C6 glioma cells.
Brain Res. 1998;790:284-292.
24. Akagawa KS, Momoi T, Nagai Y, Tokunaga T. Appearance of asialo GM1 glycosphingolipid on the
cell surface during lymphokine-induced differentiation of M1 cells. FEBS Lett. 1981;130:80-84.
25. Kiguchi K, Iwamori M, Nagai Y, Eto Y, Akatsuka
J. Characterization of glycosphinolipids from cells
of various types of human leukemia: occurrence
of two glycosphingolipids, one reacting with antiasialo GM1 antibody and one with anti-Forssman
antibody. Gann 1983; 74:382-390.
26. Charley MR, Mikhael A, Hackett J, Kumar V, Bennett M. Mechanism of anti- asialo GM1 prevention of graft versus host disease identification of
allo-antigen activation of T cells. J Invest Derm.
1988;91:202-206.
27. Enzan H, Hiroi M, Saibara T, et al. Immunoelectron microscopic identification of asialo GM1positive cells in adult rat liver. Virchows Archiv B
Cell Pathol. 1991;60:389-398.
28. Kudo C, Araki A, Matsushima K, Sendo F. Inhibition of IL-8-induced W3/25⫹ (CD4⫹) T lymphocyte recruitment into subcutanoeus tissues of rats
by selective depletion of in vivo neutrophils with a
36. Tateda K, Moore TA, Deng JC, et al. Early recruitment of neutrophils determines subsequent
T1/T2 host responses in a murine model of legionella pneumophila pneumonia. J Immunol. 2001;
166:3344-3361.
37. Xia Y, Zweier JL. Superoxide and peroxynitrite
generation from inducible nitric oxide synthase in
macrophages. Proc Natl Acad Sci U S A. 1997;
94:6954-6958.
38. Beckman JS, Koppenol WH. Nitric oxide, superoxide and peroxynitrite: the good, the bad, the
ugly. Am J Physiol. 1996;271:C1424-C1437.
39. Karbowski M, Kurono C, Nishizawa Y, Horie Y,
Soji T, Wakabayashi T. Induction of megamitochondria by some chemicals inducing oxidative
strees in primary cultured rat hepatocytes. Biochim. Biophys Acta. 1997;1349:242-250.
40. Karbowski M, Kurono C, Wozniak M, et al. Free
radical-induced megamitochondria formation and
apoptosis. Free Radical Biol Med. 1999;26:396409.
41. Gal I, Varga T, Szilagyi I, Balazs M, Schlammadinger J. Protease-elicited TUNEL positivity of nonapoptotic fixed cells. J Histochem Cytochem.
2000;48:963-969.
42. Stadelmann C, Lassmann H. Detection of apoptosis in tissue sections. Cell Tissue Res. 2000;
301:19-31.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2002 100: 1373-1380
doi:10.1182/blood-2002-01-0174 originally published online July
5, 2002
Living T9 glioma cells expressing membrane macrophage
colony-stimulating factor produce immediate tumor destruction by
polymorphonuclear leukocytes and macrophages via a
''paraptosis''-induced pathway that promotes systemic immunity against
intracranial T9 gliomas
Yijun Chen, Thomas Douglass, Edward W. B. Jeffes, Qingcheng Xu, Christopher C. Williams, Neary
Arpajirakul, Christina Delgado, Michael Kleinman, Ramon Sanchez, Qinghong Dan, Ronald C. Kim, H.
Terry Wepsic and Martin R. Jadus
Updated information and services can be found at:
http://www.bloodjournal.org/content/100/4/1373.full.html
Articles on similar topics can be found in the following Blood collections
Immunobiology (5489 articles)
Immunotherapy (577 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.