University of Pennsylvania
ScholarlyCommons
Publicly Accessible Penn Dissertations
1-1-2015
Deciphering ARAP3 Functions in Hematopoiesis
and Hematopoietic Stem Cells
Yiwen Song
University of Pennsylvania, [email protected]
Follow this and additional works at: http://repository.upenn.edu/edissertations
Part of the Developmental Biology Commons, and the Molecular Biology Commons
Recommended Citation
Song, Yiwen, "Deciphering ARAP3 Functions in Hematopoiesis and Hematopoietic Stem Cells" (2015). Publicly Accessible Penn
Dissertations. 1141.
http://repository.upenn.edu/edissertations/1141
This paper is posted at ScholarlyCommons. http://repository.upenn.edu/edissertations/1141
For more information, please contact [email protected].
Deciphering ARAP3 Functions in Hematopoiesis and Hematopoietic
Stem Cells
Abstract
ARAP3 is a GTPase-activating protein that inactivates Arf6 and RhoA GTPases. ARAP3 deficiency in mice
causes a sprouting angiogenic defect resulting in embryonic lethality by E11. Mice with an ARAP3
R302,303A mutation (KI/KI) that prevents activation by PI3K have a similar angiogenic phenotype, although
rare animals survive to adulthood. Although ARAP3 was first discovered in porcine leukocytes, it remains
largely unstudied in hematopoiesis and hematopoietic stem cells (HSCs). In this thesis, we aim to elucidate
the potential cell-autonomous and non-cell-autonomous roles of ARAP3 in hematopoiesis and HSCs using
several conditional knockout (CKO) transgenic mouse models in addition to the KI/KI mutant mouse
model. Here, we report that HSCs from surviving adult KI/KI bone marrow (BM) are compromised in their
ability to self-renew and reconstitute recipient mice. To decipher the possible mechanisms of the KI/KI
mutation, we utilize our genetic CKO models to conditionally delete Arap3 in hematopoietic cells and in
several cell types within the HSC niche. Excision of Arap3 in hematopoietic cells using Vav-Cre does not alter
the ability of ARAP3-deficient HSCs to provide multi-lineage reconstitution and to undergo self-renewal,
suggesting ARAP3 does not play a cell-autonomous role in HSCs. Deletion of Arap3 in osteoblasts and
mesenchymal stromal cells using Prx1-Cre resulted in no discernable phenotypes in hematopoietic
development or HSC homeostasis in adult mice. However, reverse transplantation into Arap3;Prx1 CKO
mice resulted in an expanded phenotypic HSC compartment, suggesting ARAP3 plays a crucial role in the
BM niche to maintain and regulate HSC self-renewal. In contrast, deletion of Arap3 using VEC-Cre resulted
in embryonic lethality, yet HSCs from surviving adult mice were largely normal and reverse transplantation
into Arap3;VEC CKO mice revealed HSC frequencies and functions comparable to control mice. Taken
together, this thesis work suggests that despite a critical role for ARAP3 in embryonic vascular development,
its loss in endothelial cells minimally impacts HSCs in adult BM; however ARAP3 may play a pivotal role in
the mesenchymal and osteoblastic BM niche to regulate HSC functions.
Degree Type
Dissertation
Degree Name
Doctor of Philosophy (PhD)
Graduate Group
Cell & Molecular Biology
First Advisor
Wei Tong
Keywords
ARAP3, hematopoiesis, hematopoietic stem cells, HSC niche, mouse models
This dissertation is available at ScholarlyCommons: http://repository.upenn.edu/edissertations/1141
Subject Categories
Developmental Biology | Molecular Biology
This dissertation is available at ScholarlyCommons: http://repository.upenn.edu/edissertations/1141
DECIPHERING ARAP3 FUNCTIONS IN HEMATOPOIESIS AND
HEMATOPOIETIC STEM CELLS
Yiwen Song
A DISSERTATION
in
Cell and Molecular Biology
Presented to the Faculties of the University of Pennsylvania
in
Partial Fulfillment of the Requirements for the
Degree of Doctor of Philosophy
2015
Supervisor of Dissertation
___________________________________
Wei Tong, Ph.D., Associate Professor of Pediatrics
Graduate Group Chairperson
___________________________________
Daniel S. Kessler, Ph.D., Associate Professor of Cell and Developmental Biology
Dissertation Committee:
Mitchell J. Weiss, M.D., Ph.D., Professor of Pediatrics
Judy Meinkoth, Ph.D., Professor of Pharmacology
Margaret Chou, Ph.D., Associate Professor of Pathology and Laboratory Medicine
Martin P. Carroll, M.D., Ph.D., Associate Professor of Medicine
Acknowledgments
This thesis work and concurrent manuscript publication would not have been
possible without the guidance and insightfulness of my advisor, Dr. Wei Tong. I would
like to thank Dr. Tong for the endless help with generating new ideas, troubleshooting,
interpreting data, and training me to become a meticulous and technically sound scientist.
I would also like to thank all past and present members of the Tong lab for being
collaborative and helpful colleagues during my graduate career. It is because of these
people that I look forward to working in the laboratory every day. I would especially like
to thank Dr. Krasimira Rozenova and Dr. Jing Jiang for their level of dedication in
helping me grow as a scientist, and in teaching me new techniques as well as helping me
troubleshoot existing experiments throughout my 5 years in the lab. The three of us
started in the laboratory during the same summer in 2009, and I consider our journey
together these past 5 years to be one that is filled with happy memories and forever
engrained in my very existence as a scientist, and more importantly, as a person.
I would like to thank my thesis committee, Dr. Judy Meinkoth, Dr. Margaret
Chou, Dr. Martin Carroll, and Dr. Mitchell Weiss, for their endless support over the years
and for the invaluable advice regarding my thesis work, in publishing, and in my future
career.
Science would not advance as quickly as it has without collaboration and
cooperation. I would like to thank our collaborators that have been instrumental in
providing the mice strains that are the support of my thesis work, as well as being
ii
thorough critics of my data. This includes Dr. Sonja Vermeren, Dr. Nancy Speck, Dr.
Patrick Viatour, Dr. Gerd Blobel, and Dr. Mitchell Weiss, as well as the members of their
respective labs. I would specifically like to thank Dr. Janice Burkhardt, Dr. Xiongwei
Cai, Dr. Joanna Tober, Dr. Jingmei Hsu, and Dr. Marijke Maijenburg for help in new
techniques that were foreign to our laboratory specialties, but were pivotal in my thesis
work. I would especially like to thank Amanda Yzaguirre for her expertise in performing
the embryo immunofluorescence experiments presented in this thesis.
I would also like to thank the team of people at the University of Pennsylvania
Perelman School of Medicine that have been vital to my time here as a graduate student.
This includes the Cancer Biology chairs that have spanned my graduate career, Dr. Brian
Keith, Dr. Andrei Thomas-Tikhonenko, and Dr. Craig Bassing, whom have guided me in
choosing a graduate laboratory and helped me navigate the process of graduating from
this program. This also includes Kathy O’Connor-Cooley and Sara Forrest, the
administrative coordinators of Cancer Biology and Biomedical Graduate Studies, for all
their help with the administrative aspects of the graduate program. I would also like to
thank Dr. Celeste Simon and Dr. Brian Keith for warmly welcoming me into their home
during recruitment weekend and taking the time to know each candidate personally
before we ever entered the program. They have been a constant support system and
advocates over the years, and the reason I chose this specific program is due in large part
to their efforts. I would like to thank the Cell and Molecular Biology program as a whole
and its chair Dr. Daniel Kessler, for being one of the nation’s top biomedical science
iii
graduate programs with an excellent curriculum and a plethora of resources for budding
young scientists.
I would also like to thank the University of Pennsylvania as a whole for being one
of the nation’s finest institutions, that has acted as a vehicle for meeting people from all
walks of life and in all majors across the ten graduate schools on campus. The resources
available on campus to graduate students have been essential in building a well-rounded
foundation in biomedical sciences and the greater healthcare system. These resources and
the on-campus organizations and personnel that embody them, including Career Services,
Penn Graduate Women in Science and Engineering, and Penn Biotech Group, have been
fundamental in shaping my career development during my graduate studies.
As much as scientific training has been a critical component of my graduate
career, an equally if not more important aspect has been the colleagues and friends I have
made along the way. To this end, I would like to thank everyone whom I have met in the
past 6 years that I am lucky enough to call my friend in Philadelphia and New York City.
Some of these people were also in graduate schools, though many were not; yet, knowing
that we all had common struggles in life and sharing in these experiences together has
solidified a bond of friendship that extends beyond professional boundaries and my
graduate career. Your friendship means everything to me. I am also forever indebted to
my existing friends prior to entering graduate school for their endless support and
encouragement over the years. A source of familiarity and lifelong friendships, these are
relationships I cherish most that can stand any test of time and hardship. As they say,
friends are the family you choose for yourself.
iv
And lastly, but most importantly, I would like to thank my actual family. To my
parents, my little brother, and my grandparents who have been constant supporters of all
the crazy ideas I have had and all the new things I endeavor to accomplish in this lifetime
of mine, I thank you from the bottom of my heart and am forever grateful for your
unconditional love and encouragement. Having to endure being on the other side of the
country from my family and closest friends has been the hardest part of the last 6 years,
but knowing they are proud of all the hard work and sacrifice I put into this thesis work
has made it all worth it in the end. To these most significant people in my life that mean
the world to me: “Family is not an important thing, it is everything.” – Michael J. Fox.
v
ABSTRACT
DECIPHERING ARAP3 FUNCTIONS IN HEMATOPOIESIS AND
HEMATOPOIETIC STEM CELLS
Yiwen Song
Wei Tong, Ph.D.
ARAP3 is a GTPase-activating protein that inactivates Arf6 and RhoA GTPases. ARAP3
deficiency in mice causes a sprouting angiogenic defect resulting in embryonic lethality
by E11. Mice with an ARAP3 R302,303A mutation (KI/KI) that prevents activation by
PI3K have a similar angiogenic phenotype, although rare animals survive to adulthood.
Although ARAP3 was first discovered in porcine leukocytes, it remains largely unstudied
in hematopoiesis and hematopoietic stem cells (HSCs). In this thesis, we aim to elucidate
the potential cell-autonomous and non-cell-autonomous roles of ARAP3 in
hematopoiesis and HSCs using several conditional knockout (CKO) transgenic mouse
models in addition to the KI/KI mutant mouse model. Here, we report that HSCs from
surviving adult KI/KI bone marrow (BM) are compromised in their ability to self-renew
and reconstitute recipient mice. To decipher the possible mechanisms of the KI/KI
mutation, we utilize our genetic CKO models to conditionally delete Arap3 in
hematopoietic cells and in several cell types within the HSC niche. Excision of Arap3 in
hematopoietic cells using Vav-Cre does not alter the ability of ARAP3-deficient HSCs to
provide multi-lineage reconstitution and to undergo self-renewal, suggesting ARAP3
vi
does not play a cell-autonomous role in HSCs. Deletion of Arap3 in osteoblasts and
mesenchymal stromal cells using Prx1-Cre resulted in no discernable phenotypes in
hematopoietic development or HSC homeostasis in adult mice. However, reverse
transplantation into Arap3;Prx1 CKO mice resulted in an expanded phenotypic HSC
compartment, suggesting ARAP3 plays a crucial role in the BM niche to maintain and
regulate HSC self-renewal. In contrast, deletion of Arap3 using VEC-Cre resulted in
embryonic lethality, yet HSCs from surviving adult mice were largely normal and reverse
transplantation into Arap3;VEC CKO mice revealed HSC frequencies and functions
comparable to control mice. Taken together, this thesis work suggests that despite a
critical role for ARAP3 in embryonic vascular development, its loss in endothelial cells
minimally impacts HSCs in adult BM; however ARAP3 may play a pivotal role in the
mesenchymal and osteoblastic BM niche to regulate HSC functions.
vii
Table of Contents
Chapter 1: Introduction to ARAP3 and hematopoiesis .................................................1
1. Overview of ARAP3 ................................................................................................2
1.1 Discovery and characterization of ARAP3 ........................................................2
1.2 Genetic studies of Arap3 in mouse and zebrafish models .................................5
2. Overview of Hematopoiesis .....................................................................................7
2.1 Hematopoietic stem and progenitor cells (HSPCs) and the HSC niche ............7
2.2 Arf and Rho GAPs in hematopoiesis ...............................................................10
3. Scope and findings of this thesis research .............................................................12
Chapter 2: In vitro shRNA knockdown of ARAP3 .......................................................15
1. Introduction ............................................................................................................16
2. Results ....................................................................................................................16
2.1 Identification of ARAP3 as a protein of interest .............................................16
2.2 Screen of shRNAs targeting Arap3..................................................................17
2.3 Arap3 knockdown inhibits cell growth in vitro ...............................................18
2.4 Arap3 knockdown attenuates cell cycle progression .......................................19
2.5 Arap3 knockdown in primary cells inhibits proliferation ................................21
2.6 Arap3 knockdown inhibits repopulation of the hematopoietic compartment
upon transplantation ...............................................................................................22
3. Discussion ..............................................................................................................22
Chapter 3: Cell-autonomous functions of ARAP3 in HSCs.........................................24
1. Introduction ............................................................................................................25
2. Results ....................................................................................................................26
2.1 Arap3 is efficiently excised in f/f;Vav mice.....................................................26
2.2 ARAP3 is dispensable for steady-state hematopoiesis ....................................26
2.3 ARAP3 does not play a cell-autonomous role in HSCs ..................................28
viii
2.4 f/-;Vav mice recapitulate that ARAP3 is not essential in hematopoiesis .........29
2.5 Loss of Arap3 does not affect HSC function in serial transplantations ...........30
2.6 ARAP3 does not play a role in 5-FU-induced stress hematopoiesis ...............31
2.7 Acute loss of Arap3 in adult mice does not impact hematopoiesis or HSC
function ..................................................................................................................32
3. Discussion ..............................................................................................................33
Chapter 4: Non-cell-autonomous roles of ARAP3 in the HSC niche ..........................35
1. Introduction ............................................................................................................36
2. Results ....................................................................................................................37
2.1 Arap3 is not robustly excised in f/f;VEC mice.................................................37
2.2 Residual Arap3 expression in endothelial cells is sufficient for normal
development ...........................................................................................................38
2.3 ARAP3 expression in endothelial cells is important for embryonic
development but not in the adult endothelium to support HSC function ..............38
2.4 ARAP3 expression in BM endothelial cells is not required to support HSC
homeostasis ............................................................................................................40
2.5 ARAP3 may play a pivotal role in Prx1-expressing niche cells to regulate
HSC self-renewal and expansion ...........................................................................41
3. Discussion ..............................................................................................................42
Chapter 5: Arap3 R302,303A knock-in mutation disrupts HSC function ..................45
1. Introduction ............................................................................................................46
2. Results ....................................................................................................................46
2.1 KI/KI mice are born alive at a rare rate but appear grossly normal .................46
2.2 Arap3 R302,303A mutation impairs HSC functions ........................................47
2.3 Arap3 R302,303A mutation acts cell-autonomously to inhibit HSC
functions .................................................................................................................48
3. Discussion ..............................................................................................................49
Chapter 6: Conclusions and future perspectives ..........................................................52
1. Research findings summary ...................................................................................53
ix
2. Conclusions and future perspectives ......................................................................55
2.1 Cell-autonomous role of ARAP3 in HSCs ......................................................55
2.2 Non-cell-autonomous roles for ARAP3 in the HSC niche ..............................60
2.3 ARAP3 R302,303A mutant mice ....................................................................65
2.4 Other considerations ........................................................................................69
Chapter 7: Materials and methods .................................................................................72
Chapter 8: Tables, figures, and legends .........................................................................83
Chapter 9: References ...................................................................................................149
x
Chapter 1:
Introduction to ARAP3 and hematopoiesis
1
1. Overview of ARAP3
1.1 Discovery and characterization of ARAP3
ARAP3 is a member of the ARAP (Arf GAP and Rho GAP with ankyrin repeat
and PH domains) family of proteins, first identified in the cytosol of porcine leukocytes
in a screen for phosphoinositide-binding proteins (Figure 1.1) [Krugmann et al. 2002].
Specifically, ARAP3 was found to bind phosphatidylinositol (3,4,5)-triphosphate (PIP3),
the lipid second messenger produced by class I phosphoinositide 3-kinases (PI3Ks), with
high affinity in vitro [Krugmann et al. 2002].
The interaction between PIP3 and ARAP3 minimally requires the first two
pleckstrin homology (PH) domains at the N-terminus of ARAP3. This binding is
strengthened when the N-terminal sterile alpha motif (SAM) domain is included
[Krugmann et al. 2002, Craig et al. 2010]. Once binding occurs, PIP3 recruits ARAP3 to
the plasma membrane, where it can act on its GTPase substrates (Figure 1.2). Although
deletion of any one of its 5 PH domains can abolish ARAP3 binding to PIP3 in vitro
[Craig et al. 2010], in the context of the full-length protein, a tandem arginine to alanine
mutation at residues 307 and 308 in the first PH domain (R307,308A) is sufficient for
complete ablation of PIP3 binding [Krugmann et al. 2002, Craig et al. 2010]. Thus,
ARAP3 functions in the plasma membrane are mediated by PI3K-dependent PIP3
production.
The SAM domain is well-characterized for forming heterodimers, capable of
recruiting other regulatory proteins into effector complexes [Stapleton et al. 1999, Thanos
2
et al. 1999]. To date, ARAP3 has been found to heterodimerize in a SAM domaindependent manner with SHIP2, a negative regulator of PI3K signaling [Pesesse et al.
1998, Raaijmakers et al. 2007, Leone et al. 2009], as well as Odin and CIN85 [Kowanetz
et al. 2004, Mercurio et al. 2012]. These proteins are all associated with the regulation of
the actin cytoskeleton, cell adhesion, and endocytic receptor trafficking [Tong J et al.
2013, Zheng et al. 2014, Tossidou et al. 2012, Pesesse et al. 1998], all of which are
known processes regulated by Arf and Rho small G-protein families. Vav2, another
known regulator of cell migration and endocytosis [Cowan et al. 2005, Marignani and
Carpenter 2001, Hunter et al. 2006], has been found to interact directly through its Src
homology 2 (SH2) domain with phosphorylated tyrosine residues in the C-terminal
region of ARAP3 [Wu et al. 2012].
ARAP3 is a dual GTPase-activating protein (GAP) with two distinct domains
targeting Arf and Rho GTPases [Krugmann et al. 2002]. As a dual GAP, ARAP3 acts as
a negative regulator of these small G-proteins, stimulating the hydrolysis of GTPases in
their active guanosine triphosphate (GTP)-bound form to their inactive guanosine
diphosphate (GDP)-bound form (Figure 1.3) [Tcherkezian and Lamarche-Vane 2007].
Through in vitro characterization in porcine aortic endothelial (PAE) cells, ARAP3 was
found to specifically target Arf6 and RhoA GTPases, dependent on the binding of PIP3
[Krugmann et al. 2002, Krugmann et al. 2004, Krugmann et al. 2006].
Additionally, its Rho GAP domain is activated in vitro through direct binding of
Rap GTPase to a weakly conserved Ras association domain at the C-terminal end.
Studies in Sf9 insect cells show that in the presence of PIP3, binding of Rap-GTP to
3
ARAP3 subsequently induces a two-fold increase in ARAP3 Rho GAP activity,
indicating PI3K activity is required for Rap-GTP to activate ARAP3 Rho GAP function
[Krugmann et al. 2004]. The ARAP3 R307,308A mutant abolishes binding to PIP3,
thereby preventing ARAP3 recruitment to the plasma membrane where it normally acts
to inactivate its GTPase substrates, Arf6 and RhoA [Krugmann et al. 2002]. Two other
ARAP family members, ARAP1 and ARAP2, are known. They also bind PIP3 in a PH
domain-mediated fashion [Craig et al. 2010], though ARAP1 lacks an N-terminal SAM
domain [Miura et al. 2002]. Despite sharing similar domain structures, they do not share
the same substrate specificities for GAP activity as ARAP3; ARAP1 targets Arf1 and
RhoA in vivo, while ARAP2 targets Arf6 but lacks Rho GAP catalytic activity [Yoon et
al. 2006, Miura et al. 2002].
Arf and Rho families of small G-proteins are known to be regulators of cell actin
cytoskeletal dynamics [Randazzo et al. 2007, Hall 1998]. Therefore, many initial studies
of ARAP3 involve its manipulation to study the effects on cellular actin remodeling.
Overexpression in HEK293 human embryonic kidney epithelial cells results in a cell
rounding phenotype, antagonizing its ability to migrate without affecting its potential for
adherence on fibronectin-coated surfaces [I et al. 2004]. This effect is ablated with
expression of a Rho GAP defective mutant of ARAP3 where arginine is mutated to
leucine at residue 938 (R938L), but not with expression of an Arf GAP defective mutant
R527K, indicating suppression of cell motility occurs in a Rho GAP-dependent manner [I
et al. 2004]. Exogenous expression of ARAP3 in PAE cells causes the loss of filamentous
actin that is exacerbated upon platelet derived growth factor (PDGF) stimulation,
4
resulting in a membrane ruffling effect and a retraction of lamellipodia formation
[Krugmann et al. 2002]. This effect was greatly reduced with expression of either Arf
GAP or Rho GAP domain mutations, and completely abolished in the presence of both
GAP mutations together or with expression of the R307,308A mutation [Krugmann et al.
2002], suggesting a cooperation in catalytic activity of both GAP domains downstream of
PI3K-mediated ARAP3 regulation of cell morphology.
Interestingly, when ARAP3 is knocked down using an RNAi-based approach in
PAE cells, resulting cells also display a cell rounding phenotype and the formation of
very fine stress fibers [Krugmann et al. 2005]. Since ARAP3 inactivates both its
substrates Arf6 and RhoA, this implies ARAP3 control of both GTPases is tightly
regulated, and maintaining precise regulation of ARAP3 levels is crucial to actin
organization in the cell. Indeed, ARAP3 recruitment to the plasma membrane at sites of
elevated PIP3 levels is crucial for localized RhoA/Arf6 inactivation and Arf6 cycling,
both of which are necessary processes during cell migration, adhesion, and cell shape
regulation [Krugmann et al. 2005, Krugmann et al. 2002, I et al. 2004].
1.2 Genetic studies of Arap3 in mouse and zebrafish models
Germline deletion of Arap3 in mice results in embryonic lethality at embryonic
day E11 due to a sprouting angiogenesis defect in vascular development that is not
apparent in wild-type or heterozygous mice. Explant cultures of Arap3-/- embryos reveal
vasculogenesis occurs normally in these mice as major blood vessels are able to form in
early development; however smaller vessels are unable to sprout and reorganize new
branches of capillaries, indicating the defect is in angiogenesis [Gambardella et al. 2010].
5
This phenotype is recapitulated with a Tie2-Cre driven conditional knockout mouse
model of Arap3, further highlighting the endothelial origin of lethality [Gambardella et
al. 2010]. Additionally, Arap3 deficiency hinders lymphatic vessel development in mice
and zebrafish through the formation of defective lymphatic endothelial cell precursors.
Although these precursors are able to initiate the formation of lymphatic vessels from
pre-existing veins during development, they are deficient in the progression of
lymphangiogenesis and remodeling of the vascular network [Kartopawiro et al. 2013].
Yolk sacs of Arap3-/- mice appear pale and wrinkly with more narrowed vessels
compared to their wild-type counterparts. The wrinkly appearance is due in part to a
loose association of mesodermal and endothelial layers with scattered patches of blood
cells. However, colony assay analysis revealed no differences between Arap3-/- and
control yolk sacs, excluding a primitive hematopoietic defect [Gambardella et al. 2010].
Definitive hematopoiesis begins later in the mouse embryo, with the first hematopoietic
stem cell (HSC) arising from the hemogenic endothelium in the aorta-gonadmesonephros (AGM) region around E10.5 and later colonizing the fetal liver [Dzierzak
and Speck 2008]. Thus, definitive hematopoiesis has not been studied in Arap3-/- mice
due to their early lethality timepoint.
Although ARAP3 has been largely unstudied in hematopoiesis, it is abundantly
expressed in murine hematopoietic tissues [Krugmann et al. 2002, Gambardella et al.
2010] in addition to strong vascular expression in mice and zebrafish [Gambardella et al.
2010, Kartopawiro et al. 2014]. A genetic model investigating conditional knockout of
Arap3 in mouse neutrophils found Arap3 deficiency stimulates a hyper-responsive
6
adherence of neutrophils and subsequently interferes with neutrophil chemotaxis
[Gambardella et al. 2011]. Thus, ARAP3 does play an active role in at least one cell
lineage of the hematopoietic system.
Arap3 knock-in mutant mice (Arap3R302,303A/R302,303A, henceforth referred to as
KI/KI) also phenocopies Arap3-/- and Arap3fl/-;Tie2-Cre knockout mice in their
vasculature defects and embryonic lethality. The phenotype is not seen in mice
heterozygous for the mutated allele [Gambardella et al. 2010]. This KI/KI mutation, the
mouse ortholog of the previously mentioned R307,308A mutation, also ablates PIP3
binding and recruitment to the plasma membrane, recapitulating the importance of PI3Kmediated activation of ARAP3 in the mouse in vivo system [Gambardella et al. 2010].
KI/KI neutrophils also exhibit deficient chemotaxis and stimulation-induced recruitment,
mirroring Arap3-/- neutrophils [Gambardella et al. 2013]. Interestingly though, whereas
Arap3-/- mice are 100% lethal at E11, about 10% of KI/KI mice survive to birth and
appear grossly normal [Gambardella et al. 2013].
Given the importance of ARAP3 in vascular development and the shared
developmental origin of endothelial and hematopoietic tissues, the study of ARAP3 in
hematopoietic stem cells will further our knowledge of the field of hematopoiesis.
2. Overview of Hematopoiesis
2.1 Hematopoietic stem and progenitor cells (HSPCs) and the HSC niche
Hematopoietic stem cells (HSCs) are the critical source of all blood cells because
they are able to give rise to all mature lineages of the blood system [Warr et al. 2011].
7
Their potential for self-renewal and multi-lineage repopulation sustains the rapid turnover
of the blood system throughout life, and is required to replenish multi-potent progenitors
that give rise to specific hematopoietic lineage-committed precursors [Orkin 1995].
These HSPCs are devoted to the differentiation and proliferation of individual lineages of
the blood, including myeloid cells, lymphoid cells, red blood cells, and
megakaryocytes/platelets, each regulated by its specific set of hematopoietic growth
factors or cytokines (Figure 1.4) [Groopman et al. 1989].
HSCs are functionally defined as having the ability for both self-renewal and
multi-lineage repopulation [Purton and Scadden 2007], classically assessed through bone
marrow transplantations of HSCs into irradiated recipients. HSCs can be phenotypically
characterized by a cocktail of cell surface markers that are used to identify and isolate
HSCs using fluorescence-activated cell sorting (FACS). Specifically, the surface markers
Lin-cKit+Sca1+ (LSK) define a population that is enriched for HSPCs in mice [Challen et
al. 2009]. This heterogeneous compartment can further be fractionated by the signaling
lymphocytic activation molecule (SLAM) markers, CD48- and CD150+, or by CD34- and
Flk2- to define a population enriched for murine long-term HSCs, though different
surface marker combinations characterize slightly different subsets of relatively pure
HSC populations [Kiel et al. 2005, Osawa et al. 1996, Adolfsson et al. 2001].
Hematopoiesis in the mouse embryo begins in the yolk sac around embryonic day
E7.5 with the formation of blood islands known as hemangioblasts [Ferkowicz and Yoder
2005, Ueno and Weissman 2006]. The hemangioblast is thought to be the common
source of both endothelial and hematopoietic cells in the developing embryo, giving rise
8
to primitive red blood cells and parts of the yolk sac vasculature [Kinder et al. 1999,
Kennedy et al. 1997]. Once endothelial development occurs and a network of blood
vessels and capillaries form in the mouse embryo, the first HSC emerges from the aortagonad-mesonephros (AGM) region of the hemogenic endothelium by undergoing an
endothelial-to-hematopoietic transition (EHT) around E10.5 [Kissa et al. 2010]. It then
migrates to and colonizes the fetal liver, the initial site of embryonic definitive
hematopoiesis. Further colonization of the thymus, spleen, and eventually the bone
marrow, and expansion of the HSC populations that have migrated to these niches
together comprise the adult mouse hematopoietic system [Medvinsky and Dzierzak 1996,
Muller et al. 1994, de Bruijn et al. 2000, Dzierzak and Speck 2008].
In the homeostatic adult mouse, HSCs are rare cells that are normally maintained
in their quiescent non-cycling state [Morrison and Scadden 2014, Passegue et al. 2005].
Upon hematopoietic stress such as injury or transplantation into irradiated hosts, they will
enter the cell cycle to actively differentiate and replenish the required hematopoietic
lineages [Orkin and Zon 2008]. They reside in and are regulated by complex bone
marrow (BM) niches that are not mutually exclusive. These specialized
microenvironments may be composed of multiple cell types that contribute to the niches
in distinct as well as redundant ways [Ding and Morrison 2013]. Extensive research has
shown that HSC perivascular and osteoblastic niches are comprised of endothelial cells,
mesenchymal stromal cells, osteoblasts, sympathetic nerves and non-myelinating
Schwann cells, all of which contribute either directly or indirectly to the formation and
maintenance of HSC niches [Calvi et al. 2003, Ding et al. 2012, Ding and Morrison 2013,
9
Yamazaki et al. 2011, Mendez-Ferrer et al. 2008, Katayama et al. 2006, Morrison and
Scadden 2014]. Genetic studies of HSC niche factors, stem cell factor (SCF) and
CXCL12 (also known as stromal derived factor-1), reveal the crucial role that the niche
plays in the retention and maintenance of functional HSCs. When Scf is conditionally
deleted from the endothelial and perivascular mesenchymal bone marrow niche in mice,
85% of all long-term multi-lineage reconstituting cells are eliminated, including all
quiescent HSCs capable of serial transplantable activity [Oguro et al. 2013, Ding et al.
2012]. When Cxcl12 is deleted from approximately 70% of perivascular mesenchymal
cells, HSCs mobilize out of the bone marrow niche [Greenbaum et al 2013]. Furthermore,
HSCs are depleted upon conditional knockout of Cxcl12 in greater than 95% of
perivascular mesenchymal or endothelial niche cells, but are unaffected by deletion of
Cxcl12 from osteoblasts or hematopoietic cells [Ding and Morrison 2013, Greenbaum et
al 2013].
2.2 Arf and Rho GAPs in hematopoiesis
HSC functions are tightly regulated by a plethora of extrinsic and intrinsic
regulatory pathways. One such family of regulators is the Rho family of GTPases,
molecular switches that cycle between an active GTP-bound form and an inactive GDPbound form [Etienne-Manneville and Hall 2002, Hall 1998]. Both Arf and Rho GTPases
outside of the hematopoietic system are known to be master regulators of cell actin
cytoskeletal dynamics, including control of cell adherence, motility, cell shape, and
endocytic membrane trafficking [Van Aelst and D’Souza-Schorey 1997, Randazzo et al.
2000, Murali et al. 2014]. While Arf GTPases have not been studied in hematopoiesis,
10
Rho GTPases, including its best studied members RhoA, Rac1, and Cdc42, have been
found to play pivotal roles in HSPC actin cytoskeletal functions [Mulloy et al. 2010, Gu
et al. 2003, Gottig et al. 2006, Ghiaur et al. 2006, Florian et al. 2012, Chae et al. 2008,
Cancelas et al. 2006, Cancelas et al. 2005].
Recent genetic studies of the Rho GTPase family in hematopoiesis have expanded
our knowledge of their roles to include regulation of HSC self-renewal, multi-lineage
differentiation, homing/migration, proliferation, cytokinesis and survival [Yang et al.
2007, Guo et al. 2009, Kalfa et al. 2010]. Specifically, conditional knockout of RhoA in
hematopoietic progenitors leads to a cytokinesis defect resulting in the failure of
hematopoietic progenitor cells (HPCs) to divide and multiply, thereby causing increased
HPC necrosis and multilineage hematopoietic failure [Zhou et al. 2013]. RhoA-/- HSCs
retained their long-term engraftment potential, but could not give rise to any HPCs or
subsequent mature lineages of the blood [Zhou et al. 2013]. Another study found that
conditional deletion of RhoA in HSCs aberrantly regulated lymphoid progenitor
production, reaffirming the requirement for RhoA at the progenitor level for proliferation
and lineage-specific differentiation [Zhang et al. 2012].
Whereas the role of Rho GTPases in hematopoiesis and cellular functions has
begun to be understood, the role of Rho GAPs is less well studied. GAPs stimulate the
hydrolysis of bound GTP to GDP, thereby inactivating their G-protein substrates
[Tcherkezian and Lamarche-Vane 2007]. One Rho GAP in particular, p190B RhoGAP, is
a perfect example of the tight regulation under which GTPases need to be controlled in
vivo. A study shows that loss of p190B in fetal liver HSCs, resulting in the heightened
11
activation of its substrate RhoA, enhances long-term HSC engraftment and self-renewal
[Xu et al. 2009]. In a separate study, expression of dominant negative RhoA in HSCs also
enhances engraftment and self-renewal potential [Ghiaur et al. 2006]. These studies of
RhoA and its negative regulator p190B show similar effects with opposing mechanisms,
indicating any dysregulation of GTPases results in aberrant functioning. As GAPs are
increasingly studied, the complex network of tissue- and context-specific activation of
these GAPs has come to light. There are about two to three times the number of Rho
GAPs as there are Rho GTPases that they regulate, meaning GTPases often have multiple
GAP regulators [Tcherkezian and Lamarche-Vane 2007]. Sometimes GAPs can also
regulate more than one member of a GTPase family, again depending on context and
tissue specificity [Tcherkezian and Lamarche-Vane 2007]. There are also multi-domain
GAPs like ARAP3 that target more than one family of small G-proteins, further
complicating the story and revealing the necessity for continued investigation to enhance
the understanding of GTPase-activating proteins.
Dysregulation of Rho family GTPases and Rho GAPs has been associated with
multiple human cancers and hematologic disorders such as leukemia, neutrophil
dysfunction, and Fanconi anemia [Cherfils et al. 2013, Karlsson et al. 2009, Hall 2009,
Lazer and Katzav 2011, Troeger and Williams 2013, Haneline et al. 1999, Tcherkezian
and Lamarche-Vane 2007]. Therefore further study of Rho GTPases and their regulators,
such as GAPs, is crucial to discovering potentially untapped therapeutic value.
3. Scope and findings of this thesis research
12
Little is known about how ARAP3 functions in the hematopoietic system. It was
first identified in pig leukocyte cytosol more than 10 years ago [Krugmann et al. 2002]
and is highly expressed in endothelial and hematopoietic tissues [Krugmann et al. 2002,
Gambardella et al. 2010, Kartopawiro et al. 2014], including various cell types and
subsets of the bone marrow (Figure 1.5). Despite this, ARAP3 has only recently been
studied in murine neutrophils with regard to the blood system [Gambardella et al. 2013].
Arap3-/- mice die early from endothelial defects during embryonic development,
precluding the study of definitive hematopoiesis in this genetic model [Gambardella et al.
2010]. Since HSCs first emerge from the hemogenic endothelium during development
[Dzierzak and Speck 2008], it is intriguing to investigate whether ARAP3 may also play
a role in hematopoietic stem cells and hematopoiesis.
The main purpose of this thesis is to uncover and understand the role that ARAP3
plays in hematopoiesis and HSPC regulation. This thesis examines both the cellautonomous and non-cell-autonomous effects of Arap3 deletion on HSC function,
utilizing several conditional knockout genetic mouse models (Table 1.1 and Figure 1.6)
as well as the KI/KI mutant model.
Initial in vitro studies of shRNA-mediated knockdown of Arap3 in immortalized
32D hematopoietic cell lines showed loss of ARAP3 compromised cell proliferation and
colony formation. Showing promise of a potential regulatory role in hematopoiesis, we
generated several conditional knockout mouse models of Arap3 to examine how
hematopoietic-specific and niche-specific deletion of Arap3 affected HSC function. We
found that ARAP3 is dispensable in HSCs in a cell-autonomous manner. ARAP3 has
13
previously been shown to be a necessary component in the embryonic endothelium
during development [Gambardella et al. 2010], however we showed that it is not essential
in the adult mouse endothelium for normal HSC functioning. Additionally, deletion of
Arap3 in the perivascular stromal and osteoblastic bone marrow niches revealed that
ARAP3 may potentially play a critical role in the microenvironment to regulate HSC
expansion and self-renewal, though further studies are necessary to confirm this
observation.
Interestingly, KI/KI mice exhibit impaired HSC engraftment upon transplantation
and a lineage skewing of repopulated cells, as well as compromised HSC self-renewal
after serial transplantations. This indicates a necessity of PI3K-coupled ARAP3
activation for proper HSC functioning that is not apparent when ARAP3 is completely
ablated within the hematopoietic compartment. Further study is warranted to decipher the
mechanism of KI/KI HSC functioning and how it differs from Arap3-/- HSCs.
14
Chapter 2:
In vitro shRNA knockdown of ARAP3
15
1. Introduction
Little is known about ARAP3 in the hematopoietic system. Despite its early
discovery in porcine leukocyte cytosol [Krugmann et al. 2002], early studies of ARAP3
were conducted in endothelial and epithelial cells in vitro to study its roles in actin
cytoskeletal organization, cell motility, and adhesion [Krugmann et al. 2005, Krugmann
et al. 2002, I et al. 2004]. Only recently has ARAP3 been studied in neutrophils of the
blood system, where it has been found to inhibit chemotaxis when ablated [Gambardella
et al. 2013].
Here, we investigate the effects of short hairpin RNA (shRNA)-mediated
knockdown of Arap3 in vitro in the 32D murine hematopoietic cell line. We also examine
knockdown of Arap3 in primary mouse bone marrow cells to study whether ARAP3
plays a physiological role in the murine hematopoietic system.
2. Results
2.1 Identification of ARAP3 as a protein of interest
We first identified ARAP3 from mass spectrometry as a novel binding partner for
Lnk adaptor protein (Figure 2.1). We confirmed the association between endogenous
ARAP3 and Lnk by co-immunoprecipitation experiments in the HEL human
erythroleukemia cell line stably expressing BCR-Abl and Flag-tagged Lnk. The ARAP3Lnk interaction is specifically abolished upon treatment with the Abl/Kit/PDFGR
tyrosine kinase inhibitor Gleevec (Figure 2.2). This coincides with the abrogation of
16
ARAP3 tyrosine phosphorylation by Gleevec. It suggests that this interaction is mediated
in a tyrosine phosphorylation-dependent manner (Figure 2.2).
2.2 Screen of shRNAs targeting Arap3
To begin studying the relevance of ARAP3 in hematopoietic cells, we first
studied whether ablation of ARAP3 in cell lines would result in a physiological response
and phenotype. We screened several shRNAs targeted against Arap3 to assess the level of
knockdown at the protein and RNA levels. ShRNAs employ viral vectors that, when
infected into mammalian cells such as the 32D hematopoietic cell line, stably integrate
into the cell genome to ensure long-term knockdown of the target gene [Moore et al.
2010].
In the initial screen, we doubly infected 293T cells with murine Arap3 and one of
five short hairpins (numbered 135-139) targeting Arap3. Upon western blot using an
ARAP3 antibody, we found reduced levels of ARAP3 expression in cells expressing
shArap3 136 and 137, and almost complete ablation of ARAP3 expression when short
hairpins shArap3 138 and 139 were utilized. In contrast, cells infected with shArap3 135
showed no loss of ARAP3 expression level, comparable to cells expressing either a
control scrambled short hairpin (scr) or no shRNA at all (Figure 2.3). We then infected
shArap3 136-139 into 32D murine hematopoietic cells to examine the level of
knockdown of endogenous mouse Arap3 RNA levels, normalized to Arap3 transcript
levels in uninfected cells. By quantitative real-time PCR (qRT-PCR), we found robust
reduction of Arap3 transcript levels using shArap3 136 and 139, while shArap3 137 and
138 showed partial reduction of transcript levels (Figure 2.4).
17
2.3 Arap3 knockdown inhibits cell growth in vitro
To study the effects of Arap3 knockdown on cell growth, we infected shArap3
136-139 into 32D cells stably expressing the myeloproliferative leukemia virus oncogene
(c-mpl) receptor (32D mpl cells). This cell line responds to both interleukin-3 (IL-3), a
necessary cytokine to maintain growth of 32D cells [Greenberger et al. 1983], and
thrombopoietin (Tpo), the growth factor ligand for c-mpl receptor [Kaushansky et al.
1994, de Sauvage et al. 1994], serving as a tool to investigate cell proliferation. In the
presence of varying concentrations of murine Tpo and IL-3, we measured the cell density
using the MTT assay, a colorimetric assay that converts the reduction of MTT compound
by metabolically active cells into a quantifiable optical density reading on a
spectrophotometer, correlating into a cell proliferation rate. At concentrations above
0.1ng/ml murine Tpo or 0.003ng/ml IL-3, there is a significant reduction in cell
proliferation after Arap3 knockdown with all short hairpins employed, though the
inhibition appears most severe in shArap3 139-infected cells (Figure 2.5).
We further examined cell growth in shArap3-infected 32D mpl cells cultured in
either 1ng/ml murine Tpo or 0.1ng/ml IL-3. Here, we employed short hairpins targeting
Arap3 that also express green fluorescence protein (GFP). By flow cytometry, we
measured the percentage of GFP-expressing cells over time as a fraction of the
percentage of GFP-positive cells on day 0. By day 6, the percentage of GFP-expressing
cells, indicative of cells in which Arap3 is knocked down, was much lower compared to
day 0. In contrast, cells infected with the control scrambled short hairpin maintained a
steady percentage of GFP-expressing cells over time, signifying a decreased rate of
18
growth in shArap3-infected cells (Figure 2.6). When the growth rate of GFP-positive
cells was quantified by cell count, shScr-expressing control cells grew exponentially
faster than shArap3-expressing cells by day 6 of culture in either Tpo or IL-3 (Figure
2.7).
2.4 Arap3 knockdown attenuates cell cycle progression
To determine whether knockdown of Arap3 in 32D mpl cells inhibits proliferation
by increasing apoptosis or slowing down cell cycling, we first looked for the presence of
apoptotic cells in GFP-positive shArap3-expressing cells after seven days in culture. In
early to intermediate stages of apoptosis, phosphatidylserines (PS) are translocated to the
external side of the cytoplasmic membrane, exposing them for detection by fluorescencelabeled Annexin V antibodies that specifically bind PS. At later stages of apoptosis, the
integrity of the plasma membrane begins to break apart, exposing nucleic acids to 7AAD
intercalation and fluorescence [Zimmermann and Meyer 2011]. By flow cytometry using
AnnexinV and 7AAD, we were able to determine no significant differences in the
percentage of AnnexinV+7AAD- early apoptotic cells or AnnexinV+7AAD+ late apoptotic
cells caused by the expression of control shScr or knockdown shArap3 in the GFPpositive fraction of cells. As a control, we also looked at the percentage of early and late
apoptotic cells in the GFP-negative fraction and could discern no differences (Figure 2.8).
Since decreased cell proliferation rate after Arap3 knockdown did not result from
increased apoptosis, we next examined if there were changes in the cell cycle of shArap3expressing cells using a bromodeoxyuridine (BrdU) assay. BrdU is a thymidine analog
that is incorporated into actively dividing cells during the synthesis phase of the cell cycle
19
that, when used in combination with 7AAD, can pinpoint by flow cytometry the
particular phase of the cell cycle each cell is undergoing at a static timepoint. After 45
minutes of BrdU pulse in culture, a larger percentage of shArap3-expressing cells
remained in G0/G1 phase compared to control shScr-expressing cells in the GFP-positive
fraction. Correspondingly, there was a decrease in the percentage of shArap3-expressing
cells in S phase compared to control cells, indicating more cells potentially remained in
the initial growth phase, progressed through this growth phase more slowly, or were nondividing altogether (Figure 2.9). We hypothesize that there may be a possible defect in G1
to S transition that could have stemmed from knockdown of Arap3. There were no
changes in the percentage of cells in G2/M phase of the cell cycle. Again as a control, we
analyzed the GFP-negative fraction of cells that did not express any short hairpins and
found no changes in the fractions of cells in each phase of the cell cycle. These levels
were also comparable to those in GFP-positive control shScr-expressing cells (Figure
2.9).
To study whether known proliferative signaling pathways were downregulated as
a result of Arap3 knockdown, we performed a western blot of whole cell lysates from
32D mpl cells infected with short hairpins that were serum-starved for 3 hours, then
stimulated for 10 minutes with either 10ng/ml IL-3 or 25ng/ml murine Tpo. We did not
see any noticeable differences between uninfected cells, control shScr-expressing cells, or
shArap3-expressing cells in the activation and phosphorylation of STAT5, Akt, or ERK,
effectors of the JAK-STAT, PI3K, and MAPK signaling cascades, respectively, that
promote cell growth and proliferation (Figure 2.10) [Weber-Nordt et al. 1998, Kops and
20
Burgering 1999, Seger and Krebs 1995]. Since proliferative pathways are unaffected, it is
likely that ARAP3 may be affecting members of the cell cycle, potentially through RhoA
and Arf6, rather than proliferative signaling pathways to regulate cell growth dynamics,
though we did not measure signaling changes at multiple timepoints nor as a summation
of activation over time.
2.5 Arap3 knockdown in primary cells inhibits proliferation
To evaluate the potential for ARAP3 physiological relevance in hematopoiesis,
we next studied Arap3 knockdown in primary murine bone marrow cells from wild-type
C57Bl6/J mice. After isolating and infecting primary cells with control shScr or Arap3targeted short hairpins 136 or 139, we tested these cells by qRT-PCR to assess the
efficiency of Arap3 knockdown and found partial reduction of Arap3 transcript levels in
shArap3 136-expressing primary cells and near complete ablation of Arap3 transcript
levels in shArap3 139-expressing primary cells when normalized to control shScrexpressing cells (Figure 2.11). We cultured these Arap3 knockdown cells in
methylcellulose to quantify the number of individual colonies that would grow.
Puromycin was used as a selection marker for 7 days in cells stably expressing the short
hairpins. When normalized to the number of colonies formed on shScr cultures in four
independent experiments, there was a marked decrease in the quantity of colonies that
grew from cells in which Arap3 was knocked down (Figure 2.12). This confirms our
earlier studies in 32D cells that ARAP3 ablation undermines cell proliferation. More
importantly, these in vitro studies in primary cells outline the possibility that ARAP3 may
play an important physiological function in hematopoiesis in vivo.
21
2.6 Arap3 knockdown inhibits repopulation of the hematopoietic compartment upon
transplantation
Before moving into in vivo genetic models to study ARAP3 function, we
performed a bone marrow transplantation (BMT) of GFP- and shArap3- co-expressing
primary bone marrow cells into irradiated recipient mice. Peripheral blood of the
recipient mice was evaluated every 4 weeks post-transplant for GFP-positive donor
chimerism. By 12-16 weeks post-transplant, when reconstitution of the hematopoietic
compartment in recipient mice is from transplanted long-term HSCs, there is a significant
reduction of donor chimerism in recipients transplanted with shArap3-expressing bone
marrow cells compared to control shScr-expressing transplanted recipients (Figure 2.13).
These experiments involving Arap3 knockdown in primary cells show a potential for
ARAP3 to play a major role in the regulation of hematopoiesis and HSC function in vivo.
3. Discussion
We are the first group to investigate ARAP3 function in vitro in a hematopoietic
cell line. In this chapter, we employ short hairpin-targeted knockdown of Arap3 to study
its role in 32D murine hematopoietic cells and primary mouse bone marrow cells.
We find that Arap3 knockdown constrains cell growth in the presence of growth
factor Tpo and cytokine IL-3. These cells cycle more slowly, particularly in the G1 to S
phase transition, after Arap3 knockdown. We would normally proceed to investigate the
G1/S checkpoint to explore whether any cell cycle regulators are disrupted as a result of
Arap3 knockdown. However, since this work was done in vitro in a hematopoietic cell
22
line, we first wanted to study whether the same phenotype would manifest in vivo using
genetic Arap3 knockout mouse models before probing further into the mechanism of
ARAP3 function on the cell cycle.
Along these lines, our studies of Arap3 knockdown in primary bone marrow cells
also show decreased cell growth in colony forming assays in vitro, recapitulating our cell
line work. Additionally, Arap3 knockdown in primary cells compromises HSC function
upon transplantation in vivo. Together, our initial investigation into the role of ARAP3 in
the hematopoietic system shows that knockdown of Arap3 in vitro and ex vivo causes
defects in normal hematopoietic processes. To verify these results, we must move into
genetic studies of Arap3.
It is important to keep in mind that short hairpin-targeted knockdown of Arap3 is
not the same as genetic deletion of Arap3. ShRNAs, though screened for their ability to
target the specific gene of interest without affecting other genes, may still have unknown
off-target effects that could contribute to the phenotypes manifested. Additionally,
shRNAs do not guarantee a complete ablation of the target gene, as our studies have
shown. Therefore, what occurs in shRNA-mediated Arap3 knockdown hematopoietic
cells may not necessarily reflect what would occur in a genetic knockout model of Arap3.
Using our in vitro knockdown studies as a starting guide point, we next investigate if
there is a functional correlation when Arap3 is genetically knocked out in mice.
23
Chapter 3:
Cell-autonomous functions of ARAP3 in HSCs
24
1. Introduction
Previous studies of Arap3 germline knockout mice show they are embryonic
lethal at E11 due to an angiogenic defect during embryonic development [Gambardella et
al. 2010]. Since the first definitive hematopoietic stem cell does not arise from the
hemogenic endothelium to colonize the fetal liver until approximately E10.5 during
mouse embryonic development [Dzerizak and Speck 2008], this early lethality precludes
the study of hematopoiesis and Arap3-deficient HSCs in this genetic model.
In this chapter, we generated conditional knockout (CKO) mouse models to ablate
Arap3 in the hematopoietic compartment in order to investigate the role of ARAP3 in
hematopoiesis and HSCs. Using the Cre-Lox recombination system [Nagy 2000], we
were able to excise floxed Arap3 alleles [Gambardella et al. 2010] using either Vav
promoter- or myxovirus resistance-1 (Mx1)-promoter driven Cre recombinase
expression. Vav is a pan-hematopoietic promoter whose expression begins in the
developing embryo around embryonic day E11.5 and is fully turned on and expressed in
greater than 99% of hematopoietic cells in the mouse embryo by E13.5 [Stadtfeld and
Graf 2004], thereby excising floxed alleles in most, if not all, fetal liver and adult
hematopoietic cells. Mx1 is a dormant pan-hematopoietic promoter whose active
expression can be induced by type I interferon or synthetic double-stranded RNA such as
polyinosine-polycytosine (pIpC) [Kuhn et al. 1995] and can be utilized to study loss of
targeted genes at desired timepoints. Thus, both the Vav-Cre and Mx1-Cre driven genetic
knockout models serve as tools to study homeostatic and acute loss of Arap3,
respectively, in the adult mouse hematopoietic system.
25
2. Results
2.1 Arap3 is efficiently excised in f/f;Vav mice
To begin studying the cell-autonomous function of ARAP3 in hematopoietic
cells, we crossed floxed Arap3 mice to Vav-Cre mice to mediate Vav-driven excision of
Arap3 (f/f;Vav). f/f;Vav mice are born alive and in Mendelian ratios, and appear grossly
normal when compared to their control f/f littermates (data not shown). To measure the
deletion efficiency at the DNA level, we cultured unfractionated bone marrow cells from
either f/f;Vav knockout or f/f control mice in methylcellulose colony-forming cell (CFC)
assays containing cytokines that facilitate multi-lineage differentiation of progenitor cells.
Each progenitor cell present in the culture gives rise to an individual colony, from which
DNA is isolated to measure Arap3 deletion efficiency on a clonal basis. Clonal analysis
by PCR of bone marrow cells harvested from f/f;Vav mice shows complete Vav-Cremediated ablation of Arap3 (Figure 3.1). We also measured Arap3 deletion efficiency at
the transcript level using qRT-PCR of RNA isolated from f/f;Vav mice, showing greater
than 95% deletion of Arap3 transcripts in the bone marrow when normalized to transcript
levels in f/f control mice (Figure 3.2). In contrast, the transcript levels of the other ARAP
family members, Arap1 and Arap2, remain unchanged in the bone marrow (Figure 3.2).
Thus, Arap3 is specifically and efficiently knocked out in f/f;Vav CKO mice.
2.2 ARAP3 is dispensable for steady-state hematopoiesis
At 6 weeks of age, when adult mice have equilibrated to a homeostatic level of
hematopoiesis, f/f;Vav mice are indistinguishable from their f/f littermate controls in their
26
peripheral blood composition by complete blood counts (Figure 3.3). At 4-6 months of
age, the composition of hematopoietic tissues as analyzed by flow cytometry in f/f;Vav
mice is comparable to that of their littermate controls (Figure 3.4). Since Vav-Cremediated excision begins in early embryonic hematopoietic development and ablates
Arap3 in all hematopoietic cells of the adult mouse, our data suggests that ARAP3 is
dispensable for steady-state hematopoiesis in the adult mouse under homeostatic
conditions.
After observing no effect on the frequencies of terminally differentiated cell
populations, we next probed the frequencies of more primitive hematopoietic
compartments by phenotypic surface marker expression. Within the Lin-Sca1+cKit+
(LSK) compartment, a heterogeneous population known to be enriched for HSPCs
[Challen et al. 2009], further fractionation using the SLAM surface markers CD48 and
CD150 revealed similar percentages of cells in the CD48-CD150+LSK compartment that
is enriched for long-term HSCs [Kiel et al. 2005] between f/f;Vav and f/f mice (Figure
3.5). Furthermore, to evaluate the ability of Arap3-deficient progenitor cells to
differentiate, proliferate and give rise to colonies of multiple cell lineages in vitro, we
performed CFC assays with total bone marrow cells or purified LSK cells from f/f;Vav
and f/f mice. We found no differences in the ability to form various types of colonies with
normal frequencies (Figure 3.6) and morphology (data not shown) caused by loss of
Arap3.
Although Arap3 deficiency in progenitor cells results in no functional differences
in vitro and ARAP3 is not required for normal hematopoietic development, we show here
27
that Arap3-/- neutrophils from f/f;Vav CKO mice exhibited enhanced polyRGD-induced
adhesion (Figure 3.7) and increased RhoA activation (Figure 3.8), as previously
published [Gambardella et al. 2011]. These data together suggest the cell-intrinsic
functions of ARAP3 may be limited to mature downstream differentiated cells, such as
neutrophils, rather than in the immature HSPC populations upstream.
2.3 ARAP3 does not play a cell-autonomous role in HSCs
Although loss of Arap3 does not confer differences in the ability of the
heterogeneous LSK population for differentiation and proliferation in vitro, we next
wanted to probe whether there would be functional differences in Arap3-/- HSPCs in vivo.
To test these stem cells for multi-lineage repopulating potential and the ability to selfrenew, we performed serial competitive bone marrow transplantation (BMT) assays using
donor cells derived from f/f;Vav knockout or f/f control mice. Due to differences in
background strains of the donor and recipient mice, LSK cells were sorted from either
f/f;Vav or f/f littermate controls (CD45.2+) and injected along with whole bone marrow
cells from SJL competitor mice (CD45.1+) into each irradiated F1 recipient mouse
(CD45.1+CD45.2+). Peripheral blood of recipient mice was evaluated at 4, 8 and 12
weeks post-transplantation for donor chimerism and multi-lineage repopulation of the
irradiated hematopoietic compartment. There were no significant differences in donor
chimerism of the total blood measured every 4 weeks following the primary transplant
and in the individual cell lineages within the blood as measured at 12 weeks posttransplantation (Figure 3.9). Within the donor-derived cells, reconstitution of each cell
lineage was similarly distributed between Arap3 CKO and control donors (Figure 3.10).
28
Four months after the primary transplant, whole unfractionated bone marrow from
either f/f;Vav CKO or f/f control cohorts of recipient mice were injected into secondary
irradiated recipient mice. As before, the peripheral blood was analyzed at 4, 8 and 12
weeks post-secondary transplantation, and the recipient mice were again found to have no
drastic differences in HSPC self-renewal and multi-lineage reconstitution upon serial
transplantation (Figure 3.12). Interestingly, donor chimerism did increase drastically to
over 80% of repopulated hematopoietic cells (Figure 3.11). However this effect was
found in secondary recipients of both f/f;Vav and f/f donors, suggesting this may be due to
an advantage conferred by strain differences between the donor and recipient mice, rather
than due to the direct loss of Arap3 in the serially transplanted hematopoietic stem cells.
Thus, despite very efficient deletion of Arap3 at the DNA and RNA levels (Figures. 3.1
and 3.2), loss of Arap3 resulted in minimal functional impact on HSPCs.
2.4 f/-;Vav mice recapitulate that ARAP3 is not essential in hematopoiesis
To rule out any effects that strain differences may be causing in our studies, we
backcrossed f/f;Vav mice 8 generations onto the pure C57Bl/6J background. Additionally,
to ensure a more complete and specific deletion of Arap3 in hematopoietic cells, we
generated Arap3flox/-;Vav-Cre (f/-;Vav) mice. These CKO mice showed 100% deletion in
all f/-;Vav mice we examined at both the DNA and RNA levels (Figures 3.13 and 3.14).
f/-;Vav mice were also born at normal Mendelian ratios and appeared grossly normal
(data not shown). Adult f/-;Vav mice showed normal peripheral blood composition by
complete blood counts (Figure 3.15) and normal lineage distribution of hematopoietic
29
tissues as analyzed by flow cytometry (Figure 3.16) in comparison to f/f and f/- control
mice.
In examining the primitive hematopoietic compartments, we found that f/-;Vav
mice had a normal distribution of CD48-CD150+, CD48-CD150-, and CD48+CD150populations within the HSPC-enriched LSK compartment (Figure 3.17), indicating
normal phenotypic HSPCs determined by flow cytometry. As in f/f;Vav mice, f/-;Vav
bone marrow cells did not produce adverse effects on hematopoietic progenitor cell
proliferation or differentiation in CFC assays (Figure 3.18). Through the phenotypic
characterization of f/-;Vav mice, we are ensured that ubiquitous loss of one Arap3 allele
does not affect hematopoiesis and HSPCs, as f/- mice are virtually indistinguishable from
f/f control mice (Figures 3.13-3.18).
Despite comparably distributed phenotypic HSPCs between f/-;Vav CKO and f/control mice, we questioned whether this would reflect similar numbers of functional
HSCs between Arap3-/- and control mice. Through limiting dilution BMT assays using
unfractionated BM cells, we quantified the frequency of functional HSCs as 1 in 21,215
bone marrow cells in f/- control mice and 1 in 34,853 bone marrow cells in f/-;Vav CKO
mice (Figure 3.19), indicating an approximate 1.5-fold reduction in the frequency of
functional HSCs when Arap3 is ablated in HSCs compared to control mice.
2.5 Loss of Arap3 does not affect HSC function in serial transplantations
Although f/f;Vav and f/-;Vav mice are similarly efficient in Arap3 excision, we
wanted to investigate whether there would be differences in HSC function after
30
transplantation of f/-;Vav LSK cells now that these CKO mice are on a pure background
and are shown to have a 1.5-fold decrease in HSC frequency. As in earlier experiments,
we assessed whether ARAP3 plays a role in HSC function in vivo using competitive
BMT assays. LSK cells sorted from knockout or control mice were transplanted into
lethally-irradiated recipients and peripheral blood reconstitution was evaluated. Despite a
lower frequency of f/-;Vav functional HSCs, there were no discernable differences in
donor chimerism (Figure 3.20) or multi-lineage reconstitution of the peripheral blood
(Figure 3.21). Serial transplantation also showed normal reconstitution in secondary
recipients (Figures 3.22-3.23). Together, our studies of Arap3 CKO mice on both mixed
and pure backgrounds firmly establish that ARAP3 does not cell-autonomously impact
hematopoiesis and HSPC function under homeostatic conditions.
2.6 ARAP3 does not play a role in 5-FU-induced stress hematopoiesis
Though ARAP3 does not seem to play a role in steady-state hematopoiesis, we
probed whether ARAP3 would act as a critical player when a stress-induced
hematopoietic response is elicited, as HSPC homeostasis is crucial to tissue maintenance
and regeneration in response to injury or stress [Geiger and Rudolph 2009, Wilson et al.
2009]. To invoke a stress response, we injected f/-;Vav CKO and f/- and f/f control mice
with the pyrimidine analog 5-fluorouracil (5-FU) to eradicate actively dividing cells in
the blood, causing bone marrow stress in the mice. This forces normally quiescent HSCs
to enter the cell cycle and undergo rapid expansion and differentiation to repopulate the
hematopoietic compartment [Harrison and Lerner 1991]. For a period of 29 days after 5FU-induced trauma, we observed no differences in hematopoietic recovery between
31
control and knockout mice (Figure 3.24), though there was a slight decrease in white
blood cell counts at D15 post-injection during the period of peak recovery in f/-;Vav
mice. This temporary variance may be corroborated by earlier studies showing a
defective ability of Arap3-/- neutrophils to respond to injury [Gambardella et al. 2011], as
well as our hypothesis that ARAP3 function may be limited to mature leukocyte lineages
rather than in the primitive HSPC compartment.
2.7 Acute loss of Arap3 in adult mice does not impact hematopoiesis or HSC
function
After investigating genetic loss of Arap3 during embryogenesis and its impact on
adult mouse HSCs under homeostatic and 5-FU-induced stress conditions, we next
explored whether acute loss of Arap3 in adult mice as an alternative form of stress would
affect HSC function. In these studies, we utilized Arap3f/f;Mx1-Cre mice (f/f;Mx1) to
induce Arap3 excision upon pIpC injection in 2-3 month old CKO and control f/f mice.
After induced excision, we measured deletion efficiency at the clonal DNA level (Figure
3.25) and found very efficient deletion in f/f;Mx1 bone marrow cells extending as far as 6
months post-induction. By qRT-PCR, there remained about 5% Arap3 transcript levels
when normalized to f/f controls in the bone marrow after Mx1-driven excision, though the
deletion was specific to Arap3 and not other ARAP family members (Figure 3.26).
Two weeks post-pIpC induction, we found that both control and CKO injected
mice showed anomalies in their hematopoietic compartments due to the side effects of
pIpC (data not shown). Thus, we waited 4-6 weeks post-induction for the mice to return
to a state of homeostasis before assessing the mice. We found normal complete blood
32
counts in the peripheral blood (Figure 3.27) and lineage distribution within the
hematopoietic tissues (Figure 3.28), indicating ARAP3 does not play an essential role in
regulating hematopoiesis despite acute loss in the adult mouse. Moreover, the distribution
of immature HSPC populations within the LSK compartment was indistinguishable
between pIpC-induced f/f and f/f;Mx1 mice (Figure 3.29), further confirming that ARAP3
does not play a role in lineage fate determination and differentiation within the blood
system.
To test whether acute loss of Arap3 affects HSC function, we transplanted LSK
cells isolated from pIpC-treated f/f or f/f;Mx1 mice into irradiated recipients. We found no
differences in donor chimerism (Figure 3.30) and long-term multi-lineage reconstitution
(Figure 3.31) in recipient mice up to 16 weeks post-transplant. Therefore, our studies in
Vav-driven and Mx1-driven Arap3 CKO mice support the conclusion that ARAP3 is not a
necessary component in the regulation of hematopoiesis and HSC function.
3. Discussion
We are the first group to generate a hematopoietic-specific conditional knockout
mouse model of Arap3 to investigate cell-autonomous ARAP3 functions in
hematopoiesis. In this chapter, we demonstrate that f/-;Vav conditional knockout mice are
born alive and healthy, in expected Mendelian ratios, and appear grossly normal. In the
absence of ARAP3, isolated LSK cells from these CKO mice are not functionally
different from their control littermate counterparts, whether in vitro by colony-forming
cell assays or in vivo by competitive bone marrow transplantation. Furthermore, Arap3-/hematopoietic stem cells are functionally competent to self-renew and maintain their
33
HSC pool upon serial transplantation despite a lower frequency of functional HSCs in f/;Vav mice. This indicates that ARAP3 does not play a major role in HSCs.
Under stress conditions induced by 5-FU treatment of f/-;Vav mice, we find no
discernable deficiencies in subsequent hematopoietic recovery. Additionally, acute loss
of Arap3 in the adult mouse using an inducible Mx1-Cre excision model produces intact
HSPCs functionally capable of long-term multi-lineage reconstitution upon
transplantation. Therefore, our studies show that ARAP3 is dispensable for HSC function
in both homeostatic and stress environments.
Although ARAP3 is not a critical cell-intrinsic regulator of HSC homeostasis or
function, it is important to consider that a function for ARAP3 in hematopoietic cells may
be limited to mature differentiated downstream cells, rather than in HSPCs, as we know
that ARAP3 already plays an active role in neutrophil adhesion and chemotaxis
[Gambardella et al. 2011]. The terminally differentiated cells of each lineage of the
hematopoietic system are the cells most actively utilized physiologically, and thus will
require the most active regulation of RhoA and the actin cytoskeleton. Just as RhoA
deletion or use of a dominant-negative RhoA mutant produces different tissue-specific
phenotypic outcomes [Ghiaur et al. 2006, Xu et al. 2003, del Pozo et al. 1999], ARAP3
may also have different functions in a context- or tissue-specific manner. It will be
important to study how pinpointed deletion of Arap3 in lymphoid and non-granulocyte
myeloid lineages will affect those specific cellular functions.
34
Chapter 4:
Non-cell-autonomous roles of ARAP3 in the HSC niche
35
1. Introduction
Hematopoietic stem cells are rare cells that are normally maintained in a quiescent
state within specific HSC niches [Morrison and Scadden 2014, Passegue et al. 2005]. As
such, regulation of the microenvironment is a crucial aspect to the maintenance and
proper functioning of HSCs [Mendelson and Frenette 2014]. There has been much debate
over the source and composition of the adult HSC niche within the bone marrow stroma
[Calvi et al. 2003, Ding et al. 2012, Ding and Morrison 2013, Yamazaki et al. 2011,
Mendez-Ferrer et al. 2008, Katayama et al. 2006, Lymperi et al. 2010, Wang and Wagers
2011, Morrison and Scadden 2014]. It was originally believed to be osteoblastic in nature
[Zhang et al. 2003, Calvi et al 2003], though recent advances in the field present strong
evidence showing osteoblasts do not directly support HSC maintenance in the bone
marrow [Greenbaum et al. 2013, Ding et al. 2012, Ding and Morrison 2013]. Instead,
new studies support the existence of stromal HSC niches that are mostly mesenchymal in
nature and perivascular in localization [Mendez-Ferrer et al. 2010, Sugiyama et al. 2006,
Pinho et al. 2013, Kunisaki et al. 2013, Nombela-Arrieta et al. 2013]. Some studies also
reveal an association between HSCs and sinusoidal endothelium in the bone marrow,
suggesting the endothelium may play a regulatory role within the HSC microenvironment
[Kiel et al. 2005, Himburg et al. 2012, Hooper et al. 2009].
In this chapter, we examine whether ARAP3 plays a role in the HSC
microenvironment as part of the niche that maintains and regulates HSC quiescence,
proliferation, and differentiation. To elucidate any potential non-cell-autonomous
functions of ARAP3 in HSCs, we utilize vascular endothelial cadherin (VEC)-Cre to
36
delete Arap3 in endothelial cells of the HSC niche. VEC-Cre mediates an endothelial cell
deletion starting just before E8 during embryogenesis [Drake and Fleming 2000], and is
shown to be more specific to endothelial cells than Tie2-Cre [Kisanuki et al. 2001, Iurlaro
et al. 2003]. Additionally, because the first HSC arises from the endothelium during
embryonic development, VEC-Cre deletes Arap3 in all subsequent hematopoietic cells of
the adult mouse as well (Figure 4.1). We also utilize paired related homeobox-1 (Prx1)Cre mice to genetically delete Arap3 in osteoblasts and mesenchymal stromal cells of the
HSC niche, shown to induce excision in nearly all osteoblasts and 95% of perivascular
stromal cells in the bone marrow, but not in endothelial cells [Ding and Morrison 2013].
2. Results
2.1 Arap3 is not robustly excised in f/f;VEC mice
Arap3 has previously been ablated in endothelial cells using Tie2-Cre to study
ARAP3 in embryonic angiogenic development [Gambardella et al. 2010]. Since Tie2-Cre
also shows some expression in stromal cells [Kisanuki et al. 2001, Iurlaro et al. 2003], we
utilized VEC-Cre that is found to be more endothelial cell-specific [Alva et al. 2006,
Chen et al. 2009]. Arap3f/f;VEC-Cre (f/f;VEC) mice were born fertile and at expected
Mendelian ratios (Table 4.1). This was surprising given the endothelial developmental
defect that leads to embryonic lethality in germline Arap3-/- mice. However, upon
analysis of deletion efficiency at the clonal DNA level, we observed an average 80%
excision rate in f/f;VEC mice (Figure 4.2). By qRT-PCR, approximately 15% Arap3
transcripts remained in f/f;VEC bone marrow when normalized to levels in control f/f
37
mice, though levels of Arap1 and Arap2 transcripts remain unchanged (Figure 4.3). Thus,
this model, while specific in targeting Arap3, is inefficient in its excision rate.
2.2 Residual Arap3 expression in endothelial cells is sufficient for normal
development
These f/f;VEC mice appear grossly normal and have similar peripheral blood
composition from their control littermates at 6 weeks of age (Figure 4.4) and comparable
hematopoietic tissue composition at 12-16 weeks of age (Figure 4.5). Like f/f;Vav mice,
f/f;VEC mice exhibit no differences in the ability of bone marrow progenitor cells to
differentiate and proliferate in CFC assays (Figure 4.6) and have comparable percentages
of cells in the CD48-CD150+LSK compartment that is enriched for long-term HSCs
(Figure 4.7). Upon transplantation of f/f;VEC LSK cells, these cells engrafted and gave
rise to multi-lineage repopulation of the irradiated hematopoietic compartment in
recipient mice comparably to transplanted LSK cells harvested from control f/f littermates
(Figure 4.9). Donor contribution was indistinguishable in all hematopoietic lineages of
transplanted recipients between f/f;VEC and f/f donor cohorts (Figure 4.8). As expected,
incomplete loss of ARAP3 did not confer differences in donor chimerism or multilineage repopulation upon secondary transplantation as well (Figures 4.10-4.11). From
these studies, residual Arap3 expression is sufficient for the emergence of functionally
normal HSPCs in f/f;VEC CKO mice.
2.3 ARAP3 expression in endothelial cells is important for embryonic development
but not in the adult endothelium to support HSC function
38
Earlier studies of Arap3 conditional knockout using Tie2-Cre resulted in
embryonic lethality only with more robust excision on the f/-, but not f/f, background
[Gambardella et al Sci Sig 2010]. To obtain a more complete deletion of Arap3 in
endothelial cells, we generated Arap3f/-;VEC-Cre (f/-;VEC) mice. These CKO mice were
born at a significantly reduced ratio (Table 4.2). The surviving CKO mice appeared
grossly normal, and showed an average 85% excision efficiency (Figure 4.12), ranging
from 80% to 95%, compared to an average 80% excision rate in f/f;VEC mice (Figure
4.2). By qRT-PCR, an approximate 10% Arap3 transcripts remained in f/-;VEC BM
(Figure 4.13), in contrast to 15% in f/f;VEC BM (Figure 4.3). In agreement with
previously published data [Gambardella et al. 2010], this indicates that ARAP3 function
in endothelial cells is essential for embryonic development.
Surviving f/-;VEC mice were phenotypically normal as characterized by their
peripheral blood and hematopoietic tissue composition (Figures 4.14-4.15). f/-;VEC bone
marrow showed similar progenitor proliferation ability in CFC assays (Figure 4.16) as
well as a normal distribution of HSPCs within the LSK compartment (Figure 4.17)
comparable to both f/f and f/- controls. By limiting dilution assay, we calculated the
frequency of functional HSCs in f/-;VEC mice to be 1 in 55,951 bone marrow cells,
approximately 2.5-fold less than the 1 in 21,215 bone marrow cells HSC frequency in f/mice (Figure 4.18).
To further explore f/-;VEC HSC functions, we performed competitive serial BMT
assays. f/-;VEC LSK cells showed largely normal donor chimerism (Figure 4.19) and
multi-lineage reconstitution (Figure 4.20) in the peripheral blood after transplantation
39
compared to f/- LSK cells. Normal HSC functions were perpetuated in the secondary
transplants (Figures 4.21-4.22), demonstrating f/-;VEC HSCs are capable of long-term
self-renewal and multi-lineage repopulation, and are unaffected by the ablation of Arap3
from the endothelial compartment. Taken together, our investigation establishes that
despite an essential role for ARAP3 in embryonic vascular development [Gambardella et
al. 2010, Kartopawiro et al. 2014], ARAP3 loss in endothelial cells does not functionally
compromise HSCs in adult mouse bone marrow.
2.4 ARAP3 expression in BM endothelial cells is not required to support HSC
homeostasis
To test whether ARAP3 plays a role in the endothelial HSC niche to affect f/;VEC HSC function, we performed reverse BMT assays of wild-type bone marrow cells
from SJL (CD45.1+) mice into f/-;VEC irradiated recipients. 8 weeks post-transplant, we
found similar multi-lineage reconstitution in the peripheral blood (Figure 4.23) and
percentages of CD45.1+ donor-derived LSK and SLAM LSK (CD48-CD150+LSK) cells
in the recipient bone marrow (Figure 4.24), indicating no defects in the native f/-;VEC
HSC microenvironment to support wild-type HSC engraftment, self-renewal,
differentiation and proliferation. When CD45.1+ reconstituted LSK cells were purified
from primary recipients and transplanted into secondary F1 (CD45.1+CD45.2+) wild-type
recipients, there were no differences in the percentage of CD45.1+ donor chimerism in
the repopulated peripheral blood of secondary recipients (Figure 4.25). This demonstrates
the f/-;VEC microenvironment is capable of supporting and maintaining the long-term
functional capacity of wild-type HSCs.
40
Since HSCs first arise from the endothelium during embryonic development, we
also examined immunofluorescence images of f/f;VEC and f/-;VEC embryos at E9.5-10.5
before the lethality timepoint to see whether loss of Arap3 in the endothelium affects
HSC emergence. These embryos were able to form hematopoietic clusters, indicating
emergence is not an issue in these CKO mice. Some hematopoietic clusters were
ectopically expressed throughout the embryo proper in E9.5 embryos, however by E10.5
hematopoietic clusters were present in the major arteries in the expected proportions and
quantities (Figure 4.26). It is evident that ARAP3 is critical to embryonic endothelial
development, as exemplified by delayed vascular development in the E10.5 f/-;VEC
embryo, possibly resulting in the delay of hematopoietic cluster colonization of and
localization to the fetal liver (Figure 4.26).
2.5 ARAP3 may play a pivotal role in Prx1-expressing niche cells to regulate HSC
self-renewal and expansion
We next inquired whether ARAP3 plays a role in the osteoblastic and
mesenchymal stromal cells of the HSC niche using Prx1-Cre driven excision of Arap3.
Arap3f/-;Prx1-Cre (f/-;Prx1) mice were born alive in expected Mendelian ratios and
appeared grossly normal. Hematopoietic development of f/-;Prx1 mice appeared normal
as determined by CBC and lineage distribution in hematopoietic tissues, as well as by
progenitor numbers and function in CFC assays (data not shown). f/-;Prx1 mice also
exhibited normal frequencies of phenotypic HSCs and progenitors as characterized by
flow cytometric analysis (Figure 4.27). Using competitive BMT assays, we found that f/;Prx1 LSK cells engrafted and repopulated comparably to control f/- LSK cells (Figure
41
4.28). These data indicate that loss of ARAP3 in the stromal and osteoblastic HSC niche
minimally impacts homeostatic HSC functions in adult mice.
To determine whether ARAP3 plays a role in the mesenchymal and osteoblastic
HSC niche to act non-cell-autonomously on HSCs, we performed reverse BMT assays of
wild-type bone marrow cells into irradiated f/-;Prx1 recipients. We did not ascertain any
differences in engraftment or multi-lineage repopulation of wild-type HSCs in the f/;Prx1 native microenvironment compared to f/- recipients, as assessed by peripheral
blood reconstitution (Figure 4.29). However, we did observe an expansion of the
CD45.1+ donor-derived SLAM LSK phenotypic HSC population, but not the total
CD45.1+ LSK population in the reconstituted bone marrow (Figure 4.30). This implies an
important role for ARAP3 in the bone marrow niche to regulate HSC self-renewal,
expansion, and possibly quiescence. Taken together, these studies suggest that ARAP3
may non-cell-autonomously regulate phenotypic HSC pool size through its role in Prx1expressing niche cells, though assessment of the functionality of these phenotypic HSCs
by secondary transplantation remains to be determined.
3. Discussion
In this chapter, we present the first study of Arap3 genetic deletion in the adult
mouse endothelium. Previous studies with f/-;Tie2 mice resulted in embryonic lethality at
E11 similar to germline Arap3-/- mice [Gambardella et al. 2010]. Although Tie2-Cre and
VEC-Cre are both expressed in early embryonic development in the endothelium around
E7.5 [Drake and Fleming 2000], their expression patterns and deletion efficiencies are
slightly different. Tie2-Cre is expressed in a small subset of mesenchymal cells in
42
addition to endothelial cells [Kisanuki et al. 2001, Iurlaro et al. 2003] and may give rise
to a more robust phenotype than VEC-Cre. This is a potential reason why we may see a
difference between f/-;Tie2 and f/-;VEC live births.
Here, we present data suggesting that when Arap3 deletion is near 100%, mice are
embryonic lethal, as is evidenced by the reduced rates of f/-;VEC live births (Table 4.2)
and in agreement with previously published data [Gambardella et al. 2010]. However,
when there are residual 5-10% Arap3 transcripts remaining, this is sufficient for
developing embryos to proceed to live birth and resulting adult mice are phenotypically
normal. Additionally, a high efficiency of Arap3 deletion in endothelial cells might still
impact HSCs but may not be apparent in surviving f/-;VEC mice that may have
upregulated compensatory mechanisms to maintain normal HSC functions under
homeostatic and stress hematopoiesis situations. Further studies of HSC emergence and
early development during embryogenesis of f/-;VEC mice may shed some light on the
potential impact of the loss of ARAP3 in endothelial cells on HSC functions.
Reverse transplantation of wild-type HSCs into an Arap3-depleted endothelial
microenvironment did not display altered ability of the host niche to maintain and support
long-term HSC function. However, we show for the first time that ARAP3 has a pivotal
role in the bone marrow stromal microenvironment, particularly in mesenchymal and
osteoblastic cells. Loss of ARAP3 in the HSC niche of host f/-;Prx1 mice results in
significantly expanded SLAM LSK compartments upon transplantation of wild-type bone
marrow cells, while maintaining similar sized LSK compartments as littermate f/- control
hosts. This implies an important role for ARAP3 in maintaining the phenotypic HSC
43
pool. Secondary transplantation of these phenotypic HSCs into irradiated wild-type
recipients will show whether this rapid expansion yields functional HSCs capable of
multi-lineage repopulation of the irradiated hematopoietic compartment. If so, continued
investigation will elucidate the specific cell type and mechanism through which ARAP3
acts to regulate HSC engraftment, survival, and self-renewal to induce this rapid
expansion in the context of an Arap3-deficient niche.
44
Chapter 5:
Arap3 R302,303A knock-in mutation disrupts HSC function
45
1. Introduction
The known mechanism of action of ARAP3 on its Arf and Rho GTPase substrates
is through PI3K-mediated activation upon PIP3 binding and recruitment to the plasma
membrane [Krugmann et al. 2002, Craig et al. 2010]. PIP3 binding is ablated when a
tandem arginine to alanine mutation is introduced at residues R302,R303 in the first PH
domain of the mouse Arap3 allele, preventing ARAP3 activation and subsequent
recruitment to the plasma membrane [Krugmann et al. 2002, Gambardella et al. 2010].
Arap3R302,303A/R302,303A homozygous knock-in mutant mice (KI/KI) phenocopy Arap3-/mice, suggesting an essential role for PI3K-dependent activation of ARAP3
[Gambardella et al. 2010].
In this chapter, we investigate the effect of uncoupling PI3K activation from
ARAP3 function on HSCs and hematopoiesis by employing the KI/KI genetic mutant
model, in which approximately 2-5% of mice are viable [Gambardella et al. 2013].
Viability of rare KI/KI mice is largely dependent upon the background strain of mice.
After backcrossing 8 generations onto a pure C57Bl/6J background, we found that no
KI/KI mice survive to live birth. Therefore, all KI/KI mice used for experimentation
within the scope of this thesis are bred on a mixed Bl6/129 background.
2. Results
2.1 KI/KI mice are born alive at a rare rate but appear grossly normal
When heterozygous KI/+ mice are crossed together, the survival rate is
approximately 2% of all live births (Tables 5.1-5.2). Figure 5.1 shows representative
46
images of wild-type, heterozygous KI/+, and both viable and non-viable KI/KI mutants at
E11.5 of embryonic development. The non-viable KI/KI mutant is shrunken and devoid
of any vasculature or structural development, as magnified at 2x view, while the viable
KI/KI mutant is nearly indistinguishable from wild-type or heterozygous littermates.
Flow cytometric analysis of fetal livers from wild-type, heterozygous KI/+, and
homozygous KI/KI mice at E15.5 show virtually identical distribution of fetal liver
erythroid progenitors at various stages of maturation (Figure 5.2). When KI/+ mice are
crossed to KI/KI mice, the rate of KI/KI viability improves to approximately 15% of all
live births (Table 5.2)
In analyzing viable KI/KI adult mice, these mice were indistinguishable from
control mice in gross appearance as well as by phenotypic characterization of their
peripheral blood by 8-12 weeks of age (Figure 5.3). KI/KI bone marrow also showed
normal progenitor cell numbers and function as determined by CFC assays (Figure 5.4),
and normal percentages of SLAM LSK cells enriched for long-term HSCs as determined
by flow cytometry (Figure 5.5).
2.2 Arap3 R302,303A mutation impairs HSC functions
To evaluate the function of KI/KI mutant HSCs, purified LSK cells from KI/KI
mutant mice or control mice were competitively transplanted into irradiated recipient
mice. Reconstitution in individual recipient mice was followed every 4 weeks posttransplant. We found that KI/KI LSKs displayed a significantly lower donor chimerism in
the total blood (Figure 5.6) as well as all lineages of the peripheral blood (Figure 5.7) in
reconstituted recipient mice compared to controls, but preserved the lineage distribution
47
within donor-derived cells with a slight skewing towards myeloid reconstitution from
KI/KI donors (Figure 5.8). Bone marrow of primary transplanted recipients 12-16 weeks
post-transplantation showed donor-derived cells in total bone marrow as well as the LSK
and SLAM LSK populations were significantly lower in mice transplanted with KI/KI
cells, in comparison to control cells (Figure 5.9).
Four months after the primary transplant, unfractionated bone marrow from
primary recipients was harvested and injected into secondary irradiated recipient mice to
further assess HSC function through serial transplantation. Tertiary transplants were
performed similarly. Peripheral blood and bone marrow HSC reconstitution after each
transplant was analyzed by flow cytometry. We found that the defects in reconstitution of
KI/KI cells were exacerbated upon serial transplantations in both the blood and bone
marrow, indicating compromised HSC self-renewal (Figures 5.10-5.11). Interestingly, the
initial slight myeloid skewing within KI/KI reconstituted mice from the primary
transplant manifested into a significant myeloid bias in the multi-lineage reconstitution of
secondary (Figure 5.12) and tertiary (data not shown) transplanted recipients, reminiscent
of aged HSCs [Janzen et al. 2006, Rossi et al. 2005, Sudo et al. 2000]. The extent of
KI/KI HSC functional defects can be summed up in Figure 5.13, showing the declining
donor chimerism in recipient peripheral blood over the course of serial transplantations.
2.3 Arap3 R302,303A mutation acts cell-autonomously to inhibit HSC functions
Since earlier studies of f/-;Vav mice showed no apparent role for ARAP3 in cellautonomous regulation of HSC function in the absence of ARAP3, we were interested to
understand whether the ubiquitously expressed R302,303A knock-in mutation that
48
uncouples ARAP3 from PI3K-mediated interaction acts in a cell-intrinsic or non-cellintrinsic manner to impede HSC function.
To investigate whether the knock-in mutation acts non-cell-autonomously within
the HSC niche to regulate HSC function, we performed reverse transplantation of
purified wild-type (CD45.1+) LSK cells into irradiated KI/KI and control recipients. At 8
weeks post-transplant, we found similar multi-lineage reconstitution in the peripheral
blood (Figure 5.14) and percentages of CD45.1+ donor-derived LSK and SLAM LSK
cells in the recipient bone marrow (Figure 5.15), indicating no deficiencies in the KI/KI
HSC microenvironment to support the engraftment, self-renewal, and multi-lineage
reconstitution of wild-type HSCs. When CD45.1+ reconstituted LSK cells were purified
from primary recipients and transplanted into secondary F1 (CD45.1+CD45.2+) wild-type
recipients, there were no discernable differences in the percentage of CD45.1+ donor
chimerism in the reconstituted peripheral blood of secondary recipients (Figure 5.16).
This demonstrates the KI/KI mutant microenvironment is capable of supporting and
maintaining the long-term functional capacity of wild-type HSCs.
Thus, the Arap3 knock-in mutation likely does not act to negatively regulate HSC
function through the BM microenvironment, but rather, acts through a cell-autonomous
mechanism in mutant HSCs. Since the knock-in mutation is ubiquitously expressed in
KI/KI mice, these studies do not rule out possible non-cell-autonomous effects of the
R302,303A mutation from sources other than the BM niche to impact HSC function.
3. Discussion
49
In this chapter, we present the first study of hematopoiesis and HSC function in
Arap3 KI/KI mice. We show that KI/KI mice exhibit defective HSC functions upon
transplantation, indicating that PI3K-mediated ARAP3 function is important for HSCs.
Through reverse BMT studies of wild-type HSCs into the KI/KI host microenvironment,
we are able to rule out a role for ARAP3 R302,303A mutant in the HSC niche to regulate
HSC function. Our findings suggest a cell-intrinsic mechanism of action in KI/KI HSCs,
but does not exclude the possibility of other non-cell-intrinsic signals, for example, such
as the possibility of the knock-in mutant playing a role in the adult mouse endothelium to
impact HSCs as was earlier hypothesized with f/-;VEC CKO mice in chapter 4.
It will be important to further study the KI/KI genetic model, despite the
difficulties of rare viability associated with utilizing this system, to decipher the
mechanism of action of the ARAP3 R302,303A mutant. There are a number of possible
explanations for why we see a difference between cell-autonomous regulation of HSCs in
KI/KI mice compared to f/-;Vav CKO mice. 1) A developmental delay could result in
dysregulation of normal homeostatic processes that may indirectly affect HSC
development, maintenance and function in the adult mouse. 2) Ubiquitous expression of
the Arap3 R302,303A mutation means ARAP3 could additionally be acting non-cellautonomously outside of the HSC niche to regulate HSC function. 3) The ARAP3 knockin mutant may sequester or disrupt normal functions of its interacting proteins that may
directly or indirectly regulate HSC function. 4) ARAP3 R302,303A mislocalization away
from the plasma membrane could affect other pathways that control HSC function. 5) In
the absence of intact ARAP3, other compensatory mechanisms may regulate HSC
50
function; however in the presence of full-length but mutated ARAP3 protein, it may act
as a dominant negative mutant. Investigation into each of these possibilities will provide
answers to shape a more complete model of how ARAP3 functions in the hematopoietic
system to regulate hematopoietic stem cell function.
51
Chapter 6:
Conclusions and future perspectives
52
1. Research findings summary
Prior to this thesis study, ARAP3 has never extensively been studied in the
hematopoietic system. ARAP3 was largely studied in vitro [I et al. 2004, Krugmann et al.
2005, Krugmann et al. 2004, Krugmann et al. 2002] and in the endothelium of mouse
embryonic development [Gambardella et al. 2010]. Only recently has ARAP3 been
studied in neutrophils through an inducible knockout system [Gambardella et al. 2011,
Gambardella et al. 2013], however nothing was known about ARAP3 function in the
process of hematopoiesis and in HSC functions. Consequently, the aim of this thesis is to
unveil novel knowledge about ARAP3 in the adult mouse blood system.
The findings presented in this thesis investigate the physiological and functional
role of ARAP3 in hematopoiesis and hematopoietic stem cell function using novel
genetic mouse models. Preliminary studies in vitro in hematopoietic cell lines showed the
potential for ARAP3 to be an important regulator of hematopoiesis, as shRNA-directed
knockdown studies exhibited a suppressed proliferative phenotype in cell lines and
primary mouse bone marrow cells. ShArap3-infected primary cells also did not engraft
and repopulate as efficiently as non-depleted cells upon transplantation. However, the
limitations of shRNA-mediated knockdown in primary HSPCs include inefficient
infection rate, inefficient knockdown, and off-target effects. Therefore, we turned to
genetic ablation of Arap3 using knockout/knock-in mouse models.
When Arap3 was genetically excised from the mouse hematopoietic compartment
using Vav-Cre and Mx1-Cre mediated conditional knockout models, the in vitro
phenotype was not recapitulated in vivo. In fact, HSCs functioned normally in the
53
absence of ARAP3, and we present here that ARAP3 is dispensable for cell-autonomous
regulation of HSC function or steady-state hematopoiesis.
In this thesis, we also investigated whether ARAP3 plays a role in the HSC
microenvironment in the regulation and maintenance of HSC quiescence, self-renewal,
and proliferative abilities. Arap3 excision from the endothelial niche of the bone marrow
by VEC-driven Cre recombinase expression did not disrupt the ability of the Arap3depleted endothelial niche to support or maintain normal HSC functional abilities.
However, our findings did uncover a potential importance for ARAP3 in the osteoblastic
and mesenchymal stromal niches of the bone marrow to support and maintain HSC pool
size. Arap3 excision from Prx1-expressing cells of the bone marrow microenvironment
promoted expansion of the phenotypic HSC compartment, suggesting ARAP3 may play a
role in the niche to regulate HSC quiescence and self-renewal.
Furthermore, the thesis work presented here also uncovers a detrimental hit to
HSC functional ability in the presence of an ARAP3 mutant homozygous for the
R302,303A mutant allele, reiterating the importance of PI3K-mediated activation for
ARAP3 function. These KI/KI mice display a cell-intrinsic defect in HSC self-renewal
and multi-lineage reconstitution, though the scope of our studies has not ruled out
additional non-cell-intrinsic factors that may compound to negatively regulate HSCs, or
dominant negative effects of this mutation rather than the function of the wild-type
ARAP3 protein itself.
This thesis work presents a novel study of ARAP3 in HSCs and the HSC niche.
Taken together, our findings begin to paint a partial picture of how ARAP3 functions in
54
the hematopoietic system. However, further investigation is warranted to decipher the
mechanism of ARAP3 action in hematopoietic stem cells and its interplay with ARAP3
function in the adult bone marrow niche and in the endothelium during embryonic
development.
2. Conclusions and future perspectives
2.1 Cell-autonomous role of ARAP3 in HSCs
In studying cell-autonomous roles of ARAP3 in HSCs, we found that ARAP3 is
dispensable in both homeostatic and stress-induced hematopoiesis. We examined both
steady-state hematopoiesis and 5-FU-induced stress hematopoiesis in f/-;Vav mice and
found no deficiencies in normal HSC functions and hematopoietic recovery after stress
such as 5-FU or transplantation. However, our study of ARAP3 during hematopoietic
stress is by no means exhaustive. Other forms of hematopoietic injury such as
inflammation, radiation, hypoxia or reactive oxygen species [Signer and Morrison 2013,
Suda et al. 2011, Mendelson and Frenette 2014] cause different types of damage or stress
conditions that remain to be examined. It is possible that ARAP3 plays a particularly
defined context-dependent role in specific hematopoietic stress-induced situations.
In previous studies of inducibly deleted Arap3-deficient neutrophils, an inducible
knockout system was utilized wherein a global transient deletion of Arap3 occurs 11-12
days post-tamoxifen induction [Gambardella et al. 2011]. Arap3 is also acutely deleted in
our Mx1-Cre inducible system, though there is a much shorter recovery period (11-12
days as opposed to 4-6 weeks in our f/f;Mx1 mice) before Arap3-/- neutrophils undergo
55
functional tests. The key to revealing a functional role for ARAP3 in HSPCs may thus lie
in provocation with acute loss and short recovery.
Therefore, an important consideration is the upregulation of compensatory
mechanisms that may potentially occur with constitutive loss of Arap3 as opposed to
acute loss. In our f/-;Vav mouse model, Arap3 is excised during development and CKO
mice may have an opportunity to activate compensatory mechanisms internally before the
mouse reaches birth or adulthood. Conversely, with acute Arap3 ablation in f/f;Mx1 mice,
we observed an influx of change in the hematopoietic system within 2 weeks of pIpC
injection due to the upregulation of activated interferons. It will be interesting to examine
HSC function during this 2 week time period to evaluate whether there are functional
differences. In our studies, we waited for the mice to return to a state of
equilibrium/homeostasis (4-6 weeks post injection) and proceeded to look for changes in
HSC function by BMT assay. However, like the Vav-Cre CKO model, perhaps this return
to homeostasis also triggers other compensatory mechanisms in vivo. Alternatively, pIpC
induction can be performed 4-8 weeks post-transplantation [Zhou et al. 2013] to
characterize whether acute ablation of Arap3 in transplanted HSPCs are able to function
normally and carry out long-term repopulation of irradiated recipients.
The findings we present from our in vivo cell-autonomous study of ARAP3 do not
mirror our initial study of Arap3 knockdown in transplanted primary bone marrow cells.
However, the latter experiments were conducted ex vivo, and may not be reflective of its
true physiological relevance. ShRNA knockdown studies are also an imperfect system, as
infection rate and true knockdown of HSCs ex vivo are variable and not 100% efficient. It
56
is also important to consider that shRNAs have off-target effects and are not as specific
as genetic knockout models.
This thesis work presents findings showing no apparent role for ARAP3 in HSCs,
yet previous work shows that ARAP3 plays a role in maintaining neutrophils in their
quiescent pre-activated state [Gambardella et al. 2011]. Thus, we consider the possibility
that ARAP3 plays lineage-specific functional roles in downstream mature blood cells
rather than in the immature HSPC populations in the process of hematopoiesis. In our
studies, the frequencies of mature lineages in the blood and hematopoietic tissues are
largely normal at steady-state; however we have not examined mature blood cell
functions since our studies within the scope of this thesis have focused largely on HSPC
functions. Further study of Arap3-/- lymphoid cell, monocyte, erythrocyte, and
megakaryocyte/platelet functions will unveil a comprehensive understanding of whether
a necessary role for ARAP3 is limited to mature differentiated cell types.
A more pertinent role for ARAP3 limited to more mature lineages is highly
plausible in that changes to the cell actin cytoskeleton are actively occurring in these
cells. For example, neutrophils are attracted to sites of injury or inflammation, where they
must stop their endothelial rolling movement and extravasate out into the tissue at the site
of injury [Butcher 1991]. This process of cell mobility, adherence, and extravasation
requires rapid changes and reorganization of the actin cytoskeleton, and requires high
coordination of RhoA and Arf6 [Worthylake et al. 2001, Weber et al. 2001]. RhoA has
been found to be a critical component of proper leukocyte transendothelial migration
(TEM) [Heemskerk et al. 2014] and epithelial-to-mesenchymal (EMT) transition
57
[Tavares et al. 2006]. Therefore it is likely that RhoA, and in corollary ARAP3, plays an
important role in cell types that require extravasation or shape shifting, particularly in
leukocytes such as neutrophils or macrophages. Correspondingly, this is reflected in our
qRT-PCR analysis of Arap3 expression in the bone marrow that shows the highest Arap3
message levels in myeloid cells.
In HSCs, one function that may require RhoA and actin cytoskeletal
reorganization is the mobilization of HSCs out of the bone marrow niche and into the
peripheral blood [Korbling et al. 1981, Lemoli and D’Addio 2008], normally in response
to stress or to maintain a level of homeostasis. HSC mobilization can be tested with GCSF stimulation [Wright et al. 2001, Sipkins et al. 2005, Ding et al. 2012] to see if loss of
Arap3 results in impaired mobilization due to dysregulation of RhoA.
RhoA has been characterized in vivo to regulate migration and chemotaxis of
mature hematopoietic cells [Xu et al. 2003, Del Pozo et al. 1999], as well as HSPC
engraftment, multi-lineage repopulation and cell survival [Ghiaur et al. 2006, Zhang et al.
2012, Zhou et al. 2013]. ARAP3 is not the only GTPase-activating protein that targets
RhoA. Other GAPs, such as p190B RhoGAP, are also important regulators of HSPC
function mediated through its inactivating activity on RhoA [Xu et al. 2009, Raman et al.
2013]. P190B-/- mice are embryonic lethal, but p190B-/- fetal liver HSCs are functionally
normal and retain their ability for multi-lineage repopulation upon transplantation, though
with increased long-term engraftment and repopulation potential over serial
transplantation [Xu et al. 2009]. However, these mice undergo hematopoietic failure
during development due to a non-cell-autonomous effect from the loss of p190B in
58
mesenchymal stromal cells of the HSC niche, causing altered bone marrow composition
and a switch in mesenchymal stem cells to an osteoblastic or adipocytic fate [Raman et
al. 2013]. While this phenotype is not directly comparable to Arap3-/- mice due to the
differences in embryonic lethality timepoint, both ARAP3 and p190B are GAPs for
RhoA, indicating there could be a correlation between these two proteins, their regulation
of RhoA in the bone marrow niche, and how that regulation affects HSC function. Due to
the large number of regulators for RhoA, it is likely that each acts in its own individual
temporal- and spatial-specific manner. The possibility of redundancies between the
various GAPs also exists [Jeon et al. 2010], such that changing the dynamic by ablating
one GAP is not enough to alter the process of normal hematopoiesis. It would be
interesting to investigate whether deletion of multiple GAPs in hematopoietic cells would
result in greater deficiencies than migration or engraftment alone.
As a dual GTPase-activating protein, ARAP3 targets Arf6 as well as RhoA. Arf6
has mostly been studied in non-hematopoietic cells with regard to its role in membrane
trafficking and the cell actin cytoskeleton [Randazzo and Hirsch 2004, Nie and Randazzo
2006, Randazzo et al. 2007]. Like RhoA, it is actively involved in cell migration,
adhesion, proliferation and cytokinesis [Schweitzer and D’Souza-Schorey 2005,
Knizhnik et al 2011, Randazzo et al. 2000]. However, the potential role of Arf6 in HSPCs
and hematopoiesis has not been well established. One study showed that the decrease of
active Arf6-GTP in platelets is critical to the activation of Rho GTPases that is necessary
for cytoskeletal rearrangements preceding full platelet function [Choi et al. 2006]. It is
important to further investigate and understand the role of Arf6 in hematopoiesis,
59
particularly in HSCs. It is also important to note that regulators of Arf and Rho GTPases
engage in crosstalk within their signaling networks [Guilluy et al. 2011, Boulter et al.
2012, Cherfils and Zeghouf 2013], thus as a regulator of both pathways, ARAP3 may
interact with various different proteins, either directly or indirectly, to enact its function.
Therefore, a genetic study of ARAP3 ablation in hematopoietic cells may not be adequate
to fully uncover its significance and function in the hematopoietic system.
2.2 Non-cell-autonomous roles for ARAP3 in the HSC niche
Our studies reveal a potential non-cell-autonomous role for ARAP3 in
hematopoiesis. Because initial studies in f/-;Tie2 mice [Gambardella et al. 2010] delete
Arap3 in the endothelium and a small subset of mesenchymal cells during development,
we investigated whether isolated loss of Arap3 in mesenchymal cells would result in
HSC defects, both in studying traditional HSC development by looking at native HSC
function in f/-;Prx1 mice and in studying whether the microenvironment is able to
support and maintain wild-type HSC functions by reverse transplantation. In our f/-;Prx1
mice, initial data show that complete ablation of Arap3 in Prx1-expressing cells of the
bone marrow microenvironment results in an expansion of the SLAM LSK compartment,
but not the overall heterogeneous LSK compartment, of wild-type donor cells upon
reverse transplantation, suggesting a role for ARAP3 within the mesenchymal and/or
osteoblastic niche to influence HSC function non-cell-autonomously. Secondary
transplantation of these donor-derived LSK cells still needs to be performed to confirm
whether these expanded SLAM LSK cells are functionally identical to wild-type HSCs.
Additionally, Mx1-Cre also deletes in a subset of mesenchymal stromal cells and
60
osteolineage cells of the HSC niche [Joseph et al. 2013], though we did not test for
efficiency of Arap3 deletion in the niche. It would be insightful to perform a reverse
transplantation of wild-type HSCs into the pIpC-induced f/f;Mx1 microenvironment to
examine if the same expansion of donor wild-type SLAM LSKs occurs as in f/-;Prx1
mice. If so, this would affirm an importance for ARAP3 in the BM mesenchymal niche to
keep HSC self-renewal in check, perhaps as a regulatory mechanism to preserve HSC
function and prevent premature exhaustion.
To further dissect the cell types within the BM niche that ARAP3 may be acting
in to regulate HSC self-renewal and expansion, additional niche cell type-specific genetic
knockout models can be employed. Prx1 is expressed in 95% of mesenchymal stromal
cells and nearly all osteoblasts in the BM niche [Ding and Morrison 2013]. To isolate
these individual cell types, Col2.3-Cre can be utilized to drive excision in osteoblasts,
Sp7-Cre (Osterix-Cre) to drive excision in osteolineage progenitors and CXCL12abundant reticular (CAR) cells, and Lepr-Cre or Nestin-Cre to drive excision in nonoverlapping subsets of mesenchymal stromal cells [Morrison and Scadden 2014, Joseph
et al. 2013]. Whether ARAP3 is necessary in either or both cell types of the BM niche to
non-cell-autonomously regulate HSCs can in turn be utilized to decipher its mechanism
of action.
Endothelial cells are also a critical component of the BM niche, as HSCs have
been found to localize perivascularly in the bone marrow [Kiel et al. 2005, Sugiyama et
al. 2006]. Thus, we utilized VEC-Cre mice to excise Arap3 in endothelial cells, as it has
been shown to be more endothelial-specific than Tie2-Cre [Kisanuki et al. 2001, Iurlaro
61
et al. 2003, Alva et al. 2006, Chen et al. 2009]. In our f/-;VEC mice, Arap3 is deleted
from both the endothelial and hematopoietic compartments, and both forward and reverse
BMTs do not show any significant effects on HSC function due to loss of ARAP3 in the
endothelium. Additionally, through our limiting dilution assays, we determined the
frequency of functional HSCs in f/-;Vav mice to be about 1.5x less than in control mice,
while f/-;VEC mice exhibit about a 2.5-fold reduction in functional HSC frequency.
However, this decrease in functional HSC frequency did not result in differences in
engraftment or multi-lineage repopulation upon transplantation of purified LSK HSPCs,
indicating that the activity of individual HSCs is not affected and therefore can serve to
repopulate irradiated hematopoietic compartments. It is possible that with extended serial
transplantation, we may begin to see differences between control and either f/-;Vav or f/;VEC donor HSPCs as they begin to exhaust faster, if there are truly less functional HSCs
within the phenotypic LSK population. It is intriguing that we failed to detect a change in
phenotypic HSCs by flow cytometry, but found a significant reduction in functional
HSCs using unfractionated total BM cells, signifying an alteration of surface marker
expression on HSPCs in these Arap3-excised CKO mice. Perhaps there is only a
deficiency in stem cell function when there is a limiting dose or frequency of HSCs.
When a threshold level of functional HSCs is reached, repopulation occurs normally,
possibly explaining why we observe no differences in reconstitution after transplantation
of 1000 CKO LSKs in primary and secondary recipients.
Previous studies [Gambardella et al. 2010] showed that ARAP3 is crucial in the
mouse embryonic endothelium for angiogenic formation of the vasculature during
62
development. Our data is consistent with this finding. We showed that f/-;VEC mice have
a drastically reduced survival rate of 10% instead of the expected 25% if born in
Mendelian ratios. However, what our studies uncover is that ARAP3 is not critical in the
adult endothelium to support HSCs. Future studies of ARAP3 in the adult endothelium
need to be undertaken to delineate whether ARAP3 plays an important role in the
endothelium in non-hematopoietic processes. One way to tease out this answer is to
separate the variables and isolate Arap3 endothelial deletion during adulthood only,
instead of creating a conditional knockout model that excises Arap3 during development.
This can be achieved through an inducible endothelial deletion of Arap3 in adult mice
using, for example, VEC-Cre-ERT2. In the proposed genetic model, Arap3 would only be
deleted from the adult endothelium upon tamoxifen induction and would tell us whether
loss of ARAP3 in the endothelium leads to changes in angiogenesis, or perhaps even in
HSC function, with acute deletion of Arap3 in the endothelial bone marrow niche.
However from our reverse transplantation experiments of wild-type cells into f/-;VEC
microenvironments, it is likely that ARAP3 is not a major non-cell-autonomous regulator
of HSC functions in adult BM.
Creating this inducible system will also circumvent the embryonic lethality
caused by constitutive Arap3 knockout, thus focusing exclusively on the importance for
ARAP3 in the adult endothelium as opposed to the embryonic endothelium. Because we
know ARAP3 is such a crucial aspect of endothelial development in the embryo, perhaps
there are residual effects of high Arap3 deletion efficiency in surviving f/-;VEC embryos
that carry over to the HSCs that arise from their endothelium. It is possible that the
63
formation of the first HSCs from the endothelium is a deficient process due to loss of
Arap3, though we know HSC emergence is not an issue from our E10.5 f/-;VEC embryo
imaging in chapter 4. To test whether HSCs that emerge from the endothelium during
embryonic development are functionally deficient to begin with, harvested HSCs from
the fetal livers of E11.5-13.5 embryos can be transplanted into irradiated recipients to
look for multi-lineage reconstitution and assess whether there is a functional difference in
initial HSCs that colonize the fetal liver from the endothelium of f/-;VEC knockout and
f/- and f/f control mice.
Between f/-;Prx1 and f/-;VEC CKO mice, we have covered a large portion of cells
thought to contribute to the HSC niche. However, there are other components of the HSC
niche, including sympathetic nerves, non-myelinating Schwann cells, macrophages,
CXCL12-abundant reticular cells, and adipoctyes [Calvi et al. 2003, Ding et al. 2012,
Ding and Morrison 2013, Yamazaki et al. 2011, Mendez-Ferrer et al. 2008, Katayama et
al. 2006, Morrison and Scadden 2014], that have all been found to be sources and
contributors to HSC niches in context-dependent manners. Therefore, it will be intriguing
to continue study of ARAP3 in the BM microenvironment in these other cell types to see
whether ARAP3 is more broadly essential in the BM niche.
Our data suggest that ARAP3 might play distinct roles in different cell types.
ARAP3 plays a positive role in embryonic endothelial cells to support angiogenesis of
sprouting vessels. ARAP3 might play a positive role in hematopoietic cells to maintain
HSC activity in limiting doses and surface marker expression, based on our limiting
64
dilution BMT data. Moreover, ARAP3 might play a negative role in BM mesenchymal
and/or osteoblastic cells to maintain quiescent HSCs and prevent premature self-renewal.
2.3 ARAP3 R302,303A mutant mice
Our results demonstrate that the ARAP3 R302,303A mutation (KI/KI) that
uncouples PI3K-mediated activation and disrupts ARAP3 recruitment to the plasma
membrane markedly impairs HSC function in a cell-autonomous manner. KI/KI HSCs
show exacerbated reconstitution defects upon serial transplantations. The potential
reasons presented earlier in chapter 5 for the difference in KI/KI and f/-;Vav HSC
phenotypes are: 1) developmental defects, 2) non-cell-autonomous signals from nonhematopoietic KI/KI cells, 3) binding partners sequestered, 4) mislocalization, or 5)
dominant negative mutant. We propose a series of experiments to test these possibilities.
Surviving KI/KI mice are rare, indicating few escape the embryonic lethality that
results from the inability to form vascular structures during development. The ones that
do survive may develop aberrantly, particularly with regard to HSC emergence and early
definitive hematopoiesis that stems directly from the affected vasculature. To bypass this
developmental issue and to circumvent the high embryonic lethality rate at E11 due to
defective angiogenic development, we can create an inducible KI/KI model or a
hematopoietic tissue-specific (i.e. Vav-Cre-ERT2 or Vav-Cre) conditional knock-in
model to study the effect of the R302,303A mutation specifically in HSCs. In so doing,
that system would eliminate developmental defects as a potential contributing factor to
the defective KI/KI HSC phenotype that our studies revealed. This system would also
tease out whether defective KI/KI HSCs are due solely to cell-intrinsic regulation by the
65
R302,303A mutation or through a combination of cell-autonomous and non-cellautonomous signals. Our studies already reveal that the R302,303A mutation in the BM
niche is likely not contributing to HSC functional impairment, as reverse transplantation
into KI/KI niches resulted in functionally normal HSCs. Therefore, if an identical
phenotype arises in hematopoietic-specific KI/KI HSCs, it would indicate the functional
impairment is cell-intrinsic and not due to developmental issues or non-cell-autonomous
signals from other cell types. Alternatively, we could also transplant HSCs from KI/KI
fetal livers to see if they emerge defective during embryogenesis due to developmental
issues or the early influence of mutant ARAP3 in the embryonic endothelium or other
cell types that may affect HSC emergence, colonization of the fetal liver, and expansion
of the HSC pool.
Another possibility for compromised HSCs in KI/KI mice might be that the
ARAP3 R302,303A mutant acts in a dominant negative manner to prevent translocation
of other interacting players (including Vav2, Ship2, Odin, and CIN85) [Kowanetz et al.
2004, Wu et al. 2012, Leone et al. 2009, Raaijmakers et al. 2007, Mercurio et al. 2013] to
the plasma membrane, which may affect HSC function. These proteins have largely been
implicated in motility and endocytic receptor trafficking, but our understanding of their
functions in hematopoietic cells may be incomplete. Although ARAP3 has not been
shown to act as a scaffold for the plasma membrane translocation of any interacting
proteins, and the in vivo relevance of these interactions remains to be tested, the fact that
we see a cell-intrinsic defect with KI/KI HSCs but not with f/-;Vav HSCs in BMT assays
speaks in favor of this possibility. It will be crucial to further study binding partners of
66
ARAP3 to see if deletion or dysregulation by the R302,303A mutant affects those protein
functions. Once a good antibody for ARAP3 immunoprecipitation is developed, the
identification of potentially more binding partners by mass spectrometry will be possible.
Additionally, it will be important to study whether other members of the PI3K pathway
are affected downstream when the PI3K effector ARAP3 is ablated or mutated. We can
also image KI/KI hematopoietic cells to examine where mutant ARAP3 localizes to in the
cells, and whether this mislocalization away from the plasma membrane (and the
potential binding partners it sequesters in the process) also plays a role in how it affects
HSC function.
Often, dominant negative mutations are more deleterious than null mutations or
null alleles. If ARAP3 forms multimers or protein complexes with other potential binding
partners, such as its in vitro heterodimerization with SHIP2 and Odin or interactions with
Vav2 and CIN85 suggest [Kowanetz et al. 2004, Wu et al. 2012, Leone et al. 2009,
Raaijmakers et al. 2007, Mercurio et al. 2013], then the R302,303A mutation could affect
other signal transduction pathways as well. Since KI/KI uncouples PI3K-mediated
activation and prevents inactivation of RhoA and Arf6 at the plasma membrane, it will
also be interesting to observe if point mutations in the RhoA and Arf6 GAP domains of
ARAP3 [I et al. 2004] will produce null alleles or the same effect as KI/KI HSCs. This
will ultimately tell us whether ARAP3 function in HSCs has to do directly with its
function as a dual RhoA/Arf6 GAP, or whether ARAP3 acts indirectly through other
effectors or binding partners that do not involve its RhoA/Arf6 GAP function.
67
To further dissect the relevance of ARAP3 existence in hematopoietic cells, and
specifically HSCs, continued study of the processes and functions that its substrates
RhoA and Arf6 are most actively involved in is necessary. HSCs typically rest in a
quiescent state, but must be functionally capable of self-renewal and multi-lineage
reconstitution when circumstances stimulate these functions. RhoA has been found to be
a critical regulator of mitosis, as its presence is required for cytokinesis of dividing
HSPCs [Zhou et al. 2013]. Perhaps KI/KI HSCs have a more severe phenotype because
the mutation prevents mitosis of self-renewing HSPCs and differentiation into mature
lineages upon transplantation. In f/-;Vav CKO mice, this phenotype could be subtle; in
the absence of intact ARAP3 protein, the fold increase of activated RhoA in bone marrow
cells is not even two-fold. The fold change in RhoA activation of KI/KI bone marrow
cells still remains to be determined. Additionally, when Arap3 is excised during
development, other compensatory mechanisms or other Rho GAPs may take over to
control RhoA activation in HSPCs in the absence of ARAP3. However, with the KI/KI
model, since we believe it is likely acting as a dominant negative mutant, its effects on
cell division could be magnified in HSPCs that must rapidly expand to repopulate an
irradiated hematopoietic compartment after BMT. This may explain why initial primary
BMT recipients exhibit drastically impaired donor chimerism that is perpetuated but not
further reduced in secondary and tertiary BMT recipients. If mitosis and rapid expansion
is impaired in KI/KI HSCs, they may exhibit similar longevity as wild-type HSCs. Other
than mitotic processes during self-renewal and differentiation, HSCs do not involve much
cell shape or actin cytoskeletal remodeling, the main regulatory roles for RhoA and Arf6
in vivo. Still, investigating filamentous actin distribution in CKO versus KI/KI HSPCs
68
may provide insight about whether ARAP3 directly, and perhaps in different manners,
affects actin localization through RhoA and Arf6 regulation in these various transgenic
mice.
Although phenotypic SLAM LSK frequencies in KI/KI mice are comparable to
control mice, it is necessary to perform limiting dilution BMT assays using KI/KI donors
to quantify the frequency of functional HSCs in these mice. If surface marker expression
is altered on KI/KI HSPCs, this may partially explain the reduced donor chimerism after
transplantation with KI/KI LSK donor cells. If HSC frequency remains the same, then
single cell KI/KI HSC BMTs should be performed to test whether the activity of
individual KI/KI HSCs is diminished.
We should also consider the possibility that KI/KI HSCs are impaired in their
ability to home to the recipient BM niche upon transplantation, perhaps due to
impairments in mobilization, homing to the proper niche signals, or adherence to the
niche itself [Ghiaur et al. 2006, Xu et al. 2009]. This is an alternative explanation for why
donor chimerism is low in the primary recipient, but does not dramatically worsen over
serial transplantations nor does it affect multi-lineage reconstitution initially. Therefore,
investigating the number of donor KI/KI HSPCs that home to the bone marrow within 48
hours of transplantation [Yusuf and Scadden 2009] will provide a clearer understanding
of KI/KI HSC functional impairment. In corollary, G-CSF stimulated mobilization of
KI/KI HSCs out of the bone marrow niche and into the peripheral blood will also help
clarify whether the R302,303A mutation hinders HSC mobility.
2.4 Other considerations
69
To understand whether other compensatory mechanisms and protein expression
may be upregulated in the absence of ARAP3, the next step would be to investigate
expression levels of other RhoA and Arf6 regulators and effectors when ARAP3 is
ablated or mutated. Along these lines, ARAP3 is part of a dual-GAP family that also
includes ARAP1 and ARAP2. Although ARAP1 and ARAP2 have been found to target
different GTPase substrates and have varying catalytic activity, they both show high
expression in peripheral blood leukocytes and hematopoietic tissues, though Arap2
message levels were not detected in bone marrow [Miura et al. 2002, Cuthbert et al.
2007, Yoon et al. 2006]. Thus, these three proteins may have overlapping and redundant
roles in hematopoiesis, and may work in conjunction to regulate HSPC function. It will
be interesting to see whether crosstalk of their respective substrate pathways can maintain
normal HSC function in the absence of ARAP3. Thus, genetic studies of mice deficient in
Arap1 or Arap2, or with combination deletions of multiple ARAP proteins would clarify
whether there is a significant role and an additive effect for the ARAP family of proteins
together in hematopoiesis.
Although ARAP3 was first purified from porcine leukocytes for its PIP3 binding
ability [Krugmann et al. 2002], and is highly expressed in hematopoietic tissues
[Krugmann et al. 2002, Gambardella et al. 2010], our studies show that ARAP3 is not a
critical cell-intrinsic regulator of hematopoiesis. ARAP3 does not play a cell-autonomous
role in regulating HSC homeostasis or function, though it is important in the embryonic
endothelium and likely in the bone marrow niche to maintain and support adult HSPCs.
Based on proposed future experiments, new results will clarify whether other
70
compensatory mechanisms and proteins compensate for ARAP3 function in HSCs and
whether ARAP3 in the hematopoietic system is directly influenced by its presence in the
adult endothelium. We will also be able to delineate the mechanism of KI/KI action, and
isolate the variables to separate and explain the different phenotypes in CKO and KI/KI
adult mice versus during embryonic development.
Lastly, ARAP3 has been implicated in the regulation and progression of several
human diseases, including defense against bacterial infection, diabetes and gastric
carcinoma, by capitalizing on the ability of ARAP3 to manipulate vesicle internalization
and cell invasion [Lu et al. 2004, Nandy et al. 2009, Yagi et al. 2011]. Dysregulation of
Rho family GTPases and their regulators have also been correlated with human blood
disorders and tumorigenesis [Cherfils and Zeghouf 2013, Karlsson et al. 2009, Hall 2009,
Lazer and Katzav 2011, Troeger and Williams 2013]. While aberrant expression of
ARAP3 has not yet been found in blood disorders, its ability to regulate the actin
cytoskeleton makes it a potential target for the dysregulation of homeostatic cell
functions. Thus, continued study of ARAP3 in normal and abnormal hematopoiesis will
be important to elucidate a more comprehensive understanding of its role in the blood
system, including in the HSC microenvironment.
71
Chapter 7:
Materials and methods
72
Generation of Arap3 transgenic mice
Arap3flox/flox (f/f) and Arap3KI/KI (KI/KI) mice were generated as described
previously [Gambardella et al. 2010]. Vav-Cre mice were originally generated by Dr.
Thomas Graf [Stadtfeld and Graf 2004] and backcrossed to C57Bl/6J background for 8
generations. VEC-Cre mice were kindly provided by Dr. Nancy Speck [Chen et al. 2009]
and backcrossed to C57Bl/6J background for 8 generations. These two strains of mice,
along with Mx1-Cre, were crossed to generate f/+;Cre mice, which were then crossed to
f/f mice to generate f/f;Cre conditional knockout mice. Initial studies in f/f;Vav, f/f;VEC,
and f/f;Mx1 mice were done in mixed Bl6/129 background, while later studies in f/-;Vav
and f/-;VEC mice were performed on a pure C57Bl/6J background following
backcrossing for 8 generations. f/+ mice on the pure C57Bl/6J background were crossed
with CMV-Cre mice on the C57Bl/6J background (The Jackson Laboratory) to generate
Arap3+/- (+/-) mice. These mice were used to generate f/-;Vav mice, f/-;VEC and f/-;Prx1
conditional knockout mice (all on a pure Bl6 background) that will ensure a more
complete deletion efficiency. Prx1-Cre and Mx1-Cre mice on a C57Bl/6J background
were purchased from The Jackson Laboratory. Wild-type SJL (CD45.1+) used for
transplantations were also purchased from The Jackson Laboratory.
The animal studies were carried out in strict accordance with the
recommendations in the Guide for the Care and Use of Laboratory Animals of the
National Institutes of Health. The protocol was approved by the Institutional Animal Care
and Use Committee of the Children’s Hospital of Philadelphia.
PCR genotyping and qRT-PCR
73
For genotyping and clonal PCR analysis, primers were generated to detect
wildtype, floxed and deleted alleles of Arap3 using DNA isolated from CFU-C assays or
mouse tissues. PCR reactions were performed on a BioRad thermal cycler using the
following primers for Arap3: 5’-AGAGGCTCAGGACTAGAAGGACTA-3’
(Arap3_461F) and 5’-GGGCTGAGTAGAGACT GACGCGCC-3’ (Arap3_EcorV_F)
and 5’-GAGGCCAGCCTGAGATAGATGAAACCC-3’ (Arap3_EcorV_R) in a
0.15:1:0.5 ratio.
For quantitative real-time PCR, total RNA was isolated from FACS-sorted bone
marrow cells, CFC assays or hematopoietic tissues using Trizol Reagent (Invitrogen Life
Technologies) followed by isolation with the RNeasy Mini kit (Qiagen). cDNAs were
produced using BioRad iScript kit and qRT-PCR reactions were performed on an Applied
Biosystems 7900HT real-time PCR system using Sybr-Green detection with the
following primers: Arap3: 5’–CCCTCTGACTGCCATCGA–3’ and 5’–ATTCCAGGTC
ATTACCGGCC–3’; Arap1: 5’-GATGCCGCACTGTCTGTAGCT-3’ and 5’-CTGCTCA
AAGAGTGCCGTGTAC-3’; Arap2: 5’-CGGGACGAATGGCGTATTAG-3’ and 5’TCTCGCCCTGAAACTGAAAGA-3’; Gapdh: 5’–GGAGCGAGACCCCACTAACA–3’
and 5’–TTCACACCCATCACAAACAT–3’. The transcript levels in CKO mice were
first normalized to Gapdh levels, then expressed as a percentage of normalized levels in
control f/f mice.
Complete blood counts
74
Peripheral blood was collected by retro-orbital bleeding into capillary blood
collection tubes with EDTA (Becton Dickinson). CBC analysis was performed using the
mouse setting on a HemaVet 950 machine (Drew Scientific).
Cell sorting and flow cytometry
Cells from either peripheral blood or hematopoietic tissues were lysed of red
blood cells, then stained with surface markers on ice and washed in PBS with 2% bovine
calf serum. Surface markers used to identify cell populations are: CD3e-PE for T-cells,
CD19-APC for B-cells, Gr1-PE and Mac1-APC for myeloid cells (eBiosciences), and
propidium iodide for viability. This method was also used for peripheral blood analysis of
transplanted mice with the addition of CD45.1-PE-Cy7 and CD45.2-FITC antibodies.
Fetal liver cells were stained with CD71-PE and Ter119-PE-Cy7 (eBiosciences) and
analyzed by flow cytometry for erythroblast stages. Flow cytometry was performed on a
FACS Canto analyzer (Becton Dickinson).
For HSPC analysis, total bone marrow cells were flushed from femurs, tibias and
iliac crests of mice. Single-cell suspensions were lysed of red blood cells and stained with
the following primary antibodies: biotinylated lineage cocktail (B220, CD4, CD5, CD8,
CD19, IL-7R, Gr1, Mac1, Ter119), Sca1-PerCP-Cy5.5, cKit-APC-Cy7, CD48-FITC, and
CD150-PE-Cy7 (eBiosciences). Cells were then washed in PBS with 2% bovine calf
serum and stained with streptavidin-PE-TexasRed secondary antibodies. DAPI was used
for viability. Immunophenotypes were defined by signaling lymphocytic activation
molecule (SLAM) family markers [Kiel et al. 2005] CD48-CD150+LSK (SLAM LSK) as
a population enriched for long-term HSCs. CD48-CD150-LSK and CD48+CD150-LSK
75
populations are enriched for HPCs. Flow cytometry was performed on a LSR Fortessa
analyzer (Becton Dickinson).
For cell sorting, bone marrow cells were first depleted of lineage-positive cells
using biotinylated lineage cocktail and streptavidin-coupled Dynabeads (Invitrogen) per
manufacturer’s protocol. Lineage-negative (Lin-) cells were then stained for LSKs as
described above and sorted on a FACS Aria Cell Sorter (Becton Dickinson). All analysis
of FACS data was performed using FlowJo software (TreeStar).
Colony-forming cell (CFC) assays
Unfractionated bone marrow cells or sorted LSK cells were plated at a
concentration of 15,000-20,000 or 200 cells per plate, respectively, in duplicate using
semisolid methylcellulose (Methocult M3434, StemCell Technologies) containing SCF,
IL-3, IL-6 and erythropoietin. Cells were incubated at 37°C, 5% CO2 with high humidity,
and colonies were enumerated after 10-12 days in culture.
Competitive bone marrow transplantation (BMT) and serial BMTs
Bone marrow cells (CD45.2+) were harvested and sorted for LSK surface markers
as described above. 500-1000 LSK cells were mixed with 3-4x105 competitor bone
marrow cells (CD45.1+) and injected into each lethally-irradiated (a split dose of 10Gy,
137
Cs source) [Bersenev et al. 2008] F1 recipient mouse (CD45.1+CD45.2+). Donor-
derived reconstitution in the periphery was measured by flow cytometry every 4 weeks
post-transplant. At 12-16 weeks, recipient mice were sacrificed and analyzed for donor
HSPCs, as described above with the addition of CD45.1-PE and CD45.2-APC antibodies.
76
For secondary transplantation, 2x106 unfractionated bone marrow cells from pooled or
individual primary recipient mice were transplanted into lethally irradiated F1 recipients.
Reconstitution was again measured every 4 weeks post-transplant and data of secondary
transplant endpoints are shown where mentioned. Tertiary transplants were performed
similarly.
Reverse bone marrow transplantations
In reverse BMTs, 1x106 total bone marrow cells from CD45.1+ wild-type donor
SJL mice were transplanted into lethally irradiated f/f and f/- controls or f/f;VEC, f/-;VEC,
and f/-;Prx1 (CD45.2+) CKO recipients. Donor-derived reconstitution in the peripheral
blood and the percentage of CD45.1+ LSK and SLAM LSK cells in the bone marrow of
recipients was measured 8 weeks after transplantation. 2,000-3,000 CD45.1+ LSKs were
sorted from primary recipients and competitively transplanted along with 3.5x105 F1
(CD45.1+CD45.2+) bone marrow cells into irradiated F1 secondary recipients. Donorderived reconstitution was measured in the peripheral blood of secondary transplant
recipients every 4 weeks post-transplant.
For KI/KI reverse BMTs, 104 LSK cells were sorted from SJL mice and
transplanted along with 3x105 F1 competitor cells into KI/KI or KI/+ irradiated
recipients. Reconstitution and donor-derived HSPCs were measured as described above.
Secondary transplants into F1 irradiated recipients were also performed as described
above.
Limiting dilution competitive BMT assay
77
For each BMT experiment, bone marrow cells from control and CKO mice of
each genotype were serially diluted, mixed with 3.5×105 CD45.1+ competitors, and
subsequently transplanted into lethally irradiated recipient mice. We analyzed peripheral
blood chimerism 3-4 months after transplant, and mice with either over 1% donorderived cells in each lineage or over 1% in total donor-descent (CD45.2+) cells in the
peripheral blood were counted as positive reconstitution [Szilvassy et al. 1990].
Calculation of competitive repopulation units was conducted using L-Calc software
(StemCell Technologies).
Immunofluorescence and imaging of embryos
Whole embryos were removed from pregnant dams on specified days of
embryonic development. After dissection, embryos were fixed with 2%
paraformaldehyde on ice for 20 minutes, then washed three times in cold PBS for 10
minutes. The embryos were then kept in 50% methanol on ice for 10 minutes, followed
by 100% methanol on ice, and stored at -20°C in 100% methanol until staining. Embryos
were stained using CD31 for endothelial cells and Runx1 for hematopoietic clusters.
Images were taken on a confocal microscope.
5-fluorouracil (5-FU) hematopoietic stress challenge and recovery
Mice were intraperitoneally injected with a single dose of 150mg/kg 5-FU on D0.
Retro-orbital and tail vein blood was alternately taken on days 0, 2, 5, 8, 11, 15, 21, and
29 after administration and assessed by CBC for recovery.
Neutrophil adhesion assay
78
Neutrophils were isolated from 2-3 month old mice. Femurs and tibias were
flushed with calcium- and magnesium-free Hank’s Balanced Salt Solution (Life
Technologies) with 1% bovine serum albumin (HBSS solution) to prevent neutrophil
activation. Cells were centrifuged at 400g for 10 minutes at 4°C. Pelleted cells were lysed
of erythrocytes and washed with HBSS solution and resuspended in 1-3ml of HBSS
solution. Cells were loaded onto a three-layer Percoll gradient (81%, 62%, 55%
Amersham) diluted in HBSS, then centrifuged at 1500g for 30 minutes at room
temperature. Neutrophils were harvested from the 81%/62% interface and washed with
2ml HBSS solution. Neutrophils were then resuspended in HBSS solution at a
concentration of 106 cells/ml and used for adhesion assay within 6 hours.
For adhesion assays, 24 well non-tissue culture plates (Nunc) were pre-coated
with 20ug/ml polyRGD or blocked with heat inactivated bovine calf serum (Invitrogen)
for 1 hour at 37°C. Bone marrow-derived neutrophils were prewarmed for 5 minutes at
37°C, then 5x106 cells were plated on these 24 well plates for 30 minutes at 37°C before
washing three times with PBS and enumerating the number of adherent cells per field of
view at 20x magnification on a light microscope.
RhoA-GTP pull-down assay
RhoA-GTP was assessed by a RhoA Pull-down Activation Assay Biochem Kit
(Cytoskeleton) according to the manufacturer’s instructions. Unfractionated bone marrow
cells were lysed in buffer containing 0.5% NP-40, phosphatase, and protease inhibitors.
GTP-bound RhoA was then immunoprecipitated from protein supernatants with
glutathione S-transferase-tagged Rhotekin-Rho-binding domain protein bound to
79
glutathione agarose. The beads were washed and precipitates were blotted with a
monoclonal antibody against RhoA. Lysates were blotted with RhoA as a control.
Cell culture and growth assays
32D murine hematopoietic cells with or without mpl expression were stably
infected with short hairpins targeting Arap3 (OpenBiosystems) or a control scrambled
shRNA. Short hairpins contained a puromycin resistance gene or were engineered to coexpress GFP. Cells were cultured in varying concentrations of thrombopoietin or
interleukin-3 where indicated.
To assess proliferation, shRNA-infected cells were either selected by puromycin
for 7 days and then counted every 2 days afterwards on a hemacytometer (Hausser
Scientific), or analyzed every other day by flow cytometry for co-expression of GFP. For
MTT assays (Promega), the protocol was conducted according to the manufacturer’s
protocol. Cells were plated at a concentration of 105 cells/ml in 96-well tissue culture
plates in the presence of cytokines and allowed to proliferate at 37°C for 24-48 hours.
15ul of the Dye Solution was then added to the wells and allowed to incubate at 37°C for
4 hours, at which time 100ul of Stop Solution was added to each well and incubated
overnight at room temperature. Absorbance was read at 570nm using a 96-well plate
reader (Molecular Devices).
Annexin V assay
Assays were carried out in accordance with manufacturer’s protocol (BD
Pharmingen). 32D cells infected with short hairpins co-expressing GFP were cultured for
80
4-7 days. Cells were collected and pelleted by centrifugation, then washed twice with
cold PBS and resuspended in 1X Binding Buffer at a concentration of 106 cells/ml. 100ul
of cells were transferred to a 5ml culture tube and 5ul of Annexin V and 5ul of 7-AAD
was added to the tube, then mixed and incubated for 15 minutes in the dark at room
temperature. 400ul of 1X Binding Buffer was added to each tube and cells were analyzed
by flow cytometry on a FACS Canto analyzer (Becton Dickson).
Bromodeoxyuridine (BrdU) cell cycle analysis
BrdU assays using the APC BrdU Flow Kit (BD Pharmingen) was carried out
according to manufacturer’s protocol. 32D cells infected with short hairpins coexpressing GFP were cultured in the presence of BrdU at a final concentration of 10uM
for 45 minutes at 37°C. BrdU-pulsed cells were then harvested and washed in 1ml of cold
PBS. Pelleted cells were resuspended in 100ul of BD Cytofix/Cytoperm Buffer and
incubated at room temperature for 20 minutes. Cells were washed with 1ml BD
Perm/Wash Buffer and then resuspended in 100ul of BD Cytoperm Plus Buffer for 10
minutes on ice. Cells were again washed with 1ml BD Perm/Wash Buffer and
resuspended in 100ul BD Cytofix/Cytoperm Buffer and incubated for 5 minutes at room
temperature. Cells were washed with 1ml BD Perm/Wash Buffer and resuspended in
100ul of DNase diluted to 300 ug/ml in PBS, then incubated for 1 hour at 37°C. Cells
were washed with 1ml BD Perm/Wash Buffer, resuspended in 50ul of BD Perm/Wash
Buffer containing APC-BrdU antibody, and incubated at room temperature for 20
minutes. Cells were washed in 1ml BD Perm/Wash Buffer and resuspended in buffer
containing 7-AAD solution, then analyzed by FACS Canto analyzer (Becton Dickinson).
81
Western blot
32D culture cells infected with short hairpins targeting Arap3 were washed and
starved in RPMI with 0.5% BSA for 2 hours. The cells were either left unstimulated or
stimulated with 25ng/ml Tpo or 10ng/ml IL-3 for 10 minutes. Cells were then lysed in 10
mM Tris-Cl (pH 7.4), 150 mM NaCl, and 1% NP-40, containing 2 mM each of NaF and
Na3V2O4 plus protease inhibitors (Roche). The samples were run on SDS-PAGE gels
and transferred onto Nitrocellulose membranes. The blots were then probed with the
following antibodies: anti-Stat5 (C-17) rabbit polyclonal antibodies (Santa Cruz
Technology Inc.) and anti–pStat5 (Tyr694), pMAPK (Thr202/Tyr204), p42/44 MAPK,
pAkt (Thr473), and Akt antibodies (Cell Signaling Technology). Unstimulated cells were
also probed for ARAP3 expression using sheep anti-ARAP3 antiserum [Krugmann et al.
2002].
Statistics
Statistical analysis was performed using two-tailed Student’s t tests. P values of
less than 0.05 were considered significant.
82
Chapter 8:
Tables, figures, and legends
83
Tables
Cre strains
Vav-Cre
Mx1-Cre
VEC-Cre
Prx1-Cre
Expression
Turns on around E11.5 in embryo; expressed in more than 99%
of hematopoietic cells by E13.5; deletes in all hematopoietic
cells [Stadtfeld and Graf 2004]
Interferon-inducible expression; expressed in all hematopoietic
cells, a subset of bone marrow mesenchymal stromal cells
including more than 50% of nestin+ cells, perivascular cells,
and osteolineage cells; expressed in other tissues including
liver, kidney, and heart [Park et al. 2012, Kuhn et al. 1995,
Joseph et al. 2013]
Turns on around E7.5-E8 in embryo; deletes in all endothelial
cells and hematopoietic cells [Drake and Fleming 2000, Chen
et al. 2009, Alva et al. 2006]
Turns on around E9.5 in embryo; deletes in 95% of
mesenchymal stromal cells, mostly all osteoblasts, and 50% of
the PDGFRa+Sca1+ mesenchymal stem cell population [Ding
and Morrison 2013, Greenbaum et al. 2013, Logan et al. 2002]
Table 1.1. Expression of various promoter-driven Cre in Arap3 conditional
knockout mouse models.
f/f x f/+;VEC
f/f;VEC
f/+;VEC
f/f
f/+
30/142
(21.1%)
37/142
(26.1%)
36/142
(25.3%)
39/142
(27.5%)
25%
25%
25%
Expected ratios 25%
Table 4.1. f/f;VEC live birth rates. Breeding pairs are labeled in the left column.
Genotypes of expected pups are labeled at the top of each column. Birth rates are
displayed as a percentage and fraction of total pups born alive. Expected Mendelian ratios
are listed below each cross breeding.
84
f/- x f/f;VEC
f/-;VEC
f/f;VEC
f/-
f/f
14/136
(10.3%)
30/136
(22.1%)
45/136
(33.1%)
47/136
(34.6%)
25%
25%
25%
Expected ratios 25%
Table 4.2. f/-;VEC live birth rates. Breeding pairs are labeled in the left column.
Genotypes of expected pups are labeled at the top of each column. Birth rates are
displayed as a percentage and fraction of total pups born alive. Expected Mendelian ratios
are listed below each cross breeding.
KI/KI
KI/+
+/+
Notes
E10.5
1
5
4
1 KI/KI dead
E11.5
4
3
2
3 KI/KI dead
E12.5
0
5
0
E13.5
0
5
1
E14.5
0
10
6
E15.5
1
6
1
Table 5.1. KI/KI embryo survival analysis. Embryos from KI/+ x KI/+ matings
examined for genotype. Embyonic age of embryos labeled in the left column. Genotypes
of embryos/pups are labeled at the top of each column. Notes indicate when KI/KI
embryos were found to be embryonic lethal in utero.
85
KI/KI
KI/+
+/+
KI/+ x KI/+
2/110 (1.8%)
68/110 (61.8%)
40/110 (36.4%)
Expected ratios
25%
50%
25%
KI/+ x KI/KI
38/243 (15.6%)
205/243 (84.4%)
--
Expected ratios
50%
50%
--
Table 5.2. KI/KI live birth rates. Breeding pair genotypes are displayed in the left
column. Genotypes of expected pups are labeled at the top of each column. Birth rates of
each genotype are displayed as a percentage and fraction of total pups born alive.
Expected Mendelian ratios of each genotype are listed below each cross.
86
Figures
Figure 1.1. ARAP3 structural domains. SAM = sterile alpha motif, PH = pleckstrin
homology, GAP = GTPase-activating protein, RA = Ras association domain.
Figure 1.2. PI3K-mediated ARAP3 activity in vivo. PIP3 binds the N-terminus of
ARAP3 in a PI3K-mediated fashion and recruits ARAP3 to the plasma membrane where
it can act on its substrates, Arf6 and RhoA small GTPases.
87
Figure 1.3. GAP proteins inactivate GTPases. Small GTPases act as molecular
switches that cycle between an active GTP-bound form and an inactive GDP-bound form.
GAP proteins hydrolyze GTP to GDP, thus inactivating the GTPase.
88
Figure 1.4. Classical hematopoietic hierarchy. Long-term stem cells retain the ability
to self-renew and give rise to all lineages of the blood. Multi-potent progenitor cells
differentiate into lineage-committed progenitor, eventually giving rise to all mature
lineages of the hematopoietic system.
Figure 1.5. Arap3 transcript expression in the bone marrow. Arap3 transcript levels in
various cell types and subsets of wild-type mouse bone marrow were measured by
quantitative real-time PCR (qRT-PCR), normalized to levels of Gapdh. Cells were sorted
based on the following surface marker expressions: hematopoietic = CD45+, stromal =
CD45-Ter119-VEC-PDGFRab+, endothelial = CD45-Ter119-VEC+PDGFRab+, myeloid =
Gr1+ and Mac1+, lymphoid = CD3+ and CD19+, erythroid = Ter119+, HSPCs = LinSca1+cKit+ (LSK), long-term HSCs = CD48-CD150+LSK.
89
Figure 1.6. Promoter expression of Arap3 CKO mice in various cell types of the HSC
niche. Vav-Cre expresses in all hematopoietic cells. VEC-Cre mediates excision in all
endothelial and hematopoietic cells. Prx1-Cre ablates in osteoblasts and mesenchymal
stromal cells. Mx1-Cre deletes in all hematopoietic cells as well as a subset of
mesenchymal stromal cells/osteolineage cells upon interferon induction.
90
Figure 2.1. Identification of ARAP3 as a protein of interest. Tandem Affinity
Purification (TAP) of epitope- tagged Lnk in hematopoietic cell lines followed by mass
spectrometric analysis. Through this approach we identified ARAP3 as a novel Lnk
binding partner.
91
Figure 2.2. Lnk interacts with endogenous ARAP3. HEL B/A cells stably expressing
Flag-tagged Lnk were either treated with vehicle control or Gleevec 6 hrs before lysis.
Lysates were precipitated with anti-ARAP3 antibodies followed by WB with anti- Flag,
4G10 and ARAP3 antibodies sequentially (top panel), or precipitated with anti-Flag
antibodies followed by WB using anti- ARAP3, 4G10, and Lnk antibodies (bottom
panel). pY: phospho-tyrosine; C: IgG control.
92
Figure 2.3. shArap3 knockdown efficiency. 293T cells were infected with exogenous
mouse ARAP3 protein, and either one of 5 different short hairpins targeting Arap3 or a
control scrambled short hairpin (scr). Whole cell lysates were blotted for ARAP3
expression, with tubulin as a loading control.
Figure 2.4. shArap3 knockdown efficiency of endogenous mouse Arap3 transcripts
in 32D cells. 32D murine hematopoietic cells were infected with shArap3. Cell lysates
were assayed by qRT-PCR for level of Arap3 transcripts remaining, normalized first to
the housekeeping gene Gapdh, and then normalized to Arap3 transcript levels in
uninfected cells.
93
Figure 2.5. MTT growth assay of 32D mpl cells infected with shArap3. 32D cells
were infected with control shScr or short hairpins targeting Arap3, then grown in culture
with increasing concentrations of mouse thrombopoietin (top panel) or interleukin-3
(bottom panel). Cell density was measured by MTT assay.
94
Figure 2.6. shArap3 growth assays by GFP percentage. 32D mpl cells were infected
with short hairpins co-expressing GFP, then cultured in 1ng/ml mTpo (top panel) or
0.1ng/ml IL-3 (bottom panel) for 6 days. The percentage of GFP+ shRNA-expressing
cells was measured every two days, and is represented as a fraction of the percentage of
GFP+ cells on D0 of culture.
95
Figure 2.7. shArap3 growth assays by cell count. 32D mpl cells were infected with
short hairpins and cultured in 1ng/ml mTpo (top panel) or 0.1ng/ml IL-3 (bottom panel)
for 6 days. Cell counts were measured every 2 days in culture.
96
Figure 2.8. Apoptosis in 32D cells expressing shArap3. 32D cells were infected with
short hairpins co-expressing GFP, then assayed for apoptotic cells by flow cytometry
using AnnexinV and 7AAD as markers. The top panel shows percentage of apoptotic
cells within the GFP+ shArap3- or shScr-expressing fraction of cells. The bottom panel
shows percentage of apoptotic cells within the GFP- control uninfected fraction of cells.
n.s. = not significant.
97
98
Figure 2.9. Cell cycle analysis of 32D cells expressing shArap3. 32D cells were
infected with short hairpins co-expressing GFP, then assayed by flow cytometry using
BrdU and 7AAD as markers for the percentage of cells in each phase of the cell cycle,
defined by the gates shown in the top panel. The middle panel shows percentage of cells
within each phase of the cell cycle in the GFP+ shArap3- or shScr-expressing fraction of
cells. The bottom panel shows percentage of cells in each phase within the GFP- control
uninfected fraction of cells.
Figure 2.10. Changes in signaling pathways upon cytokine stimulation of 32D cells
infected with shArap3. 32D mpl cells were infected with short hairpins and stimulated
for 10 minutes with either 10ng/ml IL-3 or 25ng/ml mTpo. Shown are western blots of
whole cell lysates for changes in phosphorylation and activation of STAT5, Akt, and
ERK.
99
Figure 2.11. shArap3 knockdown efficiency in primary bone marrow cells. Murine
bone marrow cells infected with shArap3 were assayed by qRT-PCR for the level of
Arap3 transcripts remaining, normalized first to the housekeeping gene Gapdh, and then
normalized to Arap3 transcript levels in shScr-infected cells.
Figure 2.12. shArap3 knockdown on colony-forming abilities of primary cells.
Murine bone marrow cells infected with shScr or shArap3 were plated on methylcellulose
cultures (CFC assays) and enumerated after 11 days. Shown are total colony counts
normalized to shScr cultures from 4 independent experiments.
100
Figure 2.13. Donor chimerism after transplantation of bone marrow cells infected
with shArap3. Murine bone marrow cells were infected with control (scr) or Arap3targeting (136, 139) short hairpins co-expressing GFP, then transplanted into irradiated
mice. GFP% was measured by flow cytometry in the cells on D0 before transplantation,
then every 4 weeks post-transplantation in the peripheral blood of reconstituted recipient
mice.
Figure 3.1. Clonal analysis of f/f;Vav mice bone marrow deletion efficiency.
Representative PCR genotyping results of individual colonies from CFC assays of f/f;Vav
bone marrow cells are shown. Controls are tail DNA isolated from control and CKO
mice. The top band is floxed Arap3 while the bottom band reflects deleted Arap3.
101
Figure 3.2. qRT-PCR analysis of f/f;Vav bone marrow deletion efficiency. RNA
transcript levels from f/f;Vav mice bone marrow were assayed by qRT-PCR for the
relative transcript levels of Arap1, Arap2, and Arap3 remaining compared to that in f/f
controls. Each symbol represents an individual mouse; horizontal lines indicate mean ±
SEM levels.
Figure 3.3. Complete blood counts of f/f;Vav mice peripheral blood. CBC of f/f
control (white bars) and f/f;Vav CKO mice (black bars). n=17. Graphs show mean ±
SEM.
102
Figure 3.4. Lineage distribution in f/f;Vav hematopoietic tissues. Flow cytometric
analysis of the percentage of various cell populations in the BM, spleen, and thymus of f/f
and f/f;Vav mice. n=17. Graphs show mean ± SEM.
Figure 3.5. CFC assays of f/f and f/f;Vav bone marrow cells. 15,000 total bone marrow
cells (left panel) or 200 LSK cells (right panel) were plated in methylcellulose CFC
103
assays and enumerated after 11 days in culture. n=17 and 3, respectively. Colonies
identified as multipotent myeloid progenitors (GEMM), erythroid (BFU-E), granulocytemonocyte progenitors (GM), granulocyte (G), or monocyte (M). Graphs show mean ±
SEM.
Figure 3.6. SLAM LSK percentage in f/f;Vav mice. The percentage of SLAM LSK
population enriched for long-term hematopoietic stem cells in f/f and f/f;Vav bone
marrow, gated on the Lin-c-Kit+Sca1+ (LSK) population, followed by SLAM markers
CD48-CD150+. Horizontal lines show mean ± SEM.
104
Figure 3.7. Adherence of f/f;Vav neutrophils. Poly-RGD induced adherence of bone
marrow-derived neutrophils from f/f and f/f/;Vav mice was quantified in triplicate as the
number of cells per field of view at 20x magnification. Graphs show mean ± SEM. Pvalues determined by two-tailed Student’s t-test.
Figure 3.8. RhoA-GTP pulldown assay of f/f;Vav bone marrow. Bone marrow cells
from f/f and f/f;Vav mice were assayed for levels of active RhoA-GTP by western blot
(left panel) and the fold change in expression was quantified using ImageJ and
normalized to the levels of RhoA-GTP in f/f bone marrow (right panel). RhoA in the
lysates was blotted as a control.
105
Figure 3.9. f/f and f/f;Vav primary BMT peripheral blood assessment for donor
chimerism. Primary transplantation of LSK cells from f/f and f/f;Vav donor mice.
Peripheral blood of recipient mice assessed at 4, 8, and 12 weeks after primary
transplantation for the percentage of donor-derived leukocytes (left panel). Donor
contribution to myeloid, B-cell, and T-cell compartments in the peripheral blood at the
end of the primary transplants was analyzed by flow cytometry (right panel). Results
pooled from 3 separate experiments. Myeloid: Mac1+; B-cells: CD19+; T-cells: CD3+.
Graphs show mean ± SEM.
106
Figure 3.10. f/f and f/f;Vav primary BMT peripheral blood assessment for lineage
distribution. Bars show lineage distributions within CD45.2 donor-derived cells of
individual recipient mice (left Y-axis), while diamond symbols indicate total donor
leukocyte percentages (right Y-axis) in the peripheral blood, at the end of the primary
transplants. T: CD3+; B: CD19+; M: Mac1+. Results pooled from 3 separate experiments.
Figure 3.11. f/f and f/f;Vav secondary BMT peripheral blood assessment for donor
chimerism. Secondary transplantation of total bone marrow from primary BMT
recipients. Peripheral blood of recipient mice assessed every 4 weeks after secondary
transplantation for donor-derived leukocytes (left panel). Donor contribution to myeloid,
B-cells, and T-cells in the peripheral blood at the end of the secondary transplants was
analyzed by flow cytometry (right panel). Results pooled from 3 separate experiments.
Myeloid: Mac1+; B-cells: CD19+; T-cells: CD3+. Graphs show mean ± SEM.
107
Figure 3.12. f/f and f/f;Vav secondary BMT peripheral blood assessment for lineage
distribution. Bars show lineage distributions within CD45.2 donor-derived cells of
individual recipient mice (left Y-axis), while diamond symbols indicate total donor
leukocyte percentages (right Y-axis) in the peripheral blood, at the end of the secondary
transplants. T: CD3+; B: CD19+; M: Mac1+. Results pooled from 3 separate experiments.
Figure 3.13. Clonal analysis of f/f;Vav and f/-;Vav bone marrow deletion efficiency.
Representative PCR genotyping results of individual colonies from CFC assays of f/-;Vav
108
and f/f;Vav CKO mice. Controls are tail DNA isolated from f/f, f/- and f/-;Vav mice,
showing the Arap3 floxed band (top band) and the Arap3 deleted band (bottom band).
Figure 3.14. qRT-PCR analysis of f/f;Vav and f/-;Vav bone marrow deletion
efficiency. Arap3 RNA transcript levels from BM of f/-, f/f;Vav, and f/-;Vav mice were
assayed by qRT-PCR and first normalized to Gapdh levels. The graph shows the relative
Arap3 transcripts remaining in the CKO mice compared to that in f/f controls. Each
symbol represents an individual mouse; horizontal lines indicate mean ± SEM levels.
109
Figure 3.15. Complete blood counts of f/-;Vav mice peripheral blood. CBC of f/f
(white bars), f/- (crosshatch bars), and f/-;Vav (black bars) mice. n=8. Graphs show mean
± SEM.
Figure 3.16. Lineage distribution in f/-;Vav hematopoietic tissues. Percentage of
various cell populations in the BM and spleen of f/f, f/-, and f/-;Vav mice was analyzed by
flow cytometry, as defined by the surface markers indicated. n=5. Graphs show mean ±
SEM.
Figure 3.17. CFC assays of f/-;Vav bone marrow cells. CFC assays of f/f, f/-, and f/;Vav BM cells were enumerated after 11 days in culture. n=8. Graphs show mean ± SEM.
110
Figure 3.18. Percentage of HSPC populations in f/-;Vav bone marrow. Percentage of
various HSPC populations in the BM from f/f, f/-, and f/-;Vav mice was quantified using
flow cytometry, defined by Lin-Sca1+c-Kit+ (LSK) and the SLAM markers CD48 and
CD150. n=5. Graphs show mean ± SEM.
111
Figure 3.19. HSC frequency in f/-;Vav mice. HSC frequencies quantified using limiting
dilution BMT assays of total bone marrow cells from f/- and f/-;Vav mice. Peripheral
blood of recipient mice were analyzed 3-4 months after transplantation, with mice over
1% donor chimerism in every lineage of the blood (top panel) or over 1% in total donorderived cells (bottom panel) counted as positive reconstitution. HSC frequencies: top
panel: 1 in 42,188 (f/-), 1 in 83,779 (f/-;Vav); bottom panel: 1 in 21,215 (f/-), 1 in 34,853
(f/-;Vav). Results pooled from 3 independent experiments.
Figure 3.20. Vav CKO primary BMT peripheral blood assessment for donor
chimerism. Primary transplantation of LSK cells from f/f and f/- control or f/f;Vav and f/112
;Vav CKO donor mice. Peripheral blood in the recipients was assessed at 4, 8, and 12
weeks after primary transplant from control (CTL = f/f and f/-, white bars) and CKO (KO
= f/f;Vav and f/-;Vav, black bars) donor mice by flow cytometry for the percentage of
donor-derived cells. Data pooled from 3 independent experiments. n=8-15. Graphs show
mean ± SEM.
Figure 3.21. Vav CKO primary BMT peripheral blood assessment for lineage
distribution. Bars show lineage distributions within donor-derived cells of individual
113
recipient mice (top panel) or the average of all recipient mice (bottom panel) at the end of
the primary transplants. T: CD3+; B: CD19+; M: Mac1+. Graphs show mean ± SEM.
Figure 3.22. Vav CKO secondary BMT peripheral blood assessment for donor
chimerism. Secondary transplantation of total bone marrow from primary BMT
recipients. Peripheral blood of recipients assessed at the end of the secondary transplant
for donor chimerism by flow cytometry. CTL = f/f and f/-, white bars; KO = f/f;Vav and
f/-;Vav, black bars. Data pooled from 3 independent experiments. n=8-15. Graphs show
mean ± SEM.
114
Figure 3.23. Vav CKO secondary BMT peripheral blood assessment for lineage
distribution. Bars show average lineage distributions within donor-derived cells of all
recipient mice at the end of the secondary transplants. T: CD3+; B: CD19+; M: Mac1+.
Graphs show mean ± SEM.
Figure 3.24. Hematopoietic recovery following 5-FU-induced stress. f/f, f/-, and f/;Vav mice peripheral blood was assessed by CBC for 29 days following 5-FU injection.
Results pooled from 2 independent experiments, n = 9-18.
115
Figure 3.25. Clonal analysis of f/f;Mx1 mice bone marrow deletion efficiency.
Representative PCR genotyping results of individual colonies from CFC assays of
f/f;Mx1 bone marrow cells are shown after pIpC induction. Controls are tail DNA isolated
from control and CKO mice. The top band is floxed Arap3 while the bottom band reflects
deleted Arap3.
Figure 3.26. qRT-PCR analysis of f/f;Mx1 bone marrow deletion efficiency. RNA
transcript levels from f/f;Mx1 mice bone marrow were assayed by qRT-PCR for the
relative transcript levels of Arap1, Arap2, and Arap3 remaining compared to that in f/f
controls after pIpC induction. Bars show mean ± SEM levels.
116
Figure 3.27. Complete blood counts of f/f;Mx1 mice peripheral blood. CBC of f/f
control (white bars) and f/f;Mx1 CKO mice (black bars) after pIpC induction. n=7.
Graphs show mean ± SEM.
117
Figure 3.28. Lineage distribution in f/f;Mx1 hematopoietic tissues. Flow cytometric
analysis of the percentage of various cell populations in the BM, spleen, and thymus of f/f
and f/f;Mx1 mice after pIpC induction. n=5. Graphs show mean ± SEM.
Figure 3.29. Percentage of HSPC populations in f/f;Mx1 bone marrow. Percentage of
various HSPC populations in the BM from f/f and f/f;Mx1 mice was quantified using flow
cytometry, defined by LSK and the SLAM markers CD48 and CD150. n=5-7. Graphs
show mean ± SEM.
118
Figure 3.30. f/f and f/f;Mx1 primary BMT peripheral blood assessment for donor
chimerism. Primary transplantation of LSK cells from f/f and f/f;Mx1 donor mice.
Peripheral blood of recipient mice assessed at 4, 8, and 16 weeks after primary
transplantation for the percentage of donor-derived leukocytes. Graphs show mean ±
SEM.
Figure 3.31. f/f and f/f;Mx1 primary BMT peripheral blood assessment for lineage
distribution. Bars show average lineage distributions within donor-derived cells of all
recipient mice at the end of the primary transplants. T: CD3+; B: CD19+; M: Mac1+.
Graphs show mean ± SEM.
119
Figure 4.1. VEC-Cre mediates Arap3 excision in all endothelial and hematopoietic
cells. The first HSC emerges from the hemogenic endothelium around E10.5 during
development. Since vascular endothelial cadherin (VEC) expression turns on just before
E8 during embryogenesis, this model deletes in all endothelial and hematopoietic cells.
Figure 4.2. Clonal analysis of f/f;VEC mice bone marrow deletion efficiency.
Representative PCR genotyping results of individual colonies from CFC assays of
f/f;VEC bone marrow cells are shown. Controls are tail DNA isolated from control and
CKO mice. The top band is floxed Arap3 while the bottom band reflects deleted Arap3.
120
Figure 4.3. qRT-PCR analysis of f/f;VEC bone marrow deletion efficiency. RNA
transcript levels from f/f;VEC mice bone marrow were assayed by qRT-PCR for the
relative transcript levels of Arap1, Arap2, and Arap3 remaining compared to that in f/f
controls. Each symbol represents an individual mouse; horizontal lines indicate mean ±
SEM levels.
Figure 4.4. Complete blood counts of f/f;Vav mice peripheral blood. CBC of f/f
control (white bars) and f/f;VEC CKO mice (gray bars). n=12. Graphs show mean ±
SEM.
121
Figure 4.5. Lineage distribution in f/f;VEC hematopoietic tissues. Percentage of
various cell populations in the BM, spleen, and thymus of f/f and f/f;VEC mice. n=12.
Graphs show mean ± SEM.
122
Figure 4.6. CFC assays of f/f and f/f;VEC bone marrow cells. Methylcellulose colony
assays of f/f and f/f;VEC BM cells were enumerated after 11 days in culture. n=12.
Graphs show mean ± SEM.
Figure 4.7. SLAM LSK percentage in f/f;VEC mice. The percentage of the SLAM
LSK population enriched for long-term HSCs in f/f and f/f;VEC bone marrow, gated on
the LSK population, followed by CD48-CD150+. Horizontal lines show mean ± SEM.
Figure 4.8. f/f and f/f;VEC primary BMT peripheral blood assessment for donor
chimerism. Primary transplantation of LSK cells from f/f and f/f;VEC donor mice.
Peripheral blood of recipient mice assessed at 4, 8, and 12 weeks after primary
transplantation for the percentage of donor-derived leukocytes (left panel). Donor
contribution to myeloid, B-cell, and T-cell compartments in the peripheral blood at the
123
end of the primary transplants was analyzed by flow cytometry (right panel). Myeloid:
Mac1+; B-cells: CD19+; T-cells: CD3+. Graphs show mean ± SEM.
Figure 4.9. f/f and f/f;VEC primary BMT peripheral blood assessment for lineage
distribution. Bars show lineage distributions within CD45.2 donor-derived cells of
individual recipient mice (left Y-axis), while diamond symbols indicate total donor
leukocyte percentages (right Y-axis) in the peripheral blood, at the end of the primary
transplant. T: CD3+; B: CD19+; M: Mac1+.
Figure 4.10. f/f and f/f;VEC secondary BMT peripheral blood assessment for donor
chimerism. Secondary transplantation of total bone marrow from primary BMT
124
recipients. Peripheral blood of recipient mice assessed every 4 weeks after secondary
transplantation for donor-derived leukocytes (left panel). Donor contribution to myeloid,
B-cells, and T-cells in the peripheral blood at the end of the secondary transplants was
analyzed by flow cytometry (right panel). Myeloid: Mac1+; B-cells: CD19+; T-cells:
CD3+. Graphs show mean ± SEM.
Figure 4.11. f/f and f/f;VEC secondary BMT peripheral blood assessment for lineage
distribution. Bars show lineage distributions within CD45.2 donor-derived cells of
individual recipient mice (left Y-axis), while diamond symbols indicate total donor
leukocyte percentages (right Y-axis) in the peripheral blood, at the end of the secondary
transplant. T: CD3+; B: CD19+; M: Mac1+.
125
Figure 4.12. Clonal analysis of f/;VEC bone marrow deletion efficiency.
Representative PCR genotyping results of individual colonies from CFC assays of f/;VEC CKO mice. Controls are tail DNA isolated from f/f, f/- and f/-;VEC mice, showing
the Arap3 floxed band (top band) and the Arap3 deleted band (bottom band).
Figure 4.13. qRT-PCR analysis of f f/-;VEC bone marrow deletion efficiency. Arap3
RNA transcript levels from BM of f/- and f/-;VEC mice were assayed by qRT-PCR and
first normalized to Gapdh levels. The graph shows relative Arap3 transcripts remaining
compared to that in f/f controls. Each symbol represents an individual mouse; horizontal
lines indicate mean ± SEM levels.
126
Figure 4.14. Complete blood counts of f/-;VEC mice peripheral blood. CBC of f/f
(white bars), f/- (crosshatch bars), and f/-;VEC (gray bars) mice. n=5. Graphs show mean
± SEM.
Figure 4.15. Lineage distribution in f/-;VEC hematopoietic tissues. Percentage of
various cell populations in the BM and spleen of f/f, f/-, and f/-;VEC mice was analyzed
by flow cytometry, as defined by the surface markers indicated. n=5. Graphs show mean
± SEM.
Figure 4.16. CFC assays of f/-;VEC bone marrow cells. CFC assays of f/f, f/-, and f/;VEC BM cells were enumerated after 11 days in culture. n=5. Graphs show mean ±
SEM.
127
Figure 4.17. Percentage of HSPC populations in f/-;VEC bone marrow. Percentage of
various HSPC populations in the BM from f/f, f/-, and f/-;VEC mice was quantified using
flow cytometry, defined by LSK and the SLAM markers CD48 and CD150. n=5. Graphs
show mean ± SEM.
128
Figure 4.18. HSC frequency in f/-;VEC mice. HSC frequencies quantified using
limiting dilution BMT assays of total bone marrow cells from f/- and f/-;VEC mice.
Peripheral blood of recipient mice were analyzed 3-4 months after transplantation, with
mice over 1% donor chimerism in every lineage of the blood (top panel) or over 1% in
total donor-derived cells (bottom panel) counted as positive reconstitution. HSC
frequencies: top panel: 1 in 42,188 (f/-), 1 in 72,928 (f/-;VEC); bottom panel: 1 in 21,215
(f/-), 1 in 55,951 (f/-;VEC). Results pooled from 4 independent experiments.
Figure 4.19. f/-;VEC primary BMT peripheral blood assessment for donor
chimerism. Primary transplantation of LSK cells from f/f or f/- control and f/-;VEC CKO
129
donor mice. Peripheral blood in the recipients was assessed every 4 weeks post-primary
transplant for the percentage of donor-derived cells. Data pooled from 4 independent
experiments. n=18-24. Graphs show mean ± SEM.
Figure 4.20. f/-;VEC primary BMT peripheral blood assessment for lineage
distribution. Bars show average lineage distributions within donor-derived cells of all
recipient mice at the end of the primary transplants. T: CD3+; B: CD19+; M: Mac1+.
Graphs show mean ± SEM.
Figure 4.21. f/-;VEC secondary BMT peripheral blood assessment for donor
chimerism. Secondary transplantation of total bone marrow from primary BMT
130
recipients. Peripheral blood of recipients assessed at the end of the secondary transplant
for the percentage of donor-derived cells by flow cytometry. Results pooled from 4
independent experiments. n=18-24. Graphs show mean ± SEM.
Figure 4.22. f/-;VEC secondary BMT peripheral blood assessment for lineage
distribution. Bars show average lineage distributions within donor-derived cells of all
recipient mice at the end of the secondary transplants. T: CD3+; B: CD19+; M: Mac1+.
Graphs show mean ± SEM.
131
Figure 4.23. Donor chimerism post-reverse transplantation into VEC CKO mice.
Reverse transplantation of wild-type CD45.1+ bone marrow cells into f/f and f/- control
(SJL:CTL) or f/f;VEC and f/-;VEC CKO (SJL:VEC-CKO) mice were performed. Bars
show average lineage distributions within CD45.1 donor-derived cells of all recipient
mice at 8 weeks post-transplant. T: CD3+; B: CD19+; M: Mac1+. n=9 pooled from two
independent experiments. Graphs show mean ± SEM.
Figure 4.24. Donor-derived HSPCs in bone marrow after reverse transplantation
into VEC CKO mice. Reverse transplantation of wild-type CD45.1+ bone marrow cells
into f/f and f/- control (SJL:CTL) or f/f;VEC and f/-;VEC CKO (SJL:VEC-CKO) mice.
Percentage of CD45.1+ LSK and SLAM LSK cells in the recipient bone marrow was
quantified by flow cytometry 8 weeks post-transplantation. n=9 pooled from two
independent experiments. Graphs show mean ± SEM. P-values determined by Student’s
t-test.
132
Figure 4.25. Reconstitution after reverse secondary transplantation. 2000 CD45.1+
donor LSK cells from primary reverse transplantation recipients were isolated and
competitively transplanted into secondary wild-type recipients to look for functional
reconstitution. Peripheral blood of secondary recipients was assessed every 4 weeks posttransplantation. Dots show individual reconstituted mice; red circles indicate donor LSKs
from f/f and f/- control primary recipients (SJL:CTL), and black squares indicate donor
LSKs from f/f;VEC and f/-;VEC CKO primary recipients (SJL:VEC-CKO). Horizontal
lines represent mean ± SEM.
133
134
135
Figure 4.26. Immunofluorescence imaging of E9.5 and E10.5 VEC CKO embryos for
endothelial and hematopoietic cells. First full panel: E9.5 f/f;VEC, and f/-;VEC embryos
show abnormal and delayed endothelial (CD31+) development compared to f/f controls.
Hematopoietic clusters (Runx1+) should be localized to the AGM region as displayed in
the f/f embryo, but show ectopic expression in the VEC CKO embryos. Second full panel:
E10.5 f/f;VEC and f/-;VEC embryos display hematopoietic clusters in the major arteries
in the expected proportions. The f/-;VEC embryo has a partially fused dorsal aorta,
possibly accounting for the absence of Runx1+ cells in the fetal liver. Inset shows
magnification of the dorsal aorta in f/f;VEC and f/-;VEC embryos compared with a nonlittermate wild-type E10.5 embryo.
Figure 4.27. HSPC populations in f/-;Prx1 mice. Bone marrow cells from f/f control
and f/-;Prx1 CKO mice were quantified for the percentage of cells in various HSPC
populations using LSK and SLAM markers. n=3. Bars show mean ± SEM.
136
Figure 4.28. f/-;Prx1 BMT peripheral blood assessment for lineage distribution.
Primary transplantation of LSK cells from f/f and f/-;Prx1 donor mice. Bars show lineage
distributions within CD45.2 donor-derived cells of individual recipient mice (left Y-axis),
while diamond symbols indicate total donor leukocyte percentages (right Y-axis) in the
peripheral blood, at the end of the primary transplant. T: CD3+; B: CD19+; M: Mac1+.
Figure 4.29. Donor chimerism post-reverse transplantation into Prx1 CKO mice.
Reverse transplantation of wild-type CD45.1+ bone marrow cells into f/- control (SJL:f/-)
or f/-;Prx1 (SJL:f/-;Prx1) mice were performed. Bars show average lineage distributions
137
within CD45.1 donor-derived cells of all recipient mice at 8 weeks post-transplant. T:
CD3+; B: CD19+; M: Mac1+. n=6. Graphs show mean ± SEM.
Figure 4.30. Donor-derived HSPCs in bone marrow after reverse transplantation
into Prx1 CKO mice. Percentage of CD45.1+ LSK and SLAM LSK cells in the control
(SJL:f/-) or CKO (SJL:f/-;Prx1) recipient bone marrow was quantified by flow cytometry
8 weeks post-transplantation. n=6. Graphs show mean ± SEM. P-values determined by
Student’s t-test.
138
Figure 5.1. Light microscope images of E11.5 KI embryos. KI/KI viable embryos at
E11.5 appear more pale than WT or KI/+ heterozygous littermates, with slightly delayed
development. Dead KI/KI embryos at E11.5 are shriveled and devoid of any vasculature
or blood.
139
Figure 5.2. Erythroid development in E15.5 KI fetal livers. Fetal liver cells were
analyzed by flow cytometry for the percentage of cells in various stages of erythroid
differentiation, as fractionated by the surface markers CD71 and Ter119. Bars show
percentage of cells in each erythroblast stage in individual E15.5 embryos.
140
Figure 5.3. Complete blood counts of KI/KI mice peripheral blood. CBC of f/f control
mice (white bars) and KI/KI mutant mice (dotted black bars). n=4. Graphs show mean ±
SEM.
Figure 5.4. CFC assays of f/-;VEC bone marrow cells. Methylcellulose colony assays
of f/f and KI/KI bone marrow cells were enumerated after 11 days in culture. n=3. Graphs
show mean ± SEM.
141
Figure 5.5. SLAM LSK percentage in KI/KI mice. The percentage of the SLAM LSK
population enriched for long-term HSCs in f/f and KI/KI bone marrow, gated on the LSK
population, followed by CD48-CD150+. Horizontal lines show mean ± SEM.
Figure 5.6. KI/KI primary BMT peripheral blood assessment for total donor
chimerism. Primary transplantation of LSK cells from f/f and KI/KI donor mice.
Peripheral blood of recipient mice assessed at 4, 8, and 12 weeks after primary
transplantation for the percentage of donor-derived leukocytes. Results pooled from 2
separate experiments, n=11-14. Graphs show mean ± SEM. P-values determined by twotailed Student’s t-test.
142
Figure 5.7. KI/KI primary BMT peripheral blood assessment for individual lineage
donor chimerism. Donor contribution to myeloid, B-cell, and T-cell compartments in the
peripheral blood at the end of the primary transplants was analyzed by flow cytometry.
Myeloid: Mac1+; B-cells: CD19+; T-cells: CD3+. Graphs show mean ± SEM. P-values
determined by two-tailed Student’s t-test.
Figure 5.8. KI/KI primary BMT donor chimerism in the bone marrow. CD45.2+
donor percentages in the total BM, LSK, and SLAM LSK compartments (CD48CD150+LSK) of the bone marrow were enumerated by flow cytometry at the end of the
primary transplants. Graphs show mean ± SEM. P-values determined by two-tailed
Student’s t-test.
143
Figure 5.9. KI/KI primary BMT peripheral blood assessment for lineage
distribution. Bars show lineage distributions within CD45.2+ donor-derived cells of
individual recipient mice (left Y-axis), while diamond symbols indicate total donor
leukocyte percentages (right Y-axis) in the peripheral blood, at the end of the primary
transplants. T: CD3+; B: CD19+; M: Mac1+.
Figure 5.10. KI/KI secondary BMT peripheral blood assessment for individual
lineage donor chimerism. Secondary transplantation of total bone marrow from primary
BMT recipients. CD45.2+ donor contribution to myeloid, B-cell, and T-cell
compartments in the peripheral blood at the end of the secondary transplants was
144
analyzed by flow cytometry. Myeloid: Mac1+; B-cells: CD19+; T-cells: CD3+. Results
pooled from 2 separate experiments, n=11-14. Graphs show mean ± SEM. P-values
determined by two-tailed Student’s t-test.
Figure 5.11. KI/KI secondary BMT donor chimerism in the bone marrow. CD45.2+
donor percentages in the total BM, LSK, and SLAM LSK compartments (CD48CD150+LSK) of the bone marrow were enumerated by flow cytometry at the end of the
secondary transplants. Graphs show mean ± SEM. P-values determined by two-tailed
Student’s t-test.
145
Figure 5.12. KI/KI secondary BMT peripheral blood assessment for lineage
distribution. Bars show lineage distributions within CD45.2+ donor-derived cells of
individual recipient mice (left Y-axis), while diamond symbols indicate total donor
leukocyte percentages (right Y-axis) in the peripheral blood, at the end of the primary
transplants. T: CD3+; B: CD19+; M: Mac1+.
Figure 5.13. Reconstitution in KI/KI serial transplantations. Peripheral blood
reconstitution in serial transplants was assayed by flow cytometry. 1°: primary; 2°:
secondary; 3°: tertiary BMT. Results pooled from 2 separate experiments, n=11-14.
Graphs show mean ± SEM. P-values determined by two-tailed Student’s t-test.
146
Figure 5.14. Donor chimerism post-reverse transplantation into KI/KI mice. Reverse
transplantation of wild-type CD45.1+ bone marrow cells into control (SJL:CTL) or KI/KI
(SJL:KI) mice were performed. Bars show average lineage distributions within CD45.1+
donor-derived cells of all recipient mice at 8 weeks post-transplant. T: CD3+; B: CD19+;
M: Mac1+. n=6-9 pooled from two independent experiments. Graphs show mean ± SEM.
Figure 5.15. Donor-derived HSPCs in bone marrow after reverse transplantation
into KI/KI mice. Reverse transplantation of wild-type CD45.1+ bone marrow cells into
control (SJL:CTL) or KI/KI (SJL:KI) mice. Percentage of CD45.1+ LSK and SLAM LSK
cells in the recipient bone marrow was quantified by flow cytometry 8 weeks posttransplantation. n=6-9 pooled from two independent experiments. Graphs show mean ±
SEM. P-values determined by Student’s t-test.
147
Figure 5.16. Reconstitution after reverse secondary transplantation. 3000 CD45.1+
donor LSK cells from primary reverse transplantation recipients were isolated and
competitively transplanted into secondary wild-type recipients to look for functional
reconstitution. Peripheral blood of secondary recipients was assessed at 4 and 8 weeks
post-transplantation. Dots show individual reconstituted mice; red circles indicate donor
LSKs from control primary recipients (SJL:CTL), and black squares indicate donor LSKs
from KI/KI primary recipients (SJL:KI). Horizontal lines represent mean ± SEM.
148
Chapter 9:
References
149
1. Adolfsson J, Borge OJ, Bryder D, Theilgaard-Monch K, Astrand-Grundstrom I,
Sitnicka E, Sasaki Y and Jacobsen SE (2001) Upregulation of Flt3 expression within
the bone marrow Lin(-)Sca1(+)c-kit(+) stem cell compartment is accompanied by
loss of self-renewal capacity. Immunity 15: 659-669.
2. Alva JA, Zovein AC, Monvoisin A, Murphy T, Salazar A, Harvey NL, Carmeliet P
and Iruela-Arispe ML (2006) VE-Cadherin-Cre-Recombinase transgenic mouse: a
tool for lineage analysis and gene deletion in endothelial cells. Dev Dyna 235: 759767.
3. Bersenev A, Wu C, Balcerek J and Tong W (2008) Lnk controls mouse
hematopoietic stem cell self-renewal and quiescence through direct interactions with
JAK2. J Clin Invest 118: 2832-2844.
4. Boulter E, Estrach S, Garcia-Mata R and Feral CC (2012) Off the beaten paths:
alternative and crosstalk regulation of Rho GTPases. FASEB J 26: 469-479.
5. Butcher EC (1991) Leukocyte-endothelial cell recognition: three (or more) steps to
specificity and diversity. Cell 67: 1033-1036.
6. Calvi LM, Adams GB, Weibrecht KW, Weber JM, Olson DP, Knight MC, Martin
RP, Schipani E, Divieti P, Bringhurst FR, Milner LA, Kronenberg HM and Scadden
DT (2003) Osteoblastic cells regulate the haematopoietic stem cell niche. Nat Lett
425: 841-846.
7. Cancelas JA, Jansen M and Williams DA (2006) The role of chemokine activation of
Rac GTPases in hematopoietic stem cell marrow homing, retention, and peripheral
mobilization. Exp Hemat 34: 976-985.
8. Cancelas JA, Lee AW, Prabhakar R, Stringer KF, Zheng Y and Williams DA (2005)
Rac GTPases differentially integrate signals regulating hematopoietic stem cell
localization. Nature Med 11: 886-891.
150
9. Chae H, Lee KE, Williams DA and Gu Y (2008) Cross-talk between RhoH and Rac1
in regulation of actin cytoskeleton and chemotaxis of hematopoietic progenitor cells.
Blood 111:2597-2605.
10. Challen GA, Boles N, Lin KK and Goodell MA (2009) Mouse hematopoietic stem
cell identification and analysis. Cytometry A 75: 14-24.
11. Chen MJ, Yokomizo T, Zeigler BM, Dzierzak E and Speck NA (2009) Runx1 is
required for the endothelial to haematopoietic cell transition but not thereafter. Nature
457: 887-892.
12. Cherfils J and Zeghouf M (2013) Regulation of small GTPases by GEFs, GAPs, and
GDIs. Physiol Rev 93: 269-309.
13. Choi W, Karim ZA and Whiteheart SW (2006) Arf6 plays an early role in platelet
activation by collagen and convulxin. Blood 107: 3145-3152.
14. Cowan CW, Shao YR, Sahin M, Shamah SM, Lin MZ, Greer PL, Gao S, Griffith EC,
Brugge JS and Greenberg ME (2005) Vav family GEFs link activated Ephs to
endocytosis and axon guidance. Neuron 46: 205-217.
15. Craig HE, Coadwell J, Guillou H and Vermeren S (2010) ARAP3 binding to
phosphatidylinositol-(3,4,5)-triphosphate depends on N-terminal tandem PH domains
and adjacent sequences. Cell Signal 22: 257-264.
16. Cuthbert EJ, Davis KK and Casanova JE. Substrate specificities and activities of
AZAP family Arf GAPs in vivo (2007) Am J Physiol Cell Physiol 294: C263-C270.
17. De Bruijn MF, Speck NA, Peeters MC and Dzierzak E (2000) Definitive
hematopoietic stem cells first develop within the major arterial regions of the mouse
embryo. EMBO J 19: 2465-2474.
18. De Sauvage FJ, Hass PE, Spencer SD, Malloy BE, Gurney AL, Spencer SA,
Darbonne WC, Henzel WJ, Wong SC, Kuang WJ, et al. (1994) Stimulation of
megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand. Nature 369: 533-538.
151
19. Del Pozo MA, Vicente-Manzanares M, Tejedor R, Serrador JM and Sanchez-Madrid
F (1999) Rho GTPases control migration and polarization of adhesion molecules and
cytoskeletal ERM components in T lymphocytes. Eur J Immunol 29: 3609-3620.
20. Ding L and Morrison SJ (2013) Haematopoietic stem cells and early lymphoid
progenitors occupy distinct bone marrow niches. Nature Lett 495: 231-236.
21. Ding L, Saunders TL, Enikolopov G and Morrison SJ (2012) Endothelial and
perivascular cells maintain haematopoietic stem cells. Nature 481: 457-462.
22. Drake CJ and Fleming PA (2000) Vasculogenesis in the day 6.5 to 9.5 mouse
embryo. Blood 95: 1671-1679.
23. Dzierzak E and Speck NA (2008) Of lineage and legacy: the development of
mammalian hematopoietic stem cells. Nature Immunol 9: 129-136.
24. Etienne-Manneville S and Hall A (2002) Rho GTPases in cell biology. Nature 420:
629-635.
25. Ferkowicz MJ and Yoder MC (2005) Blood island formation: longstanding
observations and modern interpretations. Exp Hematol 33: 1041-1047.
26. Florian MC, Dorr K, Niebel A, Daria D, Schrenzenmeier H, Rojewski M, Filippi MD,
Hasenberg A, Gunzer M, Scharffetter-Kochanek K, Zheng Y and Geiger H (2012)
Cdc42 activity regulates hematopoietic stem cell aging and rejuvenation. Cell Stem
Cell 10: 520-530.
27. Gambardella L, Anderson KE, Jakus Z, Kovacs M, Voigt S, Hawkins PT, Stephens L,
Mocsai A and Vermeren S (2013) Phosphoinositide 3-OH Kinase regulates integrindependent processes in neutrophils by signaling through its effector ARAP3. J
Immunol 190: 381-391.
28. Gambardella L, Anderson KE, Nussbaum C, Segonds-Pichon A, Margarido T,
Norton L, Ludwig T, Sperandio M, Hawkins PT, Stephens LR and Vermeren S
152
(2011) The GTPase-activating protein ARAP3 regulates chemotaxis and adhesiondependent processes in neutrophils. Blood 118: 1087-1098.
29. Gambardella L, Hemberger M, Hughes B, Zudaire E, Andrews S and Vermeren S
(2010) PI3K signaling through the dual GTPase-activating protein ARAP3 is
essential for developmental angiogenesis. Sci STKE 3: ra76.
30. Geiger H and Rudolph KL (2009) Aging in the lympho-hematopoietic stem cell
compartment. Trends Immunol 30: 360-365.
31. Ghiaur G, Lee AW, Bailey J, Cancelas JA, Zheng Y and Williams DA (2006)
Inhibition of RhoA GTPase activity enhances hematopoietic stem and progenitor cell
proliferation and engraftment. Blood 108: 2087-2094.
32. Gottig S, Mobest D, Ruster B, Grace B, Winter S, Seifried E, Gille J, Wieland T and
Henschler R (2006) Role of the monomeric GTPase Rho in hematopoietic progenitor
cell migration and transplantation. Eur J Immunol 36: 180-189.
33. Greenbaum A, Hsu YS, Day RB, Schuettpelz LG, Christopher MJ, Borgerding JN,
Nagasawa T and Link DC (2013) CXCL12 in early mesenchymal progenitors is
required for haematopoietic stem-cell maintenance. Nature Lett 495: 227-231.
34. Greenberger JS, Sakakeeny MA, Humphries RK, Eaves CJ and Eckner RJ (1983)
Demonstration of permanent factor-dependent multipotential
(erythroid/neutrophil/basophil) hematopoietic progenitor cell lines. Proc Natl Acad
Sci 80: 2931-2935.
35. Groopman JE, Molina JM and Scadden DT (1989) Hematopoietic growth factors.
Biology and clinical applications. NEJM 321: 1449-1459.
36. Gu Y, Filippi MD, Cancelas JA, Siefring JE, Williams EP, Jasti AC, Harris CE, Lee
AW, Prabhakar R, Atkinson SJ, Kwiatkowski DJ and Williams DA (2003)
Hematopoietic cell regulation by Rac1 and Rac2 guanosine triphosphatases. Science
302: 445-449.
153
37. Guilluy C, Garcia-Mata R and Burridge K (2011) Rho protein crosstalk: another
social network? Trends Cell Biol 21: 718-726.
38. Guo F, Velu CS, Grimes HL and Zheng Y (2009) Rho GTPase Cdc42 is essential for
B-lymphocyte development and activation. Blood 114: 2909-2916.
39. Hall, A (1998) Rho GTPases and the actin cytoskeleton. Science 279: 509-514.
40. Hall A (2009) The cytoskeleton and cancer. Cancer Metastasis Rev 28: 5-14.
41. Haneline LS, Gobbett TA, Ramani R, Carreau M, Buchwald M, Yoder MC and Clapp
DW (1999) Loss of FancC function results in decreased hematopoietic stem cell
repopulating ability. Blood 94: 1-8.
42. Harrison DE and Lerner CP (1991) Most primitive hematopoietic stem cells are
stimulated to cycle rapidly after treatment with 5-fluorouracil. Blood 78: 1237-1240.
43. Heemskerk N, van Rijssel J and van Buul JD (2014) Rho-GTPase signaling in
leukocyte extravasation: an endothelial point of view. Cell Adh Migr 8: 67-75.
44. Himburg HA, Harris JR, Ito T, Daher P, Russell JL, Quarmyne M, Doan PL, Helms
K, Nakamura M, Fixsen E, Herradon G, Reya T, Chao NJ, Harroch S and Chute JP
(2012) Pleiotrophin regulates the retention and self-renewal of hematopoietic stem
cells in the bone marrow vascular niche. Cell Rep 2: 964-975.
45. Hooper AT, Butler JM, Nolan DJ, Kranz A, Iida K, Kobayashi M, Kopp HG, Shido
K, Petit I, Yanger K, James D, Witte L, Zhu Z, Wu Y, Pytowski B, Rosenwaks Z,
Mittal V, Sato TN and Rafii S (2009) Engraftment and reconstitution of
hematopoiesis is dependent on VEGFR2-mediated regeneration of sinusoidal
endothelial cells. Cell Stem Cell 4: 263-274.
46. Hunter SG, Zhuang G, Brantley-Sieders D, Swat W, Cowan CW and Chen J (2006)
Essential role of Vav family guanine nucleotide exchange factors in EphA receptormediated angiogenesis. Mol Cell Biol 26: 4830-4842.
154
47. I STT, Nie Z, Stewart A, Najdovska M, Hall NE, He H, Randazzo PA and Lock P
(2004) ARAP3 is transiently tyrosine phosphorylated in cells attaching to fibronectin
and inhibits cell spreading in a RhoGAP-dependent manner. J Cell Sci 117: 60716084.
48. Iurlaro M, Scatena M, Zhu W, Fogel E, Wieting SL and Nicosia RF (2003) Rat aortaderived mural precursor cells express the Tie2 receptor and respond directly to
stimulation by angiopoietins. J Cell Sci 116: 3635-3643.
49. Janzen V, Forkert R, Fleming HE, Saito Y, Waring MT, Dombkowski DM, Cheng T,
DePinho RA, Sharpless NE and Scadden DT (2006) Stem-cell ageing modified by the
cyclin-dependent kinase inhibitor p16INK4a. Nature 443: 421–426.
50. Jeon CY, Kim HJ, Morii H, Mori N, Settleman J, Lee JY, Kim J, Kim SC and Park
JB (2010) Neurite outgrowth from PC12 cells by basic fibroblast growth factor
(bFGF) is mediated by RhoA inactivation through p190RhoGAP and ARAP3. J Cell
Physiol 224: 786-794.
51. Joseph C, Quach JM, Walkley CR, Lane SW, Celso CL and Purton LE (2013)
Deciphering hematopoietic stem cells in their niches: a critical appraisal of genetic
models, lineage tracing, and imaging strategies. Cell Stem Cell 13: 520-533.
52. Kalfa TA, Pushkaran S, Zhang X, Johnson JF, Pan D, Daria D, Geiger H, Cancelas
JA, Williams DA and Zheng Y (2010) Rac1 and Rac2 GTPases are necessary for
early erythropoietic expansion in the bone marrow but not in the spleen.
Hematologica 95: 27-35.
53. Karlsson R, Pedersen ED, Wang Z and Brakebusch C (2009) Rho GTPase function in
tumorigenesis. Biochim Biophys Acta 1796: 91-98.
54. Kartopawiro, J, Bower NI, Karnezis T, Kazenwadel J, Betterman KL, Lesieur E,
Koltowska K, Astin J, Crossier P, Vermeren S, Achen MG, Stacker SA, Smith KA,
Harvey NL, Francois M and Hogan BM (2014) Arap3 is dysregulated in a mouse
155
model of hypotrichosis-lymphedema-telangiectasia and regulates lymphatic vascular
development. Hum Mol Genet 23: 1286-1297.
55. Katayama Y, Battista M, Kao WM, Hidalgo A, Peired AJ, Thomas SA and Frenette
PS (2006) Signals from the sympathetic nervous system regulate hematopoietic stem
cell egress from bone marrow. Cell 124: 407-421.
56. Kaushansky K, Lok S, Holly RD, Broudy VC, Lin N, Bailey MC, Forstrom JW,
Buddle MM, Oort PJ, Hagen FS, et al. (1994) Promotion of megakaryocyte
progenitor expansion and differentiation by the c-Mpl ligand thrombopoietin. Nature
369: 568-571.
57. Kennedy M, Firpo M, Choi K, Wall C, Robertson S, Kabrun N and Keller G (1997)
A common precursor for primitive erythropoiesis and definitive haematopoiesis.
Nature 386: 488-493.
58. Kiel MJ, Yilmaz OH, Iwashita T, Yilmaz OH, Terhorst C and Morrison SJ (2005)
SLAM family receptors distinguish hematopoietic stem and progenitor cells and
reveal endothelial niches for stem cells. Cell 121: 1109-1121.
59. Kinder SJ, Tsang TE, Quinlan GA, Hadjantonakis AK, Nagy A and Tam PP (1999)
The orderly allocation of mesodermal cells to the extraembryonic structures and the
anteroposterior axis during gastrulation of the mouse embryo. Dev 126: 4691-4701.
60. Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson RA and
Yanagisawa M (2001) Tie2-Cre transgenic mice: a new model for endothelial celllineage analysis in vivo. Dev Biol 230:230-242.
61. Kissa K and Herbomel P (2010) Blood stem cells emerge from aortic endothelium by
a novel type of cell transition. Nature 464: 112-115.
62. Knizhnik AV, Kovaleva OV, Komelkov AV, Trukhanova LS, Rybko VA,
Zborovskaya IB and Tchevkina EM (2011) Arf6 promotes cell proliferation via the
PLD-mTORC1 and p38MAPK pathways. J Cell Biochem 113: 360-371.
156
63. Kops GJ and Burgering BM (1999) Forkhead transcription factors: new insights into
protein kinase B (c-akt) signaling. J Mol Med 77: 656-665.
64. Korbling M, Burke P, Braine H, Elfenbein G, Santos G and Kaizer H (1981)
Successful engraftment of blood derived normal hemopoietic stem cells in chronic
myelogenous leukemia. Exp Hematol 9: 684-690.
65. Kowanetz K, Husnjak K, Holler D, Kowanetz M, Soubeyran P, Hirsch D, Schmidt
MH, Pavelic K, De Camilli P, Randazzo PA and Dikic I (2004) CIN85 associates
with multiple effectors controlling intracellular trafficking of epidermal growth factor
receptors. Mol Biol Cell 15: 3155-3166.
66. Krugmann S, Anderson KE, Ridley SH, Risso N, McGregor A, Coadwell J, Davidson
K, Eguinoa A, Ellson CD, Lipp P, Manifava M, Ktistakis N, Painter G, Thuring JW,
Cooper MA, Lim ZY, Holmes AB, Dove SK, Michell RH, Grewal A, Nazarin A,
Erdjument-Bromage H, Tempst P, Stephens LR and Hawkins PT (2002)
Identification of ARAP3, a novel PI3K effector regulating both Arf and Rho
GTPases, by selective capture on phosphoinositide affinity matrices. Mol Cell 9: 95108.
67. Krugmann S, Andrews S, Stephens L and Hawkins PT (2005) ARAP3 is essential for
formation of lamellipodia after growth factor stimulation. J Cell Sci 119: 425-432.
68. Krugmann S, Stephens LR and Hawkins PT (2006) Purification of ARAP3 and
characterization of GAP activities. Methods Enzymol 406: 91-103.
69. Krugmann S, Williams R, Stephens LR and Hawkins PT (2004) ARAP3 is a PI3Kand Rap-regulated GAP for RhoA. Curr Biol 14: 1380-1384.
70. Kuhn R, Schwenk F, Aguet M, and Rajewsky K (1995) Inducible gene targeting in
mice. Science 269: 1427–1429.
157
71. Kunisaki Y, Bruns I, Scheiermann C, Ahmed J, Pinho S, Zhang D, Mizoguchi T, Wei
Q, Lucas D, Ito K, Mar JC, Bergman A and Frenette PS (2013) Arteriolar niches
maintain haematopoietic stem cell quiescence. Nature 502: 637-643.
72. Lazer G and Katzav S (2011) Guanine nucleotide exchange factors for RhoGTPases:
good therapeutic targets for cancer therapy? Cell Signal 23: 969-979.
73. Leko V, Varnum-Finney B, Li H, Gu Y, Flowers D, Nourigat C, Bernstein ID and
Bedalov A (2012) SIRT1 is dispensable for function of hematopoietic stem cells in
adult mice. Blood 119: 1856-1860.
74. Lemoli RM and D’Addio A (2008) Hematopoietic stem cell mobilization.
Haemtologica 93: 321-324.
75. Leone M, Cellitti J and Pellecchia M (2009) The Sam domain of the lipid
phosphatase Ship2 adopts a common model to interact with Arap3-Sam and EphA2Sam. BMC Struct Biol 9:59.
76. Logan M, Martin JF, Nagy A, Lobe C, Olson EN and Tabin CJ (2002) Expression of
cre recombinase in the developing mouse limb bud driven by a Prx1 enhancer.
Genesis 33: 77-80.
77. Lu Q, Wei W, Kowalski PE, Chang AY and Cohen SN (2004) EST-based genomewide gene inactivation identifies ARAP3 as a host protein affecting cellular
susceptibility to anthrax toxin. Proc Natl Acad Sci 101: 17246-17251.
78. Lymperi S, Ferraro F and Scadden DT (2010) The HSC niche concept has turned 31.
Has our knowledge matured? Ann NY Acad Sci 1192: 12-18.
79. Marignani PA and Carpenter CL (2001) Vav2 is required for cell spreading. J Cell
Biol 154: 177-186.
80. Medvinsky A and Dzierzak E (1996) Definitive hematopoiesis is autonomously
initiated by the AGM region. Cell 86: 897-906.
158
81. Mendelson A and Frenette PS (2014) Hematopoietic stem cell niche maintenance
during homeostasis and regeneration. Nat Med 20: 833-846.
82. Mendez-Ferrer S, Lucas D, Battista M and Frenette PS (2008) Haematopoietic stem
cell release is regulated by circadian oscillations. Nature 452: 442-447.
83. Mercurio FA, Marasco D, Pirone L, Scognamiglio PL, Pedone EM, Pellecchia M, and
Leone M (2013) Heterotypic Sam-Sam association between Odin-Sam1 and Arap3Sam: binding affinity and structural insights. Chembiochem 14: 100-106.
84. Miura K, Jacques KM, Stauffer S, Kubosaki A, Zhu K, Hirsch DS, Resau J, Zheng Y
and Randazzo PA (2002) ARAP1: A point of convergence for Arf and Rho signaling.
Mol Cell 9: 109-119.
85. Moore CB, Guthrie EH, Huang MT and Taxman DJ (2010) Short hairpin RNA
(shRNA): design, delivery, and assessment of gene knockdown. Methods Mol Biol
629: 141-158.
86. Morrison SJ and Scadden DT (2014) The bone marrow niche for haematopoietic stem
cells. Nature Rev 505: 327-334.
87. Muller AM, Medvinsky A, Strouboulis J, Grosveld F and Dzierzak E (1994)
Development of hematopoietic stem cell activity in the mouse embryo. Immunity 1:
291-301.
88. Mulloy JC, Cancelas JA, Filippi MD, Kalfa TA, Guo F and Zheng Y (2010) Rho
GTPases in hematopoiesis and hemopathies. Blood 115: 936-947.
89. Murali A and Rajalingam K (2014) Small Rho GTPases in the control of cell shape
and mobility. Cell Mol Life Sci 71: 1703-1721.
90. Nagy A (2000) Cre recombinase: the universal reagent for genome tailoring. Genesis
26: 99-109.
159
91. Nandy D, Asmann YW, Mukhopadhyay D and Basu A (2009) Role of AKT-glycogen
synthase kinase axis in monocyte activation in human beings with and without type 2
diabetes. J Cell Mol Med 14: 1396-1407.
92. Nie Z and Randazzo PA (2006) Arf GAPs and membrane traffic. J Cell Sci 119:
1203-1211.
93. Nombela-Arrieta C, Pivarnik G, Winkel B, Canty KJ, Harley B, Mahoney JE, Park
SY, Lu J, Protopopov A and Silberstein LE (2013) Quantitative imaging of
haematopoietic stem and progenitor cell localization and hypoxic status in the bone
marrow microenvironment. Nat Cell Biol 15: 533-543.
94. Oguro H, Ding L and Morrison SJ (2013) SLAM family markers resolve functionally
distinct subpopulations of hematopoietic stem cells and multipotent progenitors. Cell
Stem Cell 13: 102-116.
95. Orkin SH (1995) Hematopoiesis: how does it happen? Curr Opin Cell Biol 7: 870877.
96. Orkin SH and Zon LI (2008) Hematopoiesis: an evolving paradigm for stem cell
biology. Cell 132: 631-644.
97. Osawa M, Hanada K, Hamada H and Nakauchi H (1996) Long-term
lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic
stem cell. Science 273: 242-245.
98. Park D, Spencer JA, Koh BI, Kobayashi T, Fujisaki J, Clemens TL, Lin CP,
KRonenberg HM and Scadden DT (2012) Endogenous bone marrow MSCs are
dynamic, fate-restricted participants in bone maintenance and regeneration. Cell Stem
Cell 10: 259-272.
99. Passegue E, Wagers AJ, Giuriato S, Anderson WC and Weissman IL (2005) Global
analysis of proliferation and cell cycle gene expression in the regulation of
hematopoietic stem and progenitor cell fates. J Exp Med 202: 1599-1611.
160
100.
Pesesse X, Moreau C, Drayer AL, Woscholski R, Parker P and Erneux C (1998)
The SH2 domain containing inositol 5-phosphatase SHIP2 displays
phosphatidylinositol 3,4,5-trisphosphate and inositol 1,3,4,5-tetrakisphosphate 5phosphatase activity. FEBS Lett 437: 301-303.
101.
Pinho S, Lacombe J, Hanoun M, Mizoguchi T, Bruns I, Kunisaki Y and Frenette
PS (2013) PDGFRα and CD51 mark human nestin+ sphere-forming mesenchymal
stem cells capable of hematopoietic progenitor cell expansion. J Exp Med 210: 13511367.
102.
Purton LE and Scadden DT (2007) Limiting factors in murine hematopoietic stem
cell assays. Cell Stem Cell 1: 263-270.
103.
Raaijmakers JH, Deneubourg L, Rehmann H, de Koning J, Zhang Z, Krugmann
S, Erneux C, and Bos JL (2007) The PI3K effector Arap3 interacts with the
PI(3,4,5)P3 phosphatase SHIP2 in a SAM domain-dependent manner. Cell Signal 19:
1249-1257.
104.
Raman R, Kumar RS, Hinge A, Kumar S, Nayak R, Xu J, Szczur K, Cancelas JA
and Filippi MD (2013) p190-B RhoGAP regulates the functional composition of the
mesenchymal microenvironment. Leukemia 27: 2209-2219.
105.
Randazzo PA and Hirsch DS (2004) Arf GAPs: multifunctional proteins that
regulate membrane traffic and actin remodeling. Cell Signal 16: 401-413.
106.
Randazzo PA, Inoue H and Bharti S (2007). Arf GAPs as regulators of the actin
cytoskeleton. Biol Cell 99: 583-600.
107.
Randazzo PA, Nie Z, Miura K and Hsu VW (2000) Molecular aspects of the
cellular activities of ADP-ribosylation factors. Sci STKE 2000: re1.
108.
Rossi DJ, Bryder D, Zahn JM, Ahlenius H, Sonu R, Wagers AJ and Weissman IL
(2005) Cell intrinsic alterations underlie hematopoietic stem cell aging. Proc Natl
Acad Sci 102: 9194-9199.
161
109.
Schweitzer JK and D’Souza-Schorey C (2005) A requirement for Arf6 during the
completion of cytokinesis. Exp Cell Res 311: 74-83.
110.
Seger R and Krebs EG (1995) The MAPK signaling cascade. FASEB J 9: 726-
735.
111.
Signer RA and Morrison SJ (2013) Mechanisms that regulate stem cell aging and
life span. Cell Stem Cell 12: 152-165.
112.
Singh SK, Williams CA, Klarmann K, Burkett SS, Keller JR and Oberdoerffer P
(2013) Sirt1 ablation promotes stress-induced loss of epigenetic and genomic
hematopoietic stem and progenitor cell maintenance. J Exp Med 210: 987-1001.
113.
Sipkins DA, Wei X, Wu JW, Runnels JM, Cote D, Means TK, Luster AD,
Scadden DT and Lin CP (2005) In vivo imaging of specialized bone marrow
endothelial microdomains for tumour engraftment. Nature 435: 969-973.
114.
Stadtfeld M and Graf T (2004) Assessing the role of hematopoietic plasticity for
endothelial and hepatocyte development by non-invasive lineage tracing. Dev Biol
132: 203-213.
115.
Stapleton D, Balan I, Pawson T and Sicheri F (1999) The crystal structure of an
Eph receptor SAM domain reveals a mechanism for modular dimerization. Nat Struct
Biol 6: 44-49.
116.
Suda T, Takubo K and Semenza GL (2011) Metabolic regulation of
hematopoietic stem cells in the hypoxic niche. Cell Stem Cell 9: 298-310.
117.
Sudo K, Ema H, Morita Y and Nakauchi H (2000) Age-associated characteristics
of murine hematopoietic stem cells. J Exp Med 192: 1273-1280.
118.
Sugiyama T, Kohara H, Noda M and Nagasawa T (2006) Maintenance of the
hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone
marrow stromal cell niches. Immunity 25: 977-988.
162
119.
Szilvassy SJ, Humphries RK, Lansdorp PM, Eaves AC and Eaves CJ (1990)
Quantitative assay for totipotent reconstituting hematopoietic stem cells by a
competitive repopulation strategy. Proc Natl Acad Sci 87: 8736-8740.
120.
Tavares AL, Mercado-Pimentel ME, Runyan RB and Kitten GT (2006) TGF beta-
mediated RhoA expression is necessary for epithelial-mesenchymal transition in the
embryonic chick heart. Dev Dyn 235: 1589-1598.
121.
Tcherkezian J and Lamarche-Vane N (2007) Current knowledge of the large
RhoGAP family of proteins. Biol Cell 99: 67-86.
122.
Thanos CD, Goodwill KE and Bowie JU (1999) Oligomeric structure of the
human EphB2 receptor SAM domain. Science 283: 833-836.
123.
Tong J, Sydorskyy Y, St-Germain JR, Taylor P, Tsao MS and Moran MF (2013)
Odin (ANKS1A) modulates EGF receptor recycling and stability. PLoS One
8:e64817.
124.
Tossidou I, Niedenthal R, Klaus M, Teng B, Worthmann K, King BL, Peterson
KJ, Haller H and Schiffer M (2012) CD2AP regulates SUMOylation of CIN85 in
podocytes. Mol Cell Biol 32: 1068-1079.
125.
Troeger A and Williams DA (2013) Hematopoietic-specific Rho GTPases Rac2
and RhoH and human blood disorders. Exp Cell Res 319: 2375-2383.
126.
Ueno H and Weissman IL (2006) Clonal analysis of mouse development reveals a
polyclonal origin for yolk sac blood islands. Dev Cell 11: 519-533.
127.
Van Aelst L and D’Souza-Schorey C (1997) Rho GTPases and signaling
networks. Genes Dev 11: 2295-2322.
128.
Wang L, Yang L, Filippi MD, Williams DA and Zheng Y (2006) Genetic deletion
of Cdc42GAP reveals a role of Cdc42 in erythropoiesis and hematopoietic
stem/progenitor cell survival, adhesion, and engraftment. Blood 107: 98-105.
163
129.
Wang LD and Wagers AJ (2011) Dynamic niches in the origination and
differentiation of haematopoietic stem cells. Nat Rev Mol Cell Biol 12: 643-655.
130.
Warr MR, Pietras EM and Passegue E (2011) Mechanisms controlling
hematopoietic stem cell functions during normal hematopoiesis and hematological
malignancies. Rev Syst Biol Med 3: 681-701.
131.
Weber KS, Weber C, Ostermann G, Dierks H, Nagel W and Kolanus W (2011)
Cytohesin-1 is a dynamic regulator of distinct LFA-1 functions in leukocyte arrest
and transmigration triggered by chemokines. Curr Biol 11: 1969-1974.
132.
Weber-Nordt RM, Mertelsmann R and Finke J (1998) The JAK-STAT pathway:
signal transduction involved in proliferation, differentiation and transformation. Leuk
Lymphoma 28: 459-467.
133.
Wilson A, Laurenti E and Trumpp A (2009) Balancing dormant and self-renewing
hematopoietic stem cells. Curr Opin Genet Dev 19: 461-468.
134.
Worthylake RA, LEmoine S, Watson JM and Burridge K (2001) RhoA is required
for monocyte tail retraction during transendothelial migration. J Cell Biol 154: 147160.
135.
Wright DE, Wagers AJ, Gulati AP, Johnson FL and Weissman IL (2001)
Physiological migration of hematopoietic stem and progenitor cells. Science 294:
1933-1936.
136.
Wu B, Wang F, Zhang J, Zhang Z, Qin L, Peng J, Li F, Liu J, Lu G, Gong Q, Yao
X, Wu J and Shi Y (2012) Identification and structural basis for a novel interaction
between Vav2 and Arap3. J Struct Biol 180: 84-95.
137.
Xu H, Eleswarapu S, Geiger H, Szczur K, Daria D, Zheng Y, Settleman J, Srour
EF, Williams DA and Filippi MD (2009) Loss of the Rho GTPase activating protein
p190-B enhances hematopoietic stem cell engraftment potential. Blood 114: 35573566.
164
138.
Xu J, Wang F, Van Keymeulen A, Herzmark P, Straight A, Kelly K, Takuwa Y,
Sugimoto N, Mitchison T and Bourne HR (2003) Divergent signals and cytoskeletal
assemblies regulate self-organizing polarity in neutrophils. Cell 114: 201-214.
139.
Yagi R, Tanaka M, Sasaki K, Kamata R, Nakanishi Y, Kanai Y and Sakai R
(2011) ARAP3 inhibits peritoneal dissemination of scirrhous gastric carcinoma cells
by regulating cell adhesion and invasion. Oncogene 30: 1413-1421.
140.
Yamazaki S, , Ema H, Karlsson G, Yamaguchi T, Miyoshi H, Shioda S, Taketo
MM, Karlsson S, Iwama A and Nakauchi H (2011) Nonmyelinating Schwann cells
maintain hematopoietic stem cell hibernation in the bone marrow niche. Cell 147:
1146-1158.
141.
Yang L, Wang L, Kalfa TA, Cancelas JA, Shang X, Pushkaran S, Mo J, Williams
DA and Zheng Y (2007) Cdc42 critically regulates the balance between myelopoiesis
and erythropoiesis. Blood 110: 3853-3861.
142.
Yoon HY, Miura K, Cuthbert EJ, Davis KK, Ahvazi B, Casanova JE and
Randazzo PA (2006) ARAP2 effects on the actin cytoskeleton are dependent on Arf6specific GTPase-activating-protein activity and binding to RhoA-GTP. J Cell Sci 119:
4650-4666.
143.
Yusuf RZ and Scadden DT (2009) Homing of hematopoietic cells to the bone
marrow. J Vis Exp 25.
144.
Zhang J, Niu C, Ye L, Huang H, He X, Tong WG, Ross J, Haug J, Johnson T,
Feng JQ, Harris S, Wiedemann LM, Mishina Y and Li L (2003) Identification of the
haematopoietic stem cell niche and control of the niche size. Nature 425: 836-841.
145.
Zhang S, Zhou X, Lang RA and Guo F (2012) RhoA of the Rho family small
GTPases is essential for B-cell lymphocyte development. PLoS One 7:e33773.
165
146.
Zheng X, Zhang J and Liao K (2014) The basic amino acids in the coiled-coil
domain of CIN85 regulate its interaction with c-Cbl and phosphatidic acid during
epidermal growth factor receptor (EGFR) endocytosis. BMC Biochem 15: 13.
147.
Zhou X, Florian MC, Arumugam P, Chen X, Cancelas JA, Lang R, Malik P,
Geiger H and Zheng Y (2013) RhoA GTPase controls cytokinesis and programmed
necrosis of hematopoietic progenitors. J Exp Med 210: 2371-2385.
148.
Zimmermann M and Meyer N (2011) Annexin V/7-AAD staining in
keratinocytes. Methods Mol Biol 740: 57-63.
166