SP-A2 Gene Expression in Human Fetal Lung Airways
Kelli L. Goss, Ashish R. Kumar, and Jeanne M. Snyder
Department of Anatomy and Cell Biology, University of Iowa College of Medicine, Iowa City, Iowa
In the present study, we characterized surfactant protein (SP)-A messenger RNA (mRNA) in mid-trimester
human fetal trachea and bronchi. SP-A protein was localized by immunocytochemistry to scattered epithelial cells in the airway surface epithelium and in submucosal glands of the fetal trachea and bronchi. SP-A
mRNA (2.2 kb) was detected by Northern blot analysis in human fetal trachea, as well as in primary and
more distal bronchi. The levels of detectable SP-A mRNA were highest in the upper airways and were decreased in smaller bronchi in comparison. SP-A mRNA was barely detectable in the distal fetal lung tissue.
In contrast, SP-A mRNA was abundant in cultured explants of distal human fetal lung tissue. SP-A1 and
SP-A2 mRNA were detected by primer extension analysis in adult human lung tissue and in cultured human fetal lung explants. Only SP-A2 mRNA was detected in RNA isolated from human fetal trachea and
bronchi. SP-A mRNA was localized by in situ hybridization in the fetal trachea and bronchi in scattered
cells in the surface epithelium and, most prominently, in submucosal glands. Our results suggest that SP-A2,
and not SP-A1, is produced in the human fetal tracheal and bronchial epithelium and in submucosal
glands. Goss, K. L., A. R. Kumar, and J. M. Snyder. 1998. SP-A2 gene expression in human fetal
lung airways. Am. J. Respir. Cell Mol. Biol. 19:613–621.
Pulmonary surfactant is a lipoprotein substance, synthesized and secreted by alveolar type II cells, that reduces
surface tension at the air–alveolar interface (1). Surfactant
protein (SP)-A is the most abundant and best characterized surfactant-associated protein (2). SP-A, in combination with SP-B and SP-C, facilitates the spreading and surface-tension lowering properties of pulmonary surfactant
phospholipids (3). SP-A has also been shown to regulate
surfactant phospholipid synthesis, secretion, and recycling
(4–6). There is increasing evidence that SP-A is also involved
in local defense mechanisms against pathogens such as bacteria and viruses (7).
Human SP-A protein migrates at about 35 kD and is a
sialoglycoprotein with an acidic isoelectric point (z pI 4.5)
(8, 9). Human SP-A is encoded by two genes, SP-A1 and
SP-A2, that are 94% identical in nucleotide sequence and
96% identical in amino acid sequence (10, 11). It has been
hypothesized that the human SP-A trimer is a heterotrimer composed of two SP-A1 molecules and one SP-A2
molecule (12). The native SP-A molecule found in the
lung is thought to be a trimer of the 35-kD SP-A protein
that aggregates in clusters of six SP-A trimers, forming a
flower-bouquet-type arrangement (12).
(Received in original form August 25, 1997 and in revised form January 12,
1998)
Address correspondence to: Jeanne M. Snyder, Ph.D., Dept. of Anatomy
and Cell Biology, University of Iowa College of Medicine, Iowa City, IA
52242. E-mail: [email protected]
Abbreviations: ethylenediamenetetraacetic acid, EDTA; surfactant protein, SP; sodium chloride, sodium citrate buffer, SSC.
Am. J. Respir. Cell Mol. Biol. Vol. 19, pp. 613–621, 1998
Internet address: www.atsjournals.org
SP-A protein and messenger RNA (mRNA) have been
detected in alveolar type II cells and in bronchiolar epithelial cells in adult human lung tissue (13, 14). In mid-trimester fetal human lung, SP-A protein and mRNA have been
detected in the tracheal and bronchial epithelium and in
submucosal glands (15, 16). Toward the end of gestation in
the human fetus, SP-A protein is found in alveolar type II
cells (17). SP-A protein has also been detected in middleear epithelium, which is a respiratory epithelium similar to
the epithelium that lines the trachea and lung bronchi (18).
In addition, SP-A has been detected in epithelial cells of
the intestine (19).
In the present study, we characterized the SP-A mRNA
present in mid-trimester human fetal trachea and airways.
We found that only the SP-A2 gene was expressed in the
fetal airway epithelium and submucosal glands. Thus, it is
possible that the SP-A produced in the lung airways may
differ from the SP-A produced in the type II cells of the
distal lung.
Materials and Methods
Tissue
The experimental protocol for this study was approved by
the Human Subjects Research Review Committee at the
University of Iowa (Iowa City, IA). Fetal lung tissue was
obtained from mid-trimester abortuses and placed in serum-free Waymouth’s MB 752/1 medium that contained
100 U/ml penicillin G, 100 mg/ml streptomycin, and 0.25
mg/ml amphotericin B (GIBCO BRL, Grand Island, NY).
For some experiments, tissue was obtained from Advanced Bioscience Resources (Alameda, CA). Peripheral
614
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 19 1998
lung tissue was separated from the trachea, major bronchi,
and blood vessels using forceps and a dissecting microscope. The trachea, primary bronchi, and the next four to
five orders of bronchi were dissected, placed in sterile microfuge tubes, and snap-frozen in liquid N2. A piece of distal lung tissue was also collected and frozen for comparison. Cultured human fetal lung explants were also used in
the study. Peripheral lung tissue was minced and maintained in explant culture for 6 d, as described previously
(20). Experiments were repeated four to five times for each
protocol, using tissue from a different fetus for each experiment.
Immunostaining
The frozen tissues were mounted in O.C.T. compound,
then 7-mm frozen sections were prepared with a cryostat
and thaw-mounted on glass slides. Sections were fixed for
10 min at room temperature in freshly prepared 10% formalin in phosphate-buffered saline (PBS). The sections
were then rinsed twice, 10 min per rinse, in PBS. The sections were immunostained for SP-A using a Vectastain
Elite kit (Vector Labs, Burlingame, CA). Nonspecific
binding sites were blocked by incubating the sections with
2% normal goat serum at room temperature. The sections
were quickly rinsed in PBS, then incubated for 1 h in a humidified chamber at room temperature with guinea-pig
antihuman SP-A antiserum at a dilution of 1:500 in PBS.
The tissue sections were washed twice in PBS, 5 min per
rinse, then incubated for 30 min in a biotinylated secondary antibody, then rinsed twice in PBS, 5 min per rinse.
The sections were then incubated for 45 min in avidin-peroxidase reagent. After rinsing twice in PBS, 5 min per
rinse, the sections were incubated in diaminobenzidine
(0.7 mg/ml; Sigma, St. Louis, MO) for 1 to 3 min. Sections
were rinsed in PBS for 5 min, quickly rinsed in distilled
water, then dehydrated and mounted with coverslips. In
some experiments, the sections were counterstained with
hematoxylin for 30 s. Negative controls involved incubating the sections with either nonimmune guinea pig serum
at the same concentration as the primary antibody, with
antiserum that had been preabsorbed overnight at 4 8C
with purified human SP-A (10 mg) or with secondary antibody alone, and were performed in all experiments. The
human SP-A was purified from alveolar proteinosis lavage
material (21). Sections were viewed and photographed
with a Nikon FX photomicroscope (Nikon, Melville, NY).
RNA Isolation
The frozen tissues (50–100 mg) were homogenized in 1 ml
of RNA extraction mixture, and total RNA was isolated as
described previously (22, 23). The precipitated total RNA
pellet was washed with 1 ml 75% ethanol, air-dried, and resuspended in 25 ml sterile diethylpropylcarbonate-treated
water (24). Following quantitation of total RNA by determining the ultraviolet (UV) absorbence at 260 nm, equal
amounts of total RNA (10 mg) from each sample were separated by gel electrophoresis on a 1.0% agarose/5% formaldehyde gel, and was capillary transferred to Nytran
Plus membranes (Schleicher & Schuell, Keene, NH) using
a phosphate buffer as described previously (23). The ethid-
ium bromide-stained ribosomal RNA bands in the agarose
gel were photographed on a UV lightbox. The RNA was
cross-linked to the Nytran membrane by UV irradiation
for 2 min in a GS Gene Linker (Bio-Rad, Hercules, CA).
Northern Blot Analysis
The human complementary DNA (cDNA) probe for SP-A
(a kind gift of Dr. J. Whitsett, University of Cincinnati,
Cincinnati, OH) was radiolabeled with [a32P]deoxycytosine
triphosphate (z 3,000 Ci/mmol; Amersham, Bedford, MA)
using a random primer kit (Boehringer Mannheim, Indianapolis, IN). Northern blot analysis was performed essentially as described previously (23). The Nytran membranes
were prehybridized for 6 h at 428C in hybridization buffer,
then the radiolabeled cDNA probe (1 3 106 cpm/ml final
concentration) was added and the membranes incubated
overnight. The membranes were then washed, wrapped in
plastic wrap, and exposed to X-ray film (Eastman Kodak
Co., Rochester, NY) with an intensifier screen for up to 5 d
at 2708C. Northern blot analysis for SP-A mRNA was performed on 13 different airway specimens.
Primer Extension Analysis
An oligonucleotide primer (GGGGATACCAGGGCTTCCAACACAAACG) that is complimentary to nucleotides 1117–1144 of human SP-A1 gene (25) and nucleotides 1144–1171 of human SP-A2 gene (11) was labeled at
its 59 end using g32P-adenosine triphosphate (5,000 Ci/mmol;
Amersham) and T4 polynucleotide kinase (New England
Biolabs, Beverly, MA), as described previously (26, 27). The
unincorporated radioactive nucleotide was removed with a
Sephadex G-25 quick-spin column (Boehringer Mannheim).
Primer extension was carried out using a modification of a
standard protocol (23). Primer extension analysis was performed only on airway RNA samples in which SP-A mRNA
was detectable by Northern blot analysis. Five micrograms
of total RNA were incubated with 0.2 pmol of the radiolabeled primer for 10 min at 708C and then cooled on ice for
10 min. The primer was extended using 200 units of Superscript II reverse transcriptase (GIBCO BRL) at 428C for
1 h in 20 ml reaction buffer containing Tris-HCl (50 mM,
pH 8.3), KCl (75 mM), MgCl2 (3 mM), dATP, dGTP, dCTP,
and dTTP (1 mM of each), 20 U of ribonuclease (RNase)
inhibitor, dithiothreitol (1 mM), and actinomycin D (50 mg/
ml). The reaction was stopped by adding 1 ml of ethylenediamenetetraacetic acid (EDTA; 0.5 M, pH 8.0), and the
RNA was digested by adding 1 ml of deoxyribonucleasefree RNase (5 mg/ml) and incubating at 378C for 30 min.
The radiolabeled DNA transcripts were extracted by adding 150 ml TEN 100 buffer (Tris-HCl [10 mM, pH 7.6],
EDTA [1 mM], and NaCl [100 mM]) and 200 ml of 25:24:1
phenol:chloroform:isoamyl alcohol, mixing, then centrifuging at 12,000 3 g for 5 min at room temperature. The supernatant was transferred to a microcentrifuge tube containing 500 ml of ice-cold 100% ethanol and the labeled
transcripts were precipitated by incubation at 2208C for 1 h
followed by centrifugation at 12,000 3 g for 10 min at 48C.
The pellet was washed with 75% ethanol and resuspended
in 4 ml buffer (10 mM Tris-HCl, pH 7.6, and 1 mM EDTA).
A total of 6 ml of formamide loading buffer (80% forma-
Goss, Kumar, and Snyder: SP-A in Human Lung Submucosal Glands
Figure 1. Immunolocalization of SP-A protein in human fetal
trachea. Frozen sections of trachea obtained from a 20-wk gestational-age fetus were immunostained using a guinea pig antihuman SP-A antiserum (A) or nonimmune guinea pig serum as a
control (B). Scattered epithelial cells within the tracheal surface
epithelium were stained (A, arrows). The most intense staining
was observed in submucosal glands (A, arrowheads). Only background staining was observed in the nonimmune guinea pig serum control (B). The lumen of the trachea is indicated by L and
cartilage is indicated by C. The bar represents 50 mm.
mide, 10 mM EDTA [pH 8.0], 1 mg/ml xylene cyanol, and
1 mg/ml bromophenol blue) was added to each sample. A
6% polyacrylamide/7 M urea sequencing gel was poured
and allowed to polymerize for at least 2 h. The gel was pre-
615
Figure 2. Northern blot analysis of SP-A mRNA in human fetal
trachea, primary bronchi, distal airways, and distal peripheral
lung tissue, and in cultured human fetal lung explants. Ten micrograms of total RNA from each sample were separated by agarose
gel electrophoresis, transferred to a membrane, and hybridized
with a human SP-A cDNA probe. (Top panel) A 2.2-kb SP-A
mRNA band was detected in the trachea and distal lung tissue
obtained from one fetus (lanes A and B, respectively). In tissues
obtained from another fetus, SP-A mRNA was present in the trachea and primary bronchi, and was barely detectable in the distal
lung (lanes C, D, and E, respectively). (Bottom panel ) SP-A
mRNA was detected in human fetal primary bronchus (lane A),
distal bronchi (lane B), and distal peripheral lung tissue (lane C),
all from the same fetus, and in cultured human fetal lung explants
(lane D). The relative amount of SP-A mRNA was high in the fetal primary bronchus, decreased in the more distal airways, and
barely detectable in the distal lung. The cultured human fetal
lung explants contained abundant SP-A mRNA.
run at a constant power of 58 W for 30 min. The samples
were denatured at 958C for 2 min, placed on ice for 5 min,
and then loaded into the sequencing gel wells. The loaded
gel was electrophoresed at 58 W until the blue tracking
dye reached the bottom of the gel. The gel was transferred
to a filter paper and dried using a gel drier (Bio-Rad). The
616
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 19 1998
dried gel was exposed to X-ray film with an intensifier
screen (Lighting Plus; Dupont, Wilmington, DE) at 2708C.
In Situ Hybridization
Frozen sections (7-mm thick) were cut at 2208C and
mounted on glass slides (Superfrost Plus; Fisher, Chicago,
IL). Sections from trachea, primary bronchi, smaller bronchi, undifferentiated distal lung tissue, and cultured human
fetal lung explants were mounted on each slide to facilitate
comparison. The methods used for in situ hybridization
were modifications of those originally described by Angerer and Angerer (28). The sections were allowed to
come to room temperature, then fixed in freshly prepared
paraformaldehyde (4%, wt/vol, pH 7.5). After several
rinses in PBS (pH 7.4), the tissues were incubated in a Pronase solution (0.25 mg/ml in Tris-HCl [50 mM, pH 7.5] and
EDTA [5 mM]). After incubation in PBS that contained
glycine (2 mg/ml) for 10 min, the sections were rinsed in
triethanolamine buffer (0.1 M, pH 8.0), then treated with
acetic anhydride (0.25%) in the same buffer for 10 min.
Sections were rinsed in 23 sodium chloride, sodium citrate
buffer (SSC) (13 5 sodium chloride [NaCl, 150 mM], sodium citrate [15 mM], pH 7.0), then dehydrated through
an ethanol series.
A total of 50 ml of hybridization buffer (NaCl [300
mM], Tris-HCl [10 mM, pH 8.0], EDTA [1 mM], formamide [50%, vol/vol], 13 Denhardt’s solution [Sigma], dextran sulfate [10%, wt/vol], and yeast transfer RNA [0.28
mg/ml]) that contained the sense or antisense [3H]cRNA
probe (z 3 3 105 cpm) was applied to each slide. A coverslip (HybriWell Chambers; Lab Vision Corp., Fremont,
CA) was then placed on top of the sections and sealed. The
slides were incubated at 608C overnight in a humid chamber. After removal of the coverslip, the slides were rinsed
four times in 43 SSC for 10 min. The sections were then
incubated for 30 min at 37 8C in a solution of RNase A
(20.0 µg/ml) and RNase T1 (3.0 U/ml) in buffer (Tris-HCl
[10 mM, pH 8.0], EDTA [1 mM], and NaCl [0.5 M]). The
sections were then rinsed for 30 min at 37 8C in buffer
(Tris-HCl [10 mM, pH 8.0], EDTA [2.5 mM], and NaCl
[0.5 M]), then in 23 SSC for 30 min at room temperature,
0.13 SSC at 568C for 30 min, and 0.13 SSC at room temperature for 30 min. The sections were dehydrated
through an ethanol series and air-dried, then coated with
NTB-2 emulsion (Kodak), dried in a slide oven, and exposed in light-proof boxes at 4 8C. The photographs of
SP-A mRNA hybridization presented in the manuscript
are taken from slides that were exposed for approximately
3 wk. The autoradiograms were developed in D-19 developer, rinsed in distilled water, fixed in rapid fixer, rinsed in
distilled water, stained in hematoxylin, then dehydrated
and mounted with coverslips.
Results
SP-A protein was localized in human fetal trachea and
bronchi using avidin-biotin-immunoperoxidase staining
Figure 3. Primer extension analysis of SP-A1 and SP-A2 mRNA transcripts. (Left panel) Five micrograms of total RNA isolated from a
bronchus specimen (lane A), three different distal fetal lung tissues (lanes B, C, and D), and cultured human fetal lung explants (lane E)
were used in a primer extension assay. The major SP-A1 and SP-A2 mRNA transcripts are indicated by arrows. Only SP-A2 mRNA
was detected in the bronchus (lane A), while very low levels of SP-A1 mRNA were detected in two of three distal lung specimens (lanes
C and D). RNA from cultured human fetal lung explants contained both SP-A1 and SP-A2 mRNA transcripts (lane E). (Right panel)
Five micrograms of total RNA isolated from human fetal lung explants cultured in vitro (lane A), human fetal trachea (lane B), and
adult human lung tissue (lane C) were used in a primer extension assay. The major SP-A1 and SP-A2 mRNA transcripts are indicated
by arrows. SP-A1 and SP-A2 mRNA transcripts were detected in the cultured human fetal distal lung explants and in adult distal lung
tissue (lanes A and C, respectively). Only SP-A2 mRNA transcripts were detected in the human fetal trachea (lane B).
Goss, Kumar, and Snyder: SP-A in Human Lung Submucosal Glands
and an antiserum directed against human SP-A. SP-A protein was detected in scattered surface epithelial cells (Figure 1A). However, the strongest immunoreactivity was
present in submucosal glands present in the trachea and
bronchi (Figure 1A). Staining controls were negative (Figure 1B). In experiments in which the antiserum was preabsorbed with purified human SP-A, all staining was abolished (data not shown). Preabsorption with human serum
617
did not alter the SP-A staining pattern or intensity (data
not shown).
Northern blot analysis was used to detect SP-A mRNA
in human fetal trachea, primary bronchi, smaller bronchi,
and distal fetal lung tissue, and in cultured human fetal
lung explants (Figure 2). SP-A mRNA was detectable in
seven of 13 trachea and pulmonary airway samples and,
when detected, was present in very low levels in the distal
Figure 4. In situ hybridization of SP-A mRNA in human fetal trachea. A (brightfield) and B (darkfield) show localization of SP-A
mRNA in scattered epithelial cells of 19-wk gestational-age trachea (arrows). C (brightfield) and D (darkfield) show SP-A mRNA hybridization in fetal trachea from an 18-wk gestational-age fetus. Scattered surface epithelial cells contain SP-A mRNA (arrows). Submucosal gland progenitors contained abundant SP-A mRNA in distal epithelial cells (arrowheads). L indicates the tracheal lumen. The bar
indicates 50 mm.
618
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 19 1998
fetal lung tissue (Figure 2, top). SP-A mRNA was detected
in the primary bronchus and, in smaller amounts, in the
more distal bronchi. SP-A mRNA was barely detectable in
the distal lung tissue of eight of 13 specimens (Figure 2, bottom). However, after explants of distal fetal lung tissue
were cultured for 6 d, abundant SP-A mRNA was present
in all specimens (Figure 2, bottom). The size of the SP-A
mRNA detected in the Northern blots of the tracheal and
bronchial samples versus the cultured fetal lung explant
tissue did not appear to differ.
Human SP-A is encoded by two genes, SP-A1 and SP-A2
(11). We used primer extension analysis to characterize
the relative amounts of SP-A1 and SP-A2 mRNA present
in human fetal airways, distal human fetal lung tissue, cul-
tured human fetal lung explants, and adult human distal
lung tissue (26, 27). Both SP-A1 and SP-A2 mRNA transcripts were present in all of the cultured human fetal lung
explants and in adult human lung tissue (Figure 3, right
panel). In five distal human fetal lung specimens analyzed
by primer extension, only two had detectable SP-A mRNA,
and they contained only SP-A1 mRNA (Figure 3, left panel).
In the seven human lung airway specimens in which SP-A
mRNA was detected by Northern blot analysis, only SP-A2
mRNA was detected by primer extension (Figure 3). The
size of the SP-A2 mRNA primer extension product detected
in the airway samples was the same as that detected in the
cultured human fetal lung explants and in the adult human
lung tissue (Figure 3).
Figure 5. In situ hybridization of SP-A mRNA in human fetal trachea. A (brightfield) and B (darkfield) show SP-A mRNA localization
in tissue from a 20-wk gestational-age fetus. SP-A mRNA was detected in a few surface epithelial cells (arrows) and in submucosal gland
epithelial cells (arrowheads). C and D are brightfield photomicrographs of SP-A mRNA hybridization in fetal trachea obtained from
two different 18-wk gestational-age fetuses. SP-A mRNA was abundant in epithelial cells of submucosal glands (arrowheads, C). The
tracheal lumen is indicated by an L and the lumen of the glandular duct is indicated by DL. In D, a few scattered surface epithelial cells
contain SP-A mRNA (arrows) but the majority of hybridization is present in distal submucosal gland epithelial cells (arrowheads). Surface epithelial cells close to the origin of the submucosal glands frequently contained SP-A mRNA (arrows). The bar indicates 50 mm.
Goss, Kumar, and Snyder: SP-A in Human Lung Submucosal Glands
In situ hybridization was used to localize SP-A mRNA
in human fetal trachea. In the most immature samples
studied, SP-A mRNA was localized in scattered surface
epithelial cells (Figures 4A and 4B). In fetal tracheas in
which submucosal gland morphogenesis had begun, most
of the SP-A mRNA was present in the invaginating glands
(Figures 4C and 4D). At higher magnification, it was observed that a few scattered surface epithelial cells containing SP-A mRNA were still present and frequently flanked
the regions where submucosal gland invagination was occurring (Figures 5A, 5B, and 5D). The majority of SP-A
mRNA was present in clusters of epithelial cells in the sub-
619
mucosal glands (Figures 5C and 5D). Frequently, the most
distal portion of the submucosal gland contained the cells
that expressed SP-A mRNA (Figures 4C and 4D, and Figure 5). Only background autoradiographic grains were observed in control slides that were hybridized with sense
cRNA probes (data not shown).
SP-A mRNA was not detected in the uncultured distal
human fetal lung tissue (Figures 6A and 6B). In contrast,
abundant SP-A mRNA was present in epithelial cells of
cultured human fetal lung explants (Figures 6C and 6D).
Most, but not all, of the epithelial cells in the explants contained SP-A mRNA. Clusters of cells that contained large
Figure 6. In situ hybridization of human SP-A mRNA in undifferentiated human fetal distal lung tissue and in human fetal distal lung
explants cultured in vitro for 6 d. A (brightfield) and B (darkfield) show that little SP-A mRNA is present in the distal lung at this stage
of development. L indicates the lumen of prealveolar ducts, CT indicates connective tissue, and the arrows indicate the epithelium of the
prealveolar ducts. C (brightfield) and D (darkfield) are photomicrographs of SP-A mRNA localization in cultured human distal fetal
lung explants. SP-A mRNA was present in the majority of epithelial cells in the explants. SP-A mRNA was particularly abundant ( arrows) in clusters of epithelial cells located at sites where connective tissue was adjacent and where several prealveolar ducts were in apposition. The bar indicates 50 µm.
620
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 19 1998
amounts of SP-A mRNA were present at sites where several prealveolar ducts were in apposition. These sites were
frequently close to connective tissue. In contrast, areas of
flattened epithelium with little adjacent connective tissue
contained much lower amounts of SP-A mRNA (Figures
6C and 6D).
Discussion
The cDNA sequences for the two human SP-A mRNAs
were first described by Floros and colleagues in 1986 (10).
Although these investigators reported the existence of two
similar but different cDNAs in their study, it was not fully
appreciated that there were in fact two human SP-A genes
until the report of Katyal and associates in 1992 (11). All
of the investigations in which SP-A mRNA has been localized in human lung tissue have been performed using reagents that recognize both SP-A mRNAs. Phelps and Floros localized SP-A mRNA in adult human lung tissue in
alveolar type II cells and reported that no SP-A mRNA
was detectable in lung airways (13). Subsequently, Auten
and coworkers showed that SP-A mRNA was present in
bronchiolar epithelium of adult human lung tissue (14).
Broers and colleagues also reported that SP-A mRNA is
present in bronchial and bronchiolar epithelial cells of
adult human lung tissue (29). None of these investigators
reported the presence of SP-A mRNA in submucosal
glands of adult human lung airways. However, we have detected SP-A mRNA in the distal serous portion of submucosal glands of bronchi in adult human lung tissue (J. M.
Snyder and J. F. Engelhardt, unpublished observations).
In human fetal lung, in contrast to the adult lung, SP-A
protein and mRNA have been detected in trachea, bronchi, and bronchiolar epithelium, and in submucosal glands
(15, 16). Endo and Oka reported the presence of immunoreactive SP-A in the epithelium of main and segmental
bronchi and in submucosal glands (15). They reported that
the number of immunoreactive cells in the airways increased until about 32 wk of gestation and then decreased
until term (15). Immunoreactive SP-A protein was detected in airways of one of three adult lung samples included in their study (15). Khoor and associates, in an extensive study of human fetal lung throughout gestation,
found that SP-A mRNA and protein were present in tracheal epithelium and submucosal glands as well as in the
same sites in bronchi of some infants (16). Toward term,
the pattern of SP-A localization was not appreciably different from that earlier in gestation. Khoor and colleagues
noted that SP-A-immunostained surface epithelial cells in
the airways of human fetal lung tissue were frequently located in mucosal folds near the origin of submucosal gland
ducts (16). We also frequently detected cells containing
SP-A protein and mRNA at the junction between the surface epithelium and the origin of the developing submucosal
glands. Thus, our finding with respect to immunostaining
for SP-A protein and in situ hybridization for SP-A mRNA
is in good agreement with the studies of Endo and Oka
(15) and Khoor and coworkers (16). In our study, we
noted that SP-A mRNA was particularly abundant in the
distal portion of the developing submucosal gland, the
portion that will differentiate into the serous portion of
the gland (30). Interestingly, the cystic fibrosis transmembrane conductance regulator (CFTR) has been localized
to the orifice region and the distal serous portion of submucosal glands in adult human lung tissue, a localization
similar to the one we observed for SP-A in fetal lung in the
present study (31). We have previously reported that
CFTR mRNA can be detected in alveolar type II cells in
human fetal lung explants, cells which also express SP-A
mRNA (32). Thus, it is possible that cells which express
the CFTR also express SP-A in the lung.
Using Northern blot analysis of RNA isolated from dissected trachea, primary bronchi, distal bronchi, and distal
peripheral lung tissue from human fetal lung tissue, we detected a gradient of SP-A mRNA present in these structures, with the trachea containing the highest amounts of
SP-A mRNA. This may reflect a proximal-to-distal gradient in the morphogenesis of submucosal glands in the human fetal lung and/or the relative number of submucosal
glands present in these anatomically distinct sites. In addition, we observed that about half of the trachea or lower
airway samples contained detectable SP-A, a proportion
similar to the observations of Khoor and associates (16).
SP-A mRNA was either not detected or was barely detectable in the distal lung by Northern blot analysis in the
early mid-trimester tissues examined in our study.
In humans, SP-A is encoded by two genes (11). By use
of Northern blot analysis, polymerase chain reaction, and
primer extension analysis, both SP-A1 and SP-A2 mRNA
appear to be present in fetal and adult human lung alveolar type II cells (11, 27, 33). McCormick and coworkers used
several different primers in their primer extension analyses of human fetal lung RNA (27). Primer B, as described
in their study, was used for detecting all of the SP-A1 and
SP-A2 mRNA transcripts (27). Primer extension analysis
using this primer in our studies detected all of the SP-A1
and SP-A2 transcripts in RNA from cultured human fetal
lung explants and from adult human lung. We did not detect any SP-A mRNA transcripts in the undifferentiated
distal human fetal lung tissue that were negative for SP-A
mRNA by Northern blot analysis. Karinch and Floros also
used a single primer to detect all of the SP-A1 and SP-A2
mRNA transcripts in human lung RNA (33). It has been
reported that SP-A1 mRNA is present prior to SP-A2
mRNA in distal human fetal lung tissue (34). Our results
are in agreement with this observation. In addition, it has
been reported that the SP-A2 gene in human fetal distal
lung explants is more responsive to the stimulatory effects
of cyclic adenosine monophosphate and the inhibitory effects of dexamethasone than the SP-A1 gene (34). To date,
neither SP-A mRNA species has been localized by in situ
hybridization. In the present study, however, using primer
extension analysis, we found that only SP-A2 mRNA was
present in RNA isolated from human fetal lung trachea
and bronchi. Thus, we conclude that the SP-A immunostaining and SP-A mRNA detected in human fetal trachea
and airways in fact represented SP-A2 protein and mRNA,
respectively.
The SP-A protein present in the distal lung is synthesized by alveolar type II cells and is the predominant form
of SP-A present in the lung. The secreted form of the SP-A
present in the alveolus is hypothesized to be a heterotri-
Goss, Kumar, and Snyder: SP-A in Human Lung Submucosal Glands
mer that consists of two SP-A1 molecules and one SP-A2
molecule that in turn aggregate in groups of six to form a
flower-bouquet structure (12). Immunoreactive SP-A with
a molecular weight of 80 kD has been detected in human
middle-ear fluids (18). SP-A immunostaining was present
in epithelial cells of the eustachian tube and on the surface
of the epithelium lining the middle ear (18). The eustachian tube and middle-ear cavity are lined by respiratory
epithelium with submucosal glands similar to that of the
trachea and bronchi of the lung (35). SP-A has also been
detected in the rat intestine (19). The molecular weights of
the SP-A protein present in the intestine were variable
and included higher molecular weight forms than present
in the SP-A protein purified from secreted surfactant.
Voss and colleagues have reported that purified SP-A2
tends to form aggregates of two trimers with a structure
that is quite different from the much larger aggregates
formed by purified SP-A1, and from the flower-bouquet
structures formed by mixtures of SP-A1 and SP-A2 (12).
The native form of the SP-A2 protein present in the airway epithelium and submucosal glands is presently unknown.
Acknowledgments: This research was supported by grants from the National Institutes of Health, HL-50050 and DERC DK-25295. The authors acknowledge
the expert assistance of Paul Reimann in preparation of the photomicrographs
and Rose Marsh in the typing of the manuscript.
References
1. Creuwels, L. A. J. M., L. M. G. van Golde, and H. P. Haagsman. 1997. The
pulmonary surfactant system: biochemical and clinical aspects. Lung 175:
1–39.
2. Weaver, T. E., and J. A. Whitsett. 1991. Function and regulation of expression of pulmonary surfactant-associated proteins. Biochem. J. 273:249–264.
3. Hawgood, S., B. J. Benson, and R. L. Hamilton, Jr. 1985. Effects of a surfactant-associated protein and calcium ions on the structure and surface activity of lung surfactant lipids. Biochemistry 24:184–190.
4. Thakur, N. R., M. Tesan, N. E. Tyler, and J. E. Bleasdale. 1986. Altered
lipid synthesis in type II pneumonocytes exposed to lung surfactant. Biochem. J. 240:679–690.
5. Rice, W. R., G. F. Ross, F. M. Singleton, S. Dingle, and J. A. Whitsett. 1987.
Surfactant associated protein inhibits phospholipid secretion from type II
cells. J. Appl. Physiol. 63:692–698.
6. Wright, J. R., R. E. Wager, S. Hawgood, L. Dobbs, and J. A. Clements.
1987. Surfactant apoprotein Mr 5 26,000–36,000 enhances uptake of liposomes by type II cells. J. Biol. Chem. 262:2888–2894.
7. van Golde, L. M. G. 1995. Potential role of surfactant proteins A and D in
innate lung defense against pathogens. Biol. Neonate 67:2–17.
8. Voss, T., K. P. Schafer, P. F. Nielsen, A. Schafer, C. Maier, E. Hannappel, J.
Maaben, B. Lavides, K. Klemm, and M. Przybylski. 1992. Primary structure differences of human surfactant-associated proteins isolated from
normal and proteinosis lung. Biochim. Biophys. Acta 1138:261–267.
9. Phelps, D. S., J. Floros, and H. W. Taeusch, Jr. 1986. Post-translational
modification of the major human surfactant-associated proteins. Biochem.
J. 237:373–377.
10. Floros, J., R. Steinbrink, K. Jacobs, D. Phelps, R. Kriz, L. Sultzman, M.
Recny, S. Jones, H. W. Taeusch, H. A. Frank, and E. F. Fritsch. 1986. Isolation and characterization of cDNA clones for the 35-kDa pulmonary surfactant associated protein (PSP-A). J. Biol. Chem. 261:9029–9033.
11. Katyal, S. L., G. Singh, and J. Locker. 1992. Characterization of a second
human pulmonary surfactant-associated protein SP-A gene. Am. J. Respir.
Cell Mol. Biol. 6:446–452.
12. Voss, T., K. Melchers, G. Scheirle, and K. P. Schafer. 1991. Structural comparison of recombinant pulmonary surfactant protein SP-A derived from
two human coding sequences: implications for the chain composition of
natural human SP-A. Am. J. Respir. Cell Mol. Biol. 4:88–94.
621
13. Phelps, D. S., and J. Floros. 1988. Localization of surfactant protein synthesis in human lung by in situ hybridization. Am. Rev. Respir. Dis. 137:939–
942.
14. Auten, R. L., R. H. Watkins, D. L. Shapiro, and S. Horowitz. 1990. Surfactant protein A (SP-A) is synthesized in airway cells. Am. J. Respir. Cell
Mol. Biol. 3:491–496.
15. Endo, H., and T. Oka. 1991. An immunohistochemical study of bronchial
cells producing surfactant protein A in the developing human fetal lung.
Early Hum. Dev. 25:149–156.
16. Khoor, A., M. E. Gray, W. M. Hull, J. A. Whitsett, and M. T. Stahlman.
1993. Developmental expression of SP-A and SP-A mRNA in the proximal and distal respiratory epithelium in the human fetus and newborn. J.
Histochem. Cytochem. 41:1311–1319.
17. Kuroki, Y., K. Dempo, and T. Akino. 1986. Immunohistochemical study of
human pulmonary surfactant apoproteins with monoclonal antibodies:
pathologic application for hyaline membrane disease. Am. J. Pathol. 124:
25–33.
18. Kobayashi, K., N. Yamanaka, A. Kataura, S. Ohtani, T. Saito, and T. Akino.
1992. Presence of an 80 kilodalton protein, cross-reacted with monoclonal
antibodies to pulmonary surfactant protein A, in the human middle ear.
Ann. Otol. Rhinol. Laryngol. 101:491–495.
19. Rubio, S., T. Lacaze-Masmonteil, B. Chailley-Heu, A. Kahn, J. R. Bourbon,
and R. Ducroc. 1995. Pulmonary surfactant protein A (SP-A) is expressed
by epithelial cells of small and large intestine. J. Biol. Chem. 270:12162–
12169.
20. Snyder, J. M., J. M. Johnston, and C. R. Mendelson. 1981. Differentiation of
type II cells of human fetal lung in vitro. Cell Tissue Res. 220:17–25.
21. Snyder, J. M., H. F. Rodgers, H. C. Nielsen, and J. A. O’Brien. 1989. Uptake of the 35kDa major surfactant apoprotein (SP-A) by neonatal rabbit
lung tissue. Biochim. Biophys. Acta 1002:1–7.
22. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159.
23. Dekowski, S. A., and J. M. Snyder. 1992. Insulin regulation of messenger ribonucleic acid for the surfactant-associated proteins in human fetal lung in
vitro. Endocrinology 131:669–676.
24. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.
25. White, R. T., D. Damm, J. Miller, K. Spratt, J. Schilling, S. Hawgood, B.
Benson, and B. Cordell. 1985. Isolation and characterization of the human
pulmonary surfactant apoprotein gene. Nature 317:361–363.
26. Karinch, A. M., and J. Floros. 1995. 59 splicing and allelic variants of the human pulmonary surfactant protein A genes. Am. J. Respir. Cell Mol. Biol.
12:77–88.
27. McCormick, S. M., V. Boggaram, and C. R. Mendelson. 1994. Characterization of mRNA transcripts and organization of human SP-A1 and SP-A2
genes. Am. J. Physiol. 266:L354–L366.
28. Angerer, L. M., and R. C. Angerer. 1991. Localization of mRNAs by in situ
hybridization. In Methods in Cell Biology. B. A. Hamkalo and S. C. R. Elgin, editors. Academic Press, Inc., New York. 39–69.
29. Broers, J. L., S. M. Jensen, W. D. Travis, H. Pass, J. A. Whitsett, G. Singh,
S. L. Katyal, A. F. Gazdar, J. D. Minna, and R. I. Linnoila. 1992. Expression of surfactant associated protein-A and Clara cell 10 kilodalton
mRNA in neoplastic and non-neoplastic human lung tissue as detected by
in situ hybridization. Lab. Invest. 66:337–346.
30. Basbaum, C., J.-D. Li, and M. Lim. 1997. Airway gland growth and differentiation. In Lung Growth and Development. J. A. MacDonald, editor. Marcel Dekker, New York. 163–180.
31. Engelhardt, J. F., J. R. Yankaskas, S. A. Ernst, Y. Yang, C. R. Marino, R. C.
Boucher, J. A. Cohn, and J. M. Wilson. 1992. Submucosal glands are the
predominant site of CFTR expression in the human bronchus. Nat. Genet.
2:240–248.
32. McCray, P. B., Jr., C. L. Wohlford-Lenane, and J. M. Snyder. 1992. Localization of cystic fibrosis transmembrane conductance regulator mRNA in
human fetal lung tissue by in situ hybridization. J. Clin. Invest. 90:619–625.
33. Karinch, A. M., and J. Floros. 1995. Translation in vivo of 59 untranslatedregion splice variants of human surfactant protein-A. Biochem. J. 307:327–
330.
34. McCormick, S. M., and C. R. Mendelson. 1994. Human SP-A1 and SP-A2
genes are differentially regulated during development and by cAMP and
glucocorticoids. Am. J. Physiol. 266:L367–L374.
35. Lim, D. J. 1974. Functional morphology of the lining membrane of the middle ear and eustachian tube: an overview. Ann. Otol. Rhinol. Laryngol.
(Suppl. 11)83:5–26.