Cancer Therapy: Preclinical
Histone Deacetylase Inhibitor FK228 Activates Tumor Suppressor
Prdx1 with Apoptosis Induction in Esophageal Cancer Cells
Isamu Hoshino,1 Hisahiro Matsubara,1 Naoyuki Hanari,1 Mikito Mori,1 Takanori Nishimori,1 Yasuo Yoneyama,1
Yasunori Akutsu,1 Haruhito Sakata,1 Kazuyuki Matsushita,1 Naohiko Seki,2 and Takenori Ochiai1
Abstract
Purpose: The histone deacetylase inhibitor FK228 shows strong activity as a potent antitumor
drug but its precise mechanism is still obscure. The purpose of this study is to reveal the effect of
FK228 on gene expression in the cell and to determine the mechanism of the antitumor activity of
FK228 for further clinical applications.
Experimental Design and Results: Microarray analysis was applied to verify the gene expression profiles of 4,608 genes after FK228 treatment using human esophageal squamous
cell cancer cell lines T.Tn and TE2. Among them, peroxiredoxin 1 (Prdx1), a member of the
peroxiredoxin family of antioxidant enzymes having cell growth suppression activity, as well
as p21WAF1, were significantly activated by FK288. In addition, FK228 strongly inhibited the
cell growth of T.Tn and TE2 by the induction of apoptosis. Further, chromatin immunoprecipitation analysis revealed that FK228 induced the accumulation of acetylated histones H3 and
H4 in Prdx1 promoter, including the Sp1-binding site. In mouse xenograft models of T.Tn and
TE2 cells, FK228 injection resulted in significant tumor regression as well as activated Prdx1
expression in tumor tissues. Prdx1 suppression by RNA interference hindered the antitumor
effect of FK228.
Conclusion: Our results indicate that the antitumor effect of FK228 in esophageal cancer cells
is shown at least in part through Prdx1 activation by modulating acetylation of histones in the
promoter, resulting in tumor growth inhibition with apoptosis induction.
Esophageal
squamous cell carcinoma is a highly malignant
disease with poor prognosis, the overall 5-year survival rate
being only in a range of 5% to 25% (1, 2). Recently,
applications of combined chemotherapy and radiotherapy, or
the combination therapy as an adjunct to surgery, have improved the prognosis of esophageal squamous cell carcinoma
patients (3, 4). Thus, there is some urgency for the development of new antitumor agents so as to further improve the
prognosis of esophageal squamous cell carcinoma patients. In
this regard, among the most promising candidates as antitumor
agents are histone deacetylase inhibitors (HDACI) such as
FK228 (5, 6).
In chromatin, the four inner histones are wrapped inside 146
bp of DNA to make a nucleosome and they are aggregated to
Authors’ Affiliations: Departments of 1Frontier Surgery (M9) and 2Functional
Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan
Received 4/15/05; revised 7/26/05; accepted 8/4/05.
Grant support: Japan Society for the Promotion of Science and a grant-in-aid for
scientific research on priority areas from the Minister of Education, Culture, Sports,
Science and Technology of Japan.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: Hisahiro Matsubara, Department of Frontier Surgery (M9),
Graduate School of Medicine, Chiba University, 1-8-1Inohana, Chuo-ku, 260-8670
Chiba, Japan. Phone: 81-43-226-2109; Fax: 81-43-226-2111; E-mail: matsuhm@
faculty.chiba-u.jp.
F 2005 American Association for Cancer Research.
doi:10.1158/1078-0432.CCR-05-0840
www.aacrjournals.org
form a higher-order structure of chromatin (7). Chromatin
structure is closely related to gene transcription (8). At least two
mechanisms of chromatin remodeling are now understood: (a)
ATP-dependent chromatin remodelers make chromatin remodeling complexes and slide nucleosome core histone along DNA,
making DNA more accessible to transcription factors and DNA
binding factors to promote transcription (9) and (b) the
chromatin structure of nucleosomes is modified by histone
acetyltransferases and HDACs (10). Histone acetyltransferases,
which acetylate lysine residues of histone proteins, facilitate the
access of many transcriptional factors to DNA and consequently activate the expression of the target genes. In contrast,
HDACs, which deacetylate lysine residues, repress transcription
(11, 12). One of the histone deacetylase inhibitors, FK228
(depsipeptide), isolated from Chromobacterium violaceum, is a
new anticancer agent with potent HDAC-inhibiting activities
(5, 6). FK228 induces histone acetylation, cell cycle arrest, and
differentiation or apoptosis in vitro and in vivo in some human
cancer cell lines (13 – 16). Recently, it was shown that HDACIs
(e.g., FK228, suberoylanilide hydroxamic acid, and trichostatin A)
activate transcription of the cyclin-dependent kinase inhibitor
p21WAF1 (15, 17, 18) and induction of p21WAF1 by HDACIs
requires the Sp-1 binding site and is associated with the
accumulation of acetylated histones in the promoter region of
the gene (17 – 20).
In this study, microarray analysis revealed that FK228
activated peroxiredoxin 1 (Prdx1) gene expression, Prdx1 being
a member of the peroxiredoxin family of antioxidant enzymes
(21 – 25) in both TE2 and T.Tn cell lines. The Sp-1 binding site
7945
Clin Cancer Res 2005;11(21) November 1, 2005
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Cancer Therapy: Preclinical
Fig. 1. A, antiproliferative activity inT.Tn and TE2.
Cells were incubated for 72 hours in the absence or
presence of the indicated concentrations of FK228
and cell viability was determined using Cell Counting
Kit-8 as described in Materials and Methods. Results
are shown as the percentage of viability in the
control. Points, mean of eight separate experiments;
bars, SD. B, profiles of original flow cytometric
analysis inT.Tn and TE2 cells. Cells were treated for
24 or 72 hours with IC80 concentrations of FK228
(T.Tn, 1.83 ng/mL; TE2, 1.13 ng/mL) and stained
with propidium iodide. The percentage of cells
with a DNA content of less than sub-G1 is indicated
in each histogram. C, in vitro apoptotic effects of
FK228 inT.Tn and TE2 cells. Cells were exposed to
FK228 at IC80 concentrations for 24 or 72 hours and
apoptotic cells were stained byTUNEL inT.Tn and
TE2. Positive cells are shown with dark brown
nuclei. The numbers of positive cells increased in a
time-dependent manner in both cell lines.
of the Prdx1 promoter was acetylated by FK228. Taken together,
we propose a novel antitumor mechanism of FK228 that
induces cell growth arrest and/or apoptosis induction augmented by Prdx1 activation with promoter acetylation in
human esophageal cancer cell lines and suggest its applicability
to esophageal cancer treatment.
Materials and Methods
Cell culture and chemicals. The human esophageal cell lines were
cultured in DMEM (Life Technologies, Grand Island, NY) supplemented with 10% FCS. T.Tn cells were from Japanese Cancer Research
Resources Bank. TE2 cells were kindly provided by Dr. T. Nishihira
Table 1. TUNEL-positive cells for apoptotic index
T.Tn
0h
24 h
72 h
TE2
Control (%)
IC80 (%)
P
Control (%)
IC80 (%)
P
1.50 F 0.30
3.17 F 0.45
3.23 F 0.35
6.20 F 0.30
39.4 F 1.88
0.0006
<0.0001
0.73 F 0.40
2.43 F 0.32
3.20 F 0.36
5.60 F 0.17
50.9 F 2.16
<0.0001
<0.0001
NOTE: The apoptotic index was defined as the percentage of positive cells in 1,000 cells from three arbitrary microscopic fields. Data are expressed as mean F SD.
Statistical significance was evaluated by unpaired Student’s t test.
Clin Cancer Res 2005;11(21) November 1, 2005
7946
www.aacrjournals.org
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
FK228 Induces Prdx1 in Esophageal Cancer Cells
Table 2. List of 11genes up-regulated (>2-fold changes at least at one time point) in both T.Tn and TE2 cells
Genbank
accession no.
Gene
symbol
Description
Function
X67951
U03106
M61733
Prdx1
CDKN1A
EPB41
M59828
AK000715
X62320
AL132826
M81355
V00662
X93334
BC003560
HSPA1A
PTRF
GRN
FLRT3
PSAP
ATP8
ND4L
RPN2
Peroxiredoxine1
Cyclin-dependent kinase inhibitor1A (p21, Cip1)
Erythrocyte membrane protein band 4.1
(elliptocytosis1, RH-linked)
Heat shock 70 kDa protein1A
Polymerase I and transcript release factor
Granulin
Fibronectin leucine-rich transmembrane protein 3
Prosaposin
ATP synthase 8
NADH dehydrogenase 4L
Ribophorin II
(Tohoku University, Sendai, Japan). FK228 was provided by Fujisawa
Pharmaceutical Company (Tokyo, Japan). In in vitro studies, FK228
was dissolved in 100% ethanol and diluted with each experimental
medium. In in vivo studies, FK228 was dissolved and diluted with 10%
polyoxyethylated (60 mol) hydrogenated castor oil (HCO60) in saline.
Cytotoxicity assay. Cell growth was determined with Cell Counting
Kit-8 (Dojindo, Kumamoto, Japan). Cells (5 103 per well) were seeded
into 96-well microplates and incubated for 48 hours at 37jC under 5%
CO2. FK228 was dissolved in ethanol and diluted with DMEM. The
medium was changed for test samples and incubated in the presence or
absence of drugs for 72 hours. Then the Cell Counting Kit-8 reagent was
added and allowed to react for 3 hours. Absorbance at 450 nm was
measured using a microplate reader (Bio-Rad Laboratories, Hercules,
CA). The IC50 values were calculated by the least-square method.
Cell cycle analysis and terminal deoxynucleotidyl transferase – mediated
nick-end labeling assay. For cell cycle analysis, cells were incubated with
IC80 (T.Tn, 1.83 ng/mL and TE2, 1.13 ng/mL) FK228 and harvested at 0,
24, and 72 hours. Cells were pelleted by centrifugation and resuspended
in 70% ethanol. The cells were incubated at 30jC for at least 4 hours
and resuspended with 50 Ag/mL propidium iodine in a reaction
solution containing 1 mg/mL RNase A. Fluorescence emitted from the
propidium iodine-DNA complex was quantified using FACScan (Becton
Dickinson Medical Systems, Sharon, MA). Apoptosis was determined by
the presence of a sub-G1 population in the cell cycle profile.
Apoptosis was also detected by the analysis of DNA fragmentation
using terminal deoxynucleotidyl transferase – mediated nick end labeling assay (TUNEL) with an In situ Apoptosis Detection kit (Takara,
Tokyo, Japan). The apoptotic index was defined as the percentage of
positive cells in 1,000 cells from three arbitrary microscopic fields.
Western blot analysis. Whole cell pellets were washed thrice in
PBS, resuspended in lysis buffer [20 mmol/L Tris-HCl (pH 7.5), 5%
NP40, 1 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride,
Maximum fold change
T.Tn
TE2
Metabolism/enzyme
Cell cycle
Cytoskeleton
3.85
3.41
2.22
4.02
3.75
2.53
Transcription factor
Translation factor
Translation factor
Signal transduction
Signal transduction
Metabolism/enzyme
Metabolism/enzyme
Metabolism/enzyme
2.95
2.20
3.05
2.51
2.73
2.22
2.24
3.30
3.74
3.24
3.70
3.01
4.52
2.70
3.70
2.36
50 Amol/L leupeptin, 50 Amol/L antipain, 50 Amol/L pepstatin,
50 Amol/L N-acetyl-leucyl-leucyl-norleucinal]. Protein extracts (25 Ag)
were subjected to SDS-PAGE and transferred to polyvinylidene
difluoride membranes. Membranes were blocked in PBS containing
5% nonfat dried milk and 0.1% Tween 20. Anti-acetyl-histone H3
polyclonal antibody (1:1,000; Upstate Biotechnology, Inc., Lake
Placid, NY), anti-acetyl-histone H4 polyclonal antibody (1:1,000;
Upstate Biotechnology), anti-p21WAF1 polyclonal antibody (1:200;
Santa Cruz Biotechnology, Santa Cruz, CA), anti-Prdx1 polyclonal
antibody (1:2,000; Alexis Biochemicals, Lausen, Switzerland), and
anti-h-actin polyclonal antibody (1:200; Santa Cruz Biotechnology,
Santa Cruz, CA) were used. After incubation with a primary antibody
for 3 hours at room temperature, the membranes were incubated for
2 hours in the second antibody in PBS and visualized using ECL
Western Blotting Detection Reagents (Amersham Pharmacia Biotech,
Inc., Piscataway, NJ).
Messenger RNA preparation and cDNA microarray analysis. Cells
were seeded into a 225 cm2 flask and incubated for 48 hours,
then treated with or without an IC80 concentration of FK228 and
harvested at 0, 6, 12, 24, and 48 hours. Cells were washed with PBS
and processed for RNA extraction with RNeasy kit (Qiagen, Inc.,
Chatsworth, CA). Twenty micrograms of total RNA from cells cultured
with FK228 were compared with 20 Ag of total RNA from cells
cultured without FK228 by using a cDNA microarray consisting of
4,608 distinct cDNA clones generated as described previously (26).
Fluorescent images of the hybridized microarrays were scanned with a
fluorescence laser confocal slide scanner (Scan Array 4000, GSI
Lumonics, Ottawa, Ontario, Canada) and analyzed with Quant Array
software (GSI Lumonics). All experiments were done in duplicate and
the averaged data of each time point were subjected to statistical
analysis. To identify significantly expressed genes, we defined the data
for those genes that showed 2-fold changes for at least one time point.
Table 3. List of four genes down-regulated (>2-fold changes at least at one time point) in bothT.Tn and TE2 cells
Genbank
accession no.
Gene
symbol
Description
BC000013
BC005391
D89092
BC002355
IGFBP3
RPSA
HNPDL
HNRPA1
Insulin-like growth factor binding protein 3
Laminin receptor1 (ribosomal protein SA, 67 kDa)
Heterogeneous nuclear ribonucleoprotein D-like
Heterogeneous nuclear ribonucleoprotein A1
www.aacrjournals.org
Function
7947
Regulation of cell growth
Regulation of transcription
Translation factor
Translation factor
Maximum fold change
T.Tn
TE2
2.46
2.29
2.41
2.56
2.10
2.25
2.99
3.65
Clin Cancer Res 2005;11(21) November 1, 2005
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Cancer Therapy: Preclinical
Fig. 2. A, comparison of results obtained from real-time
quantitative PCR analysis of changes in mRNA levels after treatment
with FK228. mRNA levels at various time points after administration
of FK228 relative to the level of control cells in real-time
quantitative PCR are shown for p21WAF1 and Prdx1 genes. B, effects
of FK228 on expression levels of p21WAF1 and Prdx1proteins. T.Tn
andTE2 cells were incubated with1ng/mL of FK228 for the indicated
time periods and were analyzed for p21WAF1 and Prdx1protein
expression levels by Western blotting as described in Materials
and Methods.
Real-time quantitative reverse transcription-PCR. The expression
changes of p21WAF1 and Prdx1 genes were examined by real-time
quantitative PCR using the LightCycler technique (Roche Diagnostics
GmbH, Mannheim, Germany). The cDNA templates for real-time
PCR were synthesized from 1 Ag of total RNA using SuperScript II
reverse transcriptase and an oligo-dT primer. The glyceraldehyde-3phosphate dehydrogenase (GAPDH) gene served as internal control. The
PCR reaction mixture consisted of DNA Master SYBR Green I mix
(LightCycler-FastStart DNA Master SYBR Green I kit, Roche Diagnostics;
containing Taq DNA polymerase, deoxynucleotide triphosphate,
3 mmol/L MgCl2, and SYBR green dye), 0.5 Amol/L of each primer,
and cDNA. The PCR processes were as follows: initial denaturation
at 95jC for 10 minutes, followed by 45 cycles of denaturation at 95jC
for 15 seconds, annealing at 57jC for 10 seconds, and elongation
at 72jC for 8 to 18 seconds. The Fit Points method provided by the
LightCycler software was used to estimate the concentration of each
sample. Primers were chosen using Primer3 (available at http://wwwgenome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). The following
primer sequences were used: Prdx1, 5V-CAGCCTGTCTGACTACAAAGGA-3V and 5V-CCAGTCCTCCTTGTTTCTTAGG-3V; p21WAF1, 5V-ACTTCGACTTTGTCACCGAGA-3V and 5V-CAAGACAGTGACAGGTCCACAT-3V; and GAPDH, 5V-ACCACAGTCCATGCCATCAC-3V and 5V-TCCACCACCCTGTTGCTGTA-3V.
The expression value was calculated as follows: expression level of
each mRNA/expression level of GAPDH. Experiments were done in
duplicate.
Chromatin immunoprecipitation assay. The chromatin immunoprecipitation assay was done by chromatin immunoprecipitation assay kit
(Upstate Biotechnology). Briefly, cells were seeded at 2 106 per 10 cm
dish and incubated for 48 hours at 37jC under 5% CO2. The cells were
then cultured with 2.0 ng/mL of FK228 for 2 hours at 37jC under 5%
CO2. Formaldehyde was added to the cells to a final concentration of
1% and they were further incubated for 10 minutes at 37jC. The
harvested cells were precleared with salmon sperm DNA/protein A
agarose and subsequently incubated with either 5 AL of anti-acetylhistone H3 or anti-acetyl-histone H4 antibody at 4jC overnight.
Chromatin samples were immunoprecipitated using salmon sperm
DNA/protein A. Samples were washed once with low salt immune
complex wash buffer, once with high salt immune complex wash
buffer, once with LiCl immune complex wash buffer, and twice with TE
buffer. Immune complexes were eluted and subsequently reverse crosslinked and purified by phenol/chloroform extraction and ethanol
precipitation. The supernatant of an immunoprecipitation reaction
done in the absence of any antibody was purified and used as control to
show total input DNA. PCR analysis by Prdx1-specific primers was
carried out using DNA from chromatin immunoprecipitation experi-
Clin Cancer Res 2005;11(21) November 1, 2005
ments and input samples. The PCR processes were as follows: initial
denaturation at 95jC for 1 minute followed by 30 cycles of
denaturation at 95jC for 30 seconds and annealing and elongation at
68jC for 1.5 minutes. PCR products were run on 2% agarose/ethidium
bromide gel. The following primer sequences for Prdx1 were used:
P1, 5V- CCCAAGAGGTTCTCAGGAGGT-3V and 5V-TGGTGAAACCCTGTCTCTGCT-3V; P2, 5V-CTGAATCAGCCTCCCAAGATG-3V and
5V-ACTACGCACTGTGCCCTCAAT-3V; P3, 5V-CTCACTCCAACCTCAGCCATC-3V and 5V-CACTCACCAGTCCCAACACAA-3V; and E6,
5V-CTGGAAACCTGGCAGTGATAC-3V and 5V-AAGAAAGGCTGGTCTCTCCAC-3V. The following primer sequences for b-actin were used:
P1, 5V-GCGTGACTGTTACCCTCAAAA-3V and 5V-TAAATGTGCTGGGTGGGTCA-3V; E6, 5V-ATGTGGATCAGCAAGCAGGA-3V and 5V-ATCAAAGTCCTCGGCCACAT-3V.
Small interfering RNA transfections. The anti-Prdx1 small interfering
RNA (siRNA) sequences and the control siRNA sequence used were as
follows: Prdx1-1, CAGATGGTCAGTTTAAAGATA; Prdx1-2, CAGCCGAATTGTGGTGTCTTA; control, AATTCTCCGAACGTGTCACGT. A
total of 10,000 cells per well were seeded in a 96-well plate 1 day
before transfection. Transfection was done with 0.25 Ag siRNA and 2 AL
transmessenger per well using a transmessenger transfection kit
(Qiagen). At 48 hours after transfection, cells were treated in the
presence or absence of FK228 for 72 hours. Cell growth was determined
by the Cell Counting Kit-8 (Dojindo) as described above. In parallel,
RNA from f20,000 cells was isolated using the RNeasy kit (Qiagen) 48
hours after transfection. The relative amount of mRNA was determined
by reverse transcription-PCR and real-time quantitative PCR as
described above. All experiments were done in triplicate and data were
presented as mean F SD.
In vivo animal model. T.Tn (2.5 106 cells) and TE2 (2.5 106
cells) were injected into the backs of BALB/c nu/nu mice. When the
Fig. 3. Acetylation of histones by FK228. T.Tn and TE2 cells were incubated
with different amounts of FK228 for 2 hours and then analyzed for acetylated
histones H3 (Ac-H3) and H4 (Ac-H4) by Western blotting as described in
Materials and Methods.
7948
www.aacrjournals.org
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
FK228 Induces Prdx1 in Esophageal Cancer Cells
Fig. 4. FK228 induction of the
acetylation of the histone associated
with the Prdx1 gene promoter. A, position
of the primers in the Prdx1 gene. Treatment
of T.Tn (B) and TE2 (C) cells with or
without 2 ng/mL of FK228 for 2 hours and
immunoprecipitation of chromatin
extracts with input DNA or antibodies to
acetylated histone H3 or H4.
estimated tumor weight reached f200 mg, animals were divided into
four groups and treated i.v. thrice at 4-day intervals with 0, 1.0, 2.0, or
3.0 mg/kg, respectively. Tumor weight was calculated from the
following formula: tumor weight (mg) = length width2 / 2.
Xenograft model of real-time quantitative PCR for Prdx1 gene. T.Tn
(2.5 106 cells) and TE2 (2.5 106 cells) were injected into the backs
of BALB/c nu/nu mice. When the estimated tumor weight reached
f200 mg, animals were divided into five groups, treated i.v. once with
3.0 mg/kg of FK228, and RNA was extracted from solid tumors at 0, 6,
12, 24, and 48 hours postinjection by RNeasy Mini kit (Qiagen). RNA
was reverse-transcribed and PCR analysis for Prdx1 and GAPDH was
done as described above.
FK228 activates Prdx1 and p21WAF1 expression as detected by
microarray analysis. To determine the target genes of FK228 in
esophageal cancer cell lines, we did cDNA microarray analysis.
Two-fold or greater alterations in gene expression, either
increasing or decreasing, were considered significant. Ninetythree genes were identified in T.Tn and 65 in TE2. Among them,
11 genes were up-regulated (Table 2) and four were downregulated (Table 3) in both cell lines, respectively. Especially,
the expression levels of p21WAF1 and Prdx1 genes were remarkably increased. To verify whether p21WAF1 and Prdx1
Results
FK228 showed antiproliferative activity by inducing cell arrest
and apoptosis in human esophageal cancer cell lines. FK228 has
apparent antitumor efficacy in several human cancer cell lines
(5, 6, 13 – 16). In this study, we assessed the antitumor activity
of FK228 in human esophageal cancer cell lines T.Tn and TE2
and the sensitivities of these cells were evaluated with IC50
values of 0.373 and 0.781 ng/mL, respectively (Fig. 1A). In both
T.Tn and TE2 cell lines, the percentage of G2-M cells was
increased at 24 hours with IC80 FK228 treatment, and sub-G1
cells were increased in a time-dependent manner (Fig. 1B). For
TUNEL assay, T.Tn and TE2 cells were cultured with IC80
concentrations of FK228 for 24 and 72 hours, respectively.
In both T.Tn and TE2, TUNEL-positive cells increased in a
time-dependent manner (Fig. 1C). TUNEL index also showed
that FK228 increased sub-G1 fractions, representing the
induction of apoptosis (Table 1).
www.aacrjournals.org
Fig. 5. A, FK228 did not alter expression levels of h-actin proteins. T.Tn and TE2
cells were incubated with 1ng/mL of FK228 for the indicated time periods and were
analyzed for h-actin protein expression levels by Western blotting as described in
Materials and Methods. B, FK228 did not induce acetylation of the histone
associated with b-actin gene promoter. T.Tn and TE2 cells were treated with or
without 2 ng/mL of FK228 for 2 hours and immunoprecipitation of chromatin
extracts was done with input DNA or antibodies to acetylated histone H3 or H4.
7949
Clin Cancer Res 2005;11(21) November 1, 2005
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Cancer Therapy: Preclinical
expression levels were activated at transcriptional levels, we did
quantitative real-time reverse transcription-PCR analysis of
these mRNAs and showed that their expressions were activated
at both transcriptional (Fig. 2A) and protein levels (Fig. 2B).
FK228 acetylated histones in the Prdx1 gene promoter. FK228
treatment increased acetylated histones in several human
cancer cell lines (27). First, to determine whether FK228 can
induce histone acetylation in human esophageal cancer cells,
T.Tn and TE2 cells were exposed to FK228 at various
concentrations for 2 hours. As expected, FK228 induced
histones H3 and H4 acetylation in a dose-dependent manner,
becoming especially apparent at doses higher than 1.0 ng/mL
(Fig. 3). Second, we examined whether FK228 acetylates
histones H3 and/or H4 in the promoter of Prdx1 gene by
using chromatin immunoprecipitation assay in T.Tn and TE2
cells. As shown in Fig. 4A, primer sets encompassing the Prdx1
promoter and the coding gene were used to assess the extent of
histone acetylation; the acetylation of histone H3 of Prdx1
promoter and exon 6 (the last exon of Prdx1) was increased in
both cell lines (Fig. 4B and C). In TE2 cells, histone H4 in P3
was acetylated, whereas in T.Tn cells histone H4 in P1 and P2
regions was acetylated; however, histone H4 in exon 6 was
acetylated in both cell lines (Fig. 4B and C). These results
indicate that the regions of histone acetylation differ among
esophageal cancer cell lines.
FK228 did not induce accumulation of acetylated histones in
chromatin associated with b-actin genes. To determine whether
this effect was selective for a limited number of genes, we
examined the level of histone H3 or H4 acetylation in h-actin.
The protein expression level of h-actin was not changed by
incubation with FK228 (Fig. 5A) and there was no change in
the levels of histone H3 or H4 acetylation after culture with
FK228 (Fig. 5B). Taken together, these results suggest that the
FK228-induced changes in histone acetylation are localized to
specific areas of chromatin.
Silencing Prdx1 gene expression reduced chemosensitization by
FK228. If FK228 induces antiproliferative effects by activating
the Prdx1 gene, Prdx1 suppression by RNA interference should
reduce the antitumor activity of FK228. To examine this
hypothesis, Prdx1-specific siRNA was transfected into T.Tn
and TE2 cells (Fig. 6A and B). Expectedly, the reduction in
Prdx1 expression significantly down-regulated the chemosensitization by FK228 in both cell lines (Fig. 6C).
Effect of FK228 on the expression of Prdx1 mRNA in T.Tn
and TE2 xenografts. To establish a basis for future clinical
applications of FK288, we examined the antitumor activity
of FK228 using transplanted human esophageal cancer cell
lines in a mouse model. As shown in Fig. 7A, 50 days after the
first administration, the growth of TE2 tumors was significantly
suppressed compared with the control group. On the other
hand, in the case of T.Tn cells, although tumor growth
inhibition was observed to some extent, there was no
significant difference in tumor size between any of the treated
groups. In all cases, there was no effect on the weight of
the mice compared with controls. Furthermore, we examined
the expression of Prdx1 mRNA in T.Tn and TE2 xenografts by
real-time PCR analysis after the administration of FK228. Even
in the xenograft models, the expression of Prdx1 had its peak
at 12 hours postadministration (Fig. 7B), after which the
induction levels decreased, reaching basal expression levels at
48 hours.
Clin Cancer Res 2005;11(21) November 1, 2005
Discussion
We showed for the first time that FK228 induces both
apoptosis and cell cycle arrest, resulting in antiproliferative
effect on human esophageal cancer cell lines T.Tn and TE2.
Further, FK228 activated Prdx1 gene expression by acetylating
histones H3 and H4 of its promoter.
Acetylation and deacetylation of histones play a major role in
the regulation of gene transcription and in the modulation of
chromatin structure (10). The activity of HDACIs plays a key
role in transcriptional modulation for the therapeutic approach
that is described as ‘‘transcription therapy’’ (28). However, the
molecular events that correlate with growth inhibition by
HDACIs are not fully understood and they may differ in each
combination of reagent and tumor cells.
Fig. 6. A and B, quantification of mRNA of Prdx1 after transfection of specific
siRNA with reverse transcription-PCR (A) and real-time quantitative PCR (B).
C, effects of silencing Prdx1 gene expression on antiproliferative activity inT.Tn
and TE2. Cells were transfected with Prdx1-specific (Prdx1-1or Prdx1-2)
siRNA or nonspecific control (control) siRNA. At 48 hours after transfection,
cells were incubated for 72 hours in the presence or absence of the indicated
concentrations of FK228 and cell viability was determined using Cell Counting
Kit-8 as described in Materials and Methods. Results are shown as the percentage
of viability in the control. Points, mean of three separate experiments; bars, SD.
Statistical significance was analyzed by Dunnett’s test for multiple
comparisons (*P < 0.01versus control).
7950
www.aacrjournals.org
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
FK228 Induces Prdx1 in Esophageal Cancer Cells
Fig. 7. A, FK228 inhibition of human
esophageal cancer cell tumor growth
in vivo. Fragments of human solid tumor
were implanted s.c. into the backs of
BALB/c nu/nu mice. The drugs were given
i.v. to mice thrice at 4-day intervals with
FK228 (#). Tumor weight was calculated
from the results of five independent
experiments. Points, mean; bars, SD.
Data were analyzed for statistical
significance by Dunnett’s test for multiple
comparisons (*P < 0.05, **P < 0.01versus
control). B, changes in the expression of
Prdx1 mRNA inT.Tn andTE2 xenografts after
FK228 administration. Tumor cells were
inoculated s.c. into nude mice. FK228
(3.0 mg/kg) was given in a single i.v.
administration to the mice. Quantitative
changes in the expression levels of Prdx1
mRNA after FK228 administration inT.Tn
and TE2 xenografts were detected by
real-time quantitative PCR. Columns, mean
of four independent experiments; bars, SD.
In this study, we identified several genes that were
significantly up-regulated by FK228, one of the HDACIs, in
both T.Tn and TE2 cells. Cyclin-dependent kinase inhibitor
p21WAF1 was clearly up-regulated and it has been reported to
play an important role in growth arrest, both in G1 and G2-M
cell cycle arrest (29). Recent studies also reported that HDACIs
exert cell cycle arrest by inducing p21WAF1 in some other cell
lines (15, 17, 18). HDACIs, such as trichostatin A, butyrate,
suberoylanilide hydroxamic acid, and FK228, induce the
acetylation of histones H3 and H4 in the promoter region
including the Sp1-binding sites, also called the GC-box, which
are important for the expression of the human p21WAF1 gene
(17 – 20). Further experiments are required for revealing the
mechanism underlying how p21WAF1 and Prdx1 up-regulation
are directly or indirectly related to apoptosis induction.
In addition, FK228 seems to activate Prdx1 genes at both
transcriptional and protein levels. Peroxiredoxines are a novel
family of peroxidases that can reduce H2O2 using an electron
donor from thioredoxin and/or glutathione (21). Peroxiredoxine
has been identified and divided into six groups in mammals
(30). Prdx1 is a highly conserved protein that is up-regulated in
ras oncogene–transformed primary mammary epithelial cells
(31) and is highly expressed during proliferation (32). Recently,
Prdx1 was reported to inhibit c-Abl kinase activity by interacting
with its SH3 domain (22) and to relate to certain c-Myc–
dependent functions by interacting with its Myc box II domain
(23). Thus, Prdx1 is a potent tumor suppressor gene. It was also
reported that lower expression of Prdx1 in the tumor correlates to
larger tumor size, lymph node metastasis, and clinically
advanced stages (24), and that Prdx1 knockout mice generate
malignancies in intestines, lymphomas, and sarcomas (25).
Thus, what is the mechanism of Prdx1 activation by FK228?
One possibility may be that FK228 acetylates histones H3 and/or
H4 of promoter region, including Sp1-binding sites. These Sp1binding sites are transcriptional modulator – binding sites, such
as Sp1, Sp2, Sp3, and ZBP-89/BFCOL1 (33 – 37). Additionally,
silencing of Prdx1 gene expression by specific RNA interference
down-regulated the sensitization of cells to FK228. In any event,
it is clear that the unraveling of the precise mechanism of Prdx1
activation by FK228 will require further studies.
In summary, FK228 induces growth inhibition and apoptosis
in human esophageal squamous cancer cells, presumably by
activating the Prdx1 gene with histones H3 and H4 acetylation
of its promoter. Our findings will provide some clue that may
be helpful for the future clinical application of HDACIs in the
treatment of esophageal cancer.
References
1. MillerJD, Jain MK, de Gara CJ, Morgan D, UrschelJD.
Effect of surgical experience on results of esophagectomy for esophageal carcinoma. J Surg Oncol 1997;
65:20 ^ 1.
www.aacrjournals.org
2. Chan A,Wong A. Is combined chemotherapy and radiation therapy equally effective as surgical resection
in localized esophageal carcinoma? Int J Radiat Oncol
Biol Phys 1999;45:265 ^ 70.
7951
3. Altorki N, Kent M, Ferrara C, Port J. Three-field
lymph node dissection for squamous cell and adenocarcinoma of the esophagus. Ann Surg 2002;
236:177 ^ 83.
Clin Cancer Res 2005;11(21) November 1, 2005
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Cancer Therapy: Preclinical
4. Medical Research Council Oesophageal Cancer
Working Group. Surgical resection with or without preoperative chemotherapy in oesophageal cancer: a randomised controlled trial. Lancet 2002;359:1727 ^ 33.
5. Ueda H, Nakajima H, Hori Y, et al. FR901228, a novel
antitumor bicyclic depsipeptide produced by Chromobacterium violaceum No. 968. I. Taxonomy, fermentation, isolation, physico-chemical and biological
properties, and antitumor activity. J Antibiot (Tokyo)
1994;47:301 ^ 10.
6. Shigematsu N, Ueda H,Takase S,Tanaka H,Yamamoto
K,TadaT. FR901228, a novel antitumor bicyclic depsipeptide produced by Chromobacterium violaceum No.
968. II. Structure determination. J Antibiot (Tokyo)
1994;47:311 ^ 4.
7. Luger K, Mader AW, Richmond RK, Sargent DF,
Richmond TJ. Crystal structure of the nucleosome core
particle at 2.8 A resolution. Nature 1997;389:251 ^ 60.
8. Jenuwein T, Allis CD. Translating the histone code.
Science 2001;293:1074 ^ 80.
9. Flaus A, Owen-Hughes T. Mechanisms for ATPdependent chromatin remodelling: farewell to the
tuna-can octamer? Curr Opin Genet Dev 2004;14:
165 ^ 73.
10. Marmorstein R, Roth SY. Histone acetyltransferases:
function, structure, and catalysis. Curr Opin Genet Dev
2001;11:155 ^ 61.
11. Jacobson S, Pillus L. Modifying chromatin and
concepts of cancer. Curr Opin Genet Dev 1999;9:
175 ^ 84.
12. Kouzarides T. Histone acetylases and deacetylases
in cell proliferation. Curr Opin Genet Dev 1999;9:40 ^ 8.
13. Byrd JC, Shinn C, Ravi R, et al. Depsipeptide
(FR901228): a novel therapeutic agent with selective,
in vitro activity against human B-cell chronic lymphocytic leukemia cells. Blood 1999;94:1401 ^ 8.
14. Nakajima H, KimYB,Terano H,Yoshida M, Horinouchi
S. FR901228, a potent antitumor antibiotic, is a novel
histone deacetylase inhibitor. Exp Cell Res 1998;241:
126 ^ 33.
15. Huang L, Pardee AB. Suberoylanilide hydroxamic
acid as a potential therapeutic agent for human breast
cancer treatment. Mol Med 2000;6:849 ^ 66.
16. Kosugi H, Towatari M, Hatano S, et al. Histone
deacetylase inhibitors are the potent inducer/enhancer of differentiation in acute myeloid leukemia:
a new approach to anti-leukemia therapy. Leukemia
1999;13:1316 ^ 24.
17. SasakawaY, NaoeY, InoueT, et al. Effects of FK228,
a novel histone deacetylase inhibitor, on human
lymphoma U-937 cells in vitro and in vivo. Biochem
Pharmacol 2002;64:1079 ^ 90.
18. SowaY, OritaT, Minamikawa S, et al. Histone deacetylase inhibitor activates theWAF1/Cip1gene promoter
through the Sp1sites. Biochem Biophys Res Commun
1997;241:142 ^ 50.
19. Nakano K, Mizuno T, Sowa Y, et al. Butyrate activates the WAF1/Cip1gene promoter through Sp1sites
in a p53-negative human colon cancer cell line. J Biol
Chem 1997;272:22199 ^ 206.
20. Huang L, Sowa Y, Sakai T, Pardee AB. Activation of
the p21WAF1/CIP1 promoter independent of p53 by
the histone deacetylase inhibitor suberoylanilide
hydroxamic acid (SAHA) through the Sp1sites. Oncogene 2000;19:5712 ^ 9.
21. Chae HZ, Robison K, Poole LB, Church G, Storz G,
Rhee SG. Cloning and sequencing of thiol-specific antioxidant from mammalian brain: alkyl hydroperoxide
reductase and thiol-specific antioxidant define a large
family of antioxidant enzymes. Proc Natl Acad Sci
U S A 2004;91:7017 ^ 21.
22. Wen ST, Van Etten RA. The PAG gene product, a
stress-induced protein with antioxidant properties, is
an Abl SH3-binding protein and a physiological inhibitor of c-Abl tyrosine kinase activity. Genes Dev 1997;
11:2456 ^ 67.
23. Mu ZM,Yin XY, Prochownik EV. Pag, a putative tumor suppressor, interacts with the Myc box II domain
of c-Myc and selectively alters its biological function
and target gene expression. J Biol Chem 2002;277:
43175 ^ 84.
24. Yanagawa T, Iwasa S, Ishii T, et al. Peroxiredoxin I
expression in oral cancer : a potential new tumor
marker. Cancer Lett 2000;156:27 ^ 35.
25. Neumann CA, Krause DS, Carman CV, et al. Essential role for the peroxiredoxin Prdx1in erythrocyte antioxidant defence and tumour suppression. Nature
2003;424:561 ^ 5.
26. Mori M, Shimada H, Gunji Y, et al. S100A11 gene
identified by in-house cDNA microarray as an accurate
predictor of lymph node metastases of gastric cancer.
Oncol Rep 2004;11:1287 ^ 93.
Clin Cancer Res 2005;11(21) November 1, 2005
7952
27. Taura K, Yamamoto Y, Nakajima A, et al. Impact of
novel histone deacetylase inhibitors, CHAP31 and
FR901228 (FK228), on adenovirus-mediated transgene expression. J Gene Med 2004;6:526 ^ 36.
28.Vigushin DM, Coombes RC.Targeted histone deacetylase inhibition for cancer therapy. Curr Cancer Drug
Targets 2004;4:205 ^ 18.
29. Niculescu ABIII, Chen X, Smeets M, Hengst L, Prives
C, Reed SI. Effects of p21(Cip1/Waf1) at both the G1/S
and the G2/M cell cycle transitions: pRb is a critical determinant in blocking DNA replication andinpreventing
endoreduplication. Mol Cell Biol1998;18:629 ^ 43.
30. Wood ZA, Schroder E, Robin Harris J, Poole LB.
Structure, mechanism and regulation of peroxiredoxins. Trends Biochem Sci 2003;28:32 ^ 40.
31. Prosperi MT, Ferbus D, Karczinski I, Goubin G.
A human cDNA corresponding to a gene overexpressed during cell proliferation encodes a product
sharing homology with amoebic and bacterial proteins. J Biol Chem 1993;268:11050 ^ 6.
32. Prosperi MT, Apiou F, Dutrillaux B, Goubin G. Organization and chromosomal assignment of two human
PAG gene loci: PAGA encoding a functional gene and
PAGB a processed pseudogene. Genomics 1994;19:
236 ^ 41.
33. Bai L, Merchant JL. Transcription factor ZBP-89
cooperates with histone acetyltransferase p300
during butyrate activation of p21waf1 transcription in
human cells. J Biol Chem 2000;275:30725 ^ 33.
34. Doetzlhofer A, Rotheneder H, Lagger G, et al.
Histone deacetylase 1 can repress transcription by
binding to Sp1. Mol Cell Biol 1999;19:5504 ^ 11.
35. Xiao H, Hasegawa T, Isobe K. p300 collaborates
with Sp1 and Sp3 in p21(waf1/cip1) promoter activation induced by histone deacetylase inhibitor. J Biol
Chem 2000;275:1371 ^ 6.
36. SowaY, OritaT, Minamikawa-Hiranabe S, MizunoT,
Nomura H, Sakai T. Sp3, but not Sp1, mediates the
transcriptional activation of the p21/WAF1/Cip1 gene
promoter by histone deacetylase inhibitor. Cancer
Res 1999;59:4266 ^ 70.
37. Hasegawa T, Xiao H, Isobe K. Cloning of a
GADD34-like gene that interacts with the zinc-finger
transcription factor which binds to the p21(WAF) promoter. Biochem Biophys Res Commun 1999;256:
249 ^ 54.
www.aacrjournals.org
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Histone Deacetylase Inhibitor FK228 Activates Tumor
Suppressor Prdx1 with Apoptosis Induction in Esophageal
Cancer Cells
Isamu Hoshino, Hisahiro Matsubara, Naoyuki Hanari, et al.
Clin Cancer Res 2005;11:7945-7952.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://clincancerres.aacrjournals.org/content/11/21/7945
This article cites 36 articles, 11 of which you can access for free at:
http://clincancerres.aacrjournals.org/content/11/21/7945.full.html#ref-list-1
This article has been cited by 3 HighWire-hosted articles. Access the articles at:
/content/11/21/7945.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from clincancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.