Molecular Phylogenetics and Evolution 38 (2006) 426–438
www.elsevier.com/locate/ympev
Phylogenetic relationships of the lamprologine cichlid genus
Lepidiolamprologus (Teleostei: Perciformes) based on mitochondrial
and nuclear sequences, suggesting introgressive hybridization
Robert Schelly a,b,¤, Walter Salzburger c, Stephan Koblmüller d, Nina Duftner d,
Christian Sturmbauer d
b
a
Division of Vertebrate Zoology (Ichthyology), American Museum of Natural History, New York, NY 10024, USA
Department of Ecology, Evolution, and Environmental Biology, Center for Environmental Research and Conservation, Columbia University,
New York, NY 10027, USA
c
Lehrstuhl fuer Zoologie und Evolutionsbiologie, Department of Biology and Center for Junior Research Fellows, University of Konstanz,
D-78457 Konstanz, Germany
d
Department of Zoology, Karl-Franzens-University of Graz, Universitätsplatz 2, A-8010 Graz, Austria
Received 21 April 2005; accepted 27 April 2005
Available online 16 June 2005
Abstract
Using sequences of the mitochondrial NADH dehydrogenase subunit 2 gene (ND2, 1047 bp) and a segment of the non-coding
mitochondrial control region, as well as nuclear sequences including two introns from the S7 ribosomal protein and the loci
TmoM25, TmoM27, and UME002, we explore the phylogenetic relationships of Lepidiolamprologus, one of seven lamprologine cichlid genera in Lake Tanganyika, East Africa. Analyses consisted of direct optimization using POY, including a parsimony sensitivity
analysis, and maximum likelihood and Bayesian inference for comparison. With respect to Lepidiolamprologus, the results based on
the mitochondrial dataset were robust to parameter variation in POY. Lepidiolamprologus cunningtoni was resolved in a large clade
sister to ossiWed group lamprologines, among which the remaining Lepidiolamprologus were nested. In addition to L. attenuatus,
L. elongatus, L. kendalli, and L. profundicola, Neolamprologus meeli, N. hecqui, N. boulengeri, N. variostigma, and two undescribed
species were resolved in a two-pore Lepidiolamprologus clade sister to Lamprologus callipterus and two species of Altolamprologus.
Lepidiolamprologus nkambae, in marked conXict with morphological and nuclear DNA evidence, nested outside of the two-pore Lepidiolamprologus clade, suggesting that the mtDNA signal has been convoluted by introgressive hybridization.
 2005 Elsevier Inc. All rights reserved.
Keywords: Cichlidae; Lamprologini; Lepidiolamprologus; Lake Tanganyika; Introgressive hybridization
1. Introduction
Among the 12 cichlid tribes recognized by Poll (1986)
in Lake Tanganyika, East Africa, the substrate-brooding
lamprologines are the most diverse, with about 80 species. Additionally, eight lamprologine species are found
in the Congo River (Schelly and Stiassny, 2004), and at
*
Corresponding author. Fax: +1 212 769 5642.
E-mail address: [email protected] (R. Schelly).
1055-7903/$ - see front matter  2005 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2005.04.023
least one species occurs in the Malagarasi River (De Vos
et al., 2001; Schelly et al., 2003). While the monophyly of
Poll’s tribe Lamprologini has withstood scrutiny (Salzburger et al., 2002a; Stiassny, 1997; Sturmbauer et al.,
1994; Takahashi et al., 1998), most genera within the
tribe are unquestionably polyphyletic. For instance,
members of the “ossiWed group,” identiWed by Stiassny
(1997) and distinguished by a labial bone suspended
within the labial ligament, are scattered among four of
seven lamprologine genera potentially rendering
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
Lamprologus, Neolamprologus, and Lepidiolamprologus
non-monophyletic.
Pellegrin (1904) originally erected the genus Lepidiolamprologus for Lamprologus elongatus, deWning the
new genus, closely allied with Lamprologus, as somewhat more elongate, with teeth-like Lamprologus;
rather long gill rakers (12); small ctenoid scales numbering 90–95 in longitudinal series; 18 dorsal spines;
and 5 anal spines. Boulenger (1915) synonymized Lepidiolamprologus with Lamprologus, and arrayed lamprologines in the genera Lamprologus, Julidochromis,
and Telmatochromis, with no statement as to their
being part of a natural group. Subsequently, Regan
(1920) recognized aYnities between the lamprologines
known at the time, Telmatochromis, Julidochromis, and
Lamprologus, based on their strong conical teeth and
4–10 anal spines. Regan (1920, 1922) argued that the
diversity of Lamprologus species in the lake implied
that the group originated in Lake Tanganyika, despite
the existence of Congo River representatives, which he
believed were a single lineage. The Wrst signiWcant eVort
to use osteology to guide lamprologine classiWcation
was that of Colombe and Allgayer (1985). In that
study, the genus Lamprologus was subdivided into Wve
genera based on characters of the infraorbital series,
with only the Congo River species retained in the genus
Lamprologus. Pellegrin’s genus Lepidiolamprologus was
rehabilitated for six species (L. attenuatus, L. cunningtoni, L. elongatus, L. kendalli, L. nkambae, and L. profundicola), and three new genera were created: the
monotypic Variabilichromis for V. moorii, the monotypic Paleolamprologus for P. toae, and Neolamprologus for 38 species.
Poll (1986) retained the resurrected Lepidiolamprologus, but criticized the suYciency of Pellegrin’s original
characters for the genus. Instead, he listed 61–73 lateral
line scales, vs. 30–40 in other genera, plus a unique structure of pelvic Wn rays and numerous scales in the occipital, thoracic, and abdominal regions as supporting the
group. Poll (1986) criticized the infraorbital characters
of Colombe and Allgayer because of their variability
within species and even individuals. On these grounds,
he altered their generic allocation in his new classiWcation. In addition to re-assigning several lake endemics to
the genus Lamprologus, Poll (1986) rejected the monotypic genera Variabilichromis and Paleolamprologus, and
additionally proposed Altolamprologus as a new genus,
for the highly distinctive A. compressiceps and A. calvus.
Finally, Poll accepted Neolamprologus for most remaining Lake Tanganyika lamprologine species, with the
caveat that Neolamprologus would likely be further partitioned in the future.
The most thorough morphology-based treatment of
lamprologines was carried out by Stiassny (1997), who
listed a suite of osteological characters supporting lamprologine monophyly, in accord with numerous molecu-
427
lar studies (e.g., Salzburger et al., 2002a; Sturmbauer
et al., 1994; Thompson et al., 1994). Unlike Poll (1986),
Stiassny (1997) supported the creation of the genus Variabilichromis for V. moorii. Regarding the genus Lepidiolamprologus, she suggested that L. cunningtoni should be
excluded, and N. pleuromaculatus, N. boulengeri, N. hecqui, N. meeli, and N. lemairii should be included to render the genus monophyletic. Stiassny highlighted the
inadequacy of current lamprologine classiWcation by
deWning an “ossiWed group” of lamprologines, with representatives scattered among the genera Lamprologus,
Neolamprologus, Lepidiolamprologus, and Altolamprologus. OssiWed group lamprologines posses a sesamoid
bone within the labial ligament, a condition mirrored in
certain atherinomorphs, but unique among cichlids and
perhaps even Perciformes. More recently, Takahashi
(2003) used morphological characters to examine relationships among Tanganyikan cichlids, but did not
recover the ossiWed group as a monophyletic assemblage
in his lamprologine clade, consisting of 10 species only.
Utilizing two mtDNA loci and Wve nuclear loci for a
subset of taxa, this study focuses on resolution of the
phylogenetic relationships of species assigned to the
genus Lepidiolamprologus, one of the most distinctive
genera of the ossiWed group of lamprologines. The
mtDNA phylogeny is then used to trace the evolution of
two distinctive morphological characters. We follow
Poll’s (1996) classiWcation, in which lamprologines comprise seven genera: Altolamprologus Poll, 1986; Chalinochromis Poll, 1974; Julidochromis Boulenger, 1898,
Lamprologus Schilthuis, 1891, Lepidiolamprologus Pellegrin, 1904; Neolamprologus Colombe and Allgayer,
1985; and Telmatochromis Boulenger, 1898.
2. Materials and methods
2.1. Taxon sampling
In addition to 36 lamprologines, we included three
eretmodines (Spathodus erythrodon, Tanganicodus irsacae, and Eretmodus cyanostictus) and one perissodine
(Perissodus microlepis), representatives of lineages
nested close to lamprologines in the analysis of Salzburger et al. (2002a), as outgroups. Since the focus of
this study was the genus Lepidiolamprologus, we
included all but one species that has ever been placed in
that genus or suggested to be closely allied with it (only
N. pleuromaculatus was unavailable), and two undescribed species, one with a Xank pigmentation pattern
similar to that of L. profundicola, fresh material of
which was collected in Zambia in March, 2004, and the
other morphologically similar to N. boulengeri and
N. meeli, collected in Zambia in October, 2001, and
March, 2003. In addition, we thoroughly sampled from
the ossiWed group of Stiassny (1997), including 20 out
428
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
of 26 members.1 The diversity of non-ossiWed lamprologines was similarly well sampled, including a Congo
River species [the newly described Lamprologus teugelsi, previously identiWed as L. mocquardi in Salzburger
et al. (2002a) and Sturmbauer et al. (1994)], and representative members of Neolamprologus, Julidochromis, and
Telmatochromis. Among them were N. toae and N. moorii,
for which monotypic genera have been proposed.
2.2. Molecular biological methods
Approximately, 1400 bp of mtDNA from 40 species
(58 specimens in total) and 2700 bp of nuclear DNA
from 18 species (26 specimens total) were sequenced, and
are available from GenBank under Accession Nos.
DQ054907–DQ055127. Voucher specimens have been
deposited at the Department of Zoology, University of
Graz, Austria, the Musée Royal de l’Afrique Centrale,
the South African Institute for Aquatic Biodiversity, and
the American Museum of Natural History. Total DNA
was extracted from Wn clips or muscle tissue preserved in
95% ethanol by using the Chelex 100 method (Walsh et
al., 1991) or the Qiagen Tissue Extraction Kit following
the manufacturer’s protocol. Polymerase chain reaction
(PCR) was used to amplify portions of the mitochondrial control region (»360 bp) and NADH dehydrogenase subunit 2 gene (ND2, 1047 bp), as well as the
nuclear loci UME002 (»405 bp), TmoM25 (»320 bp),
TmoM27 (»365 bp), and the Wrst (570 bp) and second
(»1085 bp) introns of the S7 ribosomal protein.
For the mitochondrial loci, reactions of 17 l total
volume consisted of 6.5 l of deionized water, 1.7 l of
dNTP mix, 1.7 l of 20 mM Mg2+ buVer, 1.7 l of each
primer, 1.62 l of enzyme diluent, 0.085 l of Taq polymerase, and 2 l of DNA extract. Primers used to
amplify the control region were L-PRO-F, 5⬘ AACTCT
CACCCCTAGCTCCCAAAG (Meyer et al., 1994) and
TDK-D, 5⬘ CCTGAAGTAGGAACCAGATG (Kocher
et al., 1989). For ND2, the primers used for ampliWcation
were MET, 5⬘ CATACCCCAACATGTTGGT (Kocher
et al., 1995) and TRP, 5⬘ GAGATTTTCACTCCCGC
TTA (Kocher et al., 1995). AmpliWcations were performed on an Air Thermo-Cycler (Idaho Technology)
and consisted of a total of 40 cycles, beginning with 15 s
at 94 °C for denaturation, followed by Wve cycles of 0 s at
94 °C, 5 s at 48 °C for annealing, and 25 s at 72 °C for
extension, followed by 35 cycles of 0 s at 94 °C, 0 s at
52 °C, and 25 s at 72 °C. PCR products were puriWed
using the ExoSAP-IT kit (Amersham Biosciences), and
both strands were sequenced using the original primers,
1
One of our de facto ossiWed group members is Neolamprologus
variostigma, a species not examined by Stiassny (1997). Owing to the
unavailability of material, we have been unable to observe the labial
ligament in any cleared and stained N. variostigma, but tentatively consider the labial bone to be present.
plus the ND2 internal primers ND2.2A, 5⬘ CTGACAA
AAACTTGCCTT (Kocher et al., 1995), and the newly
designed primer ND2.Bob, 5⬘ CTGGCAAAAACTT
GCCCCTTT, with Big Dye Terminator Reaction Mix
(Applied Biosystems). Sequencing reactions were electrophoresed on an ABI 373A automated sequencer
(Applied Biosystems).
The Wve nuclear loci were ampliWed using tetrad thermocyclers (MJ Research) in reactions of 25 l total
volume using one Ready-To-Go PCR bead (Amersham
Biosciences), 2 l of DNA extract, and 1.25 l of each
primer, of which the following were used: UME002f, 5⬘
TCAGAGTGCAATGAGACATGAAT and UME002r,
5⬘ AATTTAGAAGCAGAAAATTAGACG (Parker and
KornWeld, 1996); TmoM25f, 5⬘ CTGCAGTGGCACAT
CAAGAATGAGCAGCGGT, TmoM25r, 5⬘ CAAGA
ACCTTTCAAGTCATTTTG, TmoM27f, 5⬘ AGGCA
GGCAATTACCTTGATGTT, TmoM27r, 5⬘ TACTA
ACTCTGAAAGAACCTGTGAT (Zardoya et al., 1996);
S7RPEX1f, 5⬘ TGGCCTCTTCCTTGGCCGT C, S7RP
EX2r, 5⬘ AACTCGTCTGGCTTTTCGCC, S7R PEX2f,
5⬘ AGCGCCAAAATAGTGAAGCC, and S7R PEX3r,
5⬘ GCCTTCAGGTCAGAGTTCAT (Chow and Hazama, 1998). AmpliWcations of the UME002 and S7 loci
consisted of 35 cycles, beginning with 6 min at 94 °C for
initial denaturation, followed by cycles of 60 s at 94 °C,
60 s at 54–66 °C for annealing, and 1 min at 72 °C for
extension, with a Wnal 6 min extension at 72 °C. AmpliWcations of the Tmo loci consisted of 39 cycles, beginning
with 5 min at 94 °C for initial denaturation, followed by
cycles of 15 s at 94 °C, 5 s at 48 °C for annealing, and 30 s
at 68 °C for extension, with a Wnal 7 min extension at
72 °C. PCR products were puriWed using AMPure
(Agencourt) and cycle-sequenced using Big Dye Terminator Reaction Mix (Applied Biosystems). Sequencing
reactions were puriWed using CleanSEQ (Agencourt)
and electrophoresed on an ABI 3730£l automated
sequencer (Applied Biosystems).
2.3. Phylogenetic analyses—direct optimization
Initially, parsimony was used to analyze a combined
dataset of control region and ND2 sequences, with
Spathodus erythrodon designated as the root, justiWed by
the analysis of Salzburger et al. (2002a). Further parsimony analyses were performed on a combined dataset of
the Wve nuclear loci for a subset of the taxa in the mitochondrial dataset, as well as a combined dataset with all
seven nuclear and mitochondrial loci including all taxa.
These analyses were performed using direct optimization
(Wheeler, 1996) in POY (Wheeler et al., 2002) on the
parallel computing cluster at the American Museum of
Natural History. Direct optimization, which treats insertions and deletions (indels) as transformation events
along with transitions (ts) and transversions (tv),
optimizes raw sequences on topologies without recourse
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
to a multiple sequence alignment, thus avoiding the possibility of tree search being adversely inXuenced by a
sub-optimal static alignment.
To speed up analyses in POY (Giannini and Simmons, 2003; Giribet, 2001; Wheeler, 2003a), datasets for
each locus were submitted as separate input Wles, within
which sequences were broken into fragments of 100–
150 bp at invariant motifs. Initially, an expanded dataset
comprising 58 terminals (units of analysis), including
multiple representatives of 10 species (2–4 individuals
per species, including eight individuals for which control
region sequences were unavailable), was analyzed under
a gap:tv:ts cost regime of 1:1:1. The search strategy
began with 50 random addition sequences followed by
tree bisection reconnection (TBR) branch swapping and
20 rounds of TBR-ratchet (Nixon, 1999) in which 40%
of the characters were reweighted by a multiplier of three
in each round. In addition, tree fusing (GoloboV, 1999b)
was performed on all replicates, allowing up to 250
fusings and exchanging subtrees with no fewer than
three taxa. Inputting the most parsimonious trees generated by this stage, a Wnal reWnement was undertaken
with reduced iterations of ratcheting and tree fusing, but
implementing three dimensional optimization alignment
with iterative pass (Wheeler, 2003a) and performing a
complete SankoV optimization on the downpass with the
command–exact. Though computationally more intensive, this step was intended to increase the accuracy of
POY heuristics. WinClada (Nixon, 2002) and NONA
(GoloboV, 1999a) were used to verify tree lengths based
on implied alignments (Wheeler, 2003b), and to calculate
the consistency index, or CI (Kluge and Farris, 1969),
and retention index, or RI (Farris, 1989).
Using the same strategy, additional datasets were
analyzed: (1) comprising the mitochondrial loci and limited to single representatives of each species (40 terminals), (2) comprising the nuclear loci for one or more
representatives of 18 species (26 terminals), and (3) comprising all of the nuclear and mitochondrial loci for all
terminals. For analyses 1 and 2, branch supports
(Bremer, 1988, 1995) were calculated with TreeRot
(Sorenson, 1996), and jackknife values were calculated in
PAUP* 4.0b10 (SwoVord, 2002) by randomly deleting
36.79% of the characters (Farris et al., 1996) for each of
10,000 replications.
429
schemes were employed to test the eVects of downweighting transversions, downweighting transitions, and
excluding transitions entirely, varying gap costs across
each scheme. The ratio of tv:ts was variously set to 1:1,
1:2, 2:1, and 4:0, and for each of these schemes three
analyses were run, with gaps weighted at 1, 2, and 4 times
the larger of the tv:ts values (see Fig. 2, bottom-left). The
two-stage tree search approach outlined above was also
used for each of these searches, with command-molecularmatrix specifying a text Wle with the appropriate stepmatrix.
2.5. Maximum likelihood and Bayesian analyses
An explicit model of evolution was used for maximum
likelihood (ML) and Bayesian inference analyses for
comparison with the results obtained using parsimony. In
these analyses, based on the 40 terminal mitochondrial
dataset, all three eretmodines (not just Spathodus erythrodon) were designated as the outgroup. Unlike for the
POY analyses, a static multiple sequence alignment was
required for the control region sequences of variable
lengths. This was initially generated with Clustal W
(Thompson et al., 1994) and manually reWned. To choose
the most appropriate model of sequence evolution for
ML and Bayesian inference, hierarchical likelihood ratio
test statistics were calculated using ModelTest 3.06
(Posada and Crandall, 1998). The model recovered was
(TrN + I + ) with nucleotide frequencies A D 0.28980,
C D 0.30690, G D 0.12000, T D 0.28330, gamma shape
parameter () 0.9111, proportion of invariable sites
0.4087, number of substitution types three, and R-matrix
A M C, A M T, C M G, and G M T D 1.0000, A M G
10.6289, and C M T 4.8090. The ML tree was calculated
with heuristic searches consisting of 50 random addition
sequence replicates in PAUP*, and as measures of conWdence, jackknife values (43 replicates; 36.79% character
deletion) were calculated. A Bayesian inference tree was
calculated with MrBayes v3.0b4 (Huelsenbeck and Ronquist, 2001). Posterior probabilities were obtained from a
2 £ 106 generation Metropolis-coupled Markov chain
Monte Carlo simulation (10 parallel chains; chain temperature 0.2; trees sampled every 100 generations), with
parameters estimated from the data set. We applied a
burn-in of 5 £ 105 generations to allow likelihood values
to reach stationarity.
2.4. Sensitivity analysis
To explore the robustness of the topology derived
under equal weights in relation to cost variation of gaps,
transversions, and transitions, a sensitivity analysis was
performed on the 40 terminal mitochondrial dataset
(Giribet and Ribera, 2000; Wheeler, 1995). In addition to
the analysis under a 1:1:1 weighting scheme, a series of
analyses under assorted diVerential weighting schemes
were performed. A total of 12 diVerent weighting
3. Results
3.1. Commonalities among analyses
Certain relationships were consistently recovered in
all analyses under all weighting schemes, and they are
brieXy considered Wrst. OssiWed group lamprologines,
represented here by 20 species after removal of duplicate
430
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
representatives, were recovered as monophyletic in each
analysis. In all cases, L. cunningtoni nested with other
non-ossiWed lamprologines, and was sister to N. modestus in all but the nuclear-only analysis. Some of the
Neolamprologus species suggested for inclusion in the
genus Lepidiolamprologus by Stiassny (1997), namely
N. meeli, N. boulengeri, and N. hecqui, invariably nested
in a clade of 10 taxa that included several Lepidiolamprologus, hereafter referred to as the two-pore Lepidiolamprologus clade, and was always resolved as the sister
group to (L. callipterus (A. compressiceps, A. calvus)).
However, the distinctive Lamprologus lemairii, another
candidate for inclusion in Lepidiolamprologus (Stiassny,
1997), was never recovered in the two-pore Lepidiolamprologus clade.
3.2. Mitochondrial dataset
Direct optimization of the equally weighted 58 terminal dataset resulted in 72 equally parsimonious trees
(strict consensus shown in Fig. 1) of length (L) D 1585,
CI D 0.41, and RI D 0.71 (calculations excluding uninformative characters). The implied alignment consisted of
1451 characters, 441 of which were parsimony-informative. Species with multiple representatives were resolved
as monophyletic in all but one case: one of the Neolamprologus sp. “meeli-boulengeri” was recovered in a polytomy with the L. attenuatus, its sister group in these
analyses. A congruent topology was recovered after
reduction of the dataset to include only single representatives of each species. The strict consensus of the 139 most
parsimonious trees (L D 1488, CI D 0.40, and RI D 0.64;
excluding uninformative characters) obtained for that 40
terminal dataset is shown with branch support values,
jackknife values, and results of the sensitivity analysis
(Fig. 2), and with key morphological characters illustrated and mapped onto the topology (Fig. 3). Of the
1442 characters in the implied alignment generated during this analysis, 409 were parsimony informative. The
ML and Bayesian results (not shown) based on a manual
alignment of the mitochondrial data for 40 terminals
diVered slightly from the parsimony result in the resolution of the basal lamprologine taxa Neolamprologus
moorii and N. toae, but were otherwise congruent with
the results discussed herein. Surprisingly, Lepidiolamprologus nkambae was consistently resolved in a stable position outside the two-pore Lepidiolamprologus clade, as
the sister group of the clade comprising the Lamprologus
callipterus–Altolamprologus clade and the two-pore Lepidiolamprologus clade. This result is strongly discordant
with morphological and nuclear DNA evidence.
3.3. Nuclear dataset
Direct optimization of the equally weighted 26 terminal dataset obtained 56 equally parsimonious trees
(strict consensus shown in Fig. 4) of length (L) D 501,
CI D 0.81, and RI D 0.93 (calculations excluding uninformative characters). The implied alignment consisted of
2746 characters, 359 of which were parsimony-informative. Due to the unavailability of fresh extractions for all
species represented in the mitochondrial dataset, only a
subset of the species in the mitochondrial dataset were
included here. Furthermore, we were unable to successfully amplify every locus for every taxon in this dataset
(See Table 1). Due to a lack of variation within ossiWed
group lamprologines at many of the nuclear loci initially
surveyed, we included, in addition to introns, some
highly length variable microsatellite loci (in particular,
UME002). We interpret the phylogeny derived from
microsatellite loci cautiously, in light of the increased
potential for homoplasy and diminished ability to identify homology in fast evolving, indel rich repeated short
motifs. Nevertheless, we believe that the large indel
events at microsatellite loci oVer a promising source of
signal in the absence of suYcient variation elsewhere in
the nuclear genome. In this instance, our combined
nuclear dataset was strongly discordant with the
mitochondrial dataset regarding the placement of
Lepidiolamprologus nkambae. These nuclear data support the placement of L. nkambae in an unresolved twopore Lepidiolamprologus clade along with its probable
sister species, L. kendalli, in agreement with morphological evidence.
3.4. Combined nuclear and mitochondrial dataset
When the nuclear and mitochondrial data were combined (tree not shown), neither of the conXicting signals
was completely swamped. The nuclear signal was suYcient to resolve Lepidiolamprologus nkambae with the
two-pore Lepidiolamprologus clade, but the conXicting
mitochondrial signal prevented L. nkambae from nesting
with L. kendalli. Rather, L. nkambae was resolved as sister to the remaining two-pore Lepidiolamprologus.
3.5. Phylogenetic implications
These analyses consistently support the placement of
L. cunningtoni outside of the “ossiWed-group,” far
removed from the other Lepidiolamprologus with which
it was allied on the basis of a similar gestalt that evolved
in parallel. Further, the monophyly of Stiassny’s (1997)
“ossiWed-group” is strongly supported by both the
nuclear and mitochondrial datasets. Within the “ossiWed-group,” however, the mitochondrial and nuclear
datasets manifest strikingly incongruent signal for the
species Lepidiolamprologus nkambae, and morphology is
strongly at odds with the mitochondrial signal. This
result is interpreted as evidence of introgression and Wxation of a distantly related mitochondrial haplotype in
L. nkambae.
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
431
Fig. 1. Strict consensus of 72 equally most parsimonious trees of L D 1585, CI D 0.41, and RI D 0.71 (calculations excluding uninformative characters)
obtained for 58 terminal mitochondrial dataset analyzed using direct optimization with a gap:tv:ts ratio of 1:1:1. Branch support (Bremer) values are
shown above nodes and jackknife values below.
4. Discussion
4.1. On Lepidiolamprologus
Taken together, our analyses fully support the monophyly of Stiassny’s (1997) ossiWed group, in accord with
the more limited sampling of previous molecular studies
(e.g., Nishida, 1997; Sturmbauer et al., 1994). These anal-
yses also conWrm that similarities in shape and squamation between L. cunningtoni and other members of Poll’s
(1986) Lepidiolamprologus are superWcial, and place
L. cunningtoni in a non-ossiWed clade far removed from
the two-pore Lepidiolamprologus clade, a Wnding in
accord with Stiassny (1997) and Takahashi (2001).
Among the morphological characters supporting the
molecular evidence are absence of a labial bone and a
432
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
Fig. 2. Strict consensus of 139 trees of length 1488 (CI D 0.40, RI D 0.64) resulting from analysis of the 40 terminal mitochondrial dataset using direct
optimization with a gap:tv:ts ratio of 1:1:1. Branch support (Bremer) values are shown above nodes and jackknife values below. Rectangular boxes at
each node depict results of sensitivity analysis of parameter variation, with a key to the parameter set represented by each cell at bottom-left. Shaded
cells indicate that the clade in question was recovered as monophyletic for the relevant parameter set; unshaded cells indicate either the collapse of
the node or variation (at the level of presence or absence) in the terminals recovered at that node.
single median frontal pore of the neurocranial lateral
line foramina (NLF0) in L. cunningtoni. Like L. cunningtoni, most Neotropical and African cichlids have coalesced pores at NLF0, but some derived lamprologines
(two-pore Lepidiolamprologus and Lamprologus lemairii)
atavistically exhibit the condition found in distantly
related Malagasy ptychochromines, of two separate
pores at NLF0 (Stiassny, 1992; see Fig. 3 for distribution
in lamprologines).
In our mitochondrial dataset, our two-pore Lepidiolamprologus clade is resolved sister to (L. callipterus
(A. calvus, A. compressiceps)). All three are ossiWed
group members with a single median frontal pore, and
their placement with respect to Lepidiolamprologus is
plausible when considered in light of a preliminary morphological dataset (Schelly, submitted). As to the actual
composition of Lepidiolamprologus, this study supports
the inclusion of L. attenuatus, L. profundicola, L. elongatus, and L. kendalli, all of which share numerous derived
morphological characters including a characteristic
supraoccipital crest proWle, widely spaced canines, and
elevated lateral line scale counts. Also resolved in the
two-pore Lepidiolamprologus clade are N. variostigma
and an undescribed Lepidiolamprologus, for which
cleared and stained material is not yet available to code
internal anatomical characters. Finally, this study supports Stiassny’s (1997) suggested placement of Neolamprologus meeli, N. boulengeri, and N. hecqui, as well as a
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
433
Fig. 3. MP topology from Fig. 2, showing taxa conWrmed or suspected of having two pores at NLF0 (taxa in bold, with asterisks), and Stiassny’s
(1997) ossiWed group (gray box). Dorsal views of neurocrania show contrasting states at NLF0 (A, B). Lateral views of lower jaw show unossiWed (C)
and ossiWed (D) conditions.
new species (N. sp. “meeli-boulengeri”) thought to be
closely allied with N. meeli and N. boulengeri, in the
genus Lepidiolamprologus. For lack of available tissue
material, the study is mute on the placement of
N. pleuromaculatus, also listed in Stiassny’s expanded
Lepidiolamprologus, and characterized by a “lepidiolamprologine” ethmovomerine type (Takahashi, 2001).
All Wve of these putative Lepidiolamprologus possess a
labial bone and two distinct pores at NLF0.
Only in the case of Lepidiolamprologus nkambae and
Lamprologus lemairii does this study contradict Stiassny
(1997). In the case of L. lemairii, a morphologically
derived species without obvious aYnities to Lepidiolamprologus, the placement outside of the two-pore Lepidiolamprologus clade in this treatment seems to be due
simply to homoplasy for the NLF0 morphological character. For instance, L. lemairii lacks the “lepidiolamprologine” ethmovomerine type (Takahashi, 2001) and the
434
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
Fig. 4. Strict consensus of 56 trees of length 501 (CI D 0.81, RI D 0.93)
resulting from analysis of the 26 terminal nuclear dataset using direct
optimization with a gap:tv:ts ratio of 1:1:1. Branch support (Bremer)
values are shown above nodes and jackknife values below.
long, slender gill rakers characteristic of Lepidiolamprologus. The nuclear dataset supports this interpretation,
suggesting that separation of the pores at NLF0 evolved
in parallel in L. lemairii and the two-pore Lepidiolamprologus. However, parallel evolution of the atavistic
NLF0 character state in Lepidiolamprologus nkambae
seems much less plausible in light of other morphological evidence and the nuclear dataset, casting doubt on
the ability of the mtDNA data to reveal the complete
evolutionary picture and strongly implicating introgressive hybridization as the mechanism for the conXicting
signal. This possibility is considered below in detail.
Although several modiWcations to the current classiWcation currently seem warranted from the results presented here, we will resist making formal changes to the
generic classiWcation of lamprologines, pending a more
thorough morphology-based analysis of the group with
increased taxon sampling, which is underway (Schelly, in
preparation).
4.2. Introgressive hybridization
Discordant signal between diVerent datasets, such as
nuclear and mitochondrial DNA, can derive simply
from homoplasy or from stochastic inheritance of ancestral polymorphisms (McCracken and Sorenson, 2005).
Hybridization resulting in introgression, or the incorporation of alien genes from one species into another, can
also sometimes explain discordance between character
sets, including morphology, allozymes, mtDNA, and
nuclear DNA (Dowling and DeMarais, 1993). Introgressive hybridization is well accepted as a fairly common
mechanism for diversiWcation in plants, but only recently
has the phenomenon begun to be recognized in animals
(Arnold, 1997; Barton, 2001; Cathey et al., 1998; Dowling and Secor, 1997; Gerber et al., 2001; Roca et al.,
2005; Sota et al., 2001; Sullivan et al., 2002, 2004).
Among Wshes, hybridization in cichlids in particular has
been documented by numerous researchers (e.g., Rüber
et al., 2001; Schliewen and Klee, 2004; Smith et al., 2003;
Streelman et al., 2004). A typical example is reported by
Rognon and Guyomard (2003), who observed congruent
signal in nuclear DNA and morphology for two species
of Oreochromis in West Africa, but found starkly conXicting signal in mtDNA, to the degree that some identical mitochondrial sequences were found in both species.
They attributed this conXicting signal to diVerential
introgression. Introgressive hybridization resulting in
speciation has already been suggested for non-ossiWed
lamprologines (Salzburger et al., 2002b). In that study,
N. marunguensis was demonstrated to have a mosaic of
nuclear alleles, all Wxed, derived from two parental lineages, but was polymorphic for the mitochondrial control region and the cytochrome b gene, also from both
parental species. Given the cases already documented in
cichlids, we consider that the results of this analysis suggest similar mechanisms.
The most striking anomaly in our mitochondrial tree
is the placement of Lepidiolamprologus nkambae outside
of the two-pore Lepidiolamprologus clade2—far removed
from L. kendalli, a species with which it shares a striking
morphological similarity—as the sister group of the
Lamprologus callipterus–Altolamprologus clade and the
two-pore Lepidiolamprologus clade. This surprising
result was conWrmed by including four representatives of
both species, several of which were recently collected
along the Zambian coast of Lake Tanganyika in March,
2004. Lepidiolamprologus nkambae and L. kendalli were
independently described within a few months of one
another (Poll and Stewart, 1977; Staeck, 1978), and they
might have been considered races of the same species if
the authors had combined their material. Morphologically, the two species are eVectively indistinguishable,
and taken together, they are quite distinct from other
2
Lepidiolamprologus cunningtoni is resolved even further from the
Lepidiolamprologus clade among non-ossiWed lamprologines. Nonetheless, morphological data (Schelly, submitted; Stiassny, 1997) support
such a placement, which will be reXected in a forthcoming revised classiWcation (Schelly, in preparation).
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
435
Table 1
GenBank accession numbers for the sequences used in this study
Taxa
Control region
ND2
S7-1
S7-2
TmoM25
TmoM27
UME002
Altolamprologus calvus 1
Altolamprologus calvus 2
Altolamprologus compressiceps
Eretmodus cyanostictus
Julidochromis marlieri
Lamprologus callipterus
Lamprologus lemairii 1
Lamprologus lemairii 2
Lamprologus meleagris
Lamprologus speciosus
Lamprologus teugelsi
Lepidiolamprologus “meeli-boulengeri” 1
Lepidiolamprologus “meeli-boulengeri” 2
Lepidiolamprologus “sp.n.”
Lepidiolamprologus attenuatus 1
Lepidiolamprologus attenuatus 2
Lepidiolamprologus attenuatus 3
Lepidiolamprologus attenuatus 4
Lepidiolamprologus cunningtoni 1
Lepidiolamprologus cunningtoni 2
Lepidiolamprologus cunningtoni 3
Lepidiolamprologus elongatus 1
Lepidiolamprologus elongatus 2
Lepidiolamprologus kendalli 1
Lepidiolamprologus kendalli 2
Lepidiolamprologus kendalli 3
Lepidiolamprologus kendalli 4
Lepidiolamprologus nkambae 1
Lepidiolamprologus nkambae 2
Lepidiolamprologus nkambae 3
Lepidiolamprologus nkambae 4
Lepidiolamprologus nkambae 5
Lepidiolamprologus profundicola
Neolamprologus boulengeri 1
Neolamprologus boulengeri 2
Neolamprologus brevis
Neolamprologus brichardi
Neolamprologus buescheri
Neolamprologus caudopunctatus
Neolamprologus christyi
Neolamprologus cylindricus
Neolamprologus hecqui 1
Neolamprologus hecqui 2
Neolamprologus helianthus
Neolamprologus marunguensis
Neolamprologus meeli
Neolamprologus modestus
Neolamprologus moorii
Neolamprologus pulcher
Neolamprologus similis
Neolamprologus toae
Neolamprologus tretocephalus
Neolamprologus variostigma 1
Neolamprologus variostigma 2
Perissodus microlepis
Spathodus erythrodon
Tanganicodus irsacae
Telmatochromis bifrenatus
Telmatochromis temporalis
DQ054913
DQ055011
DQ055097
DQ054967
DQ055022
DQ055010
DQ055039
DQ055023
DQ055019
DQ055056
DQ055027
DQ055032
DQ055059
DQ055038
DQ055052
DQ055045
DQ055036
DQ055037
DQ055055
DQ055057
DQ055017
DQ055053
DQ055054
DQ055021
DQ055049
DQ055060
DQ055042
DQ055043
DQ055044
DQ055035
DQ054969
DQ054990
DQ054991
DQ054993
DQ055117
DQ054924
DQ054911
DQ054940
DQ054925
DQ054921
DQ054953
DQ054929
DQ054934
DQ054955
DQ054939
DQ054951
DQ054944
DQ054912
DQ054938
DQ054952
DQ055072
DQ055073
DQ055075
DQ055123
DQ055125
DQ055109
DQ055121
DQ054919
DQ054923
DQ054948
DQ054941
DQ054942
DQ054937
DQ054943
DQ054945
DQ054946
DQ054947
DQ054927
DQ054936
DQ054922
DQ054917
DQ054935
DQ054926
DQ054954
DQ054933
DQ054920
DQ054915
DQ054916
DQ054950
DQ054914
DQ054918
DQ054957
DQ054932
DQ054949
DQ054928
DQ054930
DQ054931
DQ054907
DQ054909
DQ054908
DQ054910
DQ054956
DQ055046
DQ055047
DQ055048
DQ055025
DQ055034
DQ055040
DQ055020
DQ055015
DQ055033
DQ055024
DQ055058
DQ055031
DQ055018
DQ055041
DQ055013
DQ055014
DQ055051
DQ055012
DQ055016
DQ055062
DQ055030
DQ055050
DQ055026
DQ055028
DQ055029
DQ055006
DQ055008
DQ055007
DQ055009
DQ055061
lamprologines. With identical osteology, overlapping
vertebral counts, Wn spine and ray counts, scale counts,
and morphometric measurements, and a striking mot-
DQ055102
DQ055080
DQ055082
DQ055063
DQ055078
DQ055104
DQ055088
DQ055101
DQ054974
DQ054976
DQ054958
DQ054972
DQ054999
DQ055001
DQ054981
DQ054997
DQ055068
DQ055093
DQ054963
DQ054986
DQ055085
DQ055107
DQ054978
DQ055004
DQ055084
DQ055106
DQ055074
DQ055098
DQ054968
DQ054992
DQ055118
DQ055064
DQ055065
DQ055066
DQ055087
DQ055067
DQ055069
DQ055070
DQ055071
DQ055076
DQ055089
DQ055090
DQ055091
DQ055108
DQ055092
DQ055094
DQ055095
DQ055096
DQ055099
DQ054959
DQ054960
DQ054961
DQ054980
DQ054962
DQ054964
DQ054965
DQ054966
DQ054970
DQ054982
DQ054983
DQ054984
DQ055005
DQ054985
DQ054987
DQ054988
DQ054989
DQ054994
DQ055110
DQ055111
DQ055112
DQ055127
DQ055113
DQ055114
DQ055115
DQ055116
DQ055119
DQ055081
DQ055103
DQ054975
DQ055000
DQ055124
DQ055086
DQ055079
DQ055083
DQ054996
DQ054998
DQ055002
DQ055122
DQ055105
DQ054979
DQ054973
DQ054977
DQ055077
DQ055100
DQ054971
DQ054995
DQ055120
DQ055126
DQ055003
tled color pattern that diVers considerably less between
the two species than the range of color variation seen
within many lamprologine species, L. nkambae and
436
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
L. kendalli are undoubtedly sister species on the basis of
morphology. Konings (1998) suggested that the two species are in fact conspeciWc.
Our tree derived from nuclear data (Fig. 4) accords
well with morphological evidence; the single L. nkambae resolved sister to L. n.sp. may result from incomplete lineage sorting or microsatellite homoplasy, the
signal of which could be disproportionate due to the
extremely limited variability within the nuclear genome
of the two-pore Lepidiolamprologus clade. A result
based on mtDNA that is so at odds with morphology
and nuclear DNA strongly suggests introgressive
hybridization, commonly attributed as a cause of discordance between phylogenies based on mitochondrial
versus nuclear DNA (e.g., Salzburger et al., 2002b; Seehausen, 2004; Shaw, 2002). If introgression was at work
in L. nkambae, a plausible scenario could be that the
common ancestor of L. nkambae and L. kendalli, or
more likely the population in the Nkamba Bay area
only, hybridized with another species and gained a second mitochondrial haplotype. Subsequently a hybrid
species retaining the morphology of L. nkambae/L. kendalli emerged, and the mitochondrial haplotype underwent Wxation in L. nkambae, while the introgressed
nuclear genes were lost due to backcrossing. Such a scenario seems more plausible considering that the range
of L. nkambae encompasses a bay made turbid by the
inXow of the Lufubu River in an otherwise clear lake,
and turbidity has been demonstrated to interfere with
species recognition in spawning lacustrine cichlids (Seehausen et al., 1997). This scenario would require a relatively long period of time passing since the hybridization
event to allow for complete lineage sorting. The lack of a
closely related sister species of L. nkambae might be
explained by sampling bias, or by the extinction of the
parental species. The alternative hypothesis, that the
L. nkambae haplotype traces to diVerential Wxation of an
ancestral mitochondrial-haplotype polymorphism in
L. nkambae vs. all species of the clade sister to L. nkambae
(the Lamprologus callipterus–Altolamprologus clade and
the two-pore Lepidiolamprologus clade), seems less likely.
Acknowledgments
For support and assistance, we thank (at the
AMNH) Melanie Stiassny, Scott Schaefer, John Sparks,
Kevin Tang, and Leo Smith. For help with species identiWcations, we thank Jos Snoeks (MRAC, Tervuren,
Belgium). For providing tissues or for assistance in the
Weld, we thank Heinz Büscher, Roger Bills, Alex Chilala,
Cyprian Kapasa, Harris Phiri, and the team at the Mpulungu Station of the Department of Fisheries, Ministry
of Agriculture, and Cooperatives, Republic of Zambia.
R.S. was supported by the AMNH Axelrod Fund and a
grant from the American Cichlid Association. W.S. was
supported by the European Union (Marie Curie Fellowship), the Landesstiftung Baden–Wuerttemberg and
the Deutsche Forschungsgemeinschaft. S.K., N.D., and
C.S. were supported by the Austrian Science Foundation (Grant 15239). W.S., S.K., and N.D. got further
support from the Austrian Academy of Sciences [DOC
and DOC-FFORTE (women in research and technology) fellowships] and the University of Graz (S.K. and
N.D.).
References
Arnold, M.L., 1997. Natural Hybridization and Evolution. Oxford
University Press, Oxford, New York.
Barton, N.H., 2001. The role of hybridization in evolution. Mol. Ecol.
10, 551–568.
Boulenger, G.A., 1898. Report on the Wshes recently obtained by Mr.
J.E.S. Moore in Lake Tanganyika. Proc. Zool. Soc. Lond. 1898
(pt.3), 494–497.
Boulenger, G.A., 1915. Catalogue of the Freshwater Fishes of Africa in
the British Museum (Natural History). Vol. III. British Museum
(Natural History), London.
Bremer, K., 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42, 795–803.
Bremer, K., 1995. Branch support and tree stability. Cladistics 10, 295–
304.
Cathey, J.C., Bickham, J.W., Patton, J.C., 1998. Introgressive hybridization and nonconcordant evolutionary history of maternal and
paternal lineages in North American deer. Evolution 52, 1224–
1229.
Chow, S., Hazama, K., 1998. Universal PCR primers for S7 ribosomal
protein gene introns in Wsh. Mol. Ecol. 7, 1247–1263.
Colombe, J., Allgayer, R., 1985. Description de Variabilichromis, Neolamprologus, et Paleolamprologus genres nouveaux du Lac Tanganika, avec redescription des genres Lamprologus Schilthuis, 1891 et
Lepidiolamprologus Pellegrin, 1904 (Pisces: Teleostei: Cichlidae).
Rev. Fr. Cichlidophile 49, 9–16 21–28.
De Vos, L., Seegers, L., Taverne, L., Thys van den Audenaerde, D.,
2001. L’ichtyofaune du bassin de la Malagarasi (Système du Lac
Tanganyika): une synthèse de la connaissance actuelle. Ann. Mus.
R. Afr. Centr. Sci. Zool. 285, 117–135.
Dowling, T.E., DeMarais, B.D., 1993. Evolutionary signiWcance of
introgressive hybridization in cyprinid Wshes. Nature 362, 444–446.
Dowling, T.E., Secor, C.L., 1997. The role of hybridization and introgression in the diversiWcation of animals. Annu. Rev. Ecol. Syst. 28,
593–619.
Farris, J.S., 1989. The retention index and the rescaled consistency
index. Cladistics 5, 417–419.
Farris, J.S., Albert, V.A., Källersjö, M., Lipscomb, D., Kluge, A.G.,
1996. Parsimony jackkniWng outperforms neighbor-joining. Cladistics 12, 99–124.
Gerber, A.S., Tibbets, C.A., Dowling, T.E., 2001. The role of introgressive hybridization in the evolution of the Gila robusta complex
(Teleostei: Cyprinidae). Evolution 55, 2028–2039.
Giannini, N.P., Simmons, N.B., 2003. A phylogeny of megachiropteran
bats (Mammalia: Chiroptera: Pteropodidae) based on direct optimization analysis of one nuclear and four mitochondrial genes.
Cladistics 19, 496–511.
Giribet, G., 2001. Exploring the behavior of POY, a program for direct
optimization of molecular data. Cladistics 17, S60–S70.
Giribet, G., Ribera, C., 2000. A review of arthropod phylogeny: new
data based on ribosomal DNA sequences and direct character optimization. Cladistics 16, 204–231.
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
GoloboV, P.A., 1999a. NONA (NO NAME) Ver. 3. Fundacióne Instituto Miguel Lillo, Tucumán, Argentina.
GoloboV, P.A., 1999b. Analyzing large data sets in reasonable times:
solutions for composite optima. Cladistics 15, 415–428.
Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of
phylogeny. Bioinformatics 17, 754–755.
Kluge, A.G., Farris, J.S., 1969. Quantitative phyletics and the evolution
of anurans. Syst. Zool. 18, 1–32.
Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pääbo, S., Villablanca, F.X., Wilson, A.C., 1989. Dynamics of mitochondrial
DNA evolution in animals: ampliWcation and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA 86, 6196–6200.
Kocher, T.D., Conroy, J.A., McKaye, K.R., StauVer, J.R., Lockwood,
S.F., 1995. Evolution of NADH dehydrogenase subunit 2 in East
African cichlid Wsh. Mol. Phylogenet. Evol. 4, 420–432.
Konings, A., 1998. Tanganyika Cichlids in Their Natural Habitat.
Cichlid Press, El Paso, Texas.
McCracken, K.G., Sorenson, M.D., 2005. Is homoplasy or lineage sorting the source of incongruent mtDNA and nuclear gene trees in the
stiV-tailed ducks (Nomonyx-Oxyura)?. Syst. Biol. 54, 35–55.
Meyer, A., Morrissey, J.M., Schartl, M., 1994. Recurrent origin of a
sexually selected trait in Xiphophorus Wshes inferred from a molecular phylogeny. Nature 368, 539–542.
Nixon, K.C., 1999. The parsimony ratchet, a new method for rapid parsimony analysis. Cladistics 15, 407–414.
Nixon, K.C., 2002. WinClada. Published by the author, Ithaca, NY,
USA
Nishida, M., 1997. Phylogenetic relationships and evolution of Tanganyikan cichlids: A molecular perspective. In: Kawanabe, H., Hori,
M., Nagoshi, M. (Eds.), Phylogenetic Relationships and Evolution
of Tanganyikan Cichlids: a Molecular Perspective. Kyoto University Press, Kyoto, pp. 3–26.
Parker, A., KornWeld, I., 1996. Polygynandry in Pseudotropheus zebra,
a cichlid Wsh from lake Malawi. Environ. Biol. Fish. 47, 345–352.
Pellegrin, J., 1904. Contribution a l’étude anatomique, biologique et
taxinomique des poissons de la famille des cichlidés. Mém. Soc.
Zool Fr. 16, 41–402.
Poll, M., 1974. Contribution á la faune ichthyologique du lac Tanganika, d’après les récoltes de P. Brichard. Rev. Zool. Afr. 88, 99–110.
Poll, M., 1986. ClassiWcation des Cichlidae du lac Tanganika. Tribus
genres et espèces. Acad. R. Belg. Mém. Cl. Sci. 45 (2), 1–163.
Poll, M., Stewart, D., 1977. Un nouveau Lamprologus du sud du Lac
Tanganika (Zambia) (Pisces, Cichlidae). Rev. Zool. Afr. 91 (4),
1047–1056.
Posada, D., Crandall, K.A., 1998. ModelTest: Testing the model of
DNA substitution. Bioinformatics 14, 817–818.
Regan, C.T., 1920. The classiWcation of the Wshes of the family Cichlidae.–I. The Tanganyika genera. Ann. Mag. Nat. Hist. 5 (9), 33–53.
Regan, C.T., 1922. The classiWcation of the Wshes of the family Cichlidae.–II. On African and Syrian genera not restricted to the great
lakes. Ann. Mag. Nat. Hist. 10 (9), 249–264.
Roca, A.L., Georgiadis, N., O’Brien, S.J., 2005. Cytonuclear genomic
dissociation in African elephant species. Nat. Genet. 37, 96–100.
Rognon, X., Guyomard, R., 2003. Large extent of mitochondrial DNA
transfer from Oreochromis aureus to O. niloticus in West Africa.
Mol. Ecol. 12, 435–445.
Rüber, L., Meyer, A., Sturmbauer, C., Verheyen, E., 2001. Population
structure in two sympatric species of the Lake Tanganyika cichlid
tribe Eretmodini: evidence for introgression. Mol. Ecol. 10,
1207–1225.
Salzburger, W., Meyer, A., Baric, S., Verheyen, E., Sturmbauer, C.,
2002a. Phylogeny of the Lake Tanganyika cichlid species Xock and
its relationship to the central and East African haplochromine cichlid Wsh faunas. Syst. Biol. 51, 113–135.
Salzburger, W., Baric, S., Sturmbauer, C., 2002b. Speciation via introgressive hybridization in East African cichlids?. Mol. Ecol. 11,
619–625.
437
Schilthuis, L., 1891. On a collection of Wshes from the Congo; with
description of some new species. Tijd. Nederl. Dierk. Ver. 3, 83–91.
Schelly, R., Submitted. Lamprologine phylogenetics: insights from
morphology
Schelly, R.C., Stiassny, M.L.J., 2004. Revision of the Congo river
Lamprologus Schilthuis, 1891 (Teleostei: Cichlidae), with descriptions of two new species. Am. Mus. 3451, 1–40.
Schelly, R., Stiassny, M.L.J., Seegers, L., 2003. Neolamprologus devosi
sp. n., a new riverine lamprologine cichlid (Teleostei, Cichlidae)
from the lower Malagarasi River, Tanzania. Zootaxa 373, 1–11.
Schliewen, U.K., Klee, B., 2004. Reticulate sympatric speciation in
Cameroonian crater lake cichlids. Front. Zool., 1–5.
Seehausen, O., 2004. Hybridization and adaptive radiation. Trends
Ecol. Evol. 19 (4), 198–207.
Seehausen, O., van Alphen, J.J.M., Witte, F., 1997. Cichlid Wsh diversity
threatened by eutrophication that curbs sexual selection. Science
277, 1808–1811.
Shaw, K.L., 2002. ConXict between nuclear and mitochondrial DNA
phylogenies of a recent species radiation: what mtDNA reveals and
conceals about modes of speciation in Hawaiian crickets. Proc.
Natl. Acad. Sci. USA 99 (25), 16122–16127.
Sorenson, M.D., 1996. TreeRot. University of Michigan, Ann Arbor.
Sota, T., Ishikawa, R., Ujiie, M., Kusumoto, F., Vogler, A.P., 2001.
Extensive trans-species mitochondrial polymorphisms in the carabid beetles Carabus subgenus Ohomopterus caused by repeated
introgressive hybridization. Mol. Ecol. 10, 2833–2847.
Smith, P.F., Konings, A., KornWeld, I., 2003. Hybrid origin of a cichlid
population in Lake Malawi: implications for genetic variation and
species diversity. Mol. Ecol. 12, 2497–2504.
Staeck, W., 1978. Ein neuer cichlide aus dem südlichen Tanganjikasee:
Lamprologus nkambae n. sp. (Pisces, Cichlidae). Rev. Zool. Afr. 92
(2), 436–441.
Stiassny, M.L.J., 1992. Atavisms, phylogenetic character reversals, and
the origin of evolutionary novelties. Neth. J. Zool. 42, 260–276.
Stiassny, M.L.J., 1997. A phylogenetic overview of the lamprologine
cichlids of Africa (Teleostei, Cichlidae): a morphological perspective. S. Afr. J. Sci. 93, 513–523.
Streelman, J.T., Gmyrek, S.L., Kidd, M.R., Kidd, C., Robinson, R.L.,
Hert, E., Ambali, A.J., Kocher, T.D., 2004. Hybridization and contemporary evolution in an introduced cichlid Wsh from lake Malawi
national park. Mol. Ecol. 13, 2471–2479.
Sturmbauer, C., Verheyen, E., Meyer, A., 1994. Mitochondrial phylogeny of the Lamprologini, the major substrate spawning lineage of
cichild [sic] Wshes from Lake Tanganyika in Eastern Africa. Mol.
Biol. Evol. 11 (4), 691–703.
Sullivan, J.P., Lavoué, S., Hopkins, C.D., 2002. Discovery and phylogenetic analysis of a riverine species Xock of African electric Wshes
(Mormyridae: Teleostei). Evolution 56, 597–616.
Sullivan, J.P., Lavoué, S., Arnegard, M.E., Hopkins, C.D., 2004. AFLPs
resolve phylogeny and reveal mitochondrial introgression within a
species Xock of African electric Wsh (Mormyroidea: Teleostei). Evolution 58, 825–841.
SwoVord, D.L., 2002. PAUP*. Phylogenetic Analysis Using Parsimony
(* and Other Methods). Version 4.0b10. Sinauer Associates, Sunderland, Massachusetts
Takahashi, T., 2001. Description of the ethmovomerine region in
Tanganyikan cichlid Wshes (Teleostei: Perciformes). Bull. Fish. Sci.
Hokkaido Univ. 52, 117–124.
Takahashi, T., 2003. Systematics of Tanganyikan cichlid Wshes (Teleostei: Perciformes). Ichthyol. Res. 2003, 367–382.
Takahashi, K., Terai, Y., Nishida, M., Okada, N., 1998. A novel family
of short interspersed repetitive elements (SINEs) from cichlids: the
patterns of insertion of SINEs at orthologous loci support the proposed monophyly of four major groups of cichlid Wshes in Lake
Tanganyika. Mol. Biol. Evol. 15, 391–407.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W:
improving the sensitivity of progressive multiple sequence
438
R. Schelly et al. / Molecular Phylogenetics and Evolution 38 (2006) 426–438
alignment through sequence weighting, position-speciWc gap penalties, and weight matrix choice. Nucleic Acids Res. 22, 4673–4680.
Walsh, P.S., Metzger, D.A., Higuchi, R., 1991. Chelex 100 as a medium
for simple extraction of DNA for PCR-based typing from forensic
material. Biotechniques 10, 506–513.
Wheeler, W.C., 1995. Sequence alignment, parameter sensitivity, and
the phylogenetic analysis of molecular data. Syst. Biol. 44, 321–331.
Wheeler, W., 1996. Optimization alignment: the end of multiple
sequence alignment in phylogenetics?. Cladistics 12, 1–9.
Wheeler, W.C., 2003a. Iterative pass optimization of sequence data.
Cladistics 19, 254–260.
Wheeler, W.C., 2003b. Implied alignment: a synapomorphy-based multiple-sequence alignment method and its use in cladogram search.
Cladistics 19, 261–268.
Wheeler, W.C., Gladstein, D., De Laet, J., 2002. POY: Phylogeny
Reconstruction via Optimization of DNA Data, version 3.0. American Museum of Natural History, New York
Zardoya, R., Vollmer, D.M., Craddock, C., Streelman, J.T., Karl, S.,
Meyer, A., 1996. Evolutionary conservation of microsatellite Xanking regions and their use in resolving the phylogeny of cichlid Wshes
(Pisces: Perciformes). Proc. R. Soc. Lond. Ser. B Biol. Sci. 263,
1589–1598.