Virology 262, 152–162 (1999)
Article ID viro.1999.9914, available online at http://www.idealibrary.com on
Molecular Responses of Macrophages to Porcine Reproductive
and Respiratory Syndrome Virus Infection
Xuexian Zhang,* Jinho Shin,† Thomas W. Molitor,† Lawrence B. Schook,* and Mark S. Rutherford* ,1
*Department of Veterinary Pathobiology and †Department of Clinical and Population Sciences,
College of Veterinary Medicine, University of Minnesota, St. Paul, Minnesota 55108
Received April 1, 1999; returned to author for revision June 29, 1999; accepted July 20, 1999
The detailed mechanism(s) by which porcine reproductive and respiratory syndrome virus (PRRSV) impairs alveolar Mø
homeostasis and function remains to be elucidated. We used differential display reverse-transcription PCR (DDRT-PCR) to
identify molecular genetic changes within PRRSV-infected Mø over a 24 h post infection period. From over 4000 DDRT-PCR
amplicons examined, 19 porcine-derived DDRT-PCR products induced by PRRSV were identified and cloned. Northern blot
analysis confirmed that four gene transcripts were induced during PRRSV infection. PRRSV attachment and penetration alone
did not induce these gene transcripts. DNA sequence revealed that one PRRSV-induced expressed sequence tag (EST)
encoded porcine Mx1, while the remaining 3 clones represented novel ESTs. A full-length cDNA clone for EST G3V16 was
obtained from a porcine blood cDNA library. Sequence data suggests that it encodes an ubiquitin-specific protease (UBP) that
regulates protein trafficking and degradation. In pigs infected in vivo, upregulated transcript levels were observed for Mx1
and Ubp in lung and tonsils, and for Mx1 in tracheobronchial lymph node (TBLN). These tissues correspond to sites for
PRRSV persistence, suggesting that the Mx1 and Ubp genes may play important roles in clinical disease during PRRSV
infection. © 1999 Academic Press
Arteriviridae replicate primarily within Mø, and porcine
alveolar Mø are a primary target cell for PRRSV replication in vivo (Molitor et al., 1996; Wensvoort et al., 1991).
PRRSV replication in alveolar Mø is associated with
cytopathic effects (CPE; Rossow, 1998). PRRSV infection
decreases alveolar Mø release of superoxide anion
(Thanawongnuwech et al., 1997) and the number of alveolar Mø in the lung (Plana et al., 1992). It is presumed
that altered alveolar Mø function is linked to the apparent
increased incidence of pulmonary bacterial co-infections
in PRRSV-infected herds (Kobayashi et al., 1999; Thanawongnuwech et al., 1997). The high incidence of respiratory microbial co-infection in chronically infected herds
suggests that PRRSV interferes with host Mø activities
used to clear respiratory pathogens. However, the molecular pathways by which PRRSV infection disrupts normal Mø homeostasis have not been elucidated.
Once an intracellular pathogen such as a virus invades a host cell, the interactions become physiological
and biochemical as well as immunological. Pathogens
that replicate within host cells usurp host biological
processes for their own benefit. In response, the host
cell manipulates gene expression to inhibit those pathways or processes required or induced by the pathogen.
Viruses in particular subvert host cell metabolism in such
a way that viral components can be synthesized via host
cell pathways to initiate viral replication. Viral particles,
viral components, and virus-induced cellular factors all
have the potential to alter host cell gene expression.
INTRODUCTION
Porcine reproductive and respiratory syndrome (PRRS)
is prevalent in Europe, North America, and Asia, and
leads to significant economic losses in the swine industry. PRRS virus (PRRSV), the causative agent, was identified in 1991 in the Netherlands (Wensvoort et al.,1991)
and in 1992 in the United States (Collins et al.,1992).
PRRSV infection presents as reproductive failures
through premature farrowing and/or interstitial pneumonia characterized by alveolar wall thickening with macrophage (Mø) and necrotic cell debris. PRRSV is a small
enveloped RNA virus of the family Arteriviridae (Conzelmann et al., 1993), order Nidovirales (Cavanaugh, 1997),
and contains an approximately 15 kb positive strand RNA
genome. PRRSV structural proteins encoded from open
reading frames (ORF) 2 to 7 were identified as glycoprotein (GP) 2 (29–30 kDa), GP 3 (45–50 kDa), GP 4 (31–35
kDa), major envelop protein (E; 24–26 kDa), a viral membrane protein (M; 18–19 kDa), and a nucleocapsid (N; 15
kDa) (Meulenberg et al., 1996; Meulenberg et al., 1995;
van Nieuwstadt et al., 1996). The E protein is strongly
cytotoxic via induction of apoptosis in vitro (Suárez et al.,
1996). As yet, the functions for GP 2, GP 3, and GP 4 have
not been elucidated.
1
To whom reprint requests should be addressed at 1988 Fitch
Avenue, Room 295. Fax: (612) 625-0204. E-mail: [email protected].
0042-6822/99 $30.00
Copyright © 1999 by Academic Press
All rights of reproduction in any form reserved.
152
MACROPHAGE VIRAL RESPONSE GENES
153
FIG. 1. PRRSV replication in PRRSV-infected alveolar Mø. RT-PCR was performed with 59primer/39primer (PRRSV ORF 7-specific primers). Blank is
a negative PCR control without RT mixture. M is 100 bp DNA ladder. Arrow indicates the PCR product (508 bp).
Molecular genetics and cell biology can be implemented
to define the specific host cell molecules and cellular
components with which virus-encoded molecules interact.
Differential display reverse transcription polymerase
chain reaction (DDRT-PCR) is a powerful approach used
to directly compare gene expression between cells or
tissues at specific physiological states (Bhattacharjee et
al., 1998; Liang et al., 1992). DDRT-PCR provides an
unbiased mRNA fingerprint for direct observation of
cDNAs PCR amplified to different levels reflective of
relative transcript levels within a total RNA sample. By
using a reverse transcription/PCR primer that anchors on
the nucleotide just 59 of the poly(A) tail, DDRT-PCR specifically reverse transcribes only a subset of the mRNAs.
PCR is then performed using the 39-anchor primer and
an arbitrary 59 primer to amplify 100–400 fragments of the
cDNAs generated by reverse transcription. Recently,
DDRT-PCR has been used to describe host cell genetic
responses to infection by pseudorabies virus (Hsiang et
al., 1996), cytomagolovirus (Zhu et al., 1997), HIV (Sorbara
et al., 1996), herpes simplex virus (Tal-Singer et al., 1998)
and rhabdovirus (Boudinot et al., 1999). We hypothesized
that PRRSV infection alters alveolar Mø homeostatic
gene expression, leading to compromised host defenses
in the lungs of infected animals. The effect of PRRSV
infection on alveolar Mø gene expression was therefore
observed by monitoring changes in gene expression
using DDRT-PCR. We identified 19 porcine Mø-derived
DDRT-PCR amplicons induced during a 24 h in vitro
infection period. Many of these transcripts appear to
encode previously unknown gene products. Further, we
confirmed that four of these genes are induced during
PRRSV infection, and are induced in vivo in tissues
where PRRSV persistently resides, suggesting that they
may provide insight for understanding host cell molecular responses during PRRSV pathogenesis.
RESULTS
PRRSV replication and altered gene expression
in alveolar Mø
Alveolar Mø were infected using PRRSV strain VR2332
(m.o.i. 5 0.1) in vitro. CPE was not observed until 16 h
post infection and was less than 10% at 24 h post infection. At 72 h post infection, CPE was more than 70% (data
not shown). To identify differentially expressed mRNAs
during PRRSV infection, we collected total cellular RNA
from mock- and PRRSV-infected porcine alveolar Mø at 4,
12, 16, and 24 h post infection. PRRSV genome replication was confirmed via RT-PCR detection of accumulation
for ORF 7 sequences of PRRSV genomic RNA (Fig. 1).
PRRSV ORF 7 transcript levels increased with time, demonstrating active viral genomic replication in alveolar Mø.
Mø mRNAs differentially expressed during PRRSV infection were detected by DDRT-PCR comparison against
mock-infected alveolar Mø at various times post infection. For each DDRT-PCR primer pair, duplicate RNA
samples from each time point were reverse-transcribed,
PCR amplified, and fractionated on adjacent lanes to
ensure DDRT-PCR accuracy and reproducibility. Representative DDRT-PCR reactions are shown in Fig. 2.
PRRSV infection induced (Fig. 2A) or suppressed (data
not shown) several alveolar Mø transcripts. Using 16 of
the possible upstream various septamer H-AP primers
(GenHunter), over 4000 DDRT-PCR products were visually compared for band intensity. Twenty DDRT-PCR
products that were reproducibly induced (. twofold difference compared to mock-infected cultures) in both
DDRT-PCR reactions for a given RNA sample during a
154
ZHANG ET AL.
sented the porcine Mx1 cDNA as determined by 99%
nucleotide sequence similarity. Mx1 is a previously described interferon-inducible protein with allelic association to viral resistance/susceptibility phenotypes in mice
(Horisberger, 1995).
Confirmation of DDRT-PCR results
DDRT-PCR is a powerful approach to identify and isolate uniquely expressed genes (Liang and Pardee, 1992),
but it is a semi-quantitative technique with a high false
positive rate and artifacts. Template abundance, primer
sequence specificity, primer availability, PCR cycle number, and amplification efficiency can each affect DDRTPCR amplicon accumulation. Therefore, in addition to
simultaneously comparing duplicate RNA samples and
DDRT-PCR reactions, it was necessary to confirm the
expression patterns observed in the DDRT-PCR profiles.
All 19 PRRSV-induced porcine Mø DDRT-PCR clones
were screened by Northern blot analysis against total
cellular RNA from mock- and PRRSV-infected porcine
alveolar Mø. Three clones gave no signal on Northern
TABLE 1
FIG. 2. Differential display of alveolar Mø mRNA during PRRSV
infection in vitro. Total RNA was extracted from mock- and PRRSVinfected alveolar Mø, and analyzed in duplicate by DDRT-PCR. A selected comparison is shown. Filled arrows indicate amplicons showing
reproducible altered expression associated with PRRSV infection. A
hollow arrow denotes a non-reproducible amplicon. The DDRT-PCR
primers used were A) H-T 11G and H-AP 3; and B) H-T 11A and H-AP 5.
24 h PRRSV infection in vitro (Table 1). All differentially
expressed DDRT-PCR products were extracted from
acrylamide gels, reamplified, and cloned into pBluescript
SKII (Stratagene). DDRT-PCR amplicons that showed altered levels in only one of two identical samples were
not considered further.
Amplicon sequence analysis
To determine whether DDRT-PCR clones were derived
from porcine cellular genes or from the PRRSV genome,
all 20 PRRSV-induced DDRT-PCR amplicons were sequenced. One DDRT-PCR clone encoded a portion of the
PRRSV ORF2 (data not shown) and was removed from
further study. Only 5 of the remaining 19 PRRSV-induced
transcripts matched previous GenBank submissions (Table 1). Our particular DDRT-PCR application utilizes a
reverse transcription primer anchored at the last nucleotide 59 to the poly(A) tail, and PCR conditions that favor
amplification of 200–400 bp amplicons. As expected for
short cDNAs derived from the 39 end of mRNAs, no
significant open reading frames or known conserved
protein functional domains could be detected in the
PRRSV-induced, novel cDNAs. Clone G12V24 repre-
PRRSV-Induced DDRT-PCR Amplicons
DDRT-PCR
levels (24 H) a
Clone
Mock
PRRSV
Insert
size (bp)
A2V16-22 b
A2V16-23
A4V12-22
A5V12-11
A12V24-11
A12V24-21
C3V16-11
C3V16-32
C7V16-11
C7V16-31
C7V16-41
1
1
1
2
1
1
1
1
1
1
1
11
11
11
111
111
11
11
11
11
11
11
255
188
187
214
307
307
188
252
238
259
341
C7V16-52
C12V16-21
G2V12-11
G3V16-11
G4V12-11
G12V24-11
G12V24-12
G13V16-21
1
1
1
1
1
1
2
1
111
11
11
111
11
11
111
11
436
352
208
240
290
316
317
264
Identity or similarity (%)
Novel EST c
Novel EST
Bovine aS1-casein (84%)
Novel EST
Novel EST
Novel EST
Novel EST
Novel EST
Novel EST
Human thioredoxin (87%)
Bovine NADH-ubiquinone
oxidoreductase (93%)
Human galactin-3 (90%)
Novel EST
Novel EST
Novel EST d
Novel EST
Novel EST
Porcine Mx1 (99%)
Novel EST
a
The intensity of the DDRT-PCR products was graded visually from
DDRT-PCR gels exposed to film. Relative band intensity is denoted 1
to 111, and 2 denotes no DDRT-PCR product.
b
Clones in bold were subsequently confirmed by Northern blotting to
be induced by PRRSV infection of porcine alveolar Mø.
c
DDRT-PCR amplicons were considered novel ESTs if they had ,
70% identity over a continuous 100-bp sequence.
d
Clone G3V16 was subsequently determined to encode a ubiquitin
protease.
MACROPHAGE VIRAL RESPONSE GENES
155
FIG. 3. Temporal transcript expression in PRRSV-infected Mø determined by Northern blot. Total cellular RNAs (10 mg per lane) were collected from
mock- and PRRSV-infected Mø at 0 - 36 h post infection, and hybridized against DDRT-PCR cDNAs as shown. Medium indicates cultures treated with
RPMI 1640 with 10% fetal bovine serum. CL2621 denotes cultures receiving only supernatant from mock-infected CL2621 cells. UV-PRRSV denotes
cultures receiving UV-inactivated PRRSV infection. GAPDH transcripts were quantitated to normalize for RNA loading.
blot analysis (data not shown), suggesting that they were
either cloning artifacts or represented sequences expressed at levels too low to detect by this technique. Our
previous experience has shown that as many as 40% of
DDRT-PCR clones require more sensitive RT-PCR or ribonuclease protection assays (RPA) for quantification
(Bhattacharjee et al., 1998). An additional 12 PRRSVinduced DDRT-PCR clones showed less than twofold
induced expression on Northern blots (data not shown)
and their expression was not further investigated. The
four remaining DDRT-PCR clones were confirmed by
Northern blot analysis to be induced by PRRSV infection
(Fig. 3). All 4 transcripts were induced by PRRSV infection, exhibited distinct expression levels, and were of
different sizes (data not shown). These data support that
each clone was derived from a transcript representing a
unique amplicon.
Temporal accumulation of the molecular markers identified by DDRT-PCR during PRRSV infection was determined. Total cellular RNA was isolated from alveolar Mø
from 0 to 36 h after treatment with medium alone, conditioned medium from CL2621 cells used to generate
infectious PRRSV preparations, UV-irradiated PRRSV, and
PRRSV. Transcripts detected by DDRT-PCR clones
A5V12, G3V16, G2V12, and G12V24 increased concomitant with PRRSV replication (Fig. 3). Transcripts detected
by A5V12, G2V12, and G3V16 were not detected until 16 h
post infection, whereas G12V24 transcripts were induced
as early as 8 h post infection (Fig. 3). Gene transcripts
were not induced in medium control cultures or in Mø
treated with CL2621 cell-conditioned medium. Importantly, Mø infected with UV-irradiated PRRSV, which can
bind to and penetrate Mø but not replicate, did not
express detectable levels for any of the transcripts examined (Fig. 3). Together, these data indicate that active
PRRSV genomic replication within Mø is required for
induction of gene expression for these selected amplicons.
Common molecular responses of porcine alveolar Mø
To determine whether the DDRT-PCR clones identified
and characterized from PRRSV-infected Mø were specific
to this pathogen or instead result from a general viral
response molecular program, transcript expression was
determined for porcine alveolar Mø infected with pseudorabies virus (PRV) in vitro. As was observed for PRRSV,
all 4 transcripts were induced by PRV infection (Fig. 4).
However, the kinetics of expression were different. Transcripts appeared sooner and peak expression levels
were higher compared to PRRSV-infected cultures, perhaps reflecting the more severe disruption of Mø homeostasis and CPE for PRV (data not shown). Further,
transcripts for G2V12 dissipated by 24 h in PRV-infected
cultures, suggesting that it is only transiently expressed
by virally-infected cells. Thus, induction of these transcripts appears to reflect a generalized Mø molecular
response to intracellular viral replication.
Identification of a full-length cDNA clone
To further characterize PRRSV-induced porcine Mø
genes, a porcine peripheral blood cell cDNA library was
screened using clone G3V16 as a probe. A phage clone
was isolated via plaque lift hybridization and contained
an insert (1.7 kb) of approximately the same size as the
mRNA (data not shown), suggesting that it contained a
156
ZHANG ET AL.
FIG. 4. Northern blot analysis in PRV-infected alveolar Mø in vitro. Overnight cultured porcine alveolar Mø were infected with PRRSV or PRV (m.o.i.
5 0.1). Total cellular RNAs (10 mg per lane) were collected at the indicated times, fractionated by electrophoresis, transferred to nylon supports, and
hybridized against the indicated DDRT-PCR cDNAs. M is mock infection. GAPDH transcripts were quantitated to normalize for sample loading.
full-length cDNA. DNA sequence determination (Accession number AF134195) of the isolated cDNA clone confirmed that it contained a full-length coding sequence,
which included a 39 untranslated region (UTR, 572bp),
coding sequence (966 bp), and a 59 UTR (172bp). Deduced amino acid sequence identified a conserved Cys
domain (block entry, BL00972A) and a His domain (block
entry, BL00972D) (Fig. 5A), which are thought to act as
active sites for ubiquitin-specific proteases (UBPs;
Wilkinson, 1997). Further, a GenBank data search and
analyses by Blast (NCBI, NIH) and FEX (Find exon program, Sanger Center, UK) indicated that a putative human homolog is located at chromosome 22q11.2. The
putative human UBP has eight ORFs derived from approximately 15 kb of genomic DNA (Fig. 6). The amino
acid similarity and identity of porcine UBP with the putative human UBP were 81% and 75%, respectively (Fig.
5B). These results indicate that porcine UBP is a novel
member of an UBP superfamily, and suggest that intracellular protein trafficking, turnover or degradation may
be altered during PRRSV infection of porcine alveolar
Mø. The identities or putative function for PRRSV-induced
ESTs A5V12 and G2V12 have not yet been established.
Tissue specific expression in in vivo PRRSV-infected
animals
To determine whether expression of DDRT-PCR products identified in vitro reflected events during PRRSV
infection in vivo, we examined tissue-specific expression
of DDRT-PCR amplicons in PRRSV-infected pigs. Whole
tissues were collected at 14 days post infection from 2
PRRSV-infected pigs and 2 mock-infected pigs. Quantitative RT-PCR demonstrated the presence of PRRSV
genomic RNA in lungs, lymph nodes, and tonsils (data
not shown). Tissue RNAs from identically treated animals
were pooled to minimize animal-to-animal variation, and
RT-PCR was performed for 14 and 17 cycles, which we
have determined is in the linear range of amplification
(data not shown). Products were transferred onto membranes for Southern blot analysis via hybridization to
cDNA probes for porcine Mx1 and Ubp (Fig. 7). PCR
amplicon levels for each tissue sample were normalized
to HPRT amplicon levels, and normalized values for each
tissue were compared between mock- and PRRSV-infected animal (Fig. 7). Porcine Ubp transcripts were
greatly upregulated during PRRSV infection in the lungs
(4.5-fold) and tonsils (11.4-fold), but were reduced 30% in
TBLN from PRRSV-infected animals. In contrast, Mx1
transcripts were greatly induced in all three tissues (Fig.
7). Taken together, these data show (1) constitutive expression for these genes in vivo; (2) tissue-specific regulation of gene expression; and (3) PRRSV-induced upregulation of transcript levels in tissues where PRRSV is
persistent.
DISCUSSION
PRRSV infection causes significant losses in the swine
industry, in part due to poor growth associated with
interstitial pneumonia (Rossow, 1998). PRRSV infection in
vivo is thought to be a contributing factor that results in
increased secondary pulmonary bacterial infections following impairment of Mø function in the lungs. Toward
MACROPHAGE VIRAL RESPONSE GENES
157
FIG. 5. Conserved domains and human homology of porcine UBP amino acids. (A) Positions of the conserved amino acid sequence domains that
contains Cys residue and His residue in ubiquitin-specific protease (UBP) superfamily are shown in standard single letter code. Bold letters indicate
identity with porcine UBP with other members in these two domains. The aligned gene accession numbers are: UBPH-human, Q93009; FAFX-human,
Q93008; UBP41-human, AF079564; UBPY-human, P40818; UBP41-mouse, AF079565; UBP41-chicken, AF016107; FAF-flies, A49132; UBPE-flies, Q24574;
UBP8-yeast, P50102; UBPF-yeast, P50101; UBPB-schpo, Q09738; UCH-putative, AL021889. Numbers in parentheses are the amino terminus position
of conserved domain in UBPs. (B) Alignment of porcine UBP amino acid and a putative human UBP homolog with Gap program (GCG). Blast search
(NCBI, NIH) was performed for the entire G3V16 cDNA sequence. Further, FEX (find exon, http://genomic. sanger.ac.uk/) was used to find the human
homolog. Human sequence was derived from genomic DNA sequence (AC005500). Letters in bold denote the conserved Cys and His domains.
Asterisks denote translational stop.
this end, recent evidence describes slightly impaired
killing of Haemophilus parasuis and Staphylococcus aureus by PRRSV-infected alveolar Mø (Solano et al., 1998;
Thanawongnuwech et al., 1997). However, conflicting
data exists. While PRRSV-infected Mø demonstrate reduced reactive oxygen product formation (Done and Paton, 1995; Thanawongnuwech et al., 1997) and late-stage
inhibition of bacterial phagocytosis (Solano et al., 1998),
phagocytosis of opsonized S. aureus (Thanawongnuwech et al., 1997) or H. parasuis (Segalés et al., 1998) is
not impaired. Pro-inflammatory cytokine gene expression, including TNF-a, IL-8, IFN-a and IL-1b does not
appear to be significantly altered (Buddaert et al., 1998;
Trebichavsky and Valicek, 1998; Zhang and Rutherford,
1997). Further, a systemic impairment of host immunity
during persistent PRRSV infection is not supported (Albina et al., 1998). Hence, we have used a DDRT-PCR
mRNA fingerprinting approach to identify molecular responses during PRRSV infection of porcine alveolar Mø.
We now report that PRRSV infection alters host Mø gene
158
ZHANG ET AL.
FIG. 6. Putative human Ubp gene structure. Eight exons were mapped in human genomic DNA from 1 to 8. Each solid box indicates an exon. ATG
is the start codon and TGA is the stop codon.
expression programs, including a ubiquitinated protein
degradation pathway and the induction of novel genes of
unknown function.
Molecular characterization of PRRSV infection will permit us to identify and isolate important host cell molecular responses associated with PRRSV infection. However, it is clear from our in vivo studies (Fig. 7) that factors
within individual tissues can impact the molecular phenotype of the tissues and the infected cells therein.
Further, temporal effects in vivo are difficult to gauge on
a per cell basis due to the continuous influx of immune
cells through secondary lymphoid organs and inflammatory sites, leading to asynchronous infection times. The
in vivo molecular status of a tissue reflects a wide range
of effects, particularly for tissue Mø that display significant functional and molecular heterogeneity between
tissues and stages of differentiation (Rutherford et al.,
1993). Consistent with this premise, PRRSV tropism for
Mø is greatly dependent on Mø origin, state of differentiation, and level of activation (Duan et al., 1995; Molitor
et al., 1996). Thus, tissue-specific regulation of Mx1 and
Ubp gene expression is not unexpected, and may reflect
changes in the number of tissue macrophages. Further,
while these gene transcripts were identified in Mø cultures, the cell(s) that express these transcripts in vivo
and their spatial distribution in relation to virus-containing cells await elucidation.
Initial experiments used both cell culture medium and
CL2621 cell-conditioned medium as control treatments
for confirming DDRT-PCR results. This was necessary in
that PRRSV viral stocks were propagated using the
CL2621 cell line. Our results showing that CL2621 conditioned medium or UV-inactivated PRRSV stocks did not
induce Mø expression of these genes suggests that
components within the CL2621 cell culture supernatant
itself do not account for our DDRT-PCR findings. On the
FIG. 7. RT-PCR analysis of gene transcripts in vivo during PRRSV infection. Total cellular RNAs (2 mg) from lungs, tracheobronchial lymph nodes
(TBLN), and tonsils from PRRSV-infected pigs were used to perform RT-PCR. PCR was performed for 14 and 17 cycles which is in the linear range
(data not shown). RT-PCR products were analyzed with Southern blot using indicated DDRT-PCR clones. Mock denotes infection with PBS. Numbers
shown are the ratio of signal intensities for each amplicon compared to HPRT for the same tissue RNA sample.
MACROPHAGE VIRAL RESPONSE GENES
other hand, PRRSV attachment and penetration also
likely impacts host cell gene expression. Again, our data
suggest that PRRSV attachment and penetration alone
was not sufficient to induce expression of the four genes
examined here (Fig. 3). This is in contrast to Zhu et al.,
(1997) who reported that human cytomegalovirus induces host cell mRNA accumulation via original viral
particles and not viral replication in host cells. Recently,
Boudinot et al., (1999) reported that a glycoprotein from
hemorrhagic septicemia virus (VHSV) in fish directly induced vig-1 gene expression. Failure to observe attachment-induced transcripts may be due to the fact that,
compared to actively infected cultures, a lower percentage of host cells experience viral attachment and penetration in cultures treated with UV-inactivated PRRSV
(m.o.i. is 0.1), with subsequently fewer attachment-induced transcripts being present in these cultures. A
higher titer infection may help identify viral attachment
effects on host cell transcripts. We are also incorporating
a more sensitive RT-PCR screening for DDRT-PCR clones
that do not detect transcripts by Northern blot screening.
Finally, we have used only 16 of the possible 80 DDRTPCR primer pairs, and further characterization of additional DDRT-PCR clones may also reveal transcripts altered as a direct result of PRRSV attachment.
Interferons (IFN) play an important role in host defense
against viruses, in part via the induction of cellular genes
(Staeheli, 1990; Zhu et al., 1997) that include Mx genes.
The Mx1 gene was originally isolated as a viral resistance gene from mice (Lindenmann, 1964) having two
alleles, Mx 1 (resistant, dominant) and Mx - (susceptible,
recessive). Mx1 gene homologues have been described
in other mammalian species, including pigs (Horisberger
and Gunst, 1991). Mx1 inhibits primary transcription of
parental influenza viral genomes in mice (Krug et al.,
1985). In humans, the Mx1-encoded MxA protein is induced by type I IFNs, double-stranded RNA, and several
viruses, including influenza virus and Newcastle disease
virus in human embryonic cells (Aebi et al., 1989) and HIV
in monocytes (Baca et al., 1994). We now report that
PRRSV infection of Mø induces porcine Mx1 expression,
either directly or subsequent to PRRSV-induced IFN production in infected cultures.
The kinetics of Mx1 gene activation are very fast, and
MxA accumulation is detectable within 4 h post infection
(Horisberger, 1995), consistent with our observations.
The functional significance for porcine Mx1 gene expression in PRRSV infection is unknown. Based on Mx1
activities in other species and PRV induction of Mx1
expression in porcine Mø, this gene product is likely to
be involved in host cell protection against viruses in
general, either following infection directly or via IFN
released by neighboring cells which harbor the virus.
However, Mx1 mRNA accumulation did not prevent
PRRSV or PRV replication in porcine alveolar Mø. Thus,
its importance during PRRSV infection, maintenance of
159
Mø homeostasis, and development of CPE is unclear. It
is interesting to note a recent report that describes pig
breed differences in tissue lesions to a high virulence
strain of PRRSV (Halbur et al., 1998). It is presently
unknown whether Mx1 alleles exist in pigs and whether
they associate with viral resistance/susceptibility phenotypes as observed in mice (Lindenmann, 1964).
UBP comprises a protein superfamily in which more
than 60 UBPs have been identified in different species
(Wilkinson, 1997). Identification of a PRRSV-induced UBP
is the first such protein described in pigs. UBPs specifically hydrolyze ester, thiol ester, and amide bonds to the
carboxyl group of G76 of ubiquitin in which ubiquitin
conjugates with target proteins that will be degraded by
proteasome 26 (Hochstrasser, 1995; Goldberg, 1995;
Pickart, 1997). Ubiquitin modification and deubiquitination by UBPs is increasingly recognized as important
protein regulatory strategies that impact cell cycle regulation (Pagano, 1997), cellular growth modulation (Zhu et
al., 1996), transcription activation (Trier et al., 1994), antigen presentation by MHC class I (Rock et al., 1994), and
DNA repair and differentiation (Hochstrasser, 1995). Porcine Ubp gene expression induced by PRRSV may be
involved in regulating protein metabolism via a ubiquitinconjugated pathway. This could benefit the host cell in
that removing ubiquitin from host proteins prevents them
from being moved to the proteasome, helping to maintain
Mø protein levels in the face of viral disruption of host
translation. Conversely, the virus may induce UBP to
prevent newly synthesized viral proteins from being degraded. Finally, Ubp gene induction may disrupt Mø
antigen presentation, thereby compromising host immune responses to subsequent bacterial challenge.
By sequence data analysis, we determined that porcine Ubp is homologous to a putative human Ubp that is
located at the DiGeorge critical region (DGCR) on chromosome 22q11 (Fig. 6). The recently identified Ufd1 gene
encodes a protein involved in degradation of ubiquitinated proteins (Yamagishi et al., 1999), suggesting that
regulation of ubiquitinated protein degradation contributes to congenital heart and craniofacial defects in the
mouse embryo (Yamagishi et al., 1999). The detailed
molecular mechanism by which PRRSV infection leads to
sow abortion is unknown and porcine Ubp may play a
role in fetal death. However, similar cardiac and craniofacial defects in PRRSV-aborted fetuses have not been
reported.
We adopted an unbiased approach to directly identify
and capture affected host genes to extend our understanding of PRRSV-Mø interactions. DDRT-PCR has been
used to characterize host cellular gene expression in
other viral systems, including pseudorabies virus
(Hsiang et al., 1996), human herpes simplex (Tal-Singer
et al., 1998), HIV (Sorbara et al., 1996), and human cytomegalovirus (Zhu et al., 1997). Together, these studies
and our data suggest that the interactions between vi-
160
ZHANG ET AL.
ruses and host cells can be delineated via DDRT-PCR
cloning of novel genes and subsequent characterization
of gene expression involved in the altered host cell
homeostasis.
MATERIALS AND METHODS
Cells, viruses, and pigs
Six- to eight-week old pigs were selected from healthy
and PRRSV-negative pig populations. Alveolar Mø were
collected by lung lavage (Lee et al., 1996). Lungs were
washed 2–4 times with phosphate-buffered saline (PBS,
pH 7.2). Each wash was centrifuged at 1200 rpm at 4°C
for 10 min. Cell pellets were mixed, washed again in PBS,
and then resuspended in 20–50 ml of RPMI 1640. Mø
were incubated overnight at 37°C, 5% CO 2 in RPMI 1640
medium supplemented with 10% fetal bovine serum, 1
mM L-glutamine, 0.1 mM nonessential amino acids, 25
mM HEPES, and antibiotics before viral infection.
ATCC PRRSV strain VR2332 (passage 9, 5 3 10 6 PFU/
ml) and CL2621 cell culture supernatant were obtained
from Dr. K. S. Faaberg (University of Minnesota). PRRSV
suspension (m.o.i. 5 0.1) or medium was inoculated after
washing Mø monolayers. For UV inactivation, PRRSV
stock placed in a 10 cm-diameter petri dish was irradiated using an UV-Crosslinker (Stratagene Corp., La Jolla,
CA) with 120 mJ/cm 2 for 15 min. Pseudorabies virus (PRV)
strain 086 was used to infect porcine alveolar Mø (m.o.i.
5 0.1) in vitro.
For in vivo infection, six-week-old pigs obtained from a
PRRSV seronegative farm were infected intranasally with
10 5 TCID 50 of PRRSV strain VR2332 or PBS as a control.
Serum samples were collected at Day 0, 2, 5, 7, 10, and
14 post-infection, and stored at -80°C (data not shown).
Tissues were collected at 14 days post-infection and
immediately placed into TRIzol (Life Technologies, Grand
Island, NY) reagent and frozen in dry ice/ethanol. All
tissues were stored at 280°C until used.
Total cellular RNA isolation and Northern blot
analysis
Total cellular RNA was extracted from alveolar Mø
cultures and tissues using TRIzol Reagent (Life Technologies) according to the manufacturer’s protocol. RNA
integrity was evaluated on 1% agarose gels with formaldehyde (0.4 M) after staining with ethidium bromide. For
DDRT-PCR analyses, trace genomic DNA contamination
was removed with MessageClean (GenHunter Corp.,
Nashville, TN) before performing reverse transcription.
For Northern blots, total cellular RNAs (10 mg per lane)
were fractionated on 1% agarose-0.4 M formaldehyde
gels, transferred to nylon membranes (Schleicher &
Schuell, Keene, NH), and cross-linked using a UVCrosslinker (Stratagene). The cDNA probe was labeled
by random primer labeling (Life Technologies) following
the manufacturer’s protocol. Hybridization was carried
out at 42°C in 10 ml of solution containing 5 x SSPE, 50%
formamide, 0.5% SDS, 5 x Denhardt’s reagent, and 100
mg/ml sonicated salmon sperm DNA overnight. The hybridized membrane was washed twice with 2 x SSC/0.1%
SDS for 15 min at room temperature, followed by 0.1 x
SSC/0.1% SDS at 55°C for 20 min. Blots were exposed to
film overnight at -80°C or quantitated by phosphorimagery (Molecular Dynamics, Sunnyvale, CA).
Differential display assays
DDRT-PCR was performed as previously described
(Bhattacharjee et al., 1998). First-strand cDNAs (20 ml)
were synthesized for each RNA sample separately using
one of three H-T 11M anchor primers (where M is G, A, or
C, GenHunter Corp.), 0.2–0.4 mg total cellular RNA, 4 ml
5 x RT buffer, 20 mM dNTPs, and 200 U of Superscript II
reverse transcriptase (Life Technologies) at 42°C for 1 h.
PCR reactions (10 ml) were performed using the RNAimage Kit (GenHunter) and contained 1 x PCR buffer, 2 mM
dNTPs, 0.2 mM 59 H-AP primer/39 H-T 11M anchored
primer, 0.15 ml [a- 33P] dATP (2500 Ci/mM, Amersham), 1
ml reverse transcription product, and 1 U AmpliTaq DNA
polymerase (Perkin–Elmer). The PCR cycling profile was
94°C for 2 min, [94°C for 30 s, 40°C for 2 min, 72°C for
30 s] for 40 cycles, then 72°C for 5 min. Denatured
DDRT-PCR products were loaded onto a 6% denaturing
polyacrylamide DNA sequencing gel, and run for 3.5 h.
The gel was blotted onto filter paper, dried under vacuum
on a gel dryer at 80°C for 1 h, and then exposed to film
at room temperature for 16–24 h. Amplicon intensities
were compared visually for each infection time across
duplicate samples, and differentially expressed amplicons were prepared as described (Bhattacharjee et al.,
1997). Briefly, bands were excised from acrylamide gels,
placed in 100 ml of dH 2O for 10 min, and then boiled for
15 min. DDRT-PCR products were collected by centrifuging for 2 min and stored at 220°C. Reamplified cDNAs
were purified from the 2% agarose gel using the QIAEX II
kit (Qiagen Corp., Chatsworth, CA), and then stored at
220°C for cloning and hybridizing analysis.
DDRT-PCR Amplicon cloning and sequencing
Reamplified DDRT-PCR products were ligated into the
EcoRV site of pBluescript SKII (Stratagene) using a modified T-A cloning approach and recombinant clones were
identified by colony PCR (Bhattacharjee et al., 1997).
Briefly, cleaved vector was purified by GENECLEAN (Bio
101, Inc. Vista, CA), and a 39-thymidine residue was
added with AmpliTaq DNA polymerase (Perkin–Elmer)
and dTTP at 72°C for 2 h. Reaction mixtures were treated
by T4 DNA ligase at 15°C overnight, and non-ligated
vector was purified from 1% of agarose gel. DDRT-PCR
amplicons were ligated with T overhang vectors at 15°C
overnight, transfected into XL1-blue cells (Stratagene).
MACROPHAGE VIRAL RESPONSE GENES
Plasmid DNA from clones with insert was prepared by
miniprep (Qiagen). DNA sequencing was performed on
an Applied Biosystem 377 Automatic DNA sequencer
(Perkin–Elmer) in the Advanced Genetic Analysis Center,
College of Veterinary Medicine, University of Minnesota.
Sequences were analyzed by a BLAST search (NCBI,
NIH). The accession numbers are: AF102503 for clone
A5V12, AF102504 for clone G3V16, AF102505 for clone
G2V12, AF102506 for clone G12V24 and AF134195 for
porcine Ubp.
Reverse transcription PCR assay
Reverse transcription (20 ml) was performed as above
using total cellular RNA (2 mg). The reaction was stopped
by heating to 70°C for 10 min, and RT products were
treated with RNase H (Promega Corp., Madison, WI) for
20 min at 37°C. PCR reactions (25 ml) were performed
with RT product (1 ml), 10 x PCR buffer, 25 mM dNTPs, 0.2
mM each of 59 primer and 39 primers, and 1 U of AmpliTaq DNA polymerase (Perkin–Elmer). The primer pairs
used were: Mx1: 59 primer GCTTGAGTGCTGTGGTTG/39
primer GGACTTGGCAGTTCTGTGGAG; Ubp: 59 primer
AGGGGCCAAGCTCATGTGAC/39 primer GTGGCCAGCATACCATCTCC. Primer sequences and PCR profile for
porcine hypoxanthine phosphoribosyltransferase (HPRT)
have been described (Foss et al., 1998). Each cDNA was
amplified for 14 cycles and 17 cycles (linear range, data
not shown). Amplicons were analyzed by Southern blot
hybridization against DDRT-PCR probes. Signals were
quantified by phosphorimagery (Molecular Dynamics).
Isolation of cDNA clones
A pig cDNA library (kindly provided by Dr. C. W. Beattie, University of Minnesota) prepared from peripheral
blood cells and cloned in Uni-ZAP XR Vector (Stratagene)
was screened with DDRT-PCR clone G3V16. The probe
was labeled with [a2 32P] dATP by the random priming
(Life Technologies), and hybridization was performed as
described for Northern blots. A total of 1 3 10 6 phage
plaques were screened using G3V16 cDNA, and a single
positive clone was identified. By sequence analysis, the
clone identified by G3V16 probe was found to contain a
full-length coding sequence.
ACKNOWLEDGMENTS
This research was supported by the National Pork and Producers
Council (M.S.R), the Minnesota Pork Producers Association (T.W.M), the
U.S.D.A. grant 95–3205-3846 (L.B.S.), and the University of Minnesota
Agricultural Experiment Station (M.S.R.). The authors thank Drs. M. P.
Murtaugh and K. S. Faaberg for supplying the PRRSV VR2332 strain,
ORF7 PCR primers, and CL2621 cell culture, and Dr. C. W. Beattie for
porcine cDNA library. The authors further acknowledge Dr. J. E. Collins
for assistance with experimental design, and Drs. A. Bhattacharjee and
A. Rink for technical advice on the DDRT-PCR assays and cDNA library
screening.
161
REFERENCES
Aebi, M., Fah, J., Hurt, N., Samuel, C. E., Thomis, D., Bazzigher, L.,
Pavlovic, J., Haller, O., and Staeheli, P. (1989). cDNA structures and
regulation of two interferon-induced human Mx proteins. Mol. Cell.
Biol. 9, 5062–5072.
Albina, E., Piriou, L., Hutet, E., Cariolet, R., and L’Hospitalier, R. (1998).
Immune responses in pigs infected with porcine reproductive and
respiratory syndrome virus (PRRSV). Vet. Immunol. Immunopathol. 61,
49–66.
Baca, L. M., Genis, P., Kalvakolanu, D., Sen, G., Meltzer, M. S., Zhou, A.,
Silvermann, R., and Gendelman, H. E. (1994). Regulation of interferona-inducible cellular genes in human immunodeficiency virus-infected monocytes. J. Leukoc. Biol. 55, 299–309.
Bhattacharjee, A., Lappi, V. R., Rutherford, M. S., and Schook, L. B.
(1998). Molecular dissection of dimethylnitrosamine (DMN)-induced
hepatotoxicity by mRNA differential display. Toxicol. Appl. Pharmacol.
150, 186–195.
Bhattacharjee, A., Rutherford, M. S., Abrahamsen, M. S., Lappi, V. R.,
and Schook, L. B. (1997). Refinements in re-amplification and cloning
of DDRT-PCR products. BioTechniques 22, 1048–1051.
Boudinot, P., Massin, P., Blanco, M., Riffault, S., and Benmansour, A.
(1999). vig-1, a new fish gene induced by the Rhabdovirus glycoprotein, has a virus-induced homologue in humans and shares conserved motifs with the MoaA family. J. Virol. 73, 1846–1852.
Buddaert, W., van Reeth, K., and Pensaert, M. (1998). In vivo and in vitro
interferon (IFN) studies with the porcine reproductive and respiratory
syndrome virus (PRRSV). Adv. Exp. Med. Biol. 440, 461–467.
Cavanagh, D. (1997). Nidovirales: a new order comprising coronaviridae and arteriviridae. Arch. Virol. 142, 629–633.
Collins, J. E., Benfield, D. A., Christianson, W. T., Harris, L., ChristopherHennings, J., Shaw, D. P., Goyal, S. M., McCullough, S., Morrison,
R. B., Joo, H. S., Gorcyca, D., and Chladek, D. (1992). Isolation of
swine infertility and respiratory syndrome virus (isolate ATCC VR2332) in North America and experimental reproduction of disease in
gnotobiotic pigs. J. Vet. Diagn. Invest. 4, 117–126.
Conzelmann, K. K., Visser, N., Van Woensel, P., and Thiel, H. J. (1993).
Molecular characterization of porcine reproductive and respiratory
syndrome virus, a member of the arterivirus group. Virology 193,
329–339.
Done, S. H., and Paton, D. J. (1995). Porcine reproductive and respiratory syndrome: clinical disease, pathology and immunosuppression.
Vet. Rec. 136, 32–35.
Duan X., Nauwynck, H. J., and Pensaert, M. B. (1997). Effects of origin
and state of differentiation and activation of monocytes/macrophages on their susceptibility to porcine reproductive and respiratory
syndrome virus (PRRSV). Arch. Virol. 142, 2483–2497.
Foss, D. L., Baarsch, M. J., and Murtaugh, M. P. (1998). Regulation of
hypoxanthine phosphoribosyl transferase, glyceraldehyde-3-phosphate dehydrogenase and b actin mRNA expression in porcine
immune cells and tissues. Anim. BioTechnol. 9, 67–78.
Goldberg, A. L. (1995). Functions of the proteasome: the lysis at the end
of the tunnel. Science 268, 522–523.
Halbur, P. G., Rothschild, M. F., Thacker, B. J., Meng, X.-J., Paul, P. S. and
Bruna, J. D. (1998). Differences in susceptibility of Duroc, Hampshire,
and Meishan pigs to infection with a high virulence strain (VR2385)
of porcine reproductive and respiratory syndrome virus (PRRSV). J.
Anim. Breed. Genet. 115, 181–189.
Hochstrasser, M. (1995). Ubiquitin, proteasomes, and the regulation of
intracellular protein degradation. Cur. Opinion Cell Biol. 7, 215–223.
Horisberger, M. A. (1995). Interferons, Mx genes, and resistance to
influenza virus. Am. J. Respir. Crit. Care Med. 152, S67–S71.
Horisberger, M. A., and Gunst, M. C. (1991). Interferon-induced proteins:
identification of Mx proteins in various mammalian species. Virology
180, 185–190.
Hsiang, C.-Y., Ho, T.-Y., Lin, C.-H., Wu, K., and Chang, T.-J. (1996).
162
ZHANG ET AL.
Analysis of upregulated cellular genes in pseudorabies virus infection: use of mRNA differential display. J. Virol. Methods 62, 11–19.
Kobayashi, H., Morozumi, T., Miyamoto, C., Shimizu, M., Yamada, S.,
Ohashi, S., Kubo, M., Kimura, K., Mitani, K., Ito, N., and Yamamoto, K.
(1996). Mycoplasma hyorhinis infection levels in lungs of piglets with
porcine reproductive and respiratory syndrome (PRRS). J. Vet. Med.
Sci. 58, 109–113.
Krug, R. M., Shaw, M., Broni, B., Shapiro, G., and Haller, O. (1985).
Inhibition of influenza viral mRNA synthesis in cells expressing the
interferon-induced Mx gene product. J. Virol. 56, 201–206.
Lee, J.-K., Schook, L. B. and Rutherford, M.S. (1996). Molecular cloning
and characterization of the porcine CD18 leukocyte adhesion molecule. Xenotransplantation 3, 222–230.
Liang, P., and Pardee, A. B. (1992). Differential display of eukaryotic
messenger RNA by means of the polymerase chain reaction. Science 257, 967–971.
Lindenmann, J. (1964). Inheritance of resistance to influenza virus in
mice. Proc. Soc. Exp. Biol. Med. 116, 506–509.
Meulenberg, J. J. M., and Petersen-den Besten, A. (1996). Identification
and characterization of a sixth structural protein of Lelystad virus: the
glycoprotein GP2 encoded by ORF2 is incorporated in virus particles.
Virology 225, 44–51.
Meulenberg, J. J. M., Petersen-den Besten, A., de Kluyve, E. P., Moormann, R. J. M., Schaaper, W. M. M., and Wensvoort, G. (1995).
Characterization of proteins encoded by ORFs 2 to 7 of Lelystad
virus. Virology 206, 155–163.
Molitor, T. W., Xiao, J., and Choi, C. S. (1996). PRRS virus infection of
macrophages: regulation by matuation and activation state. Proc.
Annu. Meet. Am. Assoc. Swine Pract. 27, 563–569.
Pagano, M. (1997). Cell cycle regulation by the ubiquitin pathway.
FASEB J. 11, 1067–1075.
Pickart, C. M. (1997). Targeting of substrates to the 26 S proteasome.
FASEB J. 11, 1055–1066.
Plana, D. J., Vayreda, M., Vilarrasa, J., Bastons, M., Porquet, L., and
Urniza, A. (1992). PEARS (mystery swine disease)- summary of the
work conducted by our group. Am. Assoc. Swine Pract. News 4,
16–18.
Rock, K. L., Gramm, C., Rothstein, L., Clark, K., Stein, R., Dick, L., Hwang,
D., and Goldberg, A. L. (1994). Inhibitors of the proteasome block the
degradation of most cell proteins and the generation of peptides
presented on MHC class I molecules. Cell 78, 761–771.
Rossow, K. D. (1998). Porcine reproductive and respiratory syndrome.
Vet. Pathol. 35, 1–20.
Rutherford, M. S., Witsell, A. L., and Schook, L. B. (1993). Mechanisms
generating macrophage functionally heterogeneous macrophages:
chaos revisited. J. Leukoc. Biol. 53, 602–618.
Segalés, J., Domingo, M., Balasch, M., Solano, G. I., and Pijoan, C.
(1998). Ultrastructural study of porcine alveolar macrophages infected in vitro with porcine reproductive and respiratory syndrome
(PRRS) virus, with and without Haemophilus parasuis. J. Comp.
Pathol. 118, 231–243.
Solano, G. I., Bautista, E., Molitor, T. W., Segales, J., and Pijoan, C.
(1998). Effect of porcine reproductive and respiratory virus infection
on the clearance of Haemophilus parasuis by porcine alveolar macrophages. Can. J. Vet. Res. 62, 251–256.
Sorbara, L. R., Maldarelli, F., Chamoun, G., Schilling, B., Chokekij-
cahi, S., Staudt, L., Mitsuya, H., Simpson, I. A., and Zeichner, S. L.
(1996). Human immunodeficiency virus type I infection of H9 cells
induces increased glucose transporter expression. J. Virol. 70,
7275–7279.
Staeheli, P. (1990). Interferon-induced proteins and the antiviral state.
Adv. Virus Res. 38, 147–200.
Suárez, P., Dı́az-Guerra, M., Prieto, C., Esteban, M., Castro, J. M., Nieto,
A., and Ortin, J. (1996). Open reading frame 5 of porcine reproductive
and respiratory syndrome virus as a cause of virus-induced apoptosis. J. Virol. 70, 2876–2882.
Tal-Singer, R., Podrzucki, W., Lasner, T. M., Skokotas, A., Leary, J. J.,
Fraser, N. W., and Berger, S. L. (1998). Use of differential display
reverse transcription-PCR to reveal cellular changes during stimuli
that result in herpes simplex virus type I reactivation from latency:
upregulation of immediate-early cellular response genes TIS7, interferon, and interferon regulatory factor-1. J. Virol. 72, 1252–1261.
Thanawongnuwech, R., Thacker, E. L., and Halbur, P. G. (1997). Effect of
porcine reproductive and respiratory syndrome virus (PRRSV) (isolate ATCC VR-2385) infection on bactericidal activity of porcine pulmonary intravascular Mø (PIMs): in vitro comparisons with pulmonary alveolar macrophages (PAMs). Vet. Immunol. Immunopathol. 59,
323–335.
Trebichavsky, I., and Valicek, L. (1998). Immunoreactivity of interleukin-8
and absence of interferon-alpha in porcine bronchoalveolar lavage
cells infected with PRRS virus. Vet. Medicina 43, 7–10.
Treier, M., Staszewski, L. M., and Bohmann, D. (1994). Ubiquitin-dependent c-Jun degradation in vivo is mediated by the d domain. Cell 78,
787–798.
van Nieuwstadt, A. P., Meulenberg, J. J. M., van Essen-Zandbergen, A.,
Petersen-den Besten, A., Bende, R. J., Moormann, R. J. M., and
Wensvoort, G. (1996). Proteins encoded by open reading frames 3
and 4 of the genome of Lelystad virus (Arteriviridae) are structural
proteins of the virion. J. Virol. 70, 4767–4772.
Wensvoort, G., Terpstra, C., Pol, J. M. A., ter Lack, E. A., Bloemaraad, M.,
de Kluyver, E. P., Kragten, C., van Buiten, L., den Besten, A., Wagenaar, F., Bröekhuijsen, J. M., Moonen, P. L. J. M., Zetstra, T., de Boer,
E. A., Tibben, H. J., de Jong, M. F., van’t Veld, P., Groenland, G. J. R., van
Gennep, J. A., Voets, M. T. H., Verheijden, J. H. M., and Braamskamp,
J. (1991). Mystery swine disease in the Netherlands: the isolation of
Lelystad virus. Vet. Q. 13, 121–130.
Wilkinson, K. D. (1997). Regulation of ubiquitin-dependent processes by
deubiquitinating enzymes. FASEB J. 11, 1245–1256.
Yamagishi, H., Garg, V., Matsuoka, R., Thomas, T., and Srivastava, D.
(1999). A molecular pathway revealing a genetic basis for human
cardiac and craniofacial defects. Science 283, 1158–1161.
Zhang, X., and Rutherford, M. S. (1997). Gene expression in PRRSVinfected alveolar Mø, In Proc. 78th Conference of Research Workers
Animal Disease 1997. Chicago, IL. pp. 94.
Zhu, H., Cong, J.-P., and Shenk, T. (1997). Use of differential display
analysis to assess the effect of human cytomegalovirus infection on
the accumulation of cellular RNAs: induction of interferon-responsive
RNAs. Proc. Natl. Acad. Sci. USA 94, 13985–13990.
Zhu, Y., Carroll, M., Papa, F. R., Hochstrasser, M., and D’Andrea, A. D.
(1996). DUB-1, a deubiquitinating enzyme with growth-suppressing
activity. Proc. Natl. Acad. Sci. USA 93, 3275–3279.