Beta-adrenergic Receptor Gene Expression in Bovine
Skeletal Muscle Cells in Culture1
Kristin Y. Bridge*,2, Charles K. Smith, II†, and Ronald B. Young*,2
*Department of Biological Sciences, University of Alabama, Huntsville 35899
and †Lilly Research Laboratories, Greenfield, IN 46140
ABSTRACT:
Beta-adrenergic receptors ( bAR) are
abundant in fetal, neonatal, and adult skeletal muscles of cattle; however, only minimal levels of functional bAR were detected in multinucleated muscle
cell cultures prepared from 90- to 150-d fetal bovine
skeletal muscle. Two other lines of evidence were
consistent with low levels of bAR expression in bovine
muscle cultures. First, treating the cells with 10−6 M
isoproterenol for up to 20 min did not increase
intracellular cAMP concentration. Second, neither the
quantity of myosin heavy chain (MHC) nor its
apparent synthesis rate were changed by treating the
cells for 4 d with 10−7 or 10−6 M isoproterenol. Despite
these results, the mRNA for the b2AR could be
detected in muscle cultures by PCR and on slot blots.
Thus, the b2AR mRNA was expressed, but significant
levels of functional receptors could not be detected.
Glucocorticoids are known to activate expression of
bAR genes in several tissues, and the effect of
dexamethasone on bAR gene expression in bovine
multinucleated muscle cell cultures was evaluated.
The intracellular concentration of cAMP following
treatment with isoproterenol was elevated 10-fold by
dexamethasone, and the population of functional
receptors was elevated by approximately 50%. The
effect of dexamethasone on muscle protein synthesis
and accumulation was analyzed after pretreating the
cells with dexamethasone for 24 h, followed by
treatment with dexamethasone and 10−6 M
isoproterenol for an additional 48 h. The quantity of
MHC synthesized and the apparent synthesis rate of
MHC were stimulated by 10 to 35%. These effects
seem to be due to posttranscriptional events, because
the quantity of b2AR receptor mRNA on slot blots was
not increased by treatment with dexamethasone.
Results of this study emphasize the importance of
verifying that muscle cells contain functional bAR
when they are used to study the effects of bAR
agonists on muscle protein metabolism.
Key Words: Cattle, Muscles, Cell Cultures, b-Adrenergic Receptors
1998 American Society of Animal Science. All rights reserved.
Introduction
Two major classes of adrenergic receptor proteins,
designated a and b are present in cell membranes, and
each has several subtypes (i.e., a-1, a-2, b-1, b-2, and
b-3). These b-adrenergic receptors ( bAR) are categorized both on their distinct physiological actions and
on the basis of their pharmacological properties
(Strosberg, 1990). b-Adrenergic receptors are
1This work was supported in part by grants from Lilly Research
Laboratories and from the National Institutes of Health. The
authors are especially appreciative for the excellent technical
assistance provided by Dave Lee and Kenny Webster.
2Present address and to whom correspondence should be
addressed: NASA, Marshall Space Flight Center, ES 76, Building
4481, Huntsville, AL 35812; phone: 256/544-2421; E-mail:
[email protected].
Received November 21, 1997.
Accepted May 21, 1998.
J. Anim. Sci. 1998. 76:2382–2391
64-kDa proteins spanning the plasma membrane, and
extracellular signals are converted into intracellular
second messengers via GTP-binding regulatory proteins (or G proteins) and a membrane-bound enzyme
adenylate cyclase (Mersmann, 1998).
Several phenethanolamine bAR agonists, including
cimaterol, clenbuterol, isoproterenol, and ractopamine,
stimulate skeletal muscle hypertrophy in animals
(reviewed by Mersmann, 1995). Some of these
agonists have also been reported to influence protein
metabolism in multinucleated muscle cells in culture
(Anderson et al., 1990; Bechet et al., 1990; Grant et
al., 1990; Harper et al., 1990; Ji and Orcutt, 1991;
McMillan et al., 1992; Young et al., 1990); however,
the effects of bAR agonists have been variable and
have not been reproducible. Even though bAR are
thought to be the receptor type through which
phenethanolamines exert their actions on muscle cells,
limited efforts have been devoted to analyzing bAR
populations. If cultured muscle cells are to be used
2382
BETA-ADRENERGIC RECEPTOR IN BOVINE MUSCLE CULTURES
successfully as an in vitro model for studying the
effects of bAR agonists on muscle protein metabolism
in animals of agricultural significance, the presence of
receptors and their link to downstream signaling
events must be verified. Therefore, the goals of this
study were to analyze the b2AR population on skeletal
muscle cells in vitro and to determine the extent to
which expression of this gene could be regulated in
multinucleated muscle cell cultures. A preliminary
report of this work has appeared (Bridge et al., 1994).
Materials and Methods
Bovine Muscle Cell Cultures. Approximately
120-d fetuses (determined by crown-to-rump length)
were obtained from freshly slaughtered cows at
Tennessee Dressed Beef in Nashville. Skeletal muscle
tissue that contains a mixture of muscles was excised
from the thigh and placed in ice-cold culture medium
for transport back to the laboratory. The culture
medium consisted of Dulbecco’s Modified Eagle’s
Medium ( DMEM) with L-glutamine and 1,000 mg
glucose/L (catalog #D5523, Sigma Chemical Co., St.
Louis, MO), sodium bicarbonate buffer (3.7 g/L), and
13% selected donor herd horse serum (Gibco BRL Life
Technologies, Grand Island, NY). Fungizone (250 mg/
L; Gibco BRL), penicillin (100,000 U/L), and gentamicin (20 mg/mL) were also added, and the pH was
adjusted to 6.8.
The procedure for isolating bovine muscle cells was
a modification of the procedure for mouse satellite
cells detailed by Young et al. (1978). Working under
sterile conditions, the bovine muscle tissue was placed
in warm PBS, and blood vessels and connective tissue
were removed. After rinsing the tissue two additional
times in PBS, it was placed in a food processor (Black
and Decker, Model F1-CFP-10) and minced on high
speed for three brief periods of approximately 15 s
each. The muscle tissue was then placed in
50-mL conical tubes at approximately 10 g/tube, and
25 mL of a 2-mg/mL pronase enzyme solution in PBS
(Sigma Chemical) was added. The digestion procedure was carried out at 37°C in a rotary shaker at 175
rpm, and approximately 45 min was required for the
tissue to digest. The suspension was centrifuged at
1,500 × g for 6 min, the protease solution was
discarded, and myoblasts were harvested from the
pellet by differential centrifugation. Briefly, PBS was
added to the pellet to give a final volume of 30 mL,
and the pellet was resuspended on a vortex mixer at
top speed for 30 s. The suspension was centrifuged at
400 × g for 3 min, and the supernatants were collected
and saved. These steps were repeated two more times
with the digested muscle pellet, and all supernatants
were combined and strained through six layers of
sterile cheesecloth to remove any clumps of tissue. The
filtrate was then centrifuged at 1,500 × g for 6 min to
2383
collect the myoblasts. Cells were resuspended in
normal culture medium containing 87% DMEM, 13%
horse serum, penicillin, gentamicin, and fungizone,
and the number of cells was counted with a
hemocytometer. The cell suspension was diluted with
the above media to a final concentration of 1 × 106
cells/mL. Depending on the experiment, the cells were
then plated in collagen-coated, 6-, 10-, or 15-cm tissue
culture dishes at a density of 1.8 × 105 cells/cm2.
Under these culture conditions, myoblast fusion into
multinucleated muscle cells typically began by d 2 in
culture and reached a maximum by d 5 to 6. On the
day fusion was first observed, the medium was
replaced with DMEM as described previously, but
containing 10% horse serum and 2% chick embryo
extract. At this time, 10−6 M fluorodeoxyuridine
( FdU) was also added to inhibit DNA synthesis and
thus prevent overgrowth by fibroblasts. When cultures
were stained with Giemsa and the number of fused
and nonfused nuclei were enumerated by light
microscopy at 400× (Young and Schneible, 1984), 60
to 80% of the nuclei were observed to be within
multinucleated muscle cells. Cultures were maintained in a 98% air:2% CO2 environment, and culture
medium was replenished daily.
Because fibroblasts are always present in primary
muscle cell cultures, all measurements made in this
study on mixed cultures were repeated using purified
cultures of fibroblasts. Fibroblast cultures were prepared by treating multinucleated muscle cultures with
trypsin after approximately 7 d (i.e., after fusion was
at a maximum). Trypsin (.05% in PBS) was placed on
the cell cultures until the multinucleated muscle cells
began to detach from the plates (usually 1 to 2 min).
Detached cells were removed from the plates, horse
serum was added at a final concentration of 3%, and
the cells were centrifuged out of the trypsin-containing
solution at 1,500 × g for 5 min. Fibroblasts were plated
and again allowed to proliferate until they were
confluent, at which time a small number of multinucleated muscle cells usually formed again. This
trypsinization process was repeated two additional
times to ensure pure fibroblast cultures. Fibroblast
cultures were judged to be pure when no multinucleated muscle cells were observed in cultures that
had been confluent for at least 1 wk. The fibroblasts
were maintained on myoblast fusion media (without
FdU), and the medium was replenished daily.
Quantification of Myosin Heavy Chain Protein. On
the day fusion was first observed (usually d 2 to 3),
various treatments were initiated as described in
Results. Six replicate culture dishes were normally
utilized for each treatment. On d 7 or 8, culture media
containing 20 mCi/mL [3H]Leu (DuPont, Wilmington,
DE) was added. The cultures were pulse-labeled for 4
h, at which time the medium was quickly removed and
replaced with cold PBS.
2384
BRIDGE ET AL.
Myofibrillar proteins were collected by scraping the
cells from the dishes with a plastic spatula into a
solution containing .30 M NaCl, .02 M Tris·HCl, pH
7.4. Samples were homogenized 20 times in a tightly
fitting 7-mL Dounce homogenizer to lyse the cells, and
the lysates were centrifuged at 12,000 × g for 20 min
to pellet the cellular membranes and organelles. The
supernatants were diluted 10-fold in cold deionized
water and placed at 2°C overnight to allow aggregation of the myofibrillar proteins. The myofibrillar
proteins were collected by centrifugation at 3,000 × g
for 45 min, and the pellets were solubilized in a
detergent-containing solution for polyacrylamide gel
electrophoresis in the presence of sodium dodecyl
sulfate (SDS). The detergent-containing solution contained 1.0% SDS, .05 M Tris·HCl, pH 7.1, .5% bmercaptoethanol, 20% glycerol, and .01% pyronin Y.
After resuspension of the pellets, the solution was
heated at 80°C for 20 min. Electrophoresis was carried
out on N,N′-diallyltartardiamide ( DATD) crosslinked polyacrylamide gels (final concentration 10%
acrylamide and 0.1% DATD). The quantity of myosin
heavy chain and its apparent synthesis rate were
estimated from these gels as described by Young et al.
(1980). Statistical analyses were carried out using
Student’s t-test, and significance at the .05 level is
indicated at appropriate places in the text.
Membrane Preparations. Skeletal muscle tissue was
collected from 90-d fetuses, 120-d fetuses, and adult
cows. The semimembranosus muscle from the adult
animals and thigh muscle tissue from the fetuses were
immediately frozen in liquid nitrogen. Frozen muscle
was placed in .25 M sucrose, 1.0 mM EDTA, 10 mM
Tris·HCl, pH 7.4, and 1 mM phenylmethylsulfonyl
fluoride ( PMSF) , homogenized with a polytron at a
setting of 6 for 30 s, and centrifuged at 3,500 × g for 10
min. The supernatant was poured through two layers
of cheesecloth and centrifuged at 100,000 × g for 60
min. The pellet was resuspended in 20 mM Tris·HCl,
pH 7.4, .9% NaCl, 1 mM PMSF, and 1 mg/mL aprotinin
and was centrifuged at 100,000 × g for 60 min. The
pellet was resuspended in the same buffer, and protein
concentration was determined with the Bradford assay
(BioRad, Richmond, CA).
Membrane preparations from muscle cell cultures
and fibroblast cultures were obtained by scraping the
cells into a hypotonic solution for lysis ( 1 mM HEPES,
pH 7.4, 2 mM EDTA, and 1 mM PMSF) and
centrifuging at 24,000 × g for 20 min. The pellet was
then resuspended in 20 mM Tris·HCl, pH 7.4, .9%
NaCl, 1 mM PMSF, and homogenized 10 times with a
loosely fitting 15-mL Dounce homogenizer. Membranes were isolated as described above for skeletal
muscle.
Receptor Binding Analysis. The Kd of the radioligand [125I]iodopindolol ( IPIN, a nonselective badrenergic antagonist) was determined in triplicate
by saturation-binding analysis for the bAR of the
bovine skeletal muscle crude membrane preparations.
Nonspecific binding was determined with an identical
set of tubes containing 100 nM ( −)propranolol, a
potent b-antagonist. The IPIN was evaluated at 11
concentrations (80 to 520 pM) . All tubes were
incubated for 30 min at 30°C, and incubations were
stopped with addition of .9% NaCl, 10 mM Tris·HCl,
pH 7.4. Samples were filtered through Whatman GF/B
glass fiber filters and washed with 10 mL of .9% NaCl,
10 mM Tris·HCl, pH 7.4. Radioactivity retained on the
filters was determined in an ICN 10/600 Plus gamma
counter with an efficiency of 82% for 125I. To
determine the Kd and Bmax, estimates were obtained
by Scatchard transformation of the total bound and
nonspecific binding data from the saturation analysis
using the EBDA computer program (McPherson,
1983). The least squares nonlinear curve fitting
technique of the LIGAND computer program was then
used for final values (Munson and Rodbard, 1980).
Cyclic AMP Determinations. Primary bovine muscle
cell cultures and fibroblast cultures were washed with
PBS, and then pretreated for 30 min at 37°C with
serum-free media containing 1 mM theophylline to
inhibit phosphodiesterase enzyme activity and 1 mM
ascorbic acid (an antioxidant). Following incubation,
the medium was removed and replaced with medium
containing 1 mM theophylline, 1 mM ascorbic acid,
and 1 mM of the nonselective b-adrenergic agonist
( −)isoproterenol. Cultures were incubated at 37°C for
up to 20 min, after which the treatment media was
removed as rapidly as possible, and the cultures were
treated with ice-cold 10% trichloroacetic acid ( TCA) .
Propranolol was included in excess in some cultures to
block activity of the isoproterenol and establish a
baseline of cAMP concentration. Multinucleated muscle cells from the L6 rat skeletal muscle cell line were
used as a positive control. These cells were grown in
the same culture media as the bovine muscle cells and
received FdU for 2 d preceding the experiments. These
L6 multinucleated muscle cells exhibit large increases
in cAMP concentration in response to treatment with
( −)isoproterenol. The cellular suspension was transferred to a chilled glass centrifuge tube, and cAMP
was isolated by filtration through SEP PAK C18
cartridge (Waters Associates, Milford, MA) as follows.
The cartridge was first washed with .1% triflouracetic
acid ( TFA) solution, charged with 50% acetonitrile,
.05% TFA solution, and washed again with .1% TFA.
The sample was pumped through the cartridge, and
cAMP was eluted with 5% acetonitrile. The sample
was then concentrated with a Speed-Vac Concentrator
(Savant Instruments, Farmingdale, NY), and the
cAMP concentration was determined with a RIA
(RIANEN, Du Pont, Wilmington, DE).
Dexamethasone Treatments. Bovine skeletal muscle
cultures were grown as described earlier for the first 6
d of culture. Cells were treated on d 6 with 250 nM
dexamethasone (Sigma Chemical), and all cells were
BETA-ADRENERGIC RECEPTOR IN BOVINE MUSCLE CULTURES
harvested on d 8 for analysis of cAMP induction and
receptor population.
RNA Isolation and Polymerase Chain Reaction.
Cultured cells were scraped into a denaturing solution
containing 4 M guanidine thiocyanate ( ∼1 mL/107
cells) and were transferred to a polypropylene tube for
storage at −70°C. The RNA was then isolated as
described by Chomczynski and Sacchi (1987). The
RNA pellet was dissolved in diethylpyrocarbonate
( DEPC)-treated water and treated with deoxyribonuclease.
The cDNA was produced from DNase-treated RNA
by reverse transcription. Random hexamers were
added to DNase-treated RNA, all samples were heated
at 65°C for 10 min, and samples were placed on ice to
prevent reannealing. A reaction mixture containing 1
mM dNTP and .01 M dithiothreitol was added to each
sample and incubated at 37°C for 2 min. Superscript
Reverse Transcriptase (200 units/mg total RNA; Gibco
BRL) was added to each reaction, and all reactions
were incubated at 40°C for 90 min.
Bovine b1AR and b2AR DNA fragments were
obtained by using oligonucleotide PCR primers
designed from the published sequence of the membrane-spanning regions of human b1AR and b2AR
gene sequences. The first primer was from a region
of highly conserved sequence in the b1AR and
b2AR genes such that a common primer could be used
for both of these genes. The other primer for
each gene was unique so that fragments of different
sizes could be generated. The reverse and forward,
respectively, primer sequences for the b2AR gene
were AAGAATTCAAGAAGGGCA[AG]CCAGCAGAG[ACGT]GTGAA (nucleotides 3,095 to 3,128; Buckland
et al., 1990) and AGGCAGCTCCAGAAGATTGACAAATCTGAGGGC (nucleotides 2,933 to 2,965; Buckland
et al., 1990). The reverse and forward, respectively,
primer sequences for the b1AR gene were AAGAATTCAAGAAGGGCA[AG]CCAGCAGAG[ACGT]GTGAA
(nucleotides 2,220 to 2,253; Shimnomura and Terada,
1990) and AAGCAGGTGAAGAAGATCGACAGCTGCGAGCGC (nucleotides 2,023 to 2,045; Shimomura and
Terada, 1990). The PCR was carried out with these
primers and bovine genomic DNA as a template. The
amplified PCR fragments were cloned into the Sma I
site of pUC 18 and sequenced using universal
sequencing primers. The amplified DNA sequences
were 243 bp in length for the b1AR fragment and 196
bp for the b2AR fragment, and they were ∼86%
homologous to human and rat b1AR and b2AR. These
primers were then used to analyze muscle cell cultures
for the presence of b1AR and b2AR mRNA using
reverse transcriptase PCR. The PCR reaction conditions included 32 cycles consisting of 45 s at 95°C, 30 s
at 65°C, and 20 s at 72°C. Positive controls (skeletal
muscle RNA or cardiac muscle RNA) and negative
controls were included in each experiment. Control
2385
samples were also included in which the RNA was
treated with ribonuclease to ensure that the RNA
preparations were not contaminated with chromosomal DNA.
Slot blots containing equal amounts of total RNA
from muscle cell cultures and skeletal muscle tissue
were hybridized against the 32P-labeled b1AR and
b2AR probes. Blots were rinsed three times at room
temperature for 10 min each in 2× SSC containing .1%
SDS, two times at 60°C for 10 min each in 1× SSC
containing .1% SDS, and two times at 60°C for 10 min
each in .1× SSC containing .1% SDS. Composition of
SSC is .15 M NaCl and .015 M trisodium citrate.
Following autoradiography, x-ray films were scanned
with a laser densitometer. The b1AR and b2AR probes
were highly specific for their respective mRNA as
evidenced by the fact that the probe for the b2AR
sequence gave a positive signal in RNA isolated from
adult skeletal muscle tissue, but not in RNA isolated
from cardiac muscle. Conversely, the probe for the
b1AR sequence gave a positive signal in RNA isolated
from cardiac muscle but not in RNA from skeletal
muscle.
The normalization technique of Hollander and
Fornace (1990) was used to ensure that hybridization
to equal quantities of cellular mRNA was compared on
each slot. This technique employs hybridization of
RNA attached to the slot blot to an excess of
35S-labeled poly(T) such that the poly(A) portion of
mRNA is saturated with poly(T). Bands were then
cut from the blot, and the quantity of 35S was
measured by liquid scintillation spectrometry.
Results
Are β-Adrenergic Receptors Expressed in Bovine
Muscle Cell Cultures? Bovine myoblasts differentiated
into functional, spontaneously contracting multinucleated muscle cells after approximately 1-wk in
culture, with 60 to 80% of the nuclei within multinucleated cells. When the myofibrillar protein fraction was isolated from these cells and subjected to
electrophoresis under denaturing conditions, a prominent band identical in molecular weight to myosin
heavy chain (MHC) was always apparent (Figure 1).
The bAR were plentiful in fetal and adult skeletal
muscle tissues (Figure 2A−C). The Kd values for
90-d fetal, 120-d fetal, and adult skeletal muscles were
2.8 × 10−10, 1.0 × 10−10, and 1.0 × 10−10 M,
respectively. The Bmax values for 90-d fetal,
120-d fetal, and adult skeletal muscles were 58, 37,
and 75 fmol/mg of protein, respectively. However,
minimal levels of bAR were detected in multinucleated
muscle cell cultures prepared from fetal skeletal
muscle, as evidenced by the observation that total
binding curves and nonspecific binding curves were
not significantly separated from each other in muscle
2386
BRIDGE ET AL.
Figure 1. Electrophoretic analysis of the myofibrillar
protein fraction in bovine multinucleated muscle cells
after 10 d in culture. The protein in each lane represents
approximately 25% of the myofibrillar protein fraction
isolated from a single 6-cm tissue culture dish. The
protein samples in the four lanes were isolated from
four replicate 6-cm culture dishes. Electrophoresis under
denaturing conditions was carried out as described in
Materials and Methods, with the exception that polyacrylamide slab gels were used instead of disc gels. The
arrow indicates the position of myosin heavy chain.
cell cultures (Figure 2D). Nonspecific binding was
typically 80 to 85% of total binding. Bovine fibroblasts
also exhibited minimal separation between total
binding and nonspecific binding (not shown). As an
independent approach to analyzing bAR expression,
multinucleated muscle cultures were treated with the
potent bAR agonist isoproterenol. Short-term exposure
to isoproterenol for up to 20 min did not stimulate the
production of cAMP by bovine muscle cells, also
indicating that these cultured cells did not have a
significant population of functional bAR (Figure 3).
Bovine fibroblasts did not contain significant quantities of cAMP under these conditions (Figure 3).
Chronic exposure of multinucleated muscle cultures to
isoproterenol for 4 d did not have a significant effect
on MHC content or apparent synthesis rate (Table 1),
which is consistent with the absence of evidence for
functional bAR in Figures 2 and 3.
Despite these results, the mRNA for the b2AR was
detectable by PCR and by slot blot analysis (Figure
4). However, b2AR mRNA seems to be translated at
levels that are too low to lead to significant synthesis
of functional bAR (Figures 2 and 3). In addition, only
the b2AR mRNA was expressed in muscle cultures; the
b1AR mRNA was not expressed either in adult
skeletal muscle or multinucleated muscle cell cultures.
Can β-Adrenergic Receptor Expression be UpRegulated by Glucocorticoid Treatment? The catabolic
effect of treating multinucleated muscle cell cultures
with dexamethasone is apparent from the immediate
sixfold decline in b2AR mRNA level (Figure 5). This
decrease was followed by a gradual increase back to
the approximate original level by 48 h after dexamethasone administration. Especially noteworthy is
the observation that the level of b2AR mRNA after 48
h was approximately the same as the control level at 0
time.
When dexamethasone-treated muscle cells were
analyzed for their bAR population, a greater separation was observed between total binding and nonspecific binding than in controls (compare Figure 6
with Figure 2D). This implies that dexamethasone
leads to an increase in the population of bAR in bovine
muscle cell cultures. Analysis of specific binding from
a large number of experiments was summarized, and,
as shown in Figure 7, the level of specific binding for
bAR is significantly higher ( P < .05) in the dexamethasone-treated cells than in the control cultures.
These data show that dexamethasone treatment leads
to an increase in the population of functional bAR in
muscle cells; however, this increase occurs in the
absence of an increase in the quantity of bAR mRNA
(compare 0 and 48 h time points in Figure 5).
Cyclic AMP production in response to treatment
with 250 nM dexamethasone for 48 h was also
Figure 2. Analysis of bovine skeletal muscle tissue
and muscle cell cultures for b-adrenergic receptor
population. Total binding (ÿ) and nonspecific binding
(o) for saturation binding analysis of [125I]iodopindolol
(IPIN) to the following tissues. (A) adult skeletal muscle,
(B) 90-d fetal skeletal muscle, (C) 120-d fetal skeletal
muscle, and (D) 8-d muscle cells in culture.
BETA-ADRENERGIC RECEPTOR IN BOVINE MUSCLE CULTURES
2387
Protein metabolism experiments indicated that the
quantity of MHC was depressed 25 to 40% by
dexamethasone treatment alone (Figure 9, open
bars); however, the presence of isoproterenol, in
addition to 250 and 2,500 nM dexamethasone, led to
consistent increases of 15 to 35% in MHC quantity
(compare filled bars to open bars at each concentration of dexamethasone). Similarly, the apparent
synthesis rate of MHC was depressed 25 to 40% by
dexamethasone treatment (Figure 10, open bars), but
the presence of isoproterenol in addition to 250 and
Figure 3. Effect of isoproterenol on cyclic AMP
(cAMP) induction in bovine fibroblasts and multinucleated muscle cells (i.e., myotubes) in culture. Cells
were exposed to 10−6 M isoproterenol, and the cAMP
concentration was determined as a function of time. The
different cell types from top to bottom are as follows.
Rat L6-derived multinucleated muscle cells (ÿ). These
cells have an abundant population of b-adrenergic
receptors and serve as a positive control in all experiments; bovine muscle cells after 7 d in culture (⁄); and
confluent bovine fibroblasts (π).
evaluated (Figure 8). The fact that cAMP production
is enhanced is also consistent with the conclusion that
dexamethasone leads to an increase in functional
receptors in bovine muscle cells in culture. By
comparison with L6 multinucleated muscle cells, the
magnitude of up-regulation is still relatively low, but
it is greater than in the absence of dexamethasone.
Table 1. Effect of 10−6 M and 10−7 M isoproterenol
on the quantity of myosin heavy chain (MHC)
and the apparent synthesis rate of MHC in
bovine multinucleated muscle cell culturesa
Treatment
Control
10−6 M Isoproterenol
10−7 M Isoproterenol
Quantity of MHC
MHC synthesis rate
100
110.1 ± 12.2
100.1 ± 23.7
100
110.4 ± 15.2
94.9 ± 14.3
aCells were treated with isoproterenol for 4 d. Each value
represents the mean ± SEM of 10 experiments with six replicates in
each experiment. Data are expressed as a percentage of the control
value for each treatment. Control values were 8.5 × 10−3 absorbance
units in MHC per microgram of DNA and 30.7 cpm in MHC per
microgram of DNA.
Figure 4. Analysis of RNA from bovine muscle cell
cultures for the presence of b2-adrenergic receptor
(b2AR) mRNA by slot blots and by polymerase chain
reaction. Top: Slot blot analysis. Lane 1 contains 1 mg of
total RNA from multinucleated muscle cell cultures.
Lane 2 contains 10 mg of total RNA from muscle cell
cultures. Lane 3 (top slot) contains 1 mg of total RNA
from adult bovine skeletal muscle. Lane 3 (bottom slot)
contains 10 mg of total RNA from adult bovine skeletal
muscle. Bottom: PCR Analysis. Lane 1, RNA from
90-d fetal bovine skeletal muscle. Lane 2, Ribonucleasetreated RNA from 90-d fetal skeletal muscle. Lane 3,
RNA from 8-d bovine multinucleated muscle cell
cultures. Lane 4, ribonuclease-treated RNA from
8-d bovine muscle cell cultures. Lane 5, bovine genomic
DNA. The size of the b2AR DNA fragment was 196 bp.
2388
BRIDGE ET AL.
Figure 5. An example of an experiment in which
expression of b2-adrenergic receptor mRNA was studied
following treatment of bovine multinucleated muscle
cell cultures with 25 nM, 250 nM, and 2,500 nM
dexamethasone (Dex). The RNA was isolated from the
cultures, slot blots were hybridized against the
32P-labeled b -adrenergic receptor clone, and the x-ray
2
films were scanned with a laser densitometer.
cultures have not led to consistent results. With the
exception of the present study on bovine muscle cells
and that of Symonds et al. (1990) on ovine muscle
cells, none of the previous cell culture investigations
have attempted to confirm the presence of bAR on
muscle cell membranes (Anderson et al., 1990; Bechet
et al., 1990; Grant et al., 1990; Harper et al., 1990;
Young et al., 1990; Ji and Orcutt, 1991; McMillan et
al., 1992). In addition, the present study shows that
the bAR population induced by dexamethasone is
functional, because an increase in cAMP production
could be detected following brief treatment of cells
with isoproterenol. Bechet et al. (1990) also indicated
that cimaterol and isoproterenol had no effect on
muscle protein synthesis in bovine muscle cell cultures. Our initial inability to obtain an enhancement
of muscle protein accumulation by chronic exposure to
isoproterenol was likely due to the absence of a
significant functional bAR population, as evidenced by
lack of separation between total binding curves and
nonspecific binding curves and the lack of cAMP
production during short-term stimulation of cells with
isoproterenol. The inability to detect significant levels
of functional bAR in multinucleated muscle cultures
does not necessarily mean that the protein for the
receptor is not present. Some unique characteristics of
2,500 nM dexamethasone led to consistent increases of
15 to 35% in MHC synthesis (compare filled bars to
open bars).
Discussion
b-Adrenergic receptor agonists have been reported
to modulate growth in several mammalian and avian
species, including chickens, turkeys, rats, mice, pigs,
sheep, cows, and rabbits. The most frequently studied
bAR agonists include ractopamine, cimaterol, clenbuterol, isoproterenol, salbutamol, and L-644,969. In
general, these agents enhance the rate of gain,
decrease feed consumption, increase the amount of
skeletal muscle tissue, and decrease the amount of
adipose tissue (reviewed by Mersmann, 1995). The
increase in skeletal muscle tissue has been attributed
to either stimulation of protein synthesis, inhibition of
protein degradation, or both. Variations in the degree
to which each of these changes takes place are likely
due to studies on different species, muscle types,
treatment times, different bAR agonists used, and
possibly expression of different bAR genes.
Efforts to define the mechanism of action of bAR
agonists in the controlled environment of muscle cell
Figure 6. An example of an experiment in which
bovine muscle cells were treated with 250 nM dexamethasone for 48 h between d 6 and 8 in culture,
followed by analysis of the membranes for the population of b-adrenergic receptors. This treatment with
dexamethasone leads to a greater separation between
total binding (ÿ) and nonspecific binding (o) than in
control cells not treated with dexamethasone (compare
with Figure 2D). (IPIN = [125I]iodopindolol).
BETA-ADRENERGIC RECEPTOR IN BOVINE MUSCLE CULTURES
2389
accumulation was still not drastic. By comparison,
Symonds et al. (1990) reported no significant increase
on protein synthesis or degradation in ovine muscle
cultures treated with cimaterol when myoblasts were
prepared from fetal tissue; however, cimaterol stimulated protein synthesis in satellite cell cultures
prepared from postnatal muscle tissue.
The fact that ractopamine stimulated muscle protein synthesis in the ELC6 rat myoblast cell line
(Anderson et al., 1990) is consistent with other pieces
of information. The ELC5 cell line is a subclone of the
rat L6 cell line, and the results of the present study
indicate that L6 cells have a high population of bAR
(not shown) as well as the ability to synthesize large
quantities of cAMP. The L6 cell line is routinely used
in the authors’ laboratories as a positive control in all
cell culture experiments studying bAR population,
cAMP synthesis, and mRNA levels. In addition,
primary cultures established from fetal rat myoblasts
Figure 7. Summary of specific binding only of
[125I]iodopindolol (IPIN) to b-adrenergic receptors in
8-d-old control and dexamethasone-treated (+Dex) muscle cells. Cells were treated with 250 nM dexamethasone
for 48 h between d 6 and 8 in culture. Four levels of
IPIN were chosen to include the critical levels used in a
typical binding analysis, such as those shown in Figures
2 and 6. Nonspecific binding was subtracted from total
binding in each experiment to obtain the value for
specific binding at each concentration of IPIN. Each
value represents the mean ± SEM of 37 experiments for
control cells and 46 experiments for dexamethasonetreated cells. Measurements were made in triplicate
within each experiment. As indicated by the asterisks,
specific binding in dexamethasone-treated cells was
higher at 200 pM and 320 pM IPIN (P < .05).
the cells or perhaps incomplete receptor processing
could have prevented the receptor from assuming its
appropriate conformation for binding to ligand.
However, it is noteworthy that when bAR were
detected by receptor binding analysis, higher levels of
cAMP synthesis was also detected in all cases.
The variability encountered by most investigators
on the effects of bAR agonists on muscle protein
synthesis and accumulation is illustrated by the data
in Table 1. Even though many experiments with up to
six replicates in each were carried out, the coefficient
of variation was typically about 15 to 20%. Given the
fact that animals that have been fed bAR agonists
usually produce a 25 to 30% increase in protein
accumulation in skeletal muscle, the inability to
detect their effect in cell culture, even if bAR are
present, is perhaps not too surprising. Even when the
bAR population was increased by treatment with
dexamethasone, the increase in MHC synthesis and
Figure 8. Effect of isoproterenol on cAMP production
in bovine muscle cell cultures treated with 250 nM
dexamethasone for 48 h. Cells were then exposed to 10−6
M isoproterenol for up to 20 min, and the cAMP
concentration in the cells was determined. Bovine
skeletal muscle cell cultures treated with 250 nM
dexamethasone for 48 h (o). Control skeletal muscle cell
cultures not treated with dexamethasone (ÿ). In the
muscle cells, each point represents the mean ± SEM of
four experiments with quadruplicate measurements in
each experiment. The cAMP concentration was higher in
cells treated with dexamethasone at all time points (P <
.05). Rat L6-derived multinucleated muscle cells (π).
These cells have an abundant population of b-adrenergic
receptors, synthesize large quantities of cAMP, and
serve as a positive control. In the experimental results
shown here, each point is the mean of duplicate
determinations.
2390
BRIDGE ET AL.
express bAR and are capable of synthesizing cAMP
(Young et al., 1996).
The importance of verifying that bAR are present
on muscle cells when experiments with bAR agonists
are evaluated, and that these receptors are functionally active through coupling to cAMP production,
needs to be emphasized. Some of the variability in
published work may be due to variations in the level of
bAR gene expression. Coupling of the bAR to cAMP
Figure 9. Effect of dexamethasone treatment by itself
or in combination with 10−6 M isoproterenol on the
quantity of myosin heavy chain (MHC) in bovine muscle
cells. Open bars represent muscle cells treated with the
indicated concentrations of dexamethasone by itself for a
total of 72 h, whereas filled bars represent cells that were
treated with the indicated concentrations of dexamethasone for the first 24 h, followed by treatment with
dexamethasone and 10−6 M isoproterenol for the remaining 48 h. The logic of this experiment was that if
dexamethasone caused up-regulation of functional badrenergic receptors, treatment with isoproterenol might
then stimulate muscle protein accumulation. Experiments were initiated on d 5 in culture, and the cells were
analyzed for MHC content 3 d later. This figure is an
example of the results of a typical experiment, and each
value represents the mean ± SD of six replicate cultures.
At all three concentrations of dexamethasone (open
bars), the quantity of MHC was less (P < .05) than the
quantity in control cultures either in the presence or
absence of isoproterenol. As indicated by the asterisk,
the quantity of MHC in the presence of 2,500 nM
dexamethasone and 10−6 M isoproterenol was significantly higher (P < .05) than the quantity in cells treated
only with 2,500 nM dexamethasone.
Figure 10. Effect of dexamethasone treatment by itself
or in combination with 10−6 M isoproterenol on the
apparent synthesis rate of myosin heavy chain (MHC) in
bovine muscle cells. Open bars represent muscle cells
treated with the indicated concentrations of dexamethasone by itself for a total of 72 h, whereas filled bars
represent cells that were treated with the indicated
concentrations of dexamethasone for the first 24 h,
followed by treatment with dexamethasone and 10−6 M
isoproterenol for the remaining 48 h. The logic of this
experiment was that if dexamethasone caused upregulation of functional b-adrenergic receptors, treatment with isoproterenol might then stimulate muscle
protein synthesis rate. Experiments were initiated on d 5
in culture, and the cells were analyzed 3 d later for the
rate of incorporation of [3H]Leu into MHC. This figure is
an example of the results of a typical experiment, and
each value represents the mean ± SD of six replicate
cultures. At all three concentrations of dexamethasone
(open bars), the apparent synthesis rate of MHC was
less (P < .05) than the rate in control cultures either in
the presence or absence of isoproterenol. As indicated
by the asterisk, the apparent synthesis rate of MHC in
the presence of 2,500 nM dexamethasone and 10−6 M
isoproterenol was higher (P < .05) than the rate in cells
treated only with 2,500 nM dexamethasone.
synthesis may also vary considerably; we have observed in other experiments (unpublished data) that
chick muscle cell cultures having comparable levels of
membrane bAR may vary widely in the amount of
cAMP produced. Variations may also be due to
different media compositions used for cell culture, to
variability in serum or other biological extracts added
BETA-ADRENERGIC RECEPTOR IN BOVINE MUSCLE CULTURES
to the media, to differences in levels of expression of
bAR in different species, or even to differences in
expression of different myogenic cell types within the
same species (i.e., embryonic myoblasts vs satellite
cells).
In conclusion, based on observations at the protein
level (receptor analyses), second messenger level
(cAMP induction), and anticipated physiological
response (protein metabolism), bovine muscle cells in
culture have low levels of bAR. However, the b2AR
mRNA can be amplified by PCR and is detectable on
slot blots. Thus, either the mRNA for the receptor is
being transcribed but not translated or the mRNA is
translated but the protein product is not assembled
into functional membrane receptors. There is evidence
of bAR up-regulation by dexamethasone in the receptor binding analyses, cAMP stimulation, and protein
metabolism experiments; however, this seems to be
due to posttranscriptional events because no increase
is observed in the quantity of bAR mRNA on slot blots.
Implications
Muscle cell cultures are a potentially useful model
system for understanding the effects of b-adrenergic
receptor agonists or other growth-promoting agents on
muscle protein metabolism. However, the results of
this study underscore the importance of verifying that
the appropriate classes of functional receptors are
expressed on cells used for such experiments.
Literature Cited
Anderson, P. T., W. G. Helferich, L. C. Parkhill, R. A. Merkel, and
W. G. Bergen. 1990. Ractopamine increases total and myofibrillar protein synthesis in cultured rat myotubes. J. Nutr. 120:
1677−1683.
Bechet, D. M., A. Listrat, C. Deval, M. Ferrara, and J. F. Quirke.
1990. Cimaterol reduces cathepsin activities but has no anabolic effect in cultured myotubes. Am. J. Physiol. 259:
E822−E827.
Bridge, K. Y., C. K. Smith, II, and R. B. Young. 1994. Beta-adrenergic receptor expression in bovine skeletal muscle cells in culture. Mol. Biol. Cell 5:163a.
Buckland, P. R., R. M. Hill, S. F. Tidmarsh, and P. McGuffin. 1990.
Primary structure of the rat b-2 adrenergic receptor gene.
Nucleic Acids Res. 18:682.
2391
Chomczynski, P., and N. Sacchi. 1987. Single step method of RNA
isolation by acid guanidinium thiocyanate phenol-chloroform.
Anal. Chem. 162:156−159.
Grant, A. L., W. G. Helferich, R. A. Merkel, and W. G. Bergen. 1990.
Effects of phenethanolamines and propranolol on the proliferation of cultured chick breast muscle satellite cells. J. Anim. Sci.
68:652−658.
Harper, J. M., I. Mackinson, and P. J. Buttery. 1990. The effect of
beta agonists on muscle cells in culture. Domest. Anim. Endocrinol. 7:477−484.
Hollander, M. C., and A. J. Fornace, Jr. 1990. Estimation of relative
mRNA content by filter hybridization to a polythymidylate
probe. Biotechniques 9:174−179.
Ji, S., and M. W. Orcutt. 1991. Effects of the b-adrenergic agonist
isoproterenol on protein accretion, synthesis, and degradation
in primary chicken muscle cell cultures. J. Anim. Sci. 69:
2855−2864.
McMillan, D. N., B. S. Noble, and C. A. Maltin. 1992. The effect of
the b-adrenergic agonist clenbuterol on growth and protein
metabolism in rat muscle cell cultures. J. Anim. Sci. 70:
3014−3023.
McPherson, G. A. 1983. A practical computer-based approach to the
analysis of radioligand binding experiments. Comput. Programs Biomed. 17:107−113.
Mersmann, H. J. 1995. Species variation in mechanisms for modulation of growth by beta-adrenergic receptors. J. Nutr. 125:
1777S−1782S.
Mersmann, H. J. 1998. Overview of the effects of b-adrenergic
receptor agonists on animal growth including mechanisms of
action. J. Anim. Sci. 76:160−172.
Munson, P. J., and D. Rodbard. 1980. LIGAND: A versatile computerized approach for characterization of ligand-binding systems. Anal. Biochem. 107:220−239.
Shimomura, H., and A. Terada. 1990. Primary structure of the rat
beta-1 adrenergic receptor gene. Nucleic Acids Res. 18:4591.
Strosberg, A. D. 1990. Biotechnology of beta-adrenergic receptors.
Mol. Neurobiol. 4:211−250.
Symonds, M. E., J. A. Roe, C. M. Heywood, J. M. Harper, and P. J.
Buttery. 1990. Beta-adrenoreceptors and the effect of betaagonists on protein metabolism in ovine primary muscle cell
cultures. Biochem. Pharmacol. 40:2271−2276.
Young, R. B., T. R. Miller, and R. A. Merkel. 1978. Clonal analysis of
satellite cells in growing mice. J. Anim. Sci. 46:1241−1249.
Young, R. B., D. M. Moriarity, C. E. McGee, W. R. Farrar, and H. E.
Richter. 1990. Protein metabolism in chicken muscle cell cultures treated with cimaterol. J. Anim. Sci. 68:1158−1169.
Young, R. B., M. W. Orcutt, and P. B. Blauwiekel. 1980. Quantitative measurement of protein mass and radioactivity in N,N′diallyltartardiamide crosslinked polyacrylamide slab gels. Anal.
Biochem. 107:202−208.
Young, R. B., and P. A. Schneible. 1984. Myosin heavy chain concentration, synthesis rate and degradation rate in normal and
dystrophic chicken muscle cells in culture. Eur. J. Cell Biol. 34:
75−79.
Young, R. B., C. J. Strietzel, K. Y. Bridge, S. M. Czerwinski, and C.
K. Smith, II. 1996. Beta-adrenergic receptor gene expression in
rat muscle cell cultures is enhanced by electrical stimulation.
Mol. Biol. Cell 7:428a.