[CANCER RESEARCH 54, 1305-1312. March 1. 1994]
Integration of Human Papillomavirus Type 6a DNA in a Tonsillar Carcinoma:
Chromosomal Localization and Nucleotide Sequence of the Genomic
Target Region1
T. Kahn,2 E. Türazza,R. Ojeda, A. Bercovich, A. Stremlau, P. Lichter, A. Poustka, S. Grinstein, and H. zur Hausen
Deutsches Krebsforschungszentrum,
Angewandte Tumorvirologie, Im Neuenheimer Feld 242, 69120 Heidelberg ¡T. K., P. L., A. R, H. Z. H.j, and Universitätsklinik für
Hals-Nasen-Ohren Kranke im Kopfklinikum, Josef-Schneider Strasse lì,97080 WürzburgJA. S.J, Germany: and Laboratorio de VirologÃ-a, Hospital de Niños, Gallo 1330,
1425 Buenos Aires, Argentina [E. T., R. O., A. B„S. G.]
ABSTRACT
Human papillomavirus type 6a
sillar carcinoma both as integrated
cellular junction was molecularly
72: 2569—2572, 1991). The cellular
Integration of HPV DNA is considered to be an important step in
tumor progression (reviewed in Ref. 2). Focusing on the viral se
quences involved in the integrational event, the disruption of the E2
open reading frame is regularly observed, producing viral intrage-
(HPV 6a) DNA was detected in a tonand episomal molecules, and one viralcloned (Bercovich et al., J. Gen \ ¡rol..
sequence was used as a probe for the
nomic dysregulations which favor the enhanced expression of the
E6-E7 genes (28). The product of the HPV E7 gene, among other
isolation of a cosmid from a normal human genomic DNA library. A
2.7-kilobase subclone including the integration site was sequenced. It was
effects, may induce chromosomal abnormalities (2, 29).
The chromosomal localization of integrated HPV 16 or 18 se
quences has been determined for only one primary invasive cervical
cancer (30), but for several genital cancer-derived cell lines (i.e., Refs.
30-36), or cell lines obtained after immortalization induced by HPV
16 or 18 DNA transfection (i.e., Refs. 37-39). Since it has not been
possible to immortalize cells after transfection with HPV 6 (40), or to
establish cell lines from HPV 6 lesions, no information either at the
nucleotide sequence nor at the cytogenetical level is available on
integration of DNA of this HPV type. To our knowledge nothing is
known about the integration sites of HPV DNA in head and neck
tumors, except for nasal and nasopharyngeal epithelial cells immor
talized by transfection with HPV 16 (38).
Several studies have shown that integration sites of HPV-DNA are
shown to contain sequences with similarities to the E2 and L2 regions of
human papillomaviruses, a 5' truncated long interspersed repeated DNA
element type 1 retrotransposon,
and a fragment of an O-repeat element.
The chromosomal localization of the integration site was determined to be
at region 24 of the long arm of chromosome 10 (10q24). This is the region
where the fragile site is located in which HPV 18 DNA is integrated in the
cell line FEP18-5. In addition it contains the site of breakpoints affecting
protooncogenes ll<>\\\ and Aw 10. Other genes related to cell division and
DNA repair have also been mapped to this chromosomal band. Analysis of
genomic DNA of cell lines and patients using 10q24-derived probes is
presented. The integration of human papillomavirus type 6 DNA into
chromosome 10q24 may have disrupted a cellular gene critical for normal
cell growth, which further analysis should help to identify.
preferentially located near chromosomal breakpoints, fragile sites,
protooncogenes or tumor-suppressor genes (30-32, 35, 37, 39). Ex
INTRODUCTION
HPV3 are epitheliotropic
DNA viruses of which more than 70
individual types are known so far (1). Some of them are consistently
found in precursor lesions of genital cancers. Most prominently, HPV
16 and 18 infections are linked to cervical, vulvar, penile, perianal,
and anal intraepithelial neoplasias. Other genital HPV types are more
frequent in benign lesions, particularly HPV 6 and 11 (1-3). These
low risk HPV types may be found in rare occasions to be associated
with malignant lesions (4-6). Several of the genital HPVs have also
been described in lesions of the respiratory tract: HPV 6 and 11
subtypes in juvenile laryngeal papillomas (4, 7), HPV 6, 11, 16, 18,
30, and 33 in laryngeal cancers, with and without previous laryngeal
papillomatosis, and HPV 16 in tongue carcinomas (8-16). More re
cently HPV types 6, 16, 33, and 57 have also been found in carcino
mas of the tonsils and other head and neck locations (17-21), indi
cating a possible viral etiology for carcinomas at these extragenital
sites.
In genital lesions, HPV DNA is most commonly found in an epi
somal state in precursor lesions, whereas it is generally integrated in
malignant tumors (22, 23), and always integrated in cell lines derived
from cervical carcinomas or in cells immortalized by transfection with
HPV 16 or 18 DNA (24-27).
Received 8/9/93; accepled 12/28/93.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
' This work was supported in part by Grant 1/67416 from the Volkswagen-Stiftung and
by the Verein zur Förderung der Krebsforschung in Deutschland.
2 To whom requests for reprints should be addressed, at DKFZ, ATV, Abt. 0640, Im
Neuenheimer Feld 242, 69120 Heidelberg, Germany.
3 The abbreviations used are: HPV, human papillomavirus;
EMBL. European Molecu
lar Biology Laboratory: LINE 1, long interspersed repeated DNA elements type 1; SSC.
standard saline citrale (1 X SSC is 0.15 M NaCl. 0.015 M sodium citrate); FITC, fluorescein isothiocyanate; TRITC, tetramethylrhodamine isothiocyanate; DAPI, 4'.6-diamidino2-phenylindole: PCR, polymerase chain reaction.
pression of these genes may be altered by the integrated HPV DNAs
(2). The study of cellular sequences affected by HPV DNA integration
may contribute to the identification of genes involved in tumor
development.
Complete loss of normal alÃ-elesin tumors are genetic changes
which in several instances turned out to be useful markers for the
detection of tumor suppressor genes (41). Recently we described the
presence of integrated HPV 6a DNA in an infiltrating squamous cell
carcinoma of the tonsil (19) of a patient without recognizable risk
factors. The tumor contained integrated and episomal viral sequences.
The unoccupied site corresponding to the integration locus was not
detectable in the original tumor material. This combination suggested
the possibility that the integration event might have disrupted a cel
lular gene critical for normal cell proliferation. As a first step to test
this hypothesis, we cloned the normal genomic DNA of the integration
target and determined the chromosomal localization and nucleotide
sequences surrounding the integration site.
MATERIALS
AND METHODS
Cloning of Cosmid DNA. A cosmid library from normal human leukocyte
DNA cloned in the vector pCos2 EMBL (42, 43) was screened to isolate the
corresponding normal alÃ-eleof the viral integration site in the original tonsillar
carcinoma. Screening was performed by using the 800-base pair subcloned
cellular component of the viral-cellular junction from the tonsillar carcinoma
described previously (19) as probe. Subcloning of cosmid fragments into
pBluescript was performed with the use of standard procedures.
DNA Sequencing. Plasmid DNA was extracted and purified by using
Qiagen columns and protocols (Diagen, Düsseldorf,Germany). Sequencing
was performed by the dideoxy chain termination method on double-stranded
DNA, using a kit from Pharmacia (Freiburg. Germany) and a primer walking
strategy. Synthetic oligonucleotides used as primers were synthesized on an
1305
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1994 American Association for Cancer Research.
HPV 6 INTEGRATION
IN TONSILLAR
Applied Biosystems DNA synthesizer (Foster City, CA). Sequencing was
performed in both directions and was repeated at least twice for each primer.
Computer Analysis of DNA Sequences. Computer analysis was done with
the aid of the Heidelberg Unix Sequence Analysis Resources program library,
a software package developed in part at the Deutsches Krebsforschungszen
trum, with contributions from the University of Wisconsin Genetic Computer
Group, Protein Identification Resources (PIR), the University of California at
San Diego (Doolittle), and EMBL (Vingrom, Zehetner). EMBL release 33.0,
GenBank release 73.0, PIR release 34.0, and SwissProt release 23.0 were
scrutinized for nucleotide or amino acid sequence homologies.
Determination of Chromosomal Localization by in Situ Hybridization.
For in situ hybridization, 60 ng of the cosmid C2 (see Fig. 1 and "Results"),
CARCINOMA
HPV6L2
T Cell
V////////Õ
VIRAL-CELLULAR JUNCTION
//
B«»
//'\
|
COSMID
C2
,„„
//
V////////1
11000
|
20001380UNE
labeled with biotin or digoxigenin by nick translation (44), was used in a 10-ju.l
hybridization cocktail containing 5 (xg salmon sperm DNA, 50% formamide,
2 X SSC, 10% dextran sulfate, and 50 mm sodium phosphate, pH 7.O. Prepa
ration of chromosome spreads from cultured human lymphocytes was accord
ing to standard protocols by using hypotonie treatment and methanol/acetic
acid fixation. Probe and specimen denaturation, in situ hybridization, and
posthybridization washes were carried out as described (45). Hybridized probe
was detected via FITC-conjugated avidin or TRITC-conjugated anti-digoxigenin antibodies, and chromosomes were banded by DAPI. Slides were evalu
ated on a conventional epifluorescence microscope (Axiophot, Zeiss, Ger
many). For illustration purposes, digitized images were acquired separately for
DAPI, FITC, or TRITC fluorescence, using a cooled CCD camera (Photomet
ries, Tucson, AZ) and Apple computer hardware, and FITC or TRITC images
were overlayed electronically with the DAPI image of the same object by using
the software package NIH image. Pictures were taken directly from the
monitor.
Analysis of Genomic DNA. DNA was isolated from human leukocytes,
genital lesions, and head and neck tumors which were obtained from ongoing
clinical studies regarding HPV infection in these tumors. DNA isolated from
cells of the spontaneously immortalized human keratinocyte cell line HaCat
and the cervical carcinoma-derived cell lines C4-I, C4-II, SW756, and CasKi
was kindly provided by Elisabeth Schwarz. For Southern blot analysis, DNAs
were cleaved with appropriate restriction endonucleases, separated in 0.8%
agarose gels, and transferred to GeneScreen nylon membranes (DuPont NEN,
Dreieich, Germany), using the Posiblot pressure blotter (Stratagene, Heidel
berg, Germany) and cross-linked by UV exposure plus baking. DNA fragments
were labeled with 12P by using the Pharmacia random priming kit. Hybridiza
tions were performed in 5 X SSC either at 42°Cin the presence of 50%
formamide or at 68°C.Filters were washed in 2 X SSC, 0.1% sodium dodecyl
sulfate at 68°C.Blots were exposed to Kodak XAR films at -70°Cwith the use
of intensifier screens.
HPV Diagnosis by PCR. In addition to Southern blot analysis, DNAs from
genital and aerodigestive tumors were screened for the presence of HPVs by
using type-specific and general primer PCR (46, 47).
RESULTS
Cloning of Normal Locus Corresponding to HPV 6 Integration
Site in Tousillar Carcinoma. From the viral-cellular junction, a frag
ment of 1.4-kilobases was molecularly cloned (19), and the cellular
component was subcloned and used as a probe for screening a normal
human leukocyte DNA cosmid library. One cosmid clone of about 38
kilobases, termed C2, was obtained after two rounds of screening.
Two subclones, about 8- and 2.7-kilobases in size, respectively, were
constructed, both containing the normal equivalent of the integration
site (Fig. 1). The two subclones corresponded in size to fragments
obtained by restriction enzyme cleavage of C2 DNA and of normal
human leukocyte and placenta genomic DNA as determined by South
ern blot hybridization. These comparisons were performed by using
the restriction enzymes Taq I (used for analysis of patients' genomic
1 «lumi274e2466"*
253«2727:
0 repeal
fragment
Fig. 1. Cloning of the unoccupied alÃ-elefrom normal human DNA. The 800-base pair
cellular sequence component of the Ton B viral-cellular junction cloned from the original
tonsillar carcinoma (19) was subcloned and used as a probe for cloning cosmid C2 and
subclones. In the 2.7-kilobase (kb) subclone the position of the integration site at nucleo
tide 1252 and that of the LINE 1, O-repeat elements and sequences with similarities to
HPV 6 and 16 E2 and L2 region are shown (arrows and bars). These similarities are (a)
HPV 6b E2 sense (81% in 37 base pairs); (/>) HPV 6b El anti-sense) (66% in 35 base
pairs); (c) HPV 6b L2 sense (78% in 23 base pairs); (</) HPV 6b L2 anti-sense (61% in
85 base pairs); (e) HPV 16 E2 sense (69%; 106 base pairs); (/) HPV 16 L2 sense (74%
in 39 base pairs). The precise nucleotide positions of these sequences are shown in
Table 1.
Sequence Analysis of the 2.7-kilobase Subclone. In order to char
acterize the cellular sequences involved in HPV DNA integration in
the tonsillar carcinoma, the nucleotide sequence of the 2.7-kilobase
clone was completely determined (Fig. 2). DNA rearrangements after
HPV integration have been described (48). However, no difference
could be detected between the tumor-derived viral-cellular junction
sequence and that of the 2.7-kilobase clone (named Ton B in Ref. 19).
In this sequence, the integration site is located at position 1252
(Fig. I).
The second aim was to determine whether or not already known
sequences are present in the sequenced fragment, particularly those
known to be involved in recombination events. After searching the
sequence databases, two repetitive elements were detected 3' from the
integration site. First, a 5'-truncated human repeat element belonging
to the LINE 1 family extends from position 1380 to position 2466 of
the 2.7-kilobase clone (Fig. 1). It shows a similarity of about 70% with
different members of the LINE 1 family that are localized in the
ß-globinregion of chromosome 11, at the 5'-flanking site of the
interleukin 2 gene (at chromosome 4q26-28), and in the human factor
VIII gene, termed LI.2, located at chromosome 22qll.l-qll.2
(49).
The similarity between the LINE 1 sequence in the 2.7-kilobase clone
and the sequence of LI.2 of 6.5-kilobases is 73.4% through a length
of 978 base pairs. The homology is located within ORF (open reading
frame) 2 of LI.2, which codes for a reverse transcriptase. However,
the LINE 1 sequence in the 2.7-kilobase clone contains several stop
codons and mutations introducing frame shifts, probably precluding
translation. Particularly, the region between nucleotides 1800 and
1862 seems to be more diverging.
Since on average the divergence among genomic LINE 1 sequences
is only 5% (50), the 27% divergence observed here is relatively high.
This explains why the cellular component of the original viral-cellular
junction could be used as a probe for screening and analysis purposes,
although it includes part of the LINE 1 fragment. Specificity of this
probe could be confirmed by using also a BamHl-Hincll fragment
derived from the 2.7-kilobase clone (nucleotides 1 to 968) as a probe.
This fragment is completely free from repetitive sequences (Fig. 1).
The orientation and location of the LINE 1 sequence in the 2.7-
DNA), EcoRl (used for the subcloning of the 8-kilobase fragment),
BamHl, Bglll (used for the subcloning of the 2.7-kilobase fragment),
HindUl, and Pstl, demonstrating that the cosmid C2 and the subclones
suffered no detectable rearrangements, and that the probe used is
specific for sequences derived from the C2 cosmid (data not shown).
kilobase clone is shown in Fig. 1.
This analysis was repeated with an additional C2-derived probe
The second repetitive sequence detected belongs to the human
O-repeat family of dispersed repeat elements (nucleotide positions
(see below).
1306
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1994 American Association for Cancer Research.
HPV 6 INTEGRATION
IN TONSILLAR CARCINOMA
000 1
TAGGTW\TTAAGAAATAAATACATTTAOGO^^TTr;ATATATT'J^'AAij'".AATTTCTTTATAATGAATAA';ACATTAGCACT'"A';TTTTAAATAATAAG<-"AA
0101
TCTAACATATGAATGTATCATCAAATTCTTTGAGAACTTrcAATACTTTGCTTCAAACCTTGTTATTTTAATAATTAAAATAAAAAAAGAATAATATTTT
ACATTCTATACTTACATAGTAGTTTAAGAAACTCTT^AAGGTTATGAAACGAAGTTTGCAACAATAAAATTATTAATTTTATTTTTTTCTTATTAT
0201
CTGACAAGCACAATCATACAAAATTTAAATTTCAGCGTCTATATAGTTTTATTGAGACACAGCCACATTCATTATTTCACACTTTGCWrrATGGCTGCTTT
CACTcrrCGTCnTAGTATGTTTTAAATTTAAAGTCGCAGATATATCAAAATAACTCTGTCTCGGTGTAAGTAATAAAGTGTGAAACCGATACCGACGAAA
0301
CACACACATGCGCACATTTCAGTAGATGTAACTGATATGTTATGGCCATCATACCCTAACAATATTTACTCTCTGGACTACCACAGACAACMTTTTCTG
CTGTGTCTACCCGTCTAAACTCATCTAyTTCACTATACMTACCGCTACTATCCGATTGTTATAAATGAGAGACCTGATCCTCTCTCTTCTTAAAACAC
0401
ACACTGCCCTAAATAAAAATGAATTGATGACATTCAAGTATGAAAATGAAAAATTTATGACTTTACAATAAAAAAACAAACAGATTATTGAGGAATTATT
TCTCACCGCATTTATTTTT
ACTTAACTACTCTAACTTC
AT ACTTTTAC T TTT TAAATACTCAAATCTTAT T TTTTTCTTTCTCT AATAACTCCTT AAT AA
0501
ATTTAAACTAGCTGCTTAAATCACTGAGAATATCTrCATTrrTAACAAACTTACAATACTCTC^
T AAATTT GATCGACG AAT TTACTGACTCTTATA GAAGT AAAAA TT CTTT GAATGTT ATGAC ACT CATT GT ATAAGTTCG AAAT ATA TT AT AAA GGT CA CT
0601
AATATTTTTTAAAATAATCATTATTGTTTGTTTTC^TATTTTTGAAAAATCTATTAATATCATTGGACAGTTTTCTACAAACTTCGCAACATTTGAAACT
TTATAAAAAATJTTATTAGTAATAACAAACAJUVACGATAAAAACTTTTTACATAATTATAGTAACCTGTCAAAACATCTTTCAAGCGTTCTAAACTTTCA
0701
CTTGCATTAATAGCAATGCCATTCAAATCCCTATACAAATCAATCATTATCrTTGCTAAAC
GAACGTAArrATCCTTACGGTAACTTTACGCATATCTTTACTTAGTAATAGAAACCATTTGTCTGAAATTTGAGTACAACAATTTCATAATTTAAAATCA
OÌ01
GreTTTGCAAATTGCATCAAATAAATATCAAATATACTrTAATTTTTCTATCTTCTCTAC^^
C AAAAA C CTTT AAC GT ACT TT ATTT ATAC TTT ATA TCAAA TT AAAAA GAT AC AAG AG A TGT AAAGTT ATCT AAATTTC A TT AT GCT AC AAAAT AC TTT GT
ATCCATTAATTCrrTATTTATGTAAATCCCGAAACTATATMCOTTCrTTAAAGAAATATTArTTATTCTGTAATCGTCAGTCAAAATTTATTATTCGTT
0901
AATACAAAAATCACAAGTATTATTTTCTATCAAAATTAATTTGCAGTACATATACATTTCTCTTAGTCAACTGAACATCAATTAACTAACTAGTTCATCA
TT A TG TTTTT AG TGTTC AT AAT AAAAG AT ACT TTT AA TT AAA CGT CAT G TAT AT CTAAA CAG AA TC AGTTG ACTTCT AGTT AATTG ATT CAT C AA GT ACT
1001
TTTTCTTAGTACACATTTTAATGGCATTACCTTCTTATTCTGATTACATACTGMTATTCCACCAAAAAAAAATTATGGAATAAAAATAAGTTATATTCA
AAAACAATCATGTGTAAAATTACCGTAATGGAAGAATAAGACTAATCTATGACTTATAACCTGCTTTTTTTTTAATACCTTATrrrTATTCAATATAACT
1101
TTGCTAACCTCTTCACAAAAAAAAAACCAGGAGTTATrrCTTTAAAAAACTCACATCXrrTTTATTT^
AACCATTCGACAACTCTTTTTTTTTTGGTCCTCAATAAAGAAATTTTTTCAGTGTACCAAAATAAAATAAAATAAAATAAGATAAATAAAAATATCTAAG
1201
GGGGGTACACA^GTAGTTTTGTTACATGGGTATGCTGCATAATGCTAAGGTTtGGACrrCTGTTCTACCTGTTACCTGAATAGTGAATArrCKACCCAAT
Fig. 2. NuClCOtide
Sequence
OÕ the 2.7-kÌlobaSC (kb)
Clone.
cccccATGTcrrGCATCAAAACAATGTACccATACCACCTATTACGATTccAAAccTGAAGACAACATGGACAATGGAcrrATCAcrrATAACcTGGGTT^
Horizontal arrows indicate sense and sequence of the primers
1301
HOI
ACCTGAGTTTTCAACTCCCTCTACCCTCTCACTTCTCCTTTTTGGAGTTTCCAGGGTCTGCCTATTTTCCACTGCTTAGCTTATGACTGACAATATATGG
TCCACTCAAAAgTTMGG^C^CCCAGACTGMG^CAAAAACCTCAAACCTCCCAC^CG^AAAACCT^CCMTC^TACTCtCTCrrATATtCC
TATTTGATTTCCTGTTTCTGGAATTATTTCACCTAGGATAATGCCTCCAGCTCCATCCATGCTGCTGTAAAATACATGATTTCTTTCTCTTCTATGGATG
ATAAACTAAAGGACAAAGACCTTAATAAAGTGGATCCTATTACCGAGGTCGAGGTAGGTACCACCACATTTTATGTACTAAACAAACACAACATACCTAC
1501 mAGTA^cTATGGTGTATGTATGTATGTATAccACA-mr-^
«
'
i-
-•¿ »
USCd for
armwhea¿
Original
.
viral
primer-Walking
marks
,he position
Cellular
. .
..'
illlkllun
Sequencing
of the
,
(FÕE
1)
HPV
Strategy.
The
6a insertion
The nUCteOtidC
.
.
Vertical
in the
Sequence
datareported
inthis
paperwillappear
intheEMBL, GenBank,
andDDBJ Nucleotidc
Sequence
Databases
undertheaccession
numberX77607.
1601
AATAGTCCTGCAATAAATATACTAGTGCAAGTGTCTTTCTGAAATAAAAATTTATTTTCCTTTTGGTATATACCCAGAAGTGCAGATGATAGATTAATTG
TTATCACGACGTTATTTATATGATCACGTTCACAGAAAGACTTTATTTTT
AAATAAAAGGAAAACCATATATGGGTCTTCACCTCTACTATCTAATT
AAC
1701
GAATTTCTAGTTTTATTTCTTTGGGAAATCTCTGTACTGTTTTCCATACAAGTTGTACAGATTTACCTTATCACCAGCAGCATATCGGCATTCCTTTTCT
CTTAAAGATCAAAATAAAGAAACCCTTTAGAGACATCACAAAAGGTATGTTCAACATCTCTAAATGGAATAGTCCTCCTCCTATAGCCGTAACGAAAAGA
1801
CTCCTTCTGCATATCTGTTGTTTATGACTTATTAGTAACTATTCTGACTGTTGTAACATGTATGGTATTTCATTGTCATTTCAATTTGCATTTCTCTCAT
GACGAACACGTATAGACAACAAATACTGAATAATCATTGATAACACTCACAACATTCTACATACCATAAAGTAACACTAAACTTAAACCTAAAGACACTA
1901
GATCAGTCATGTTCAGCTTTTTCTCATATATTTGTTGGCTGTTTCTATGTCTTCTTTTGAGAAATGTTTTTTTCGTGTTCATTGTCCATTTTTAATGAAG
CTAGTCACTACAACTCGAAAAAGAGTATATAAACAACCGACAAAGATACAGAAGAAAACTCTTTACAAAAAAAGCACAAGTAACAGGTAAAAATTACTTC
2001
TTATTTCGCTCTTTTTCTTGTTAAATTGTTTGAGTTCCTTATAGATTATGAATATTAGTCCTTTGTCAAATGCCTAGGTTGCAAATATTTCTCCCATTCT
AATAAACCGAGAAAAAGAACAATTTAACAAACTCAAGGAATATCTAATACTTATAATCAGGAAACAGTTTACGGATCCAACGTTTATAAAGACCGTAAGA
2101
ATAGCrrTGfcTGTTTACCCTCTTAATGATATCTTTTGCTGTGCAGAAGcrrTTCAGTTTAAGTTCCATTTrrrAATGTTTGTTTCCTTGCATTTGATTTT
TATCCAACAGACAAATGGGACAATTACTATACAAAACCACACGTCTTCGAAAAGTCAAATTCAACGTAAAAAATTACAAACAAAGCAACCTAAACTAAAA
2201
GAGcrrCTTAGTTATAAACTATTTGCCTAGGCCAATGTCAGAATGATTTTTCTCCGTTTTCTTCTGGTACTGTCATAGTTTGAACCTTTTACATCACTTTC
CTCCAGAATCyTATTTGATAAACCGATCCGCTTACACTCTTACTAAAAAGACCCAAAAGAACACCATGACAGTATCAAACTTGGAAAATCTAGTCAAAC
TGCATCATCTTCAGTTAATTTTTGTATATCATGATTAATAGTATAATTTGAAGTGGCACTGATGTGATGCTTCCAGCTTTGTTATTTTGCTTCAT'ACAGC
2301
the
2401
TTTCGCTATTTGGGCTCTTCTGGGTTCCATATGAATTTTAGAATTGTTTCTTCTAATTCTGTAAAGTCACATGCTTTGAAATCAATGTAACTGAGCCAGA
AAACCGATAAACCCCAGAACACCCAAGGTATACTTAAAATCTTAACAAAGAACATTAAGACATTTCACTGTACGAAACTTTACTTACATTCACTCGGTCT
2501
AATCACTGCAAAGAAACATGACTAGAAAAGAAGCTCTATTAGTCTGTCCTCATGCTGCTAATAAATACATATCCCAGACTAGGCAATTTTTAAAGGTAAG
TTAGTCACCTTTCTTTCTACTGATCTTTTCTTCGAGATAATCAGACAGGAGTACGACGATTATTTATGTATAGGCTCTGATCCGTTAAAAATTTCCATTC
2601
GGGTTrAATTGACTCACAGTTTACATGCCAAGGAATCATGGTGGAAGCCAAATGTGGAGCAAACTCAATGTTTTACATGCTGGCAACGAACACAGCTATT
CCCAAATTAACTGAGTCTCAAATCTACGGTTCCTTAGTACCACCTTCCGTTTACACCTCGTTTCAGTTACAAAATGTACCACCGTTCCTTCTCTCGATAA
2"701 CCAGCGGGAGCTCCCCATTATAAAACCATTAGATCCACTAGTTCTA
GGTCCCCCTCGAGGGGTAATATTTTGGTAATCTACGTGATCAACAT
2538 to 2727, Fig. 1) (51). Short isolated fragments corresponding to
the one described here are found as human extracellular circular DNA
in HeLa cells (52), in a duplication unit with O-repeat involvement on
chromosome 16 (53), and downstream of the integration site of HPV
16 in the cervical cancer cell line SiHa (54), with similarities of 75, 77,
and 79%, respectively (Fig. 3).
The other parts of the 2.7-kilobase sequence have no significant
similarities with database entries, with the exception of 5'-TTTTA-3'
blocks distributed over the whole sequence but clustered near the
integration site. Our computer analyses revealed that TTTTA se
quences are also present upstream from or in introns of several eukaryotic genes and in the L2 region from HPV 6b, 16, and 33 (data not
shown).
We looked also for similarities between the 2.7-kilobase elone and
HPV sequences, for direct and inverted repeats, and for potential
topoisomerase cleavage sites, because they are involved in recombi
nation reactions in eukaryotic cells (48, 55). Similarities to nucleotide
sequences of different length, mainly to the El, E2, and L2 regions
from HPV 6 and 16, were detected, located near the integration site
(Fig. 1). These similarities range from 81 to 61% identity over 23 to
106 base pairs in length, with stretches of up to 13 identical nucleotides (Table 1). They are observed at both sides of the integration site,
but clustered 5' from it, at the position where the HPV 6a L2 region
appeared inserted into the cellular genome in the original tumor (Fig.
1). Various direct and inverted repeats are found in the 2.7-kilobase
sequence: a direct repeat of 15 nucleotides (positions 1147-1162 and
2463-2478), several other direct repeats of 10 nucleotides located
immediately upstream of the integration site, as well as inverted
repeats of up to 15 nucleotides (positions 715-725 and 1032-1022). In
2,7 kb cl.
Orepeat
HeLaSr
SiHa
ATTAGTCTGTCCTCATGCTGCTAATAAATACATATCCGAGACTAGGCAATTTTTAAAGGT
ATTAGTCCATTCTCACACTGCTAATAAATACATACCCGAGACTGGGTAATTTATAAAGGA
TGCTAATAAAGGCATACCCGAGACTGGCTAACTTAGAAAGAA
ATTATTCTGTTCTCACGCTGCCA-TGAAGAAACACCTGAGACTGGGTAATTTATAAAGAA
2,7 kb cl.
Orepeat
HeLaSr
SiHa
AA-GGGGTTTAATTGACTCACAGTTT-ACATG-CCAAGGAA
TCATGG
TGGAAAA-GAAGTT-AATTGACTCACAGTTCAGCATGGCTGAGGAGGCCTCAGGAAACTTACAAT
AAAGAGGTTTAACAAACTCACAGTTCCACATTGCTG-GGAGGTCTCACAATCATGGCAGAA-GAGGTTTAATTGAGTCACAGTTCCACATGGCTGGGGAGGACTCAGGAAACTTACAAT
2,7 kb cl.
Orepeat
HeLaSr
SiHa
—¿GGCAAATGTGGAGCAAAGTCAATGTTTTACATGGTGGCA
AGGAAGAGAGCTATT
CATGGTGGAAGGGGAAGAAAACGTGTCCTTCACATGGTGGCAGCAAGGTGAAGTGCTGAG
-AAGGCA-AAGAGGAGCAAAG-GCATGTCTTACATG
GCAGCAAGGAGGAAAGCAGTG
CATGGCAGAAGG
CA
2,7 kb cl.
Orepeat
HeLaSr
SiHa
CCAGCGG-GAGCTCCCCATTATAAAACC
CAAAGGGAGAGAAGCCCCTTATAAAACC
TGTA-GAAGGACTGCCCTTTATAAAACC
Fig. Ì.
Multiple alignment of the 2.7-kilobase clone (cl) O-repeat. Multiple alignment
of the 2.7-kilobase clone O-rcpcat dispersed element with the O-repeat elements described
in chromosome 16 \Orepeat, Accession code (AC) M28877], in extrachromosomal cir
cular DNA of HeLa cells (HeLaSr, AC X05913), and in the HPV 16 integration site of the
SiHa cell line (SiHa, AC M15781). *. identical nucleotides in all four aligned sequences;
+ , identical nucleotides in at least three of the aligned sequences.
1307
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1994 American Association for Cancer Research.
HPV (, INTEGRATION
IN TONSILLAR
Table 1 Fit and position of the similarities between the 2.7-kilohase clone ami
different HPV f>hami Id regions
The letters a to / correspond to those on Fig. 1.
Similarity
region(a)
HPV
(s)h(b)
HPV hb E2
Position
CARCINOMA
the same region, a sequence similar to that of the topoisomerase II
consensus cleavage sequence [GTN(A/T)A(T/C)ATTNATNN(G/A)]
is observed at position 931. Cleavage sites preferred by topoisomerase
I (5'-CTT-3' or 5'-GTT-3') are also present adjacent to the integration
clone"715-750995-1029572-594858-936413-3001151-1188HPV2933-29691536-15025371-53934809^48943738-38445305-5344
1/Total29/3723/3518/2348/85
site (nucleotide positions 1158, 1257, 1332, and 1250, 1262.
(as)(c)
HPV 6b El
(s)(d)HPV 6b L2
ról/lOó«728/39°2.7-kilobase
(as)(<•)
HPV fib L2
(s)(f)HPV 16 E2
HPV 16 L2 (s)%816678616974Identica
" See Figs. 1 and 2 for a description of the position relative to the integration site and
nucleotide sequence of this 2.7-kilobase clone.
'' s. sense orientation; as, antisense orientation.
1 With one gap.
'' With two gaps.
1271,
respectively), as has also been observed in the M50 cervical carci
noma integration sequence (48).
Chromosomal Localization. The cosmid C2 was used as probe
for in situ hybridization to normal human metaphase chromosomes.
Evaluation by conventional epifluorescence microscopy revealed
highly specific fluorescent signals on the long arm of chromosome 10
as shown in Fig. 4 (see arrows). DAPI banding revealed the location
of this signal on 10q24. The majority of the evaluated 30 metaphases
showed specific signals on both chromosome homologs. Since no
Fig. 4. Mapping of cosmid C2 to 10q24 by fluo
rescence in situ hybridization to normal human
metaphase chromosomes. Hybridized probe was de
ed via FITC (see arrows) whereas chromosomes
e banded by DAPI (see "Materials and Meth"). A, complete metaphase (note the signal
sp cificity). B-D, examples of chromosome 10 ho
mi ogs after hybridization lo demonstrate the localion in chromosomal band 10q24.
1308
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1994 American Association for Cancer Research.
HPV 6 INTEGRATION
IN TONSILLAR
additional signals were observed in other regions of the human ge
nome, the localization of the HPV 6a integration site is given as
10q24.
For this chromosomal region, fragile sites, breakpoints, protooncogenes, and also the integration of HPV 18 in the cell line FEP18-5
have been described (see "Discussion").
CARCINOMA
H
M
N
M
N
Alterations at Integration Target Site in DNAs from Cell Lines
and Patients. To determine if genomic alterations at the integration
locus in 10q24 are detectable in tumors in which HPV infection may
have played an etiological role, the 800-base pair cellular component
of the original clone (Fig. 1), as well as the 968-base pair fragment
described above were used to probe Southern blots with DNAs from
cell lines, tumors, and control tissues.
When comparing DNA obtained from spontaneously immortalized
keratinocytes (HaCat) (56), which are HPV negative, with DNA from
the HPV-containing cell lines C4-I, C4-II, SW756, and CasKi, derived
from HPV-bearing cervical carcinomas, two bands were seen in HaCat
DNA but only one in cervical carcinoma cell lines after Taq I digestion
(Fig. 5). This was confirmed by using in addition the 968-base pair
fragment as probe, and by digesting cell line DNAs with Bamttt,
EcoRl, and P.v/I. In all tumor-derived cell lines only one band could
be observed (data not shown). However, when analyzing leukocyte
DNA from healthy individuals with Taq I, a restriction fragment
H
C 2 C1
W
K
Fig. 6. Southern blot analysis of genomic DNA from head and neck tumors (Taq I
digestions). Southern blot with Taq l-cleaved genomic DNA from different head and neck
lesions and normal tissue (7-10 /ig/lane). probed with the subcloned cellular component
of the original viral-cellular junction (Fig. I) at stringent conditions of hybridization (/„,
= -15°C). Group F, DNA from a patient with a carcinoma of the floor of the mouth. Lane
M, metastasis; Lane T. tumor; Lane N, normal tissue at tumor location; Lane L, leukocyte
DNA. Group H, DNA from a patient with an hypopharynx carcinoma; Lane M. metastasis;
Lane N. normal tissue at tumor location. Group T. DNA from a patient with a tonsillar
carcinoma; Lane M, metastasis; Lane N, normal tissue at tumor location. Arrows indicate
the 10 and 8-kilobasc pair bands, which correspond to those on Fig. 5.
length polymorphism was detected, which may explain the differences
observed between cell lines (not shown).
Some alterations could be detected which can be considered as
lesion specific, even though a normal tissue DNA from the same
patient was not available for confirmation. This was the case in an
HPV 11-positive vulvar condyloma, in which an amplification of a
5.8-kilobase band was observed, and in a HPV 6a-positive condyloma
acuminatum in which a band of 1.4 kilobases is obtained after Pstl
digestion, whereas all other DNAs analyzed thus far show only a band
of about 10 kilobases when digested with Pstl (not shown). A total of
15 penile condylomas and 10 cervical or vulvar condylomas were
analyzed. The majority was HPV 6 or II positive, with the exception
of one penile condyloma with a mixed HPV 11 plus HPV 31 infection,
one penile and one cervical condyloma with still unknown types, and
two HPV 33- and one HPV 35-positive cervical condylomata (not
shown).
In total, 2 of 25 (8.8%) of the genital condylomas showed alter
ations when analyzed with the 800-base pair probe used originally
(19). To further test the presence of genomic alterations at K)q24,
DNAs from seven head and neck tumors were analyzed by using Taq
Fig. 5. Southern hint analysis of genomic DNA (Taq l digestions). Southern blots with
Taq l-cleaved genomic DNA (10 (¿g/lane)from different cell lines, probed wilh the
I digestion. Two head and neck tumors were HPV 16 positive, one
subcloned cellular component of the original viral-cellular junction (Fig. 1) at stringent
contained a yet unidentified HPV, and the other tumors were negative
conditions of hybridization (tm —¿
-15°C). Molecular weights arc indicated by dashes at
when tested with the use of type-specific and general primer PCR. In
right and left: 23.7: 9.5; 6.7; 4.3; 2.2; and 2.0 kilobase pairs. Cell line DNAs: Lane H,
HaCat; Lane C2, C4-II; Lane Cl, C4-I, Lane W, SW756; Lane K, CosKi.
these cases, DNA from primary tumors or métastasesas well as
130Q
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1994 American Association for Cancer Research.
HPV 6 INTEGRATION
IN TONSILLAR
normal DNA or leukocyte DNA from the same patient were com
pared. In one tonsillar and one hypopharynx carcinoma, the loss of
one alÃ-elewas detected when comparing normal with metastatic tumor
DNA from the same patient (Fig. 6). In both cases the amount of
primary tumor DNA available was not sufficient for Southern blot
analysis. These results could be reproduced when using the 968-base
pair probe. In the other five cases analyzed, no differences between
normal and tumoral tissue could be detected (in Fig. 6, one of these
cases is shown).
DISCUSSION
In this report we describe the nucleotide sequence and chromo
somal localization of a region in normal human genomic DNA which
corresponds to an HPV 6 integration site in an invasive tonsillar
carcinoma (19). Furthermore, we searched for alterations at the ge
nomic target region in different cell lines, tumors, and normal tissues.
Tonsillar carcinomas have recently been found to contain HPVs at
a high frequency, in particular types 16 and 33 (18, 20). The integrated
HPV DNA contained at least the viral upstream regulatory region and
the genes E6 and El, which were expressed at the RNA level (57, 58).
These findings are similar to those in genital tumors and cervical
cancer-derived cell lines (2), supporting the hypothesis of a viral
etiology for tonsillar carcinomas (20), a conception that might in
future be extended to laryngeal carcinomas and other head and neck
tumors as well (14, 15).
Malignant tumors containing HPV 6 or 11 are not frequent but some
cases have been described: vulvar carcinomas (6, 59), cervical carci
nomas (4),4 malignant progression of laryngeal papillomas (8-11),
and in most Buschke-Löwensteintumors (5). In some human malig
nant tumors HPV 6 or 11 DNA is not only present but also integrated
(60). The question remains whether the same genomic regions serve as
targets for the different HPV types. The demonstration of an HPV 6
integration by cloning and sequencing (19) was of particular interest,
because it enabled us to compare nucleotide sequences and chromo
somal locations already described as targets for integration of highrisk genital HPVs (like HPVs 16 and 18), with that of a low-risk type.
We have compared the genomic target region of HPV DNA in the
tonsillar carcinoma with those for HPV integration in genital cancers.
Most of those integration sites were described in cell lines, and while,
at low passage number, they most likely represent integration events
that occurred in the tumors, a selection for certain integration events
favoring growth in cell culture could complicate the interpretation
(35). A further difficulty is the lack of sequence information in most
cases, and the absence of information about the normal counterparts of
integration sites. Nevertheless, when comparing the cellular sequences
surrounding the integration site with those already in the databases,
several common features could be detected.
The 2.7-kilobase clone contains two repetitive sequences. DNA of
HPVs has been reported previously to integrate near repetitive se
quences, particularly Alu repeats (e.g., SW756 and SiHa cell lines)
(54, 61), but there are also examples in which no repeats are present
in the vicinity of integrated HPV DNA. The ME 180 cell line (26), in
which HPV 68 DNA was found, and the HPV 16 containing M50
cervical carcinoma DNA (48) are two of such cases. In the tumor
analyzed here, the HPV 6 DNA target turned out to be a region already
containing nonviral mobile genetic elements. This is shown by the
presence of a truncated LINE 1 family repeat element and a small
fragment of an O-repeat element. Truncated LINE 1 elements lacking
a 3' terminal A-rich tract (as found in the 2.7-kilobase clone), are
believed to be inserted by DNA-mediated events, like recombination
between extrachromosomal LINE 1-containing circles and the chro
mosome (62).
4 T. Kahn, E. Turazza. R. Ojeda. and S. Grinstcin, unpublished results.
CARCINOMA
A sequence very similar to the short fragment of the O-repeat found
in the 2.7-kilobase clone, has also been found downstream of the HPV
16 integration site in the SiHa cell line (54) (Fig. 3). Future experi
ments will show whether this fragment of an O-repeat element can be
detected with some regularity near HPV integration sites. Immediately
upstream of the integration site in the tonsillar carcinoma DNA, the
2.7-kilobase sequence shows a variable degree of similarity to HPV
sequences, particularly to the E2 and L2 regions of different high-risk
HPV types. These E2 and L2 regions are frequently involved in the
recombinational events leading to integration (24, 63). These findings
are consistent with the mechanism of integration proposed by Choo et
al. (48), in which short patches of similar sequences between heterologous genomes are required for anchorage and as guide for cross
over during nonhomologous recombination.
The AT-rich regions and preferred topoisomerase I cleavage sites at
or adjacent to the integration junction, described in the M50 cervical
carcinoma DNA (48), could also be found in the 2.7-kilobase DNA. In
addition, a topoisomerase II consensus cleavage site is present in the
2.7-kilobase sequence, as well as direct and inverted repeats. In vitro
illegitimate recombination experiments using the normal cloned target
sequences and HPV 6 will be necessary to shed more light on which
sequences are the most relevant during the actual integration process.
Focusing on HPV DNA integration at the chromosomal level, it is
noteworthy that HPV DNA integrates frequently near cellular protooncogenes, fragile sites, or chromosomal breakpoints, for instance
the myc oncogene locus on chromosome 8 (30-32, 35-37, 39).
Meanwhile, a growing number of integration locations for HPVs
have been reported, suggesting that, besides the myc locus at 8q2,
additional preferred HPV DNA integration sites may exist (33-35, 38,
39). In the tonsillar carcinoma, the integration took place at chromo
some 10q24. Recently, a keratinocyte cell line immortalized by transfection of HPV 18 (FEP18-5) has been established, in which the viral
DNA integrated at 10q24-q23 (39).
The HPV 18 integration in the cell line FEP18-5 occurred directly
into a fragile site inducible by aphidicolin (39). Two breakpoints with
clinical relevance have also been described at this location. One is
observed in 7% of patients with T-cell acute lymphocytic leukemias as
a translocation t(10;14)(q24;qll). The second one, detected in
t(10;14)(q24;q32) translocations, is also found in 7% of B-cell nonHodgkin lymphomas. Protooncogenes have been described at these
locations: the Hoxi] gene (64—66),
and the Lyt-W gene, a member of
the NF-KB-rel family (67). In addition, at least four other genes that
may play a role in tumorigenesis are also located at 10q23-24. These
include the APO-1 antigen locus at 10q23 involved in apoptosis (68),
and a kinesin-related gene at 10q24.1 (69). Kinesin-related proteins
are involved in cell division. The terminal deoxynucleotidyltransferase gene at 10q23.24 (70), and the O6-methylguanine-DNA methyl-
transferase gene at 10q24.33qter (71). It remains to be determined
whether any of these genes are modified frequently in head and neck
tumors.
In the tonsillar carcinoma DNA, the long arm of chromosome 10
was altered due to the HPV 6 DNA integration. The corresponding
normal alÃ-elewas not detectable. Therefore we speculated that the
HPV insertion could have disrupted a region important for cell growth
regulation. Our analysis of a limited number of tumors indicates that
alterations in the region on 10q24 are also observed in other HPVrelated lesions. A greater number of tumors, and the availability of
normal and tumoral tissue from the same patients, will be needed to
extend the analysis in order to clarify whether mutations in 10q24 do
indeed contribute to tumorigenesis.
The data of our study fit well with the current hypothesis stating
that specific types of HPVs seem to be necessary but not sufficient for
the development of carcinomas at different sites, and that additional
modifications of cellular genes are required to render the cells inca1310
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1994 American Association for Cancer Research.
HPV <i INTEGRATION
IN TONSILLAR
pable of controlling the persisting viral genes (22, 72). Integration
could enable HPVs to evade normal ¡ntracellular surveillance, and
may directly disrupt critical cellular functions.
ACKNOWLEDGMENTS
We thank H. Adldinger and E. Schwarz for critical reading of the manu
script. O. Ritter for help in database searching, and C. Lohrey and S. Weitz for
excellent technical assistance.
REFERENCES
1. de Villiers, E-M. Humanpathogenic papillomavirus types: an update. Curr. Top.
Microhiol. Immunol., in press, 1994.
2. zur Hausen. H. Human papillomaviruses in the pathogenesis of anogenital cancer.
Virology, 184: 9-13, 1991.
3. zur Hausen, H. Papillomavirus-host cell interactions in the pathogenesis of anogenital
cancer. In: J. Brugge, T. Curran, E. Harlow, and F. McCormick (cds.). Origins of
Human Cancer: A Comprehensive Review, pp. 685-705. Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory Press, 1991.
4. Gissmann, L., Wolnik, L., Ikenberg, H., Koldovsky, U., Schnürch,H. G., and zur
Hausen, H. Human papillomaviruses type 6 and 11 sequences in genital and laryngeal
papiliomas and in some cervical cancer biopsies. Proc. Nati. Acad. Sci. USA, 80:
560-563, 1983.
5. Boshart. M., and zur Hausen, H. Human papillomavirus in Buschke-Löwenstein
tumors: physical state of the DNA and identification of a tandem duplication in the
non-coding region of a HPV 6-subtype. J. Virol., 58: 963-966, 1986.
6. Rando, R.. Groff, D-, Chirikjian. J., and Lancaster. W. Isolation and characterization
of a novel human papillomavirus type 6 DNA from an invasive vulvar carcinoma. J.
Virol., 57: 353-356, 1986.
7. Mounts. P., Shah. K. V., and Kashima. H. Viral etiology of juvenile- and adult-onset
squamous papilloma of the larynx. Proc. Nati. Acad. Sci. USA, 79: 5425-5429, 1982.
8. Zarod, A. P., Rutherford, J. D.. and Corbitt. G. Malignant progression of laryngeal
papilloma associated with human papillomavirus type 6 (HPV-6) DNA. J. Clin.
Pathol., 41: 280-283, 1988.
9. Kashima, H., Wu, T. C., Mounts, P., Heffner, D., Cachay, A., and Hyams, V. Carci
noma ex-papilloma: histologie and virologie studies in whole-organ sections of the
larynx. Laryngoscope, 98: 619-624, 1988.
H). Byrne, J., Tsao, M., Fraser, P., and Howley, P. Human papillomavirus 11 DNA in a
patient with chronic laryngotracheo-bronchial
papillomatosis and metastatic squa
mous cell carcinoma of the lung. N. Engl. J. Med., 317: 873-878, 1987.
11. Lindeberg, H., Syrjaenen, S.. Kaerjae, J., and Syrjacnen. K. Human papillomavirus
type 11 DNA in squamous cell carcinomas and pre-existing multiple laryngeal pap
iliomas. Acta Oto-Laryngol., 707: 141-149, 1989.
12. Brandsma, J. L.. Steinberg, B., Abramson, A. L., and Barbosa, W. Presence of human
papillomavirus type 16 related sequences in verrucous carcinomas of the larynx.
Cancer Res.. 46: 2185-2188. 1986.
13. Kahn, T., Schwarz, E., and zur Hausen, H. Molecular cloning and characterization of
the DNA of new human papillomavirus (HPV 30) from a laryngeal carcinoma. Int. J.
Cancer, 37: 61-65, 1986.
14. Simon. M.. Kahn, T., Schneider, A., and Pirsig, W. Laryngeal carcinoma in a 12-year
old child associated with HPV 18 and 33. Arch. Otolar. Head and Neck Surg., in press,
1994.
15. Anwar, K.. Nakakuki, K., Naiki, H., and Inuzuka, M. ras gene mutations and
HPV infection are common in human laryngeal carcinoma. Int. J. Cancer, 53: 22-28,
1993.
16. de Villici«,E. M., Weidauer, H., Otto, H., and zur Hausen, H. Papillomavirus DNA
in human tongue carcinomas. Int. J. Cancer, 36: 575-578, 1985.
17. Brandsma, J. L., and Abramson, A. L. Association of papillomavirus with cancers of
the head and neck. Arch. Otolaryngol. Head Neck Surg., 115: 621-625, 1989.
18. Niedabitek, G., Pitteroff, S., Herbst, H., Shepherd, P., Finn, T., Anagnostopoulos, L,
and Stein, H. Detection of human papillomavirus type 16 DNA in carcinomas of the
palatine tonsil. J. Clin. Pathol., 43: 918-921, 1990.
19. Bercovich, J. A., Ries Centeno, C., Gonzalez Aguilar, O., Grinstein, S., and Kahn, T.
Presence and integration of human papillomavirus type 6 in a (ensillar carcinoma. J.
Gen. Virol., 72: 2569-2572, 1991.
20. Snijders, P. J., Cromme, F. V. van den Brulé,
A. J. C., Schrijnemakers. H. F. J., Snow,
G. B., Mcijier, C. J. L. M., and Walboomcrs, J. M. M. Prevalence and expression of
human papillomavirus in tonsillar carcinomas indicates a possible viral etiology. Int.
J. Cancer, 5/: 845-850, 1992.
21. Wu, T-C., Trujillo. J. M., Kashima, H., and Mounts, P. Association of human papil
lomavirus with nasal neoplasia. Lancet, 341: 522-524, 1993.
22. zur Hausen, H. Papillomavirus in anogenital cancer as a model to understand the role
of viruses in human cancers. Cancer Res., 49: 4677^*681, 1989.
23. Cullen, A. P., Reid, R., Campion, M., and Lörincz,A. T. Analysis of the physical state
of different human papillomavirus DNAs in intraepthelial and invasive cervical
neoplasm. J. Virol., 65: 606-612, 1991.
24. Schwarz, E., Freese, U. K., Gissmann, L., Mayer, W., Roggenbuck, B., Stremlau, A.,
and zur Hausen, H. Structure and transcription of human papillomavirus sequences in
cervical carcinoma cells. Nature (Lond.), 314: 111-114, 1985.
25. McCance, D. J. Human papillomavirus and cancer. Biochim. Biophys. Acta, 823:
195-205, 1986.
26. Reuter, S., Delius, H.. Kahn, T., Hofman, B., zur Hausen, H., and Schwarz, E.
Characterization of a novel human papillomavirus DNA in the cervical carcinoma cell
line ME180. J. Virol.. 65: 5564-5568, 1991.
CARCINOMA
27. Kaur, P., and McDougall, J. K. Characterization of primary human keratinocytes
transformed by human papillomavirus type 18. J. Virol., 62: 1917-1924, 1988.
28. Romanczuk, H., Thierry, F., and Howley, P. M. Mutational analysis of cis elements
involved in E2 modulation of human papillomavirus type 16 P97 and type 18 P105.
J. Virol., 64: 2849-2859, 1990.
29. Hashida, T, and Yasumoto, S. Induction of chromosome abnormalities in mouse and
human epidermal keratinocytes by the human papillomavirus type 16 E7 oncogene. J.
Gen. Virol., 72: 1569-1577, 1991.
30. Cannizzaro, L. A., Dürst,M.. Méndez,M. J., Hecht, B. K., and Hecht, F. Regional
chromosome localization of human papillomavirus integration sites near fragile sites,
oncogenes, and cancer chromosome breakpoints. Cancer Genet. Cytogenet., 33:
93-98, 1988.
31. Popescu, N. C., DiPaolo, J. A., and Ambsbough, S. C. Integration sites of human
papillomavirus 18 DNA sequences on HeLa cell chromosomes. Cytogenet. Cell
Genet., 44: 58-62, 1987.
32. Durst, M., Croce, C. M., Gissmann, L., Schwarz, E., and Huebner, K. Papillomavirus
sequences integrate near cellular oncogenes in some cervical carcinomas. Proc. Nati.
Acad. Sci. USA, 84: 1070-1074, 1987.
33. Popescu, N., Amsbough, S. C., and Di Paolo, J. A. Human papillomavirus type 18
DNA is integrated at a single chromosome site in cervical carcinoma cell line SW756.
J. Virol., 51: 1682-1685, 1987.
34. Sastre-Garau, X., Schneider-Maunoury, S., Couturier, J., and Orth, G. Human papil
lomavirus type 16 DNA is integrated into chromosome region 12ql4-ql5 in a cell line
derived from a vulvar intraepithelial neoplasia. Cancer Genet. Cytogenet., 44:
243-251, 1990.
35. Couturier, J., Sastre-Garau, X., Schneider-Maunoury, S., Labib, A., and Orth, G.
Integration of papillomavirus DNA near myc genes in genital carcinomas and its
consequences for proto-oncogene expression. J. Virol., 65: 4534—4538, 1991.
36. Hori, T, Ichimura, H., Minamihisamatsu, M., Takahashi, E., Yamauchi, M., Hama, Y,
Kurimura, O., Yamasaki, M., and Kurimura, T. Chromosomal insertion and amplifi
cation of human papillomavirus 16 DNA sequences in a cell line of argyrophil small
cell carcinoma of the uterine cervix. Jpn. J. Cancer Res., 82: 371-375, 1991.
37. Popescu, N. C., and Di Paolo, J. A. Integration of human papillomavirus 16 DNA and
genomic rearrangements in immortalized human keratinocyte lines. Cancer Res., 50:
1316-1323, 1990.
38. Debiec-Rychter, M., Zukowski, K., Wang, C. Y, and Wen, W. N. Chromosomal
characterizations of human nasal and nasopharyngeal cells immortalized by human
papillomavirus type 16 DNA. Cancer Genet. Cytogenet., 52: 51-61, 1991.
39. Smith, P. P., Friedman, C. L., Bryant, E. M., and McDougall, J. K. Viral integration
and fragile sites in human papillomavirus immortalized human keratinocyte cell lines.
Genes Chromosom. Cancer, 5: 150-157, 1992.
40. Haibert, C. C., Deniers, G. W., and Galloway, D. A. The E7 gene of human papillo
mavirus type 16 is sufficient for immortalization of human epithelial cells. J. Virol.,
65: 473-478, 1991.
41. Ponder, B. Gene losses in human tumours. Nature (Lond.), 335: 400-402, 1988.
42. Poustka, A., Rackwitz, H-R., Frischauf, A-M„Hohn, B., and Lehrach. H. Selective
isolation of cosmid clones by homologous recombination in E. coli. Proc. Nati. Acad.
Sci. USA, 81: 4129-4133, 1984.
43. Ehrich, E., Craig, A., Poustka, A., Frischauf, A-M., and Lehrach, H. A family of
cosmid vectors with the multi-copy R6K replication origin. Gene (Amst.), 57:
229-237, 1987.
44. Lichter, P., Tang, C. C., Call. K., Hermanson, G., Evans, G. A., Housman, D., and
Ward, D. C. High resolution mapping of human chromosome 11 by in situ hybrid
ization with cosmid clones. Science (Washington DC), 247: 64-69, 1990.
45. Lichter, P.. and Cremer, T. Chromosome analysis by non-isotopic in situ hybridiza
tion. In: D. E. Rooney and B. H. Czepulkowski (eds.). Human Cytogenetics: A
Practical Approach, pp. 157-192, Oxford, England: IRL Press, 1992.
46. van den Brulé,A. J. C., Claas, E. C. J., du Maine, M., Melchers, W. J. G., Helmerhorst, T., Quint, W. G. V, Lindeman, J., Meijer, C. J. L. M., and Walboomers, J. M.
M. Use of anticontamination primers in the polymerase chain reaction for the detec
tion of human papilloma virus genotypes in cervical scrapes and biopsies. J. Med.
Virol., 29: 20-27, 1989.
47. Snijders, P. J. F., van den Brûle,H. F. J., Schrijnemakers, G., Snow, G. B., Meijer, C.
J. L. M., and Walboomers, J. M. M. The use of general primers in the polymerase
chain reaction permits the detection of a broad spectrum of human papillomavirus
genotypes. J. Gen. Virol., 71: 173-181, 1990.
48. Choo, K-B., Lee, H-H., Liew, L-N., Chong, K-Y, and Chou, H-F. Analysis of the
unoccupied site of an integrated human papillomavirus 16 sequence in a cervical
carcinoma. Virology, 178: 621-625, 1990.
49. Dombroski. B. A., Mathias, S. L., Nanthakumar, E., Scott, A. F, and Kazazian, H. H.,
Jr. Isolation of an active human transposuble element. Science (Washington DC), 254:
1805-1807, 1991.
Scott, A. F., Schmeckpeper, B. J., Abdelrazik, M., Theisen Comey, C., O'Hara, B.,
50.
51.
52.
53.
54.
Rossiter, J. P., Cooley, T, Heath, P., Smith, K. D., and Margóle!, L. Origin of the
human LI elements: proposed progenitor genes deduced from a consensus DNA
sequence. Genomics, /: 113-125, 1987.
Fields, C. A., Grady, D. L., and Moyzis, R. K. The human THE-LTR(O) and Mst\\
interspersed repeats are subfamilies of a single widely distributed highly variable
repeat family. Genomics, 13: 431^(36, 1992.
Misra, R., Matera, G., Schmid, C., and Rush, M. Recombination mediates production
of an extrachromosomal circular DNA containing a transposon-like element, THE-1.
Nucleic Acids Res., 17: 8327-8341, 1989.
Wong, Z., Royle, N. J., and Jeffreys, A. J. A novel human DNA polymorphism
resulting from transfer of DNA from chromosome 6 to chromosome 16. Genomics, 7:
222-234, 1990.
Baker, C. C., Phelps, W. C., Lindgren, V, Braun, M. J., Gonda, M. A., and Howley,
P. M. Structural and transcriptional analysis of human papillomavirus type 16 se
quences in cervical carcinoma cell lines. J. Virol., 61: 962-971, 1987.
1311
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1994 American Association for Cancer Research.
HPV f> INTEGRATION
IN TONSILLAR
55. Bae, Y-S., Kawasaki, I., Ikeda, H., and Liu, L. F. Illegitimate recombination mediated
by calf thymus DNA topoisomcrase II //; vitro. Proc. Nati. Acad. Sci. USA, 85:
2076-2080,1988.
56. Boukamp, P., Dzarlieva-Petrusevska, R. T., Breitkreutz, D., Hornung, J., Markham.
A., and Fuscnig, N. Normal keratinization in a spontaneously immortalized aneuploid
human keratinocyte cell line. J. Cell. Biol., 106: 761-771, 1988.
57. Snijders, P. J. F., Meijer, C. J. L. M.. van den Brulé,A. J. C. Schrijnemakers, H. F.
J., Snow, G. B., and Walboomers, J. M. M. Human papillomavirus type 16 and 33
E6/E7 region transcripts in tonsitlar carcinomas can originate both from integrated
and episomal HPV DNA. J. Gen. Virol., 73: 2059-2066, 1992.
58. Snijders, P. J. F., van den Brulé,A. J. C., Schrijnemakers, H. F. J., Raaphorst, P. M.,
Meijer, C. J. L. M., and Walboomers, J. M. M. Human papillomavirus type 33 in a
tonsillar carcinoma generates its putative E7 mRNA via two E6* transcript species
which are terminated at different early region poly (A) sites. J. Virol., 66: 3172-3178,
1992.
59. Sutlon, G. P., Stelman, F. B., Ehrlich, C. E., and Roman, A. Human papillomavirus
desoxirribonucleic acid in lesions of the female genital tract: evidence for type 6/11
in squamous carcinoma of the vulva. Obstet. Gynecol., 70: 564-568, 1987.
60. Manias. D.. Ostrow, R., McGlennen, R., Estensen, R., and Paras, A. Characterization
of integrated human papillomavirus type 11 DNA in primary and metastatic tumors
from a renal transplant recipient. Cancer Res.. 49: 2514-2519, 1989.
61. Schneider-Gadicke, A., and Schwarz, E. Different human cervical carcinoma cell lines
show similar transcription patterns of human papillomavirus type 18 early genes.
EMBO J., 5: 2285-2292, 1986.
62. Weiner. A., Deininger, P. L., and Efstratiadis. A. Nonviral réimposons:genes, pseudogenes, and transposable elements generated by the reverse flow of genetic infor
mation. Annu. Rev. Biochem.. 55: 631-661, 1986.
63. Wagatsuma. M., Hashimoto, K., and Matsukura, T. Analysis of integrated human
papillomavirus type 16 DNA in cervical cancers: amplification of viral sequences
together with cellular Hanking sequences. J. Virol., 64: 813-821, 1990.
CARCINOMA
64. Hatano, M., Roberts, C. W. M., Minden, M., Crist, W. M., and Korsmayer, S. J.
Deregulation of a homeobox gene.//orli,
by the t(10;14) inT-cell leukemia. Science
(Washington DC), 253: 79-82, 1991.
65. Zutter. M.. Hocket, R. D., Roberts, C. W. M.. McGuire, E. A., Bloomslone, J., Morton,
C. C., Deaven, L. L., Crist, W. M., Carroll. A. J.. and Korsmayer, S. J. The 1(10; 14)(q24;qll) of T-cell acute lymphoblastic leukemia juxtaposes the T-cell receptor with
TCL3, a conserved and activated locus at 10q24. Proc. Nail. Acad. Sci. USA, 87:
3161-3165, 1990.
66. Kennedy, M. A., Gonzalez-Sarmiento, R., Kees, U. R., Lampert, F., Dear, N., Boehm,
T., and Rabbits, T. H. HOX11, a homeobox-containing T-cell oncogene on human
chromosome 10q24. Proc. Nati. Acad. Sci. USA, 88: 8900-8904, 1991.
67. Neri, A., Chang, C-C, Lombardi. L., Salina, M., Corradini, P., Maiolo, A. T., Chaganti. R. S. K., and Dalla-Favera, R. B cell lymphoma-associatcd chromosomal
translocation involves candidale oncogene ivi-10. homologous to NF-kB p50. Cell, 7:
1075-1087. 1991.
68. Lichter, P., Walczak, H.. Weitz, S., Behrmann. 1., and Krammer, P. The human APO-1
(APT) antigen maps to 10q23, a region that is syntenic with mouse chromosome 19.
Genomics, 14: 179-180, 1992.
69. Tihy, F., Kress, M., Harper. M.. Dutrillaux. B.. and Lemieux. N. Localization of the
human kinesin-related gene to band 10q24 by fluorescence in siiti hybridization.
Genomics, 13: 1371-1372, 1992.
70. Yang-Feng, T. L., Landau, N. R., Baltimore, D., and Francke, U. The terminal
deoxynucleotydiltransferase
gene is located on human chromosome 10 (10q23-q24)
and on mouse chromosome 19. Cytogenet. Cell Genet.. 43: 121-126, 1986.
71. Gardner, E., Rydberg, B., Karran. P., and Ponder. B. A. J. Localization of the human
O''-methylguanine-DNA
methyltransferase
gene to chromosome
10q24.33-qter.
Genomics, 11: 475^t76. 1991.
72. zur Hausen. H. Inlracellular surveillance of persisting viral infections: human genital
cancer results from deficient cellular control of papillomavirus gene expression.
Lancet, 2: 489-491, 1986.
1312
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1994 American Association for Cancer Research.
Integration of Human Papillomavirus Type 6a DNA in a Tonsillar
Carcinoma: Chromosomal Localization and Nucleotide
Sequence of the Genomic Target Region
T. Kahn, E. Turazza, R. Ojeda, et al.
Cancer Res 1994;54:1305-1312.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/54/5/1305
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 1994 American Association for Cancer Research.