Promoter Polymorphisms of Human Paraoxonase PON1
Gene and Serum Paraoxonase Activities and Concentrations
Ilia Leviev, Richard W. James
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Abstract—Paraoxonase (PON) is a serum enzyme with a wide species distribution. It protects lipoproteins from toxic
oxidative modifications and is an antiatherogenic mechanism of major potential. Activity levels of PON are major
determinants of the protective function; consequently, factors that influence PON levels are of particular relevance. The
present study has identified 3 polymorphisms in the promoter region of the human PON1 gene. Cell transfection studies
have revealed their variable impact on promoter activity, with up to 2-fold differences in reporter gene expression.
Genotyping studies have established that the polymorphisms are frequent in the population, a finding that is consistent
with a major impact on PON concentrations. The physiological relevance of the polymorphisms was underlined by
showing that they are associated with highly significant differences in serum concentrations and activities of PON. The
study thus firmly establishes a genetic basis for variations in serum PON levels and, consequently, serum PON activity.
It is consistent with the suggestion that variations in a major antioxidant function of high density lipoprotein are, to an
important degree, genetically determined. (Arterioscler Thromb Vasc Biol. 2000;20:516-521.)
Key Words: HDL 䡲 atherosclerosis 䡲 oxidative stress 䡲 gene expression
P
araoxonase (PON) is a human serum enzyme entirely
complexed to HDLs.1 Clinical interest in the enzyme was
initially derived from its ability to neutralize highly toxic,
exogenous derivatives (eg, pesticides and nerve gases2). More
recently, it has been hypothesized that PON fulfills an
analogous role, that of protecting lipids from toxic oxidative
modifications.3,4 Because the latter constitutes the principal
atherogenic modification of serum LDLs, the ability of PON
to limit oxidation represents a major antiatherogenic mechanism, and a growing body of data supports that contention.3– 6
In particular, these data have demonstrated that the PON
content of HDL is a major determinant of the antioxidant
function and, consequently, the anti-inflammatory capacity of
the lipoprotein.2,7,8 Factors that influence PON levels are thus
of major consideration for the efficacy of its protective
function.
There are substantial interindividual variations in serum
PON concentrations that cannot be fully explained by known,
coding region polymorphisms.2,9 We have recently demonstrated an association of serum concentrations with a polymorphism at amino acid 54 of the coding region.9 In complementary studies, we have observed differences in the
levels of hepatic mRNA arising from the PON1 alleles
defined by the L54M mutation.10 This implicates gene expression as a major source of variations in serum PON
activities and concentrations.
The present study examined the hypothesis that polymorphisms are present in the promoter region of the human
PON1 gene and are implicated in variations in serum PON
levels. We report the identification of 3 polymorphisms,
which have been characterized with respect to their influence
on promoter activity. The physiological relevance of the
polymorphisms was analyzed by studying their association
with serum concentrations and activities of PON. Finally,
their association with PON polymorphisms in the coding
region of the gene has been determined.
Methods
Amplifying and Cloning the PON1 Gene
Promoter Region
In initial studies, the DNA region upstream from the PON1 gene was
amplified with the Genome Walker kit (Clontech) by using antisense
primers I (ATCCGGATCCGGGGATAGACAAAGGGATCGATG)
and II (AGAGTGCCAGTCCCATCCCCAAGAG). By use of the
SspI library, a 1100-bp fragment was obtained. After sequencing this
fragment, a third primer was designed (primer III, AAAACGCGTCCCACCTCCACCATTGGGGAAAACGCGTCAGATATTCCAGAAGAGAGAAGG), and primers I and III were used to amplify a
1027-bp fragment upstream from the PON1 gene coding region.
Polymerase chain reaction (PCR) conditions were as follows: 94°C
for 3 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C
for 1 minute, and 72°C for 3 minutes. PCR products were digested
with MluI and BamHI (sites incorporated via the PCR primers) and
cloned into MluI/BglII-digested plasmid. Cloned PCR products were
sequenced by use of the T7Sequencing kit (Pharmacia).
Screening for PON Promoter Polymorphisms
Analysis of Position T(ⴚ107)C
Hybridization with allele-specific oligonucleotides was used to
analyze polymorphisms at the T(⫺107)C position (Figure 2). PCR-
Received May 25, 1999; revision accepted June 25, 1999.
From the Clinical Diabetes Unit, Division of Endocrinology and Diabetology, University Hospital, Geneva, Switzerland.
Correspondence to Richard W. James, Clinical Diabetes Unit, Division of Endocrinology and Diabetology, University Hospital, 1211 Geneva 14,
Switzerland. E-mail [email protected]
© 2000 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol. is available at http://www.atvbaha.org
516
Leviev and James
Human PON1 Gene Promoter Polymorphisms
517
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Figure 1. Polymorphic sequences within the 5⬘ region of the PON1 gene. The polymorphic nucleotides are shown in bold type, and
their positions are indicated with arrows. Numbering is determined by the PON initiation codon (to the right). Distances between the
indicated nucleotide sequences are given in italics. The possible binding site for the transcription factor Sp1 is framed.
amplified fragments of the promoter region were loaded onto a nylon
membrane (Porablot NYamp, Macherey-Nagel) and hybridized either with oligonucleotide IV (CCGCCCCACCCCTCCC), which is
specific for nucleotide T at ⫺107, or with oligonucleotide V
(GGGAGGGGCGGGGCGG), which is specific for nucleotide C at
⫺107. With oligonucleotide IV, hybridization was performed at
37°C, followed by 2 washes with 2⫻ SSC/0.1% SDS at room
temperature. With oligonucleotide V, hybridization was performed at
54°C, followed by 2 washes with 2⫻ SSC/0.1% SDS at room
temperature and 1 high-stringency wash with 1⫻ SSC/0.1% SDS at
60°C.
single nucleotide position under study. Renilla luciferase gene from
plasmid pRLSV40 (Promega) was used as control for transfection
efficiency. The vectors were transfected into the hepatoma cell line
Hep G2 at 50% confluence by using 5 ␮g of DNA and 15 ␮L of the
transfection agent SuperFect (Qiagen). Transfected cells were grown
for 24 hours after transfection before being harvested for analysis of
firefly and Renilla luciferase activities by use of the Dual Luciferase
Reporter Assay kit (Promega).
The Hep G2 cell line was obtained from the European collection
of cell cultures. The cells were grown in DMEM containing 10%
fetal calf serum (GIBCO).
Analysis of Position G(ⴚ824)A
PON Activities and Mass Concentrations
Hybridization with allele-specific oligonucleotides was also used to
analyze the polymorphism at position ⫺824 (Figure 2). Allelespecific oligonucleotides were VI (TGACTGCTATTCTTCAG),
which is specific for nucleotide A at ⫺824, and VII (CTGAAGAACAGCAGTCA), which is specific for nucleotide G at ⫺824.
Hybridization was performed at 44°C and was followed by 2 washes
with 2⫻ SSC/0.1% SDS at room temperature and 2 washes with
0.1⫻ SSC/0.1% SDS at room temperature.
PON enzymatic activities were assayed in human serum samples as
described previously11 by using both phenylacetate and paraoxon as
substrates. A control pool of human sera, independently calibrated by
Dr M. Mackness (University of Manchester, School of Medicine,
Manchester, UK), was used to standardize activity assays. Mass
measurements were performed by a competitive ELISA, as described
previously in detail.11
Analysis of Position G(ⴚ907)C
Genotyping of PON Coding
Region Polymorphisms
Allele-specific PCR was used to analyze this position. The sense
allele-specific primers were VIII (CAGCAGACAGCAGAGAAGAGAC), which is specific for nucleotide C at ⫺907, and IX
(CAGCAGACAGCAGAGAAGAGAG), which is specific for nucleotide G at ⫺907. The opposing antisense primer was primer I.
PCR conditions were as described above, except that the annealing
temperature was 62°C. Taq polymerase and Q solution from Qiagen
were used in reactions.
For all oligonucleotides, hybridization was performed in ExpressHyb solution (Clontech) for 1.5 hours in the presence of 1
pmol/mL of 33P-labeled oligonucleotide.
Reporter Gene Vector, Cell Transfection, and
Cell Culture
DNA fragments (1027 bp) from individuals who differed in PON1
promoter structure were obtained by PCR amplification with the use
of primers I and III of the chromosomal DNA region adjacent to the
PON1 open reading frame. Fragments were digested with MluI and
BamHI (restriction sites within the PCR primers) and inserted before
the firefly luciferase reporter gene in the pGL2Basic (Promega)
derivative. Cloned fragments were completely sequenced to ensure
(1) the absence of any nucleotide variations different from those
described in the present report and (2) that promoter sequences that
were paired in transfection studies (Figure 3) differed only in the
DNA was extracted from blood cells, and the coding region
polymorphisms L54M and Q191R were determined by restriction
isotyping.9
Study Populations
The study population (n⫽374; 184 men and 190 women, mean age
47.9⫾0.72 years) consisted of volunteers from the medical research
and the University Hospital, Geneva, Switzerland. They were in
good health according to their answers to a short questionnaire and
were not undergoing any medical treatment or taking any medication
for chronic disease, notably cardiovascular disease and diabetes.
Participants gave a fasting blood sample. Mean serum lipid levels
were within clinically acceptable limits: cholesterol
5.50⫾1.0 mmol/L, triglycerides 1.18⫾0.61 mmol/L, and HDL
cholesterol 1.23⫾0.32 mmol/L. The study was approved by the
ethics commission of the medical faculty, University of Geneva.
Statistical Analyses
Continuous clinical and biological variables were analyzed by 1-way
ANOVA. Categorical variables were compared between groups by
the ␹2 test and crude odds ratio. Allele frequencies were estimated by
the gene-counting method, and Hardy-Weinberg equilibrium was
tested by the ␹2 test.
518
Arterioscler Thromb Vasc Biol.
February 2000
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Genbank, accession number AF051133. No other polymorphisms were detected in 100 samples analyzed by sequencing. Genotyping procedures were developed to analyze the
promoter polymorphisms in the whole population (Figure 2).
The distributions of the genotypes for the 3 promoter polymorphisms are shown in Table 1. In preliminary studies,
genotype frequencies were compared in subjects aged ⬍40
years (n⫽124) and ⬎40 years (n⫽250). These were not
found to be significantly different. The analysis revealed a
strong association between the 3 polymorphisms (for
⫺107⫻⫺907, ␹2⫽185.5, P⬍0.0001; for ⫺107⫻⫺824,
␹2⫽133.5, P⬍0.0001; and for ⫺824⫻⫺907, ␹2⫽97.8,
P⬍0.0001). A strong association was also observed between
the promoter polymorphisms and the polymorphism influencing amino acid 54 of the PON1 gene coding region (for
⫺107, ␹2⫽31.7, P⬍0.0001; for ⫺824, ␹2⫽21.7, P⬍0.0005;
and for ⫺907, ␹2⫽39.9, P⬍0.0001) but not with polymorphism 191.
Figure 2. Hybridization with allele-specific oligonucleotides of
PCR-amplified promoter region sequences. A, Determination of
variable nucleotides at position G(⫺824)A: left; hybridized with
A-specific oligonucleotide VI; right, hybridized with G-specific
oligonucleotide VII. B, Determination of variable nucleotides at
position T(⫺107)C; left; hybridized with C-specific oligonucleotide V; right, hybridized with T-specific oligonucleotide IV. Genotypes are indicated below blots.
Promoter Polymorphisms Are Associated With
Modulated Gene Expression
The influence of the polymorphisms on gene expression was
examined by using reporter gene constructs. These indicated
strong independent impacts of 2 polymorphisms on transcriptional activity of the PON1 promoter (Figure 3). The ⫺107C
variant had ⬇2 times higher activity than did the ⫺107T
variant (P⬍0.05), whereas the ⫺824A polymorphism was
⬇1.7 times more active than the ⫺824G polymorphism
(Figure 3B, P⬍0.05). This is in agreement with the observed
higher serum activities and concentrations of PON associated
with the ⫺107C and ⫺824A polymorphisms (see below). No
significant differences in gene expression were noted when
the ⫺907C and ⫺907G variants were analyzed (Figure 3C).
Further studies are necessary to determine whether there are
interactions between promoter polymorphisms with respect to
gene expression and to define what other factors, both genetic
and nongenetic,10 influence serum concentrations of PON. A
Results
Polymorphisms Exist in Promoter Region of
Human PON1 Gene
From an initial sample of 100 subjects, which had been
characterized with respect to serum PON activities and
concentrations, samples with low, medium, and high concentrations of PON were selected on the rationale that the
concentration level may reflect differences in gene expression. Amplified DNA upstream from the PON open reading
frame was sequenced and revealed 3 polymorphic sites at
nucleotide positions ⫺107 (C or T), ⫺824 (A or G), and
⫺907 (C or G) (Figure 1). The numbering is with respect to
the A of the PON1 initiation codon, which was assigned the
value 0. The complete sequence of the region is accessible at
TABLE 1.
Genotype Frequencies of PON Promoter Polymorphisms
Polymorphic Site
Genotypes
G(⫺907)C
G(⫺824)A
T(⫺107)C
L54M
Q191R
CC (0.36)
GG (0.57)
TT (0.32)
LL (0.42)
AA (0.46)
CG (0.46)
AG (0.36)
CT (0.44)
LM (0.46)
AB (0.45)
GG (0.18)
AA (0.07)
CC (0.24)
MM (0.11)
BB (0.09)
T(⫺107)C
CC
CT
TT
Total
G(⫺907)C
CC
1
18
114
133
CG
23
145
2
170
GG
64
1
0
65
Total
88
164
116
368
Genotypes were determined in healthy volunteers (n⫽368 for ⫺907, n⫽351 for ⫺824, and
n⫽374 for ⫺107). At the top, numbers in parentheses correspond to the fractional distribution of
each genotype. At the bottom, numbers correspond to subjects with the indicated genotype. Promoter
polymorphisms are numbered from the A of the PON initiation codon, which was assigned the value
0. Coding region polymorphisms (L54M and Q191R) are numbered according to the amino acid
positions.
Leviev and James
Human PON1 Gene Promoter Polymorphisms
519
Figure 3. Influence of polymorphisms on activity of PON1 promoter. Paired DNA fragments differed by a single nucleotide (indicated
below figure). The position of the variable nucleotide was T(⫺107)C (A), G(⫺824)A (B), and G(⫺907)C (C). Activities were standardized
to control (Renilla luciferase) activity. Within each pair, the activity of the stronger variant was expressed relative to that of the weaker
variant, which was attributed a value of 1.0 (mean⫾SD of 4 experiments).
minimum conclusion from these studies is that the promoter
polymorphisms strongly influence gene expression.
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Promoter Polymorphisms Are Associated With
Variations in Serum PON Concentrations
and Activities
Table 2 shows the PON concentrations and activities (with
the nondiscriminatory substrate phenylacetate) as a function
of the different polymorphisms. There were highly significant
variations in serum concentrations and activities of PON as a
function of all 3 promoter polymorphisms. Thus, ⫺107T,
⫺824G, and ⫺907C were associated with lower serum PON
levels, whereas ⫺107C, ⫺824A, and ⫺907G were correlated
with the highest concentrations and activities. A gene dose
effect is also evident, with heterozygotes having intermediate
values. Given the strong association between the promoter
polymorphisms and the data on reporter gene expression, it
remains to be determined to what extent each polymorphic
site contributes to variations in enzyme levels (see below).
Table 3 shows the results of stepwise multiple regression
analysis of the different parameters that could influence
serum concentrations of PON. Model A was limited to PON1
gene polymorphisms. It shows that the T(⫺107)C polymorphism has a predominant effect, accounting for 24.7% of
the variation in serum concentrations of PON. The G(⫺907)C
polymorphism was also implicated but did not reach statistical significance (P⫽0.07). Interestingly, the coding region
polymorphism affecting amino acid 54 also made a significant contribution to variations in serum PON concentrations
(4.4% of the variation), whereas no significant contribution
was observed for the coding region Q191R polymorphism.
The PON1 gene polymorphisms accounted for 29.1% of the
variations in serum PON levels. Model B introduced other
parameters, notably serum lipids, into the analysis. They did
TABLE 2.
P
P
Discussion
The present study has identified 3 common polymorphisms in
the promoter region of the human PON1 gene. Transfection
studies demonstrated that they have an important impact on
promoter activity, with up to 2-fold differences in reporter
gene expression between polymorphisms. The physiological
relevance of the polymorphisms was highlighted by showing
that they are associated with highly significant differences in
serum concentrations and enzymatic activities of PON. The
study thus firmly establishes a genetic basis for variations in
serum PON levels and, consequently, serum PON activity.
The physiological aspects of these polymorphisms are important. It has recently been established that the PON content of
HDL is a major determinant of the antioxidant capacity of the
lipoprotein.5,7,8 Our results suggest that this antioxidant function of HDL is, at least in part, genetically determined.
The T(⫺107)C polymorphic site appears to have a dominant effect on expression of the PON1 gene, with a minor
contribution from the G(⫺907)C polymorphic site. We are
presently examining the promoter sequence for possible
transcription sites. The polymorphic position T(⫺107)C lies
within the GGCGGG (the polymorphic site is italicized)
consensus sequence of the binding site for the transcription
factor Sp1.12 Mutations within this site have been previously
shown to affect the promoter activity of other sites.13,14
PON Mass Concentrations and Enzymatic Activities as a Function of Promoter and Coding Region Mutations
Mass concentration, ␮g/mL
Enzymatic
activity, U/mL
not modulate the associations of the T(⫺107)C and L54M
mutations with serum PON, but in this model, the association
with the G(⫺907)C polymorphism was also significant. In
addition, HDL cholesterol, triglycerides, sex, and age were
independently associated with variations in serum concentrations of PON. Model B accounted for 37.7% of the variation
in serum PON levels.
G(⫺907)C
G(⫺824)A
T(⫺107)C
L54M
Q191R
CC: 84.1⫾20.8
CG: 99.3⫾23.6
GG: 112.5⫾18.7
GG: 90.8⫾23.1
AG: 101.9⫾24.8
AA: 111.4⫾16.2
TT: 81.8⫾18.9
CT: 97.0⫾22.2
CC: 114.3⫾20.6
LL: 106.9⫾22.5
LM: 90.6⫾22.3
MM: 80.9⫾18.8
AA: 95.1⫾24.6
AB: 96.4⫾23.4
BB: 102.4⫾23.8
⬍0.0001
⬍0.0001
⬍0.0001
⬍0.0001
NS
CC: 70.6⫾19.1
CG: 86.1⫾26.5
GG: 103.1⫾16.6
GG: 77.5⫾25.4
AG: 89.7⫾23.4
AA: 102.8⫾15.5
TT: 67.8⫾16.5
CT: 84.7⫾26.1
CC: 101.8⫾18.6
LL: 90.2⫾21.3
LM: 80.7⫾27.8
MM: 71.2⫾20.6
AA: 85.7⫾28.6
AB: 80.7⫾21.7
BB: 86.4⫾20.5
⬍0.0001
⬍0.0001
⬍0.0001
⬍0.0001
NS
Values are mean⫾SD for serum PON mass concentrations and enzymatic activities with phenylacetate. Values of P are by ANOVA.
520
Arterioscler Thromb Vasc Biol.
February 2000
TABLE 3. Parameters Associated With Variations in Serum
Concentrations of PON
Variation, %
P
Model A parameter
24.7
⬍0.001
Polymorphism L54M
4.4
⬍0.001
Polymorphism G(⫺907)C
1.0
0.07
Polymorphism T(⫺107)C
Model B parameter
24.7
⬍0.001
Polymorphism L54M
4.6
⬍0.001
HDL cholesterol
3.9
⬍0.001
Polymorphism T(⫺107)C
Triglycerides
Polymorphism G(⫺907)C
Age
Sex
3.6
⬍0.001
1.2
0.04
0.8
0.047
0.8
0.049
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Stepwise forward multiple regression analysis of parameters associated with
variations in serum concentrations of PON is shown. For model A, included in
the analysis were polymorphisms G(⫺824)A and Q191R. The adjusted r2 value
for the model was 29.1. For model B, included in the analysis were
polymorphisms G(⫺824)A and Q191R and cholesterol. The adjusted r2 value for
the model was 37.8.
In a previous study, we reported a significant association
between the coding region L54M mutation and serum PON
levels.9 The present study clarifies this point. It is, in part, due
to the strong association with the promoter polymorphisms.
However, this link does not explain completely the association of L54M with serum PON concentrations, which remained significant in the model containing the promoter
polymorphisms. Thus, when we analyzed samples from
subjects with the same T(⫺107)C genotype (eg, TT homozygotes), there remained a significant difference in PON concentrations between subjects who were homozygous LL
(88.5⫾21.2 mg/mL, n⫽23) or MM (78.2⫾17.5 mg/mL,
n⫽33; by ANOVA, P⬍0.05) for the L54M mutation. The
observation is intriguing because the methionine-leucine
difference at position 54 represents a conservative amino acid
exchange. One possibility is that the latter could nevertheless
affect either protein stability or the association of PON with
HDL, the serum transport vector for the enzyme.
A second important implication of the present study relates
to the association of the PON1 gene with the risk of vascular
disease. Several studies have identified PON as an independent genetic risk factor for coronary disease,9,15–20 although
there is no complete agreement on this point.21,22 These
studies relate to the coding region polymorphisms L54M and
Q191R. The ability of the promoter polymorphisms to modulate serum concentrations of the enzymes to an important
degree suggests that they could influence the association
between the coding region mutations of the PON1 gene and
risk of disease. We are presently investigating this hypothesis. In this respect, it should be noted that polymorphisms
affecting the Sp1 site have previously been shown to have
particularly marked clinical consequences.23,24 A second
possibility is that the promoter polymorphisms could be a
confounding factor in the discordant results concerning the
role of PON as a genetic risk factor. We are also studying this
possibility.
Finally, it should be emphasized that observations involving PON also have implications in the toxicology
field. Studies in animal models have clearly demonstrated
that serum PON activity is protective against certain
environmental poisons derived from organophosphates.2,25,26 In humans, the activity of the polymorphism
arising from the Q191R coding region mutation undoubtedly has a major impact on susceptibility to these compounds. However, within subjects homozygous for Q191R
alleles, there remains a considerable range of enzymatic
activities,27,28 which will modulate susceptibility to poisoning. The present study indicates that in this case there
is also a strong genetic influence.
Acknowledgments
This study was supported by grants from the Swiss National Science
Foundation (Nos. 32-40292.94 and 31-453731.98), the Swiss Cardiology Foundation, the Stanley Thomas Johnson Foundation, and the
AR&J Leenaards Foundation. The technical expertise of MarieClaude Meynet Brulhart, Barbara Kalix, Silvana Bioletto, and Katia
Galan was greatly appreciated. Particular thanks go to Prof A.
Morabia for continual help with statistical analyses and Profs S.
Antonarakis and M. Morris for advice on the analysis of
genotype linkage.
References
1. Blatter M-C, James RW, Messmer S, Barja F, Pometta D. Identification
of a distinct human high-density lipoprotein subspecies defined by a
lipoprotein-associated protein, K-45: identity of K-45 with paraoxonase.
Eur J Biochem. 1993;211:871– 879.
2. La Du BN. Human serum paraoxonase/arylesterase. In: Kalow W, ed.
Pharmacogenetics of Drug Metabolism. New York, NY: Pergamon Press;
1992:51–91.
3. Mackness MI, Arrol S, Abbot C, Durrington PN. Protection of lowdensity lipoprotein against oxidative modification by high-density
lipoprotein associated paraoxonase. Atherosclerosis. 1993;104:129 –135.
4. Watson AD, Berliner JA, Hama SY, La Du BN, Faull KF, Fogelman AM,
Navab M. Protective effect of high density lipoprotein associated paraoxonase: inhibition of the biological activity of minimally oxidized low
density lipoprotein. J Clin Invest. 1995;96:2882–2891.
5. Aviram M, Rosenblat M, Bisgaier CL, Newton RS, Primo-Parma SL, La
Du BN. Paraoxonase inhibits high-density lipoprotein oxidation and preserves its functions: a possible peroxidative role for paraoxonase. J Clin
Invest. 1998;101:1581–1590.
6. Shih DM, Gu L, Xia Y-R, Navab M, Li W-F, Hama S, Castellani LW,
Furlong CE, Costa LG, Fogelman AM, Lusis AJ. Mice lacking serum
paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. Nature. 1998;394:284 –287.
7. Van Lenten BJ, Hama SY, de Beer FC, Stafforini DM, McIntyre TM,
Prescott SM, La Du BN, Fogelman AM, Navab M. Anti-inflammatory
HDL becomes pro-inflammatory during the acute phase response. J Clin
Invest. 1995;96:2758 –2767.
8. Shih DM, Gu L, Hama S, Xia Y-R, Navab M, Fogelman AM, Lusis
AJ. Genetic-dietary regulation of serum paraoxonase expression and its
role in atherogenesis in a mouse model. J Clin Invest. 1996;97:
1630 –1639.
9. Blatter Garin M-C, James RW, Dussoix P, Blanché H, Passa P, Froguel
P, Ruiz J. Paraoxonase polymorphism Met-Leu54 is associated with
modified serum concentrations of the enzyme: a possible link between the
paraoxonase gene and increased risk of cardiovascular disease in diabetes.
J Clin Invest. 1997;99:62– 66.
10. Leviev I, Negro F, James RW. Two alleles of the human paraoxonase
gene produce different amounts of mRNA: an explanation for differences in serum concentrations of paraoxonase associated with the
(Leu-Met54) polymorphism. Arterioscler Thromb Vasc Biol. 1997;17:
3935–3939.
11. Blatter Garin M-C, Abbot C, Messmer S, Mackness MI, Durrington P,
Pometta D, James RW. Quantification of human serum paraoxonase by
enzyme-linked immunoassay: population differences in protein concentrations. Biochem J. 1994;304:549 –554.
Leviev and James
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
12. Kadonaga JT, Carner KR, Masiarz FR, Tjian R. Isolation of cDNA
encoding transcription factor Sp1 and functional analysis of the DNA
binding domain. Cell. 1987;51:1079 –1090.
13. Saikawa Y, Price K, Hance KW, Chen TY, Elwood PC. Structural and
functional analysis of the human KB cell folate receptor gene P4 promoter: cooperation of 3 clustered Sp1-binding sites with the initiator
region for basal promoter activity. Biochemistry. 1995;34:9951–9961.
14. Sun XM, Neuwirth C, Wade DP, Knight BL, Soutar AK. A mutation
(T-45C) in the promoter region of the low density lipoprotein (LDL)receptor gene is associated with mild clinical phenotype in a patient with
heterozygous familial hypercholesterolaemia (FH). Hum Mol Genet.
1995;4:2125–2129.
15. Ruiz J, Blanché H, James RW, Blatter MC, Charpentier G, Morabia A, Passa
P, Froguel P. The polymorphism (Gln-Arg192) of the high-density
lipoprotein-bound enzyme paraoxonase is an independent cardiovascular risk
factor in non-insulin dependent diabetic patients. Lancet. 1995;346:869–872.
16. Serrato M, Marian AJ. A variant of human paraoxonase/arylesterase
(HUMPONA) gene is a risk factor for coronary heart disease. J Clin
Invest. 1995;96:3005–3008.
17. Zama T, Murata M, Matsubara Y, Kawano K, Aoki N, Yoshini H,
Watanabe G, Ishikawa K, Ikeda Y. A 192Arg variant of the human
paraoxonase (HUMPONA) gene polymorphism is associated with an
increased risk for coronary artery disease in the Japanese. Arterioscler
Thromb Vasc Biol. 1997;17:3565–3569.
18. Sanghera DK, Saha N, Aston CE, Kamboh MI. Genetic polymorphisms
of paraoxonase and the risk of coronary heart disease. Arterioscler
Thromb Vasc Biol. 1997;17:1067–1073.
19. Odawara M, Tachi Y, Yamashita K. Paraoxonase polymorphism
(Gln192-Arg) is associated with coronary heart disease in Japanese
noninsulin-dependent diabetic patients. J Clin Endocrinol Metab. 1997;
82:2257–2260.
Human PON1 Gene Promoter Polymorphisms
521
20. Pfohl M, Koch M, Enderle MD, Kühn R, Füllhase J, Karsch KR, Häring HU.
Paraoxonase 192 Gln/Arg gene polymorphism, coronary artery disease, and
myocardial infarction in type 2 diabetes. Diabetes. 1999;48:623–627.
21. Antikainen M, Murtomaki S, Syvänne M, Pahlman R, Tahvanainen E,
Jauhiainen M, Frick MH, Ehnholm C. The Gln-Arg191 polymorphism of
the human paraoxonase gene (HUMPONA) is not associated with risk of
coronary artery disease in Finns. J Clin Invest. 1996;98:883– 885.
22. Herrmann S-M, Blanc H, Poirier O, Arveiler D, Luc G, Evans A,
Marques-Vidal P, Bard J-M, Cambien F. The Gln/Arg polymorphism of
human paraoxonase (PON 192) is not related to myocardial infarction in
the ECTIM study. Atherosclerosis. 1996;126:299 –304.
23. Sakai T, Ohtani N, McGee TL, Robbins PD, Dryja TP. Oncogenic germ
line mutations in Sp1 and ATF sites in the human retinoblastoma gene.
Nature. 1991;353:83– 86.
24. Koivisto UM, Palvimo JJ, Janne OA, Kontula K. A single base substitution in the proximal Sp1 site of the human low density lipoprotein
receptor promoter as a cause of heterozygous familial hypercholesterolemia. Proc Natl Acad Sci U S A. 1994;91:10526 –10530.
25. Brealey CJ, Walker CH, Baldwin BC. A-esterase activities in relation to
the differential toxicity of pirimiphos-methyl to birds and mammals.
Pestic Sci. 1980;11:546 –554.
26. Li W-F, Costa CE, Furlong CE. Serum paraoxonase status: a major factor
in determining resistance to organophosphates. J Toxicol Environ Health.
1993;40:337–346.
27. Playfer JR, Eze LC, Bullen MF, Evans DAP. Genetic polymorphisms and
interethnic variability of plasma paraoxonase activity. J Med Genet.
1976;13:337–342.
28. Humbert R, Adler DA, Disteche CM, Hassett C, Omiecinski CJ, Furlong
CE. The molecular basis of the human serum paraoxonase activity polymorphism. Nat Genet. 1993;3:73–76.
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Promoter Polymorphisms of Human Paraoxonase PON1 Gene and Serum Paraoxonase
Activities and Concentrations
Ilia Leviev and Richard W. James
Arterioscler Thromb Vasc Biol. 2000;20:516-521
doi: 10.1161/01.ATV.20.2.516
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2000 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/20/2/516
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/