From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Plenary paper
Dominant negative mutation of the hematopoietic-specific Rho GTPase, Rac2, is
associated with a human phagocyte immunodeficiency
David A. Williams, Wen Tao, Fengchun Yang, Chaekyun Kim, Yi Gu, Pamela Mansfield, John E. Levine, Bronia Petryniak,
Caroline W. Derrow, Chad Harris, Baoqing Jia, Yi Zheng, Daniel R. Ambruso, John B. Lowe, Simon J. Atkinson,
Mary C. Dinauer, and Laurence Boxer
Rho GTPases control a variety of cellular
processes, including actin polymerization, integrin complex formation, cell adhesion, gene transcription, cell cycle progression, and cell proliferation. A patient
is described who has recurrent infections
and defective neutrophil cellular functions similar to those found in Rac2deficient mice. Molecular methods were
used to clone the expressed Rac2 cDNA
from this patient, and a single base pair
change (G3A at nucleotide 169) in the
coding sequence was identified. This results in an asparagine for aspartic acid mutation at amino acid 57 (D57N), a residue that
is involved in nucleotide binding and is
conserved in all mammalian Rho GTPases.
The cloned cDNA was then introduced into
normal bone marrow cells through retrovirus vectors, and neutrophils expressing this
mutant exhibited decreased cell movement
and production of superoxide in response
to fMLP. The expressed recombinant protein
was also analyzed biochemically and exhib-
ited defective binding to GTP. Functional
studies demonstrated that the D57N mutant
behaves in a dominant-negative fashion at
the cellular level. The syndrome of Rac2
dysfunction represents a human condition
associated with mutation of a Rho GTPase
and is another example of human disease
associated with abnormalities of small G
protein signaling pathways. (Blood. 2000;
96:1646-1654)
© 2000 by The American Society of Hematology
Introduction
Circulating blood neutrophils, which make up the initial cellular
component of inflammatory infiltrates, interact with endothelium in
a multistep process involving selectin-initiated endothelial capture,
integrin-mediated adhesion, and chemotaxis-induced diapedesis
(reviewed in Lowe and Ward1). The importance of neutrophil
movement and function in host defense is demonstrated by genetic
defects affecting neutrophil–endothelial interactions (leukocyte
adhesion deficiency),2 microbial killing (chronic granulomatous
disease),3,4 and movement (neutrophil actin dysfunction).5
To accomplish cellular responses to environmental signals, cells
use various signaling pathways linking receptors for extracellular
stimuli with effectors in the cytoplasm and nucleus. The Rho
family of GTPases, members of the Ras superfamily of small
signaling molecules, plays key roles in regulating these responses.
Rho GTPases are involved in a wide array of cellular functions,
including cytoskeletal (particularly actin) reorganization, integrin
complex formation and cell adhesion, gene transcription, cell cycle
progression, and cell proliferation.6-8 Rho GTPases, in a fashion
similar to Ras, cycle between an active, GTP-bound state and an
inactive, GDP-bound state. Proteins that activate these transitions
(guanine nucleotide exchange factors and GTPase-activating proteins) and the downstream effector proteins that interact with
activated Rho-GTPases have been increasingly identified.9 How-
ever, the specific mechanism(s) by which Rho GTPases control a
wide range of cellular processes and the relationship between the
cellular functions controlled by the same or different Rho GTPases
remain(s) largely unknown.
Several distinct members of the Rho family of GTPases have
been characterized, including Rho, Rac, and Cdc42. Each member
of the family appears to control a distinct function of the actin
cytoskeleton.9 In fibroblasts, the activation of Rho leads to the
formation of actin–myosin stress fibers and integrin-containing
adhesion complexes. Cdc42 activation induces spike-like filopodia
rich in F-actin, whereas the activation of Rac is associated with
broad lamellipodia.7 The latter 2 morphologic structures are
associated with poorly defined integrin complexes.9 Interestingly,
Rac members of the Rho family have also been implicated in
regulation of the NADPH oxidase enzyme complex that generates
superoxide in phagocytes.10-15 Although human gene mutations
encoding other components of the NADPH oxidase complex
(gp91phox, p47phox, p67phox, p40phox) results in absent or
reduced superoxide production and chronic granulomatous disease,
no patients have yet been recognized with Rac-associated abnormalities in the NADPH oxidase.3,4
Recent work by our laboratory and by other investigators has
begun to elucidate the role of Rho GTPases in phagocyte cell
From the Department of Pediatrics, Section of Pediatric Hematology/Oncology,
Wells Center for Pediatric Research, and the Department of Medicine, Section
of Nephrology, Howard Hughes Medical Institute, Indiana University School of
Medicine, Indianapolis, IN; the Department of Biochemistry, University of
Tennessee, Memphis, TN; Bonfils Blood Center and the Department of
Pediatrics, University of Colorado School of Medicine, Denver, CO; the
Department of Pediatrics, C. S. Mott Children’s Hospital and the Department of
Pathology, Howard Hughes Medical Institute, University of Michigan Medical
School; Ann Arbor, MI.
University of Michigan Clinical Research Center. The Wells Center for Pediatric
Research is a Center of Excellence in Molecular Hematology (NIDDK
P50DK49218).
Submitted April 4, 2000; accepted May 11, 2000.
Supported by National Institutes of Health grants R01 AI-20065 (L.B.), R01 HL45635 (M.C.D.), GM60523 (Y.Z.), and 1P01CA71932 (J.B.L.), and by the
1646
Reprints: David A. Williams, Department of Pediatrics, Wells Center for
Pediatric Research, Howard Hughes Medical Institute, 1044 West Walnut St,
Rm 402, Indianapolis, IN 46202-5225; e-mail: [email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2000 by The American Society of Hematology
BLOOD, 1 SEPTEMBER 2000 䡠 VOLUME 96, NUMBER 5
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2000 䡠 VOLUME 96, NUMBER 5
function. Rho has been demonstrated to mediate actin polymerization in neutrophils,16-18 and, using dominant negative and constitutively activated mutants, Rac function has been implicated in
membrane ruffling, lamellipodia formation, and chemotaxis in a
macrophage cell line.19,20 In these same cells, Cdc42 function
appears essential for cell polarization mediated by filopodia toward
a chemotactic gradient. Using a genetic approach to generate mice
deficient in the hematopoietic specific Rho GTPase, Rac2, we
demonstrated that Rac2 plays an essential and unique role in
neutrophil rolling via L-selectin, F-actin assembly, and chemotaxis
in response to several chemoattractants and in superoxide generation in response to some, but not all, agonists.21,22 Rac2-deficient
mice display a unique phenotype of immunodeficiency consisting
of the above cellular defects, leukocytosis, and neutrophilia, but
increased susceptibility to fungal infections.
Based on the phenotypic analysis of Rac2-deficient mice, it is
possible to predict a human phenotype associated with functional
abnormalities in Rac. We now characterize the molecular, biochemical, and biologic defects in a patient with a phenotype similar to
that of Rac2-deficient mice by cloning and sequencing the expressed Rac2 mRNA, and demonstrate that the mutation in Rac2
acts in a dominant negative fashion in blood cells. The cDNA
mutation is consistent with genomic sequence recently published23
on this same patient.
Patients, materials, and methods
Blood and bone marrow isolation and neutrophil separation
Blood and bone marrow (BM) were obtained after informed consent. The
protocol for obtaining these samples was approved by the institutional
review boards of the University of Michigan School of Medicine and
Indiana University School of Medicine. Peripheral polymorphonuclear
leukocytes (PMN) were separated from peripheral venous blood from the
patient or from healthy donors by dextran sedimentation, hypotonic lysis of
remaining erythrocytes, and separation of neutrophils from mononuclear
cells by Ficoll-Paque (Pharmacia, Piscataway, NJ). BM was aspirated from
the posterior superior iliac crest of healthy donors. Mononuclear cells were
isolated from fresh heparinized BM by centrifugation on Histopaque-1077
(Sigma Diagnostics, St Louis, MO) gradient as described.24 Two million
low-density mononuclear cells were plated per well in 6-well tissue culture
plates in the presence of human granulocyte colony-stimulating factor
(hG-CSF, 100 ng/mL; provided by Amgen, Thousands Oaks, CA), human
megakaryocyte growth and differentiation factor (MGDF, 100 ng/mL;
Amgen), and human stem cell factor (SCF, 100 ng/mL; Amgen) for 5 days
at 37°C in 5% CO2.
Rolling and chemotaxis assays
Neutrophils were isolated from patient or normal control blood using the
1-step Polymorphoprep medium (Gibco-BRL) and procedures recommended by the manufacturer. The rolling adhesion assay was performed as
previously described21 with the exception that the current study was limited
to 1-wall shear stress (1.26 dynes/cm2) that fell within the range of shear
stresses shown to be optimal for initiating and sustaining L-selectin–
dependent neutrophil rolling adhesion.25 The bottom surface of the rolling
chamber was coated with a 2 ␮g/mL solution of GlyCAM-1 (a generous gift
of Dr S. D. Rosen) as described.21 Tethered and rolling cells were scored
and averaged in 10 to 12 different fields of the GlyCAM-1–coated plate in
the second minute of the rolling assay. Data represent an average of 2
independent cell preparations and 3 independent plate preparations.
Chemotaxis was evaluated using 2 methods. Neutrophils were suspended in Dulbecco minimum essential medium (DMEM) containing 0.1%
bovine serum albumin (Sigma, St Louis, MO) and gradually warmed for 1
hour to 20°C. N-formyl-methionyl-leucyl-phenylalanine (10⫺7 mol/L)
Rac2 MUTATION AND HUMAN IMMUNODEFICIENCY
1647
(fMLP; Sigma) and IL-8 (5 ⫻ 10⫺9 mol/L) (Peprotech, Rocky Hill, NJ)
were diluted in the same solution and added to the lower wells of 48-well
microchambers. Polycarbonate filters of 3 ␮m pore size (Nuclepore,
Pleasanton, CA) were used to separate upper from lower wells. PMN
(5 ⫻ 104) were added to the upper wells, and the chambers were placed in a
humidified incubator at 37°C with 5% CO2 for 30 minutes. The filter was
removed, stained, and mounted. The number of neutrophils migrating
through the filter was determined by counting 5 random 400⫻ microscope
fields. Data are expressed as mean number of cells per field ⫾ SEM.
In addition, PMN chemotaxis in response to fMLP (0-10⫺5 mol/L) was
directly observed using a Zigmond chamber (Neuro Probe, Cabin John,
MD) as previously described.21 Microscopic images were recorded at
1-minute intervals using a 40⫻ oil-immersion objective lens on an inverted
microscope (Nikon Diaphot 300) equipped with DIC optics and epifluorescence optics. Collection of images from a cooled charged-coupled device
camera (Pentamax model RTEA 1372K/2; Princeton Instruments, Princeton, NJ) began 10 minutes after the chamber was set up, to allow time for a
stable gradient to form. Green fluorescent protein (GFP)-positive cells were
identified by epifluorescence using 480-nm excitation and 535-nm emission
filters (Chroma Technology, Brattleboro, VT). Metamorph software (Universal Imaging, West Chester, PA) was used to acquire and analyze the images.
Because most in vitro differentiated cells, regardless of origin, were
nonmotile, analysis was restricted to the cells that exhibited any movement.
Phagocytosis assays
Phagocytosis assays were carried out essentially as previously described.26,27 Antibody-treated erythrocytes (EIgG) were washed 3 times and
suspended in the same buffer at 2 to 3 ⫻ 109 cells/mL. After incubation,
neutrophils were activated with fMLP (100 nmol/L) for 10 minutes at 37°C;
EIgG (2 ⫻ 106/mL) were added to the activated neutrophils, and incubation
was continued for an additional 30 minutes at 37°C. EIgG that were not
internalized were lysed with distilled water, returned to isotonicity by the
addition of 0.6 mol/L KCl, and fixed with 1% glutaraldehyde. Phagocytosis
was quantitated microscopically and expressed as the number of particles
ingested per 100 cells (phagocytic index).
Measurement of NADPH oxidase activity and NBT test
Superoxide production was measured in a quantitative kinetic assay based
on the reduction of cytochrome C (Sigma) after the stimulation of cells with
fMLP alone or with cytochalasin B or phorbol myristate acetate (PMA)
alone (all Sigma). PMN were treated with 5 ␮g/mL cytochalasin B for 3
minutes and then by 400 nmol/L fMLP for 5 minutes, or fMLP alone, or 10
ng/mL PMA alone for 5 minutes. Data were expressed as mean nmol
02⫺/106 PMN/5 minutes ⫾ SEM. The nitroblue tetrazolium (NBT) test for
superoxide production was performed on PMN derived from the patient or
from healthy donors after expansion with or without transduction in vitro as
described.28 The percentage of NBT-positive cells and the intensity of
staining were determined by evaluating 100 cells.
Adhesion to fibrinogen
Neutrophils were activated with 10⫺7 mol/L fMLP for 5 minutes at 37°C,
then washed with and resuspended in Dulbecco phosphate-buffered saline
containing 5 mmol/L glucose. Plates (24 well) were coated with fibrinogen
(50 ␮g/well) (Chromogenix, Milan, Italy) for 2 hours at 37°C, washed with
Dulbecco phosphate-buffered saline, and blocked with 1% gelatin (Norland
Products, New Brunswick, NJ) for 1 hour at 22°C. Plates were again
washed, then neutrophils (1 ⫻ 105/well) were added to plates at appropriate
times to yield the durations specified. Plates were incubated at 22°C.
Neutrophils that had not adhered were washed away, and adherent cells
were fixed in 1% glutaraldehyde. The number of adherent neutrophils was
determined by counting 5 random 200⫻ microscopic fields.
Cloning and sequencing of Rac2 cDNA
Total RNA was isolated from expanded BM cells of healthy donors and the
patient using TRIZOL reagent as described by the manufacturer (Life
Technologies, Rockville, MD). First-strand cDNA synthesis was carried out
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1648
BLOOD, 1 SEPTEMBER 2000 䡠 VOLUME 96, NUMBER 5
WILLIAMS et al
using Superscript II RNase H⫺ reverse transcriptase (Life Technologies)
and oligo (dT)16 as primer (Perkin Elmer, Foster City, CA). Polymerase
chain reaction (PCR) was performed using primers spanning the entire
human Rac2 coding region (5⬘ CCGGAATTCATGCAGGCCATCAAGTGTGTGGTG 3⬘ and 5⬘ CCGCTCGAGCTAGAGGAGGCTGCAGGCGCGCTT C 3⬘). The 597-bp PCR products were cloned into pCR4TOPO vector using the procedures recommended by the manufacturer
(Invitrogen, Carlsbad, CA). Individual colonies were then picked and
sequenced with T3 and T7 primers. Thirteen clones from the patient and 7
from the normal sample were successfully sequenced.
Construction of retroviral vectors, transfections, and infection
of target cells
An improved murine stem cell virus (MSCV)-based bi-cistronic retroviral
vector, MIEG3, was constructed and used in this study. MIEG3 gives
brighter EGFP fluorescence than the parental MSCV and MIG vectors,29
which allows direct visualization of the EGFP-positive cells under a
fluorescent microscope. To construct MIEG3, the RSGFP in the MIG
retroviral vector was replaced with the EGFP of pEGFP-C1 (Clontech
Laboratories, Palo Alto, CA), yielding MIEG vector (Hanenberg H,
D.A.W., unpublished data). Subsequently, the BglII-NcoI fragment in
MIEG containing the disabled internal ribosome entry site (IRES) was
replaced with BamHI-NcoI fragment of the pIRES2-EGFP (Clontech
Laboratories), yielding MIEG3 vector. This last maneuver restores the
encephalomyocarditis virus (EMCV) IRES element to its original EMCV
viral configuration, resulting in more efficient translation of EGFP.
Flag epitope tag was introduced into the N-terminal region of the
murine wild-type (WT) Rac2 cDNA using a PCR-based technique. The
primers used in this study were as follows: 5⬘ CGGAATTCACCATGGACTACAAAGACGATGACGACAAGCAGGCCA-TCATTGTGTGGTGGTGGGTGATG 3⬘ and 5⬘ GCTCGAGCCTAGAGCAGGCTGCAGG
GGCGCTTCTGCTG 3⬘. Similarly, the Kozak consensus translation initiation sequence was incorporated into the normal human Rac2 cDNA and the
mutant (D57N) Rac2 cDNA derived from the patient to maximize the
translation of the expressed Rac2 genes. The following primers were used:
5⬘ CCGGAATTCCACCATGCAGGCCATCAAGTG TGTGGTG 3⬘ and 5⬘
CCGCTCGAGCTAGAGGAGGCTGCAGGCGCGCTT C 3⬘. Amplified
fragments were cloned into pPCR-Script SK plasmid (Stratagene, La Jolla,
CA) and sequenced multiple times. The sequence-confirmed, Flag-tagged
murine Rac2, normal human Rac2, and human mutant D57N Rac2 inserts
were digested with EcoRI and XhoI and were cloned into the same sites of
MIEG3 (see below) yielding MIEG3FR2, HR2WT, and HR2MU vectors,
respectively.
Viral supernatant collected from the transfected Phoenix-Ampho packaging cell line (obtained from American Type Culture Collection, Manassas, VA) was used to infect the GP⫹E86 packaging cell line.30 The
GFP-expressing cells with high-fluorescence intensity after 2 consecutive
infections were selected by fluorescence-activated cell sorter (FACS). The
retroviral titer was determined by FACS analysis using a method similar to
that reported recently.31 The titer of the stable MIEG3 and MIEG3FR2 E86
clone viral supernatant was approximately 2.5 ⫻ 104 cfu/mL and 1.4 ⫻ 105
cfu/mL, respectively.
Transient retroviral supernatant derived from Phoenix-Ampho (titers of
approximately 5 ⫻ 105/mL) was also used to directly infect human
mononuclear cells using the procedures described previously.24 Infected
cells were cultured with 100 ng/mL MGDF, 100 ng/mL hG-CSF, and 100
ng/mL SCF for 5 days. Transduced cells were analyzed for GFP expression
by FACScan (Becton Dickinson, Mountain View, CA) 48 hours after the
second infection.
Flow cytometric analysis, Western analysis, and cell sorting
After the initial 5 days of expansion in 3 cytokines (see above), the
transduced cells were further expanded 10 to 14 days in G-CSF, SCF (as
above), and recombinant human IL-3 (100 ng/mL; Peprotech) to enhance
myeloid differentiation. Before functional assays, cells were analyzed for
transduction by flow analysis of GFP, and the differentiation of the cells was
evaluated by expression of human CD13 on the cell surfaces using a
FACScan (Becton Dickinson) after staining the cells with phycoerythrin
antihuman CD13 (Pharmingen, San Diego, CA). The GFP-positive cells
were isolated by FACS (FACStar Plus; Becton Dickinson) under sterile
conditions. Reanalysis of the GFP-sorted cells showed purity of greater
than 90%. NIH/3T3 cells were infected twice with the MIEG3, HR2MU,
HR2WT, and MIEG3FR2 retroviral supernatants. GFP-positive cells were
sorted using FACS. After culturing in DMEM for several days, a portion of
the cells was analyzed by FLOW for GFP expression, and the remaining
cells were used for Western blot analysis using a 1:5000 dilution of
anti-Rac2 antibody (kindly supplied by Gary Bokoch, Scripps Institute, La
Jolla, CA). The Western blot was performed as previously described.32
Cell shape changes
MIEG3, HR2WT, and HR2MU-infected NIH3T3 cells were seeded on
gelatinized glass coverslips. Several days after seeding, the cells were
serum starved for 20 hours. The cells were then treated with 5 ng/mL
platelet-derived growth factor (Peprotech) or mock treated for 8 minutes
and fixed in 3.7% paraformaldehyde for 20 minutes at room temperature.
Subsequently, the cells were stained with rhodamine–phalloidin as previously described.33
Expression, purification, and guanine nucleotide binding of
recombinant proteins
The cDNA of human D57N mutant Rac2 or WT human Rac2 was cloned
into the bacterial expression vector pET-28a (Novagen, Milwaukee, WI) at
the EcoRI and XhoI cloning sites. Both WT and D57N Rac2 were expressed
in Escherichia coli as a fusion protein with His6 tag. Purification of these
proteins was carried out according to the manufacturer’s instructions. The
purified recombinant proteins were then separated on an SDS-PAGE gel to
confirm the purity (greater than 90%) of the expressed proteins. 3H-GDP
(10 ␮mol/L) and 35S-␥GTP (1 ␮mol/L) (Amersham/Pharmacia Biotech,
Piscataway, NJ) were loaded onto the recombinant GTPases (1-2 ␮g) in the
presence of 20 mmol/L Tris-HCl (pH 7.6), 100 mmol/L NaCl, 2 mmol/L
EDTA, and 1 mmol/L dithiothreitol for 20 minutes at room temperature.
Reactions were terminated by the addition of MgCl2 to a final concentration
of 10 mmol/L, and the mixture was placed on ice. Binding was quantitated
by vacuum filtration, as described.34
Results
Case history
The patient was a 1-year-old boy who had multiple recurrent,
life-threatening infections characterized by leukocytosis and notable for the absence of pus in the inflamed tissues. A detailed
clinical description of the child’s history before transplantation
will be presented elsewhere (A. Kurchubasche et al, manuscript
submitted).
A phagocyte defect was suspected and found by the original
treating physicians on the basis of neutrophilia, absence of pus in
the wounds, and improved healing in response to granulocyte
transfusions of an umbilical infection. Evaluation of neutrophil
function at the University of Michigan confirmed the original
impression of the referring physicians. Neutrophil functional data
revealed that the patient’s neutrophils responded normally to PMA
in terms of the respiratory burst. In addition, the presence and
density of CD11b, CD11c, and CD18 were normal. New data
indicated that the expression of P-selectin and CD62L (data not
shown) were also normal. Other neutrophil functions are described below.
The patient was referred to the University of Michigan Pediatric
Bone Marrow Transplantation Program for allogeneic bone marrow transplantation from his HLA-identical older brother. A
detailed workup of neutrophil function was completed before
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2000 䡠 VOLUME 96, NUMBER 5
Rac2 MUTATION AND HUMAN IMMUNODEFICIENCY
1649
42 ⫾ 6.0 EIgG/100 PMN, significantly higher (P ⬍ .05) than that
for unstimulated neutrophils but lower (P ⬍ .001) than the
138.5 ⫾ 17.5 EIgG ingested per 100 PMN by normal fMLPstimulated controls. Thus, fMLP-stimulated phagocytosis was only
slightly increased in patient cells, whereas it was increased 6-fold
in control cells. Because a striking characteristic of neutrophils
derived from Rac2-deficient mice previously described was defective rolling by L-selectin, the ability of patient neutrophils to tether
and subsequently roll on the L-selectin ligand, GlyCAM-1, was
analyzed (Figure 1C). At 1.26 dynes/cm2, the patient neutrophils
demonstrated an approximately 5-fold reduction in the number of
cells that tethered and rolled on GlyCAM-1. Adhesion of fMLPstimulated patient PMN to fibrinogen-coated plates over 10 to 60
minutes tended to be reduced compared to normal controls (Figure
1D), but this reduction reached significance only at 30 minutes. In
summary, the cellular phenotype of the patient was remarkably
similar to that of the actin-based neutrophil cellular defects
described in the Rac2-deficient mouse.21
Figure 1. Actin-based function of patient neutrophils compared to normal
neutrophils. (A) Chemotaxis in a modified Boyden chamber in response to fMLP and
IL-8. The number of neutrophils migrating through the filter was determined by
counting 5 random 400⫻ microscope fields. Data are expressed as mean number of
cells per field ⫾ SEM. *P ⫽ .01; **P ⫽ .05. (B) Phagocytosis of IgG-coated erythrocytes unstimulated and in response to fMLP. **P ⫽ .05, fMLP vs no agonist (patient);
†P ⫽ .001 patient vs normal. (C) Neutrophil rolling on the L-selectin ligand, GlyCAM-1. Tethered and rolling cells were scored and averaged in 10 to 12 different
fields of the GlyCAM-1–coated plate in the second minute of the rolling assay. Data
shown represent the average number of tethered cells, ⫾ SEM, observed using 2
independently isolated cell preparations and 2 independently prepared GlyCAM-1–
substituted chamber surfaces. *P ⫽ .01. (D) Time course of neutrophil adhesion to
fibrinogen. The number of adherent neutrophils was determined by counting 5
random 200⫻ microscope fields. **P ⫽ .05 only at the 30-minute time point; P ⬎ .05
(NS) all other points.
transplantation (see below). The patient was conditioned with
antithymocyte globulin 90 mg/kg, intravenous busulfan 16 mg/kg,
and cyclophosphamide 200 mg/kg. Transplantation was complicated by severe veno-occlusive disease of the liver, necessitating
serial paracentesis and prolonged mechanical ventilation. Neutrophils became engrafted on day 11. The only infection-related
complication was an infected arterial line that grew Stenotrophomonas maltophilia and Enterobacter cloacae, which responded well
to intravenous antibiotic therapy. The patient made a full recovery
and is currently thriving at home 4 months after undergoing bone
marrow transplantation. He has had no infections since hospital
discharge, and he requires no medications. His white blood cell
count and differential are normal, and he is well engrafted for red
blood cells and platelets, though mild thrombocytopenia persists.
Immunologic studies confirm normal T- and B-cell subsets and
normal immunoglobulin levels. His bone marrow demonstrates
100% donor cells by a variable number of tandem repeat analyses.
Superoxide production
Rac1, Rac2, or both appear to be essential for superoxide
production in cell-free systems, and neutrophil NADPH oxidase
function is impaired,10-12 but not completely deficient, in
neutrophils derived from Rac2-deficient mice.21 To assess
NADPH oxidase function in neutrophils from patients and
normal controls, cells were stimulated with fMLP and PMA, and
superoxide production was measured (Figure 2). Without prior
treatment with cytochalasin b, fMLP-elicited O2⫺ production by
patient neutrophils was significantly reduced compared to that
of normal neutrophils. After treatment with cytochalasin b,
fMLP still failed to activate O2⫺ production in the patient’s
neutrophils, which produced only 1.7 ⫾ 1.2 nmol superoxide/
106 cells per 5 minutes. In contrast, as expected, a more than
3-fold increase in O2⫺ production was seen in neutrophils from
healthy donors, which produced 43.7 ⫾ 5.8 nmol superoxide/
106 cells per 5 minutes (mean ⫾ SEM, n ⫽ 5). However,
analogous to Rac2-deficient murine neutrophils, PMA (10
ng/mL) stimulation of the patient’s neutrophils yielded normal production of superoxide. Also as expected, after successful bone marrow transplantation, O2⫺ production was equivalent on concurrently analyzed patient and normal neutrophils
(Figure 2).
Neutrophil function assays
The patient had markedly impaired chemotaxis in response to
fMLP and IL-8 in modified Boyden chamber analysis (Figure 1A).
Patient neutrophils migrating in response to 100 nmol/L fMLP and
5 mmol/L IL-8 were significantly reduced (0.5 ⫾ 0.1 and 0.3 ⫾ 0.1
cells/400⫻ field, respectively) compared to PMN obtained from a
healthy donor (77.3 ⫾ 22.1 and 45.5 ⫾ 10.9, respectively; mean ⫾
SEM; n ⫽ 5). The lack of movement was confirmed using direct
observation of PMN movement in a Zigmond chamber in the
presence of a gradient of fMLP (10⫺5 mol/L) (see below).
Phagocytosis was also impaired, but not as severely as chemotaxis.
Phagocytosis of erythrocytes opsonized with IgG (EIgG) (Figure
1B) by patient neutrophils stimulated with 100 nmol/L fMLP was
Figure 2. Superoxide generation of patient neutrophils compared to normal
neutrophils. Assays performed before and after bone marrow transplantation
(BMT). PMN were treated with 5 ␮g/mL cytochalasin B for 3 minutes, then by 400
nmol/L fMLP for 5 minutes, or fMLP alone, or 10 ng/mL PMA alone for 5 minutes. Data
were expressed as mean nmol 02⫺/106 neutrophils/5 minutes ⫾ SEM. †P ⫽ .001;
‡P ⫽ .005. NS, PMA patient vs normal; fMLP ⫹ cytochalasin B after BMT.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1650
WILLIAMS et al
BLOOD, 1 SEPTEMBER 2000 䡠 VOLUME 96, NUMBER 5
the coding amino acid sequence, and this mutation was present
in all clones sequenced (patient and healthy donor). Northern
blot analysis of total cellular RNA from the patient demonstrated nearly normal levels of Rac2 message (data not shown).
The predicted amino acid change encoded by the mutant cDNA
sequence was a substitution of asparagine for aspartic acid at
position 57 (D57N). This mutation occurs in a GTP-binding
domain that is highly conserved in all Rho GTPases and in the
Ras superfamily.35 Normal levels of mRNA and normal sequences in half the cloned cDNA from the patient suggested that
the mutant acted in a dominant-negative fashion at the cellular level.
Figure 3. Expression of mutant Rac 2 in patient bone marrow-derived cells. (A)
RT-PCR performed as described in “Materials and methods” and PCR product
separated on agarose gel. Lane 1, marker. Lane 2, PCR product derived from healthy
donor. Lane 3, PCR product derived from patient. Lane 4, control; no RNA. Location
of predicted 597-bp PCR product is shown at arrow. (B) Partial nucleotide sequence
of normal vs mutant cDNA derived from patient RT-PCR product. Upper panel:
sequence derived from cDNA product of healthy donor (A, lane 2). Lower panel:
sequence derived from cDNA of patient. Location of G3A base-pair change is noted
in the sequence on the upper and lower panels by arrowheads. Predicted amino acid
change is at position 57.
Sequencing of the Rac2 cDNA and identification of a D57N
point mutation in the patient
Low-density bone marrow (LDBM) cells obtained from the
patient before transplantation or from healthy donors were
expanded in multiple cytokines and used to prepare RNA for
RT-PCR. PCR primers were designed that flanked the entire
Rac2 coding sequence. As seen in Figure 3A, the predicted Rac2
PCR product of 597 bp was obtained from the patient’s cells and
normal BM cells. PCR products from both were cloned and
sequenced. As seen in Figure 3B, multiple sequenced cDNAs
from the patient demonstrated a G3A base pair change at
nucleotide 169. Among 13 individual clones sequenced from
samples from the patient, 8 were found to have the G3A
mutation, whereas the remaining 5 were wild type. All 7 clones
sequenced from the normal sample were found to contain the
WT sequence. In addition, we found another single base-pair
change (C3T) at nucleotide position 477 compared with the
GenBank human Rac2 sequence; this mutation does not change
Figure 4. Retroviral-mediated transduction of normal and patient cells with
Rac2-containing vectors. (A) Recombinant retroviral vectors constructed as described in “Materials and methods” were based on MIEG3, a modified MSCV vector,
and contain either the WT Rac2 sequence (HR2WT) or the D57N mutant cDNA
derived from the patient (HR2MU). Also shown is the vector expressing the
Flag-tagged WT murine Rac2 (MIEG3FR2). LTR, long terminal repeat; IRES, internal
ribosome entry site; EGFP, enhanced green fluorescent protein. (B) Flow analysis of
NIH/3T3 cells infected with respective retrovirus vectors and analyzed for expression
of GFP; horizontal axis shows GFP expression. (C) Western blot analysis of
transduced and sorted NIH/3T3 cells for Rac2 protein. Expression of the Rac2 protein
is identified in NIH/3T3 cells infected with HR2MU (patient mutant cDNA, lane 2),
HR2WT (WT cDNA, lane 4), MIEG3FR2 (murine Flag-tagged Rac2, lane 5), and the
viral producer cell expressing MIEG3FR2 virus (lane 6). No expression is seen in
NIH/3T3 cells or NIH/3T3 cells infected with the virus expressing only EGFP (lane
1,3). The size of the murine Rac2 protein is slightly higher because of the Flag tag.
The faint cross-hybridizing bands seen in lanes 1 and 3 are caused by crosshybridization with Rac1.21
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2000 䡠 VOLUME 96, NUMBER 5
Rac2 MUTATION AND HUMAN IMMUNODEFICIENCY
Construction of retrovirus expressing WT and mutant D57N
Rac2 cDNA and functional analysis
To study the cellular phenotype of the patient and the mutant D57N
cDNA in more detail, recombinant retrovirus vectors expressing
either the WT (both murine and human) and mutant Rac2 cDNA
were constructed (Figure 4A). The retrovirus backbone, MIEG3, is
derived from the MSCV retrovirus29 with modifications to improve
the expression of GFP. The use of an internal ribosome re-entry site
(IRES) in a bi-cistronic vector allows estimates of expression of
both GFP and inserted upstream sequences (in this case, Rac2) in a
limited number of cells by the intensity of GFP using Flow
analysis. To determine that HR2WT and HR2MU both encode
Rac2 protein, NIH/3T3 cells, which lack endogenous Rac2 expression, were infected and then sorted for GFP-positive cells (Figure
4B,C). As seen in Figure 4B, most NIH/3T3 cells were GFP
positive (the percentages of GFP-positive cells for MIEG3, HR2MU,
and HR2WT were 94%, 84%, and 96%, respectively). GFP-sorted
NIH/3T3 cells shown in Figure 4B were used for Western blot
analysis. As seen in Figure 4C, Western blot analysis confirmed the
expression of vector-encoded mutant Rac2 (lane 2) and WT Rac2
(lane 4) and of Flag-tagged murine Rac2 (lane 5) in infected and
GFP-sorted cells. WT Flag-tagged murine Rac2 protein is also
present, as expected, in the MIEG3FR2 producer cell line. A minor
band, likely representing cross-hybridization with Rac1 (see Roberts et al21) is present in uninfected NIH/3T3 cells (lane 1) and 3T3
cells infected with MIEG2 vector (lane 3). NIH/3T3 cells expressing D57N grew more slowly than cells expressing either WT Rac2
or GFP alone (see below).
We found no differences between the functions of murine and
human WT Rac2 (data not shown), which was consistent with the
high degree of homology of the coding sequences between species.
Therefore, in initial studies, either the murine WT or the human
Rac2 mutant retroviruses were used to transduce cells. Patient
LDBM cells were transduced with empty vector (MIEG3) or with
the WT murine or human cDNA (MIEG3FR2 or HR2WT) and
sorted for GFP-positive cells after in vitro differentiation into
granulocytic cells. As control, normal LDBM cells were transduced
with the empty vector. Neutrophil NADPH oxidase activity was
assessed using the NBT test, which detects superoxide production
in individual cells. Compared to the empty vector, expression of
WT Rac2 in patient cells derived from transduced LDBM cells
failed to increase the percentage of NBT-positive cells in response
to fMLP (4% NBT positive), though, as previously noted, the
patient cells showed similar levels of NBT-positive cells in
response to PMA (52% NBT positive) (Table 1). In contrast,
normal cells transduced with the control retrovirus expressing only
GFP demonstrated NBT-positive cells after stimulation with either
PMA (91%) or fMLP (55%).
To demonstrate more precisely at the cellular level the dominantnegative nature of the D57N mutation, normal human LDBM (or
Table 1. Neutrophil NADPH oxidase activity after transduction of normal and
patient bone marrow cells
Agonist
PMA
Normal BM
MIEG3 (%)*
Patient BM
MIEG3 (%)
Patient BM
MIEG3FR2
(%)
91
62
52
fMLP
55
1
4
No stimulant
20
0
1
NADPH oxidase activity was monitored in individual neutrophils using the NBT
test, as described in “Materials and methods.”
*Percentage NBT positive.
1651
Table 2. Neutrophil NADPH oxidase activity after transduction of normal bone
marrow cells with Rac2 mutant retrovirus
MIEG3
(%)
MIEG3FR2
(%)*
HR2MU
(%)
PMA
60
68
63
fMLP
24
28
5
1
1
0
Agonist
No stimulus
NADPH oxidase activity was monitored in individual neutrophils using the NBT
test. Shown are data from 1 of 3 experiments with similar results.
* Percentage NBT positive.
umbilical cord blood) cells were infected with either the WT and
the D57N-expressing retrovirus, and the cells were differentiated in
vitro into mature neutrophils. Between 2% and 4% of primary bone
marrow cells were transduced by the empty retrovirus vector
(MIEG3), the WT Rac2 cDNA-containing vector (MIEG3FR2), or
the D57N mutant (HR2MU) (data not shown). After transduction
and differentiation for 14 days in culture, more than 95% of cells
displayed a myeloid phenotype, as assessed by staining with CD13.
Transduced GFP-positive cells were sorted to purity by FACS and
analyzed for cell movement and superoxide generation by NBT
test. After sorting, more than 90% of the cells were found to be
CD13 and GFP double positive. As seen in Table 2, either PMA or
fMLP activates superoxide production in normal human cells
transduced with either the vector expressing GFP alone (MIEG3)
or WT Rac2 (MIEG3FR2). In contrast, normal human cells
expressing the D57N mutant (HR2MU) have few NBT-positive
cells in response to fMLP but are able to generate superoxide in
response to PMA in a fashion similar to normal. This phenotype
(PMA-, but not fMLP-, induced superoxide production) mimics
that of the patient’s cells and provides evidence of the dominantnegative nature of the D57N mutant at the cellular level.
Effects of D57N on movement of normal transduced
myeloid cells
To generate adequate numbers of transduced and expanded cells for
movement studies, we used umbilical cord blood cells, which have
a higher transduction efficiency (20%-40%) than bone marrow
cells. Chemotaxis analyzed by modified Boyden chamber demonstrated that GFP⫹/CD13⫹ cells expressing either MIEG3 or
HR2WT (human WT Rac2) were able to move in response to fMLP
(Table 3). The expression of WT Rac2 by retrovirus appeared to
enhance movement in response to fMLP (Table 3). In contrast,
expression of the D57N mutant cDNA significantly impaired
movement of these cells in response to fMLP compared with the
expression of WT Rac2 (11% ⫾ 4% mutant vs 100% ⫾ 19% WT,
P ⬍ .001, and impaired movement when compared with normal
cells at 11% ⫾ 4% vs 65% ⫾ 14%, P ⬍ .01).
To assess the speed of movement of the patient cells, we
Table 3. Chemotaxis of cord blood-derived neutrophils transduced with WT
or mutant Rac2
Vector
Cells migrated*
MIEG3
65 ⫾ 14
HR2WT
100 ⫾ 19†
HR2MU
11 ⫾ 4‡§
*Cells/low power field ⫾ SD of samples performed in triplicate by modified
Boyden chamber assay. Statistical analysis was performed using a one-way ANOVA
and Tukey-Kramer post-test for multiple comparisons.
† P ⬍ .05 HR2WT vs MIEG3.
‡ P ⬍ .001 HR2MU vs HR2WT.
§ P ⬍ .01 HR2MU vs MIEG3.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1652
BLOOD, 1 SEPTEMBER 2000 䡠 VOLUME 96, NUMBER 5
WILLIAMS et al
analyzed responses to fMLP in a videomicroscopy chamber (Figure
5A). Compared to normal neutrophils in which 50% of the cells
moved at more than 4 ␮m/min, patient neutrophils uniformly
moved slowly. Wild-type neutrophils were observed to move at
rates of up to 13 ␮m/min, whereas the maximum speed of patient
neutrophils recorded was 3.1 ␮m/min. The expression of WT Rac2
failed to increase the speed of patient neutrophil movement (patient
Rac2-EGFP). We next analyzed the effect of WT Rac2 expression
vs D57N Rac2 mutant expression on the speed of movement of
normal neutrophils derived from transduced bone marrow cells
(Figure 5B). GFP-positive cells expressing either the retrovirus
containing EGFP alone or WT Rac2 demonstrated fast movement
(more than 4 ␮m/min) in an fMLP gradient, as analyzed by
videomicroscopy. In contrast, expression of the D57N mutant
increased the number of neutrophils that demonstrated slow
movement (less than 4 ␮m/min), and none of these mutant
Rac2-GFP–positive cells were seen moving at a fast speed. Thus,
the differential response of both the NADPH oxidase to PMA and
the fMLP agonist and the movement of mutant neutrophils in
response to fMLP was recapitulated in normal cells by expressing
the patient’s mutant cDNA. The data demonstrate that expression
of the patient’s mutant allele is associated with abnormal movement and superoxide production, even in the presence of normal
Rac2 protein, and they confirm the dominant-negative nature of
this mutation.
D57N mutant fails to bind GTP and acts as a dominant negative
for Rac1 and Rac2
To determine the mechanism of the D57N mutation at the
biochemical level, GTP- and GDP-binding assays were performed.
As seen in Figure 6A, compared to recombinant WT Rac2 the
D57N mutant protein failed to bind GTP. Binding to GDP appeared
normal. These data are consistent with the location of the mutation
in the Rac sequence and the biochemical abnormalities previously
described for the analogous Ras D57 and Rho D59 position
mutations.35 Because this sequence and function are highly conserved throughout all members of the Rho GTPase family, and
because Rac1 continues to be expressed in myeloid and lymphoid
cells, we hypothesized that the D57N phenotype may involve
affects on both Rac1 and Rac2 in these lineages. To test the
hypothesis that D57N Rac2 can have dominant-negative effects on
Rac1, we expressed the D57N mutant in NIH/3T3, which expresses
Figure 5. Motility of normal and mutant cells expressing Rac proteins analyzed
by videomicroscopy. Transduced patient and normal myeloid cells were allowed to
adhere to glass coverslips before they were loaded into a Zigmond chamber with a 0
to 10⫺5 mol/L chemotactic gradient of fMLP. The speed of GFP-positive cells,
identified using epifluorescence, was analyzed from video frames digitized at
1-minute intervals. (A) Histogram of speeds of control transduced normal and patient
cells (normal/MIEG3, patient/MIEG3), and patient cells transduced with WT murine
Rac2 (patient/MIEG3FR2). Data shown are from 1 of 2 experiments with similar
results. (B) Histogram of speeds of normal cells expressing EGFP alone (MIEG3),
D57N mutant Rac2 (HR2MU), or WT Rac2 (HR2WT). Data shown represent 1 of 3
experiments with similar results.
Figure 6. GTP and GDP binding to normal and D57N recombinant Rac protein
and dominant-negative effects of D57N on morphology of NIH/3T3 cells. (A) WT
and D57N Rac2 protein was expressed in E coli and then assayed for binding to
3H-GDP or 35S-␥GTP as described in “Materials and methods.” Data presented are
from 3 experiments (mean ⫾ SEM) P ⬍ .001 vs WT. (B-D) Photomicrographs of
GFP-positive NIH/3T3 cells after infection with retrovirus vectors expressing only
GFP (MIEG3) (B), WT Rac2 (HR2WT) (C), or D57N mutant Rac2 (HR2MU) (D). (E)
Fluorescent photomicrographs of the same cells in B-D, stained with rhodamine–
phalloidin. Note the extensive ruffling in cells transfected with MIEG or HR2WT and in
the untransfected (cell staining only at arrowhead in HR2MU panel). In contrast, note
the complete absence of ruffling in 2 cells shown transduced with HR2MU (green
nuclei). Bar represents 20 ␮m.
Rac1 but not Rac2. Expression was confirmed by Western blot
(Figure 4C). As noted previously, NIH/3T3 cells expressing D57N
Rac2 grew more slowly than NIH/3T3 cells expressing either WT
Rac2 or GFP only, showing a 2-fold reduction at 72 hours after
transduction and a 7-fold reduction 5 days after transduction (T.W.,
D.A.W., unpublished data). Expression of D57N, but not WT Rac2,
significantly altered the morphology of NIH/3T3 cells, generating a
cuboidal, epithelial-like shape characterized by loss of cytoplasmic
extension (Figure 6B-D), and greatly reduced membrane ruffling in
response to platelet-derived growth factor stimulation, as assessed
by rhodamine-phalloidin staining (Figure 6E). Morphologic and
growth characteristics of these cells closely mimics those of
fibroblasts transfected with dominant-negative Rac1 (17N) constructs.36,37 Because Rac2 is not expressed in these cells, these data
support the conclusion that the D57N mutant can act in a dominantnegative fashion to interfere with Rac1 and Rac2 function.
Discussion
Cellular immunity mediated by phagocytic cells is an important
component of host defense. Several genetic causes of neutrophil
dysfunction have been characterized at both the molecular and the
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2000 䡠 VOLUME 96, NUMBER 5
cellular levels. The child described by Ambruso et al23 and further
characterized by us displayed cellular abnormalities that overlapped previously described syndromes of chronic granulomatous
disease,3,4 leukocyte adhesion deficiency,2 and actin dysfunction,5
and he shared a phenotype that closely mimicked that of a mouse
mutant deficient in the Rho GTPase, Rac2. Previously, another
child with recurrent infections who shared many of the phenotypic
abnormalities demonstrated in Rac2-deficient mice was also identified.38 The important characteristics of Rac2 dysfunction in mice
and humans appear to include leukocytosis, impaired neutrophil
chemotaxis in vitro and in vivo, impaired capture and rolling via
the L-selectin ligand, GlyCAM-1, but not via P-selectin mild to
moderate deficiency in adhesion, spreading and phagocytosis of
neutrophils, and reduced generation of superoxide in response to
some, but not all, agonists.
The mammalian Rho GTPase family is made up of at least 7
distinct protein subfamilies—Rho, Rac, Cdc42, RhoD, RhoG,
RhoE, and TC10.6 These proteins act as switches to control
processes by cycling between active (GTP-bound) and inactive
(GDP-bound) states. Members of each family have distinct effects
in cells. The studies outlined by Ambruso et al23 and by us and in
the mice deficient in Rac2 demonstrate the effects of Rac2 in
phagocytic cells. These effects appear to relate mainly to abnormalities of actin function, and the extent of the phenotype in these cells
is intriguing in light of the continued expression of highly related
Rac1, which is 92% identical to Rac2, in these cells.39 This is
particularly striking in murine neutrophils, in which Rac1 makes up
approximately 50% of the expressed Rho GTPase (M.C.D.,
unpublished data). In the mast cells derived from Rac2-deficient
mice, we recently demonstrated significant abnormalities not only
in actin-based cellular functions, but also in cell proliferation and
cell survival in spite of increased levels of Rac1 expression in
Rac2-deficient cells.40 Taken together, these data suggest that
though some functions of Rac1 and Rac2 may overlap, Rac2 is
responsible for distinct cellular processes in some hematopoietic
cells.
The mutation in the patient described here is located in the
GTP-binding region of Rac. Aspartate at position 57 (in Ras, 59 in
Rho) is invariant and is part of the G-3 region loop that is highly
conserved in all mammalian Rho GTPases. The aspartate is thought
Rac2 MUTATION AND HUMAN IMMUNODEFICIENCY
1653
to bind catalytic Mg2⫹ by a water molecule and, ultimately, by the
␥-phosphate of GTP. Several mutants of the Ras GTPase at position
57, including D57A, D57N, and D57Y, have been characterized at
the biochemical and, to a lesser extent, cellular levels41-45 (and
reviewed in Bourne et al46). Dominant-negative mutants of Ras
demonstrate decreased GTP binding activity with resultant decreased turnover rates, resulting in increased binding to GEF.
Indeed, we have demonstrated in vitro that D57N Rac2 is capable
of tight binding to GEF but has lost the catalytic GEF responsiveness, thus making D57N a bona fide dominant-negative mutant
(Y.Z., unpublished data). The severe phenotype of the patient
described here may be explained, in part, by the observation that
the mutation clearly affects the function of other Rho GTPases
because we demonstrate that expression in NIH/3T3 cells, which
express Rac1 but not Rac2, leads to the characteristic phenotypic
changes seen in these cells with dominant-negative mutants of
Rac1.36,37 Thus, though our data in Rac2⫺/⫺ cells strongly suggest
that Rac2 mediates nonoverlapping functions in some cells, the
dominant-negative nature of the Rac2 mutation in this patient and
in much previous work also demonstrates some overlapping
functions.
The data derived from murine Rac2⫺/⫺ neutrophils21 and from
our patient provide direct genetic evidence of the critical role of
Rac2 in neutrophil function in vivo, including chemotaxis, rolling
on endothelium and phagocytosis. Although Rac2 is not essential to
superoxide formation, clearly there is agonist-specific deficiency in
oxidase function. It is possible that additional patients with
neutrophil dysfunction may be identified with abnormalities in
Rac2, and, as noted by Hall,6 understanding the mechanisms that
control actin organization has implications for fully understanding
pathologic conditions in humans.
Acknowledgments
We thank Dr J. Panepinto (Rhode Island Hospital) for referring this
patient. We thank Dr Dirk Roos and members of our laboratory for
helpful discussions and Eva Meunier and Sharon Smoot for
assistance in preparation of the manuscript.
References
1. Lowe JB, Ward PA. Therapeutic inhibition of carbohydrate–protein interactions in vivo. J Clin Invest. 1997;99:822-826.
2. Arnaout MA, Spits H, Terhorst C, Pitt J, Todd RF
III. Deficiency of a leukocyte surface glycoprotein
(LFA-1) in two patients with Mo1 deficiency: effects of cell activation on Mo1/LFA-1 surface expression in normal and deficient leukocytes.
J Clin Invest. 1984;74:1291-1300.
3. Roos D, de Boer M, Kuribayashi F, et al. Mutations in the X-linked and autosomal recessive
forms of chronic granulomatous disease. Blood.
1996;87:1663-1681.
4. Dinauer M. The phagocyte system and disorders
of granulopoiesis and granulocyte function. In:
Hematology of Infancy and Childhood. Vol. 2.
Philadelphia: WB Saunders; 1998:889-967.
5. Boxer LA, Hedley-Whyte ET, Stossel TP. Neutrophil action dysfunction and abnormal neutrophil
behavior. N Engl J Med. 1974;291:1093-1099.
6. Hall A. Rho GTPases and the actin cytoskeleton.
Science. 1998;279:509-514.
7. Nobes CD, Hall A. Rho, Rac and Cdc42 GTPases
regulate the assembly of multimolecular focal
complexes associated with actin stress fibers,
lamellipodia, and filopodia. Cell. 1995;81:53-62.
8. Ridley AJ. Rho: theme and variations. Curr Biol.
1996;6:1256-1264.
9. Mackay DJ, Hall A. Rho GTPases. J Biol Chem.
1998;273:20685-20688.
10. Abo A, Boyhan A, West I, Thrasher AJ, Segal AW.
Reconstitution of neutrophil NADPH oxidase activity in the cell-free system by four components:
p67-phox, p47-phox, p21rac1, and cytochrome
b-245. J Biol Chem. 1992;267:16767-16770.
11. Knaus UG, Heyworth PG, Evans T, Curnutte JT,
Bokoch GM. Regulation of phagocyte oxygen
radical production by the GTP-binding protein
Rac 2. Science. 1991;254:1512-1515.
12. Heyworth P, Curnutte J, Badwey J. Structure and
regulation of NADPH oxidase of phagocytic leukocytes. Molecular and Cellular Basis of Inflammation. Totowa, NJ: Humana Press; 1998:165191.
13. Nisimoto Y, Freeman JL, Motalebi SM, Hirshberg
M, Lambeth JD. Rac binding to p67phox. J Biol
Chem. 1997;272:18834-18841.
14. Abo A, Pick E, Hall A, Totty N, Teahan CG, Segal
AW. Activation of the NADPH oxidase involves
the small GTP-binding protein p21rac1. Nature.
1991;353:668-670.
15. Dharmawardhane S, Bokoch GM. Rho GTPases
and leukocyte cytoskeletal regulation. Curr Opin
Hematol. 1997;4:12-18.
16. Koch G, Norgauer J, Aktories K. ADP-ribosylation
of the GTP-binding protein Rho by Clostridium
limosum exoenzyme affects basal, but not
N-formyl-peptide–stimulated, actin polymerization
in human myeloid leukaemic (HL60) cells. Biochem J. 1994;299:775-779.
17. Bengtsson T, Sarndahl E, Stendahl O, Andersson
T. Involvement of GTP-binding proteins in actin
polymerization in human neutrophils. Proc Natl
Acad Sci U S A. 1990;87:2921-2925.
18. Ehrengruber MU, Boquet P, Coates TD, Deranleau DA. ADP-ribosylation of Rho enhances actin
polymerization-coupled shape oscillations in human neutrophils. FEBS Lett. 1995;372:161-164.
19. Allen WE, Jones GE, Pollard JW, Ridley AJ. Rho,
Rac and Cdc42 regulate actin organization and
cell adhesion in macrophages. J Cell Sci. 1997;
110:707-720.
20. Cox D, Chang P, Zhang Q, Reddy PG, Bokoch
GM, Greenberg S. Requirements for both Rac1
and Cdc42 in membrane ruffling and phagocytosis in leukocytes. J Exp Med. 1997;186:14871494.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1654
WILLIAMS et al
21. Roberts AW, Kim C, Zhen L, et al. Deficiency of
the hematopoietic cell-specific Rho family
GTPase Rac2 is characterized by abnormalities
in neutrophil function and host defense. Immunity.
1999;10:183-196.
22. Kim C, Williams DA, Dinauer MC. Rac2 is an essential regulator of specific signaling pathways
which activate neutrophil NADPH oxidase. Blood.
1999;94:615a.
23. Ambruso DR, Knall C, Abell AN, et al. Human
neutrophil immunodeficiecy syndrome is associated with an inhibitory Rac2 mutation. Proc Natl
Acad Sci U S A. 2000;97:4654-4659.
24. Hanenberg H, Hashino K, Konishi H, Hock RA,
Kato I, Williams DA. Optimization of fibronectinassisted retroviral gene transfer into human
CD34⫹ hematopoietic cells. Hum Gene Ther.
1997;8:2193-2206.
25. Finger EB, Puri KD, Alon R, Lawrence MB, von
Andrian UH, Springer TA. Adhesion through
L-selectin requires a threshold hydrodynamic
shear. Nature. 1996;379:266-269.
26. Suchard SJ, Hinkovska-Galcheva V, Mansfield
PJ, Boxer LA, Shayman JA. Ceramide inhibits
IgG-dependent phagocytosis in human polymorphonuclear leukocytes. Blood. 1997;89:21392147.
27. Pommier CG, O’Shea J, Chused T, et al. Differentiation stimuli induce receptors for plasma fibronectin on the human myelomonocytic cell line
HL-60. Blood. 1984;64:858-866.
28. Bjorgvinsdottir H, Ding L, Pech N, Gifford M, Li
LL, Dinauer MC. Retroviral-mediated gene transfer of gp91phox into bone marrow cells rescues
defect in host defense against Aspergillus fumigatus in murine X-linked chronic granulomatous disease. Blood. 1997;89:41-48.
BLOOD, 1 SEPTEMBER 2000 䡠 VOLUME 96, NUMBER 5
29. Hawley RG, Lieu FHL, Fong AZC, Hawley TS.
Versatile retroviral vectors for potential use in
gene therapy. Gene Ther. 1994;1:136-138.
30. Markowitz D, Goff S, Bank A. A safe packaging
line for gene transfer: separating viral genes on
two different plasmids. J Virol. 1988;62:11201124.
31. Felts K, Bauer JC, Vaillancourt P. High-titer retroviral vectors for gene delivery. Strategies Newsletter. 1999;12:74-77.
32. van Oers NS, Tao W, Watts JD, Johnson P, Aebersold R, Teh HS. Constitutive tyrosine phosphorylation of the T-cell receptor (TCR) zeta subunit: regulation of TCR-associated protein
tyrosine kinase activity by TCR zeta. Mol Cell
Biol. 1993;13:5771-5780.
33. Raman N, Atkinson SJ. Rho controls actin cytoskeletal assembly in renal epithelial cells during
ATP depletion and recovery. Am J Physiol. 1999;
276:C1312–C1324.
34. Knaus UG, Heyworth PG, Kinsella BT, Curnutte
JT, Bokoch GM. Purification and characterization
of Rac 2: a cytosolic GTP-binding protein that
regulates human neutrophil NADPH oxidase.
J Biol Chem. 1992;267:23575-23582.
35. Ihara K, Muraguchi S, Kato M, et al. Crystal structure of human RhoA in a dominantly active form
complexed with a GTP analogue. J Biol Chem.
1998;273:9656-9666.
36. Khosravi-Far R, Solski PA, Clark GJ, Kinch MS,
Der CJ. Activation of Rac1, RhoA, and mitogenactivated protein kinases is required for Ras
transformation. Mol Cell Biol. 1995;15:64436453.
37. Qiu R-G, Chen J, Kirn D, McCormick F, Symons
M. As essential role for Rac in Ras transformation. Nature. 1995;374:457-459.
38. Roos D, Kuijpers TW, Mascart-Lemone F, et al. A
novel syndrome of severe neutrophil dysfunction:
unresponsiveness confined to chemotaxininduced functions. Blood. 1993;81:2735-2743
39. Didsbury J, Weber RF, Bokosh GM, Evans T,
Synderman R. Rac, a novel ras-related family of
proteins that are botulinum toxin substrates.
J Biol Chem. 1989;264:16378-16382.
40. Yang FC, Kapur R, King AJ, et al. Rac 2 stimulates Akt activation affecting BAD/Bcl-XL expression while mediating survival and actin-based cell
functions in primary mast cells. Immunity. 2000;
12:557-568.
41. Lu W, Mayer BJ. Mechanism of activation of Pak1
kinase by membrane localization. Oncogene.
1999;18:797-806.
42. Stowers L, Yelon D, Berg LJ, Chant J. Regulation
of the polarization of T cells toward antigen-presenting cells by Ras-related GTPase CDC42.
Proc Natl Acad Sci U S A. 1995;92:5027-5031.
43. Pai EF, Krengel U, Petsko GA, Goody RS, Kabsch
W, Wittinghofer A. Refined crystal structure of the
triphosphate conformation of H-ras p21 at 1.35 A
resolution: implications for the mechanism of
GTP hydrolysis. EMBO J. 1990;9:2351-2359.
44. Li R, Zheng Y. Residues of the Rho family
GTPases Rho and Cdc42 that specify sensitivity
to Dbl-like guanine nucleotide exchange factors.
J Biol Chem. 1997;272:4671-4679.
45. Jung V, Wei W, Ballester R, et al. Two types of
RAS mutants that dominantly interfere with activators of RAS. Mol Cell Biol. 1994;14:3707-3718.
46. Bourne HR, Sanders DA, McCormick F. The
GTPase superfamily: conserved structure and
molecular mechanism. Nature. 1991;349:117-127.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2000 96: 1646-1654
Dominant negative mutation of the hematopoietic-specific Rho GTPase,
Rac2, is associated with a human phagocyte immunodeficiency
David A. Williams, Wen Tao, Fengchun Yang, Chaekyun Kim, Yi Gu, Pamela Mansfield, John E.
Levine, Bronia Petryniak, Caroline W. Derrow, Chad Harris, Baoqing Jia, Yi Zheng, Daniel R.
Ambruso, John B. Lowe, Simon J. Atkinson, Mary C. Dinauer and Laurence Boxer
Updated information and services can be found at:
http://www.bloodjournal.org/content/96/5/1646.full.html
Articles on similar topics can be found in the following Blood collections
Phagocytes (969 articles)
Plenary Papers (495 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.