Physical Mapping of Amplified Copies of the
5-Enolpyruvylshikimate-3-Phosphate Synthase Gene in
Glyphosate-Resistant Amaranthus tuberculatus1[OPEN]
Andrew Dillon, Vijay K. Varanasi, Tatiana V. Danilova, Dal-Hoe Koo, Sridevi Nakka, Dallas E. Peterson,
Patrick J. Tranel, Bernd Friebe, Bikram S. Gill, and Mithila Jugulam*
Department of Agronomy, Wheat Genetics Resource Center, Kansas State University, Manhattan, Kansas
66506 (A.D., V.K.V., S.N., D.E.P., M.J.); Department of Plant Pathology, Kansas State University, Manhattan,
Kansas 66506 (T.V.D., D.-H.K., B.F., B.S.G.); and Department of Crop Sciences, University of Illinois, UrbanaChampaign, Illinois 61801 (P.J.T.)
ORCID IDs: 0000-0003-2209-1911 (T.V.D.); 0000-0003-0666-4564 (P.J.T.); 0000-0003-4510-9459 (B.S.G.); 0000-0003-2065-9067 (M.J.).
Recent and rapid evolution of resistance to glyphosate, the most widely used herbicides, in several weed species, including
common waterhemp (Amaranthus tuberculatus), poses a serious threat to sustained crop production. We report that glyphosate
resistance in A. tuberculatus was due to amplification of the 5-enolpyruvylshikimate-3-P synthase (EPSPS) gene, which encodes
the molecular target of glyphosate. There was a positive correlation between EPSPS gene copies and its transcript expression. We
analyzed the distribution of EPSPS copies in the genome of A. tuberculatus using fluorescence in situ hybridization on mitotic
metaphase chromosomes and interphase nuclei. Fluorescence in situ hybridization analysis mapped the EPSPS gene to
pericentromeric regions of two homologous chromosomes in glyphosate sensitive A. tuberculatus. In glyphosate-resistant
plants, a cluster of EPSPS genes on the pericentromeric region on one pair of homologous chromosomes was detected. Intriguingly,
two highly glyphosate-resistant plants harbored an additional chromosome with several EPSPS copies besides the native chromosome
pair with EPSPS copies. These results suggest that the initial event of EPSPS gene duplication may have occurred because of unequal
recombination mediated by repetitive DNA. Subsequently, gene amplification may have resulted via several other mechanisms, such as
chromosomal rearrangements, deletion/insertion, transposon-mediated dispersion, or possibly by interspecific hybridization. This report
illustrates the physical mapping of amplified EPSPS copies in A. tuberculatus.
Common waterhemp (Amaranthus tuberculatus) is a
major troublesome weed of cropping systems in North
America (Trucco and Tranel, 2011). Specifically, this
weed is problematic in agricultural fields of the Midwestern United States, causing significant yield losses
in maize (Zea mays) and soybean (Glycine max; Hager
et al., 2002; Steckel and Sprague, 2004; Costea et al.,
2005; Steckel, 2007). A. tuberculatus is a diploid (2n = 32),
dioecious, prolific seed producer that enables rapid
spread of infestation of this weed (Costea et al., 2005).
1
This research was partially funded by the Department of Agronomy and Kansas State Research and Extension (to M.J.) and by
WGRC I/UCRC National Science Foundation grant no. IIP-1338897.
* Address correspondence to [email protected].
The author responsible for distribution of materials integral to the
findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is:
Mithila Jugulam ([email protected]).
A.D. performed most of the experiments and wrote the manuscript; V.K.V. and T.V.D. provided technical assistance to A.D.; T.V.D.
performed experiments and wrote the manuscript; D.-H.K. and S.N.
performed experiments and analyzed the data; A.D. and M.J. designed
the experiments and analyzed the data; M.J. conceived the study,
supervised, and complemented the writing; D.-H.K., D.E.P., P.J.T.,
B.S.G., and B.F. helped draft the final manuscript.
[OPEN]
Articles can be viewed without a subscription.
www.plantphysiol.org/cgi/doi/10.1104/pp.16.01427
1226
Extensive genetic variability, coupled with intense
herbicide selection, resulted in evolution of resistance to
several commonly used herbicides, including glyphosate in A. tuberculatus populations throughout the US
(Nandula et al., 2013; Chatham et al., 2015a; Lorentz
et al., 2014; Bell et al., 2013).
N-(phosphonomethyl) Gly (glyphosate) is the most
widely used herbicide around the globe (Duke and
Powles, 2008; Dill et al., 2010; Brookes and Barfoot, 2014),
primarily because of its inherent safety and effectiveness
in controlling weeds (Alibhai and Stallings, 2001;
Pline-Srinc, 2006; Healy-Fried et al., 2007). Glyphosate
works by inhibiting the 5-enopyruvylshikimate-3phosphate synthase (EPSPS) enzyme of the shikimate
pathway, preventing the synthesis of the aromatic amino
acids Tyr, Trp, and Phe, essential for plant growth
(Steinrücken and Amrhein, 1980; Amrhein et al., 1980;
Duke and Powles, 2008; Herrmann and Weaver, 1999).
The known mechanisms of glyphosate resistance in
weed species have been comprehensively reviewed by
Sammons and Gaines (2014). These mechanisms can be
grouped into two broad categories: (1) non-target-site
and (2) target-site based. Non-target-site resistance to
glyphosate as a result of reduced translocation of
glyphosate to the target site was reported in annual ryegrass (Lolium rigidum) and horseweed (Conyza canadensis;
Lorraine-Colwill et al., 2003; Feng et al., 2004). The reduced
Plant PhysiologyÒ, February 2017, Vol. 173, pp. 1226–1234, www.plantphysiol.org Ó 2017 American Society of Plant Biologists. All Rights Reserved.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Physical Mapping of Amplified EPSPS Copies in A. tuberculatus
translocation likely is mediated by rapid sequestration of
glyphosate into vacuoles (Ge et al., 2013). The mechanisms
that confer target-site resistance to glyphosate generally
involve either point mutation(s) in the EPSPS gene,
resulting in reduced binding affinity of EPSPS to glyphosate or amplification of the EPSPS gene. For example,
target-site resistance to glyphosate as a result of mutations
in the EPSPS gene resulting in amino acid substitution at
Pro-106 or Thr-102 residues (corresponding to EPSPS sequence in Arabidopsis [Arabidopsis thaliana]) has been
documented in glyphosate-resistant (GR) Eleusine indica
(Baerson et al., 2002; Powles and Preston, 2006; Kaundun
et al., 2008; Yu et al., 2015), L. rigidum (Kaundun et al., 2011;
Powles and Preston, 2006; Wakelin and Preston, 2006a,
2006b), and A. tuberculatus (Nandula et al., 2013). On the
other hand, EPSPS gene amplification as a mechanism of
glyphosate resistance was first reported by Gaines et al.
(2010) in Amaranthus palmeri, a closely related species of A.
tuberculatus, and later was also found in many other weeds,
including Kochia scoparia (Wiersma et al., 2015), A. tuberculatus (Lorentz et al., 2014; Chatham et al., 2015a), A. spinosus (Nandula et al., 2013), L. perenne ssp. multiflorum
(Salas et al., 2012), E. indica (Chen et al., 2015), and Bromus
diandrus (Malone et al., 2016).
In GR A. palmeri, massive increase in EPSPS copies
(.100) relative to glyphosate-susceptible (GS) plants was
reported (Gaines et al., 2010). Furthermore, the physical
mapping of EPSPS copies in A. palmeri revealed apparently random distribution of amplified EPSPS copies
throughout the genome (Gaines et al., 2010). In contrast,
we recently illustrated a tandem arrangement of amplified copies of EPSPS in K. scoparia (Jugulam et al., 2014),
possibly, as a result of unequal recombination between
two homologous chromosomes. However, such information is not available in other weed species that evolved
resistance to glyphosate via EPSPS gene amplification.
More importantly, although closely related, GR A. tuberculatus and A. palmeri were found to have considerable
difference in the number of EPSPS copies amplified.
While 10 to 100 EPSPS copies are common in GR A.
palmeri (Gaines et al., 2010), GR A. tuberculatus typically
has 10 or fewer EPSPS copies (Chatham et al., 2015a,
2015b; Lorentz et al., 2014). Investigation of the distribution of EPSPS copies in the genome of A. tuberculatus will
enable better understanding of the mechanisms of EPSPS
amplification. Therefore, in this research, using known GS
and GR A. tuberculatus populations from the state of
Kansas in the US, we (1) determined the relationships
between EPSPS copies, level of transcript gene expression, and resistance; and (2) characterized the chromosomal distribution of EPSPS copies in the genome.
reference gene. In GS samples, EPSPS gene copy
number ranged from 0.8 to 1; therefore, for simplicity,
the values were made equal to 1 and the rest of the data
from GR samples were normalized accordingly (Fig. 1).
A positive correlation between EPSPS copies and
transcript expression was found (Fig. 2), suggesting
that the majority of the amplified copies of EPSPS gene
are functional in GR A. tuberculatus. In sensitive plants,
accumulation of shikimate occurs when EPSPS is inhibited by glyphosate treatment. Results of the shikimate
assay showed significantly higher concentration of
shikimate in GS compared to GR plants after glyphosate
treatment (Fig. 3). Furthermore, the shikimate accumulation negatively correlated with relative EPSPS gene
copy number (Fig. 3). Additionally, there was a positive
correlation between the amount of shikimate accumulated and the dose of glyphosate used in all samples (Fig.
3). Based on the relative genomic copies of EPSPS in GR
A. tuberculatus and the transcript expression, plants were
grouped as low with two to four EPSPS copies (LGR);
moderate with four to eight copies (MGR); or highly
resistant to glyphosate (HGR) with more than eight
copies (Figs. 1 and 3).
Glyphosate Dose Response
Results of the whole-plant glyphosate dose response
on clonally propagated A. tuberculatus showed 100%
injury of susceptible plants and mortality at the low
doses of glyphosate tested (Figs. 4 and 5A). The clones
of LGR (with two to four EPSPS copies) typically
showed 100% injury at 0.1253 (Fig. 5B). Clones of MGR
(more than four and up to eight EPSPS copies) survived
23 glyphosate dose. (Fig. 5C), and up to 43 glyphosate
albeit with significant injury (Fig. 5C). MGR clones
were completely dead when 63 glyphosate dose was
applied. However, clones of HGR (.8 EPSPS copies)
withstood up to 63 glyphosate (Figs. 4 and 5D).
Overall, there was a decrease in susceptibility to
glyphosate with an increase in EPSPS genomic copies.
RESULTS
Determination of EPSPS Copies and Transcript
Expression, and Effect of Glyphosate on Shikimate Levels
Quantitative PCR (qPCR) was used to measure
EPSPS genomic copy numbers in GR plants relative to a
GS sample using acetolactate synthase (ALS) as the
Figure 1. Bar graph depicting relative EPSPS:ALS genomic copy number for GS and LGR, MGR, and HGR A. tuberculatus plants.
Plant Physiol. Vol. 173, 2017
1227
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Dillon et al.
Figure 2. Scatterplot showing the relationship between relative EPSPS:ALS
cDNA expression (y axis) and relative EPSPS:ALS genomic copy number (x axis) of glyphosate-susceptible
(blue squares) and -resistant (red
diamonds) A. tuberculatus.
EPSPS Gene Sequencing
A point mutation resulting from the substitution of
amino acid Pro at position 106 of EPSPS gene with Ala,
Leu, Ser, or Thr has been found to reduce glyphosate
binding at the target site, conferring low-level glyphosate
resistance (Powles and Preston, 2006; Shaner et al., 2012;
Sammons and Gaines, 2014). Another mutation, at position 102 of the EPSPS gene, resulting in substitution of
amino acid Thr with Ile, together with the Pro106Ser mutation, was reported recently in GR E. indica (Yu et al.,
2015). This double mutation imparted high-level resistance
to glyphosate. The EPSPS gene sequence analyses of our
GS and GR A. tuberculatus indicated no evidence of any
point mutation(s) at 102 or 106 positions (Supplemental
Fig. S1), suggesting that the EPSPS enzyme is sensitive to
glyphosate in both GS and GR A. tuberculatus.
Chromosomal Location and Distribution of Amplified
EPSPS Copies in A. tuberculatus
To investigate the location of amplified EPSPS gene
copies on GR A. tuberculatus chromosomes, we used
florescence in situ hybridization (FISH) on somatic
metaphase chromosomes and interphase nuclei of
plants with different levels of resistance to glyphosate.
The 18S, 5.8S, and 26S rRNA genes are localized in
the nucleolus organizing region (NOR; Gerlach and
Bedbrook, 1979) and a probe for these genes labeled
two pairs of homologous chromosomes (Fig. 6). In GS
plant, the EPSPS gene was detected at the pericentromeric regions of one pair of metacentric chromosomes
without NOR sites. The interphase nuclei also showed
one locus each on homologous chromosomes with the
same signal intensity (Fig. 6A).
Figure 3. Combination of bar chart and scatterplot
showing the relationship between shikimate concentration (main y axis), relative EPSPS:ALS genomic copy number (secondary y axis), upon
treatment with various doses of glyphosate in GS
and LGR, MGR, and HGR plants. The GS group of
A. tuberculatus had an average of 1.01 EPSPS genomic copies. Whereas, the average number of
EPSPS copies in LGR, MGR and HGR plants was
2.6, 5.8, and 10.69, respectively. Error bars represent mean 6 1 SE (n = 6).
1228
Plant Physiol. Vol. 173, 2017
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Physical Mapping of Amplified EPSPS Copies in A. tuberculatus
Figure 4. Combination of bar graph and scatterplot showing the relationship between percent
injury (main y axis) and relative EPSPS:ALS genomic copy number (secondary y axis) of GS and
GR A. tuberculatus upon treatment with various
doses (0 to 63) of glyphosate. 13 dose of glyphosate is 868 g ae ha21. The GS group of A.
tuberculatus plants had an average of one relative
EPSPS:ALS genomic copy, whereas the GR group
of A. tuberculatus plants had an average of 6.96
EPSPS:ALS genomic copies.
In LGR and MGR plants with four and eight copies,
respectively, brighter EPSPS signals were detected at
the pericentromeric regions of one pair of metacentric
chromosomes without NOR sites. In interphase nuclei
the EPSPS probe detected clusters of closely located
genes (Fig. 6, B and C). Several plants were found to be
heterozygous as the EPSPS signals on homologous
chromosomes distinctly differed in brightness and size
of the clusters in interphase nuclei (data not shown).
More importantly, two HGR plants (with .15 EPSPS
copies) showed the brightest EPSPS signals and these
plants had 2n = 33 chromosomes. The EPSPS signals were located on one pair of metacentric chromosomes and multiple additional EPSPS signals were
observed on an additional small chromosome (Fig. 6D).
The interphase nuclei also displayed two bright signals
corresponding to the metacentric chromosomes (arrowheads in Fig. 6D) and additional dispersed signals corresponding to the extra chromosome (arrow in
Fig. 6D).
Figure 5. Glyphosate dose (0 to 63,
where 13 = 868 g ae ha21) response of
A. tuberculatus clones generated from a
single plant of: GS with EPSPS copies = 1 (A);
LGR with EPSPS copies = 2.9 (B); MGR
with EPSPS copies = 5 (C); and HGR with
EPSPS copies = 8 (D).
Plant Physiol. Vol. 173, 2017
1229
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Dillon et al.
available in public databases, including EPSPS sequence
from GR A. palmeri (Gaines et al., 2013) we selected
A. palmeri specific primers AW 190 and AW155 amplifying a 697-bp fragment from EPSPS intron1 as reported
earlier (Nandula et al., 2014) and developed two additional markers. PCR with primers M1a and M19 was
expected to amplify 235- and 103-bp fragments from
EPSPS exons 2 and 5, respectively, each with a single
nucleotide polymorphism (SNP) between the two species. The sequence of A. palmeri contains a RsaI restriction
site within the 235-bp fragment and a MspI site within
the 103-bp fragment, both of which are absent in the
A. tuberculatus EPSPS sequence. PCR products of expected lengths were amplified with primers M19 and
M1a for all DNA samples, but only GR and GS A. palmeri
PCR products showed restriction fragments of expected
lengths after digestion. The A. palmeri specific 697-bp
amplicon was obtained with primers AW90 and AW155
for A. palmeri DNA samples only (Fig. 7). Thus, the molecular marker analysis did not detect the presence of
A. palmeri EPSPS gene in HGR A. tuberculatus plant.
DISCUSSION
Figure 6. Detection of EPSPS sequences on somatic metaphase chromosomes (left panels) and interphase nuclei (right panels) of A. tuberculatus
plants by FISH. A, In the GS plant, one EPSPS copy was detected at
the pericentromeric region of one pair of homologous chromosomes
(indicated by arrowheads). B and C, In GR plants with four and eight
(MGR) EPSPS copies relative to ALS, clusters of several FISH signals
were detected on interphase nuclei. EPSPS signals at pericentromeric
regions of metaphase chromosomes are brighter than in the GS plant. D,
Plant with 17 EPSPS gene copies (HGR) has one pair of homologous
chromosomes with EPSPS gene clusters at pericentromeric regions and,
in addition, one smaller chromosome with several dispersed EPSPS
copies (indicated by arrows). EPSPS probes are labeled in red, NOR are
green, and DAPI counterstain is shown in gray pseudocolor. Additional
2.53 magnified images of chromosomes with EPSPS signals are shown
in the insets. Bars = 5 mm.
Molecular Marker Analysis
To test the hypothesis of origin of the chromosome
with dispersed EPSPS gene copies through interspecific
hybridization with A. palmeri, we analyzed the HGR
plant that showed a small additional chromosome using molecular markers. Based on the EPSPS gene and
mRNA sequences of A. palmeri and A. tuberculatus
This study reports, for the first time to our knowledge,
the physical mapping of the A. tuberculatus EPSPS gene at
the pericentromeric region of a homologous pair of metacentric chromosomes and local amplification of a native
EPSPS gene (Fig. 6). An additional smaller chromosome
with multiple EPSPS FISH sites was detected in HGR
plants. The data from a variety of experiments, including
whole plant dose response, determination of EPSPS gene
copies, and transcript expression, suggest a positive correlation between the level of glyphosate resistance and
EPSPS copies and their expression (Figs. 2, 4, and 5) and a
negative correlation for shikimate accumulation and
glyphosate resistance (Fig. 3) as seen in other GR weeds
such as A. palmeri (Gaines et al., 2010; Mohseni-Moghadam
et al., 2013), K. scoparia (Wiersma et al., 2015), and L. perenne
spp. multiflorum (Salas et al., 2012).
To withstand the field use rate (868 g ae/ha) of glyphosate, A. tuberculatus needs at least three or more
(Chatham et al., 2015a, 2015b) EPSPS copies, which is
similar to what was reported in K. scoparia (Jugulam et al.,
2014; Wiersma et al., 2015). Although closely related, it
appears that the number of EPSPS copies needed to survive the field rate of glyphosate is likely to be significantly
different between A. tuberculatus and A. palmeri. A. palmeri
appears to be inherently more sensitive to glyphosate than
is A. tuberculatus (our own observation from several field
trials). Therefore, it is possible that A. palmeri may need
more EPSPS copies than does A. tuberculatus to confer the
same level of resistance to glyphosate. Consequently, A.
palmeri may require a more robust EPSPS amplification
system for resistance than does A. tuberculatus.
The results of physical mapping of EPSPS copies
in A. tuberculatus in this study suggest possible mechanism(s) contributing to the first event of EPSPS gene
duplication resulting in the evolution of resistance to
1230
Plant Physiol. Vol. 173, 2017
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Physical Mapping of Amplified EPSPS Copies in A. tuberculatus
Figure 7. PCR restriction pattern of three
molecular markers M19-MspI, M1a-RsaI, and
AW190/155 is shown for A. tuberculatus
and A. palmeri. The A. palmeri-specific PCR
and restriction products were not detected in
HGR, MGR, and GS A. tuberculatus plants.
PA, A. palmeri; WH, A. tuberculatus.
glyphosate. In GS and GR A. tuberculatus, we found the
amplified EPSPS copies on one pair of homologous
chromosomes (Fig. 6, A–C), similar to what was seen
previously in K. scoparia (Jugulam et al., 2014). However, the localization of the gene clusters was different
in two species: metaphase FISH in K. scoparia revealed
presence of amplified EPSPS copies near the telomeric
region of chromosomes, and arranged in tandem as illustrated by high resolution fiber-FISH (Jugulam et al.,
2014). Gene duplication because of unequal recombination between homologous chromosomes occurs in
nature routinely (Eichler, 2008). The distribution of recombination events is unequal along a chromosome,
though the genome-wide patterns of recombination are
available for only a few plant species. The telomeric
regions have high recombination rates and, in contrast,
the recombination is highly suppressed in pericentromeric regions (reviewed in Gaut et al., 2007). This
suggests a possible role of unequal crossing over as a
mechanism for the origin of EPSPS gene duplication in
K. scoparia. In A. tuberculatus, unlike K. scoparia, amplified
EPSPS copy clusters were localized at the pericentromeric region on one pair of homologous chromosomes
(Fig. 6). Can the recombination resulting from unequal
crossing over still be the initial driver of EPSPS gene
amplification in A. tuberculatus? The suppression of recombination in pericentromeric regions depends on the
proportion of heterochromatin, which varies among
species (Gaut et al., 2007). Nothing is known about
proportion and distribution of heterochromatin along
A. tuberculatus chromosomes. Considering the small size
of chromosomes of A. tuberculatus, they may have low
heterochromatin content. Furthermore, a hotspot for
unequal homologous recombination in a centromeric
region of rice was described in Ma and Bennetze (2006).
Although less likely, recombination is not impossible in
pericentromeric regions. In particular, with high glyphosate selection pressure, unequal crossing over as a
mechanism of the origin of EPSPS gene duplication in A.
tuberculatus cannot be ruled out. Thus, it is conceivable
that the EPSPS amplification initially may have originated as a result of unequal recombination between two
homologous chromosomes resulting in the first gene
duplication event. Additionally, chromosome rearrangement or centromere specific segmental duplication may
have also contributed to the EPSPS gene duplication and,
subsequently, the number of EPSPS copies may have
increased. Extensive segmental duplications were detected at human, mouse, and rice pericentromeres (Thomas
et al., 2003; She et al., 2004; Ma and Bennetzen, 2006).
Gaines et al. (2013) reported miniature invertedrepeat transposable elements next to EPSPS gene copies in GR (but not in GS) A. palmeri, suggesting that the
EPSPS gene amplification may have been facilitated via
DNA-transposon-mediated replication. The transposable elements (TEs) are mobile autonomous segments
of DNA that often get inserted randomly in the genome
and can potentially incorporate within functional genes
(Fedoroff, 2012). Pericentromeric regions of chromosomes are generally heterochromatin rich and are known
to harbor clusters of satellite DNA sequences and TEs
(Slotkin and Martienssen, 2007; Tamaru, 2010).
An additional chromosome with several dispersed
EPSPS copies was present in two HGR A. tuberculatus
plants (Fig. 6D), which may suggest a different mechanism of EPSPS gene amplification. Interspecific
hybridization between different amaranth species is
possible (reviewed by Sellers et al., 2003; Ward et al.,
2013), and several cases of herbicide resistance transfer
via gene flow were reported, including resistance to
imazethapyr (an ALS inhibitor) was transferred from A.
tuberculatus to A. palmeri, and glyphosate resistance was
transferred from A. palmeri to other Amaranthus species
including spiny amaranth (A. spinosus), smooth pigweed (A. hybridus) and A. tuberculatus (Wetzel et al.,
1999; Gaines et al., 2012; Nandula et al., 2014). A random distribution of amplified EPSPS copies throughout the chromosomes was reported for A. palmeri
(Gaines et al., 2010). We tested the hypothesis that the
additional small chromosome with multiple EPSPS
FISH sites were derived from A. palmeri via interspecific
hybridization. However, molecular marker analysis
did not detect A. palmeri EPSPS sequences in the HGR
2n = 33 A. tuberculatus, suggesting that the additional
chromosome was not derived from A. palmeri (Fig. 7). It
is likely that this chromosome was originally derived
from the chromosome pair that harbored the EPSPS
genes in their pericentromeric regions. The mechanism
of how these genes were excised, amplified, and stabilized in form of an extra chromosome added to the
normal chromosome complement is unknown. However, the extra chromosome has many characteristics of
Plant Physiol. Vol. 173, 2017
1231
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Dillon et al.
accessory or B-chromosomes that may or may not be
present in different accession, or individuals within
one accession, of a species (for review, see Jones and
Houben, 2003). These chromosomes are assumed to be
derived from normal or A chromosomes, do not pair
and recombine with other chromosomes of the complement, usually do not harbor genes (except in some
cases ribosomal genes), and often have developed drive
mechanisms to ensure their preferential transmission to
the offspring. Such an origin of extra chromosome was
experimentally demonstrated in Plantago (Dhar et al.,
2002). Additional research is underway to analyze the
origin of the extra chromosome harboring amplified
EPSPS genes in A. tuberculatus.
Overall, the results of this research uncover, for the
first time to our knowledge, the localization of amplified EPSPS gene copies on A. tuberculatus chromosomes.
Future research directed toward investigation of flanking sequences, including breakpoints of the EPSPS
amplicon, will shed light on the mechanism of such
possibly recurrent rearrangement events in A. tuberculatus.
Identification of a specific TE, and the role played by TEs
in EPSPS gene duplication, are key areas for understanding the mechanism of GR.
MATERIALS AND METHODS
Characterization of GR in A. tuberculatus
Seeds of confirmed GR and known GS common waterhemp (Amaranthus
tuberculatus) from Kansas were planted in 30 3 22 3 6-cm plastic trays filled
with moisture-control potting soil (Scotts Miracle-Gro) and seedlings were
grown in a greenhouse attached to Kansas State University. The greenhouse
was maintained at 25/20°C (d/night) with a 15/9-h night photoperiod. Sunlight was supplemented with sodium vapor lamps with a 200 mmol m22 s21
photosynthetic flux. When plants were at 8 to 10 cm tall, ;80 plants were
sprayed with either 1, 2, or 43 dose of glyphosate (Roundup WeatherMAX;
Monsanto). Here, x is the field used rate, which is 868 g ae ha21 with 2% ammonium sulfate (v/v). Glyphosate treatments were applied using a track
sprayer (Generation III Research Sprayer; De Vries Manufacturing), calibrated
to apply 168 L ha21 at 220 kPa with a flat fan nozzle tip (80015LP TeeJet tip;
Spraying Systems). Two weeks after glyphosate application, the survivors were
transplanted to 11 3 11 3 12-cm plastic pots containing Miracle-Gro moisture
control potting soil. All plants were watered and fertilized as needed. Leaf tissue
(;100 mg) was harvested from the survivors of glyphosate treatment as well as
untreated GS plants. The leaf tissue was flash-frozen in liquid nitrogen (2196°C)
and then stored at 280°C until further use. Furthermore, untreated GS and the
glyphosate survivors were also propagated vegetatively by nodal cuttings (described later) to perform a whole-plant dose response assay (described later).
qPCR to Determine EPSPS Copy Number
To determine the number of EPSPS copies in GS and GR A. tuberculatus,
genomic DNA (gDNA) was extracted from frozen leaf tissue using a DNeasy
Plant Mini Kit (Qiagen) following the manufacturer’s instructions. The DNA
concentration of each sample was quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). The relative EPSPS copy number was
determined by qPCR on gDNA using ALS as a reference gene according to
Gaines et al. (2010). qPCR was conducted using a CFX-96 Touch (Bio-Rad).
Primers sequences for both ALS (forward, 59-GCTGCTGAAGGCTACGCT-39;
reverse, 59-GCGGGACTGAGTCAAGAAGTG-39; 118-bp product) and EPSPS
(forward, 59-ATGTTGGACGCTCTCAGAACTCTTGGT-39; reverse, 59TGAATTTCCTCCAGCAACGGCAA-39; 195-bp product) were as described by
Gaines et al. (2010). Quantitative PCR was performed using 96-well microtiter
plate containing a master mix of 10 mL of iQ SYBR Green Super Mix (Bio-Rad),
2 mL each of forward and reverse primers (5 mM), 2 mL of gDNA (16 ng/mL), and
4 mL molecular grade water to a total reaction volume of 20 mL in each well.
There were three technical replicates with each experiment, which was repeated. The following qPCR conditions were maintained: initial denaturing at
95°C for 15 min, followed by up to 40 cycles of denaturing at 95°C for 30 s, and
then annealing and extension at 60°C for 1 min. Relative quantification of
EPSPS was calculated as ΔCt = CtALS 2 CtEPSPS and EPSPS copy number was
expressed as 2ΔCt. The 22ΔCT = relative gene copy (ΔCT method) was used to
determine the copy number (Pfaffl, 2006). The copy number was averaged
across replications and the SD was calculated for each plant sample.
qPCR to Determine Relative EPSPS Transcript Expression
EPSPS gene transcript level was quantified using qPCR in GS and GR A.
tuberculatus relative to ALS as the reference gene as described above. Total RNA
from frozen leaf tissue collected from new and actively growing 10- to 12-cmtall plants was extracted using RNeasy Plant Mini Kit (Qiagen) following the
manufacturer’s instructions. The quantity and quality (integrity) of total RNA
were determined using a NanoDrop 1000 spectrophotometer (Thermo Fisher
Scientific) and agarose gel (1%) electrophoresis. Total RNA was treated with
DNase 1 enzyme (Thermo Fisher Scientific) to remove gDNA contamination.
cDNA was synthesized from 1 mg of total RNA using a RevertAid First Strand
cDNA Synthesis kit (Thermo Fisher Scientific) following the manufacturer’s
instructions. Concentration of the cDNA was then determined via a NanoDrop
1000 spectrophotometer (Thermo Fisher Scientific). The qPCR procedure and
quantification as described above was used to determine the relative fold increase in EPSPS gene expression.
Shikimate Assay
In sensitive plants, glyphosate inhibits the EPSPS enzyme, causing a reduction in aromatic amino acid synthesis and a buildup of shikimic acid or
shikimate (Shaner et al., 2005). Quantification of shikimate is routinely done to
determine glyphosate resistance in plants. An in vivo shikimate accumulation
assay as described by Shaner et al. (2005) was performed using GS and GR A.
tuberculatus. Briefly, twelve 6-mm leaf discs were harvested from the youngest
leaf of actively growing plants using a paper hole-punch. These discs were
placed in 96-well microtiter plates containing 100, 250, or 500 mM glyphosate
solution. The leaf discs were incubated under artificial light (200 mmol m22 s21)
for 16 h. A shikimate standard curve was used (Shaner et al., 2005) to calculate
the shikimate accumulation in ng shikimate mL21. The experiment was performed in triplicate and repeated.
Whole-Plant Glyphosate Dose Response Assay
Untreated GS and the survivors of GR A. tuberculatus (known EPSPS copy
number) were clonally multiplied to perform whole-plant glyphosate dose response assay. Nodal cuttings of approximately 4 to 5 cm in size were selected,
and the leaves and petioles were removed. The bottom of the nodal cutting was
treated with Bontone rooting powder (Bonide Products) and placed in 6 3 6 3
5-cm plastic pots containing prewetted Miracle-Gro Moisture control potting
soil. These pots were covered with a clear plastic dome to create a humid microenvironment to enable rooting. The clonal segments produced new shoots
and roots 10 to 12 d after placing them under plastic domes in the greenhouse.
At least three to five clones of each plant (8–10 cm tall) were treated with formulated glyphosate with 2% ammonium sulfate at 0, 0.625, 0.125, 0.25, 0.5, 1,
23, 43, or 63 doses (x = 868 g ae ha21 glyphosate). Visual injury rating (0 = no
injury to 100 = complete death of plant) was recorded at 1, 2, and 3 weeks after
treatment. Data of visual injury rating were analyzed in SAS ver. 9.4 using
PROC GLM (SAS Institute), and significant differences were obtained using LSD,
least square means (LSMEANS), and contrasts. The experiment was repeated.
EPSPS Gene Sequencing
A portion of the EPSPS gene was sequenced from 30 different A. tuberculatus
plants that were confirmed resistant to glyphosate to determine if any known
amino acid substitution at 106 or 102 positions conferring glyphosate resistance
are present in GR A. tuberculatus samples. A segment of EPSPS gene that
encompasses the above positions was amplified by PCR using gDNA from GS
and GR samples. Primers sequences (forward, 59-CCAAAAGGGCAGTCGTAGAG-39; reverse, 59-ACCTTGAATTTCCTCCAGCA-39; 147-bp product)
were adopted from Varanasi et al. (2015). These reactions comprised 12.5 mL
1232
Plant Physiol. Vol. 173, 2017
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Physical Mapping of Amplified EPSPS Copies in A. tuberculatus
23 PCR master mix (Promega), 2.5 mL of both forward and reverse primers
(5 mM), 5 mL gDNA (40 ng/mL), and 2.5 mL of nuclease free water (Promega), for
a total reaction volume of 25 mL for each sample. The PCR was performed on a
T100 Thermal Cycler (Bio-Rad), with the following conditions: initial denaturation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 30 s,
annealing at 53.5°C for 45 s and final extension at 72°C for 7 min. PCR product
was run on a 1% agarose gel stained with ethidium bromide and expected
amplicon size was confirmed using a 100-bp DNA ladder (Bio-Rad). The PCR
product was purified using a GeneJET PCR purification kit (Thermo Fisher
Scientific) and was sequenced. The resulting nucleotide sequences were aligned
using Multalin software (Corpet, 1988).
Cytogenetic Analysis
FISH was performed to illustrate the distribution of EPSPS copies on
chromosomes of A. tuberculatus. To prepare EPSPS FISH probe, the sequence of
A. tuberculatus EPSPS mRNA (GenBank accession FJ869881) was used to develop the PCR primers (forward, 59-GCCAAGAAACAAAGCGAAAT-39; reverse, 59-TTTCAGCATCATAATTCATAACCC-39; product length 1,804 bp).
Total RNA from leaf tissue of GS plants was extracted as described earlier.
cDNA was synthesized from 1 mg of purified RNA using a RevertAid First
Strand cDNA Synthesis Kit (Thermo Fisher Scientific) and PCR-amplified using
the above primers. The RT-PCR conditions consisted of initial denaturation at
95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing
at 53.5°C for 45 s, extension at 72°C for 2 min. Total reaction volume in each well
was 50 mL, with 25 mL of PCR Master Mix (Promega), 5 mL each of forward and
reverse primers (5 mM), 5 mL of cDNA (40 ng/mL) template, and 10 mL of nuclease free water (Promega). The expected amplicon (1,804 bp) was cut from 1%
agarose gel, purified using a QIAquick GEL extraction kit (Qiagen), and
reamplified using the same primers and protocol. PCR products were purified
with PCR Purification kit (Invitrogen) and used to prepare the FISH probe. The
amplified PCR fragment was verified by sequencing with the above primers.
Somatic chromosome preparations with drop technique, using direct nick
translation probe labeling, and the FISH procedure were performed as described
by Kato et al. (2004, 2006) with minor modifications. Specifically, root tips were
collected from young plants and treated in a nitrous oxide gas chamber for 2 h,
fixed on ice in cold 90% acetic acid for 10 min, washed and stored in 70% ethanol
at 220°C. For slide preparation, roots were washed in tap water for 10 min and
then in KCl buffer for 5 min (75 mM KCl and 7.5 mM EDTA, pH 4); three to five
meristems (0.5–1 mm long) were placed in 20 mL of 4% cellulase Onozuka R-10
(Yakult), 1% pectolyase Y23 (Karlan) in KCl buffer, and incubated for 50 min at
37°C. Digested root meristems were washed for 5 min in ice-cold Tris-EDTA
buffer, pH 7.6, then three times in 100% ethanol. Meristems were dispersed with
a needle in 10 to 15 mL of ice-cold acetic acid:methanol mix (9:1) and immediately dropped on to precleaned glass slides placed in a humid chamber. Dried
preparations were UV cross-linked, soaked in methacarn solution (methanol:
chloroform:glacial acetic acid at 6:3:1) for 2 min, dried, and used for hybridization on the same day. For labeling the NOR rRNA loci, clone pTa71, containing a 9-kb insertion with 18S, 5.8S, and 26S rRNA wheat genes (Gerlach and
Bedbrook, 1979) was used as a probe. Five micorliters of probe mixture contained 200 ng of EPSPS PCR product labeled with TX red-5-dCTP and 60 ng of
pTa71 labeled with Fluorescein-12-dUTP (Perkin-Elmer). The mixture of probes
and the slide preparation were denatured at 100°C separately. The rest of the
FISH procedure and the washes were the same as described by Kato et al.
(2006). Chromosome preparations were mounted and counterstained with 4’,6diamidino-2-phenylindole solution (DAPI) in Vectashield (Vector Laboratories). FISH images were captured with an AxioPlan 2 microscope using a cooled
CCD camera CoolSNAP HQ2 (Photometrics) and AxioVision 4.8 software (Carl
Zeiss). The images were processed using Adobe Photoshop CS5 software
(Adobe Systems). To show the chromosome shape, the DAPI-stained chromosome images were converted to black-and-white mode and overlaid with
the signal images.
Molecular Marker Analysis
Genomic DNA from GR and GS plants of A. palmeri was extracted as described above for A. tuberculatus for quantifying EPSPS gene copy number. The
genomic DNA of GS, GR A. palmeri as well as GS, MGR, and HGR A. tuberculatus was used in this analysis. PCR conditions for primers AW190 and
AW155 were as suggested by Nandula et al. (2014). To develop additional
markers we analyzed sequences of EPSPS gene and mRNAs from several accessions of A. palmeri and A. tuberculatus (NCBI accession numbers JX564536,
FJ861242, FJ861243, FJ869880, FJ869881, and AY545657) and found SNPs in
exons 2 and 5, detectable by restriction enzymes RsaI and MspI. PCR for
primers M1a (forward, CAACAGTGGTCGACAACTTGCTGTA; reverse,
TTTCCTCCAGCAACGGCAAC) and M19 (forward, CTCCTGGAAAGGCATATGTT; reverse, GTTCCACAACCCTTGACA) included initial denaturation
at 94°C for 3 min, followed by 35 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for
30 min; and final extension at 72°C for 5 min. The 25 mL of PCR reaction mixture
contained 23 PCR Master Mix (Promega), 0.5 mM each forward and reverse
primer, 50 to 100 ng of genomic DNA. Primers were synthesized by Integrated
DNA Technologies. Five microliters of a restriction enzyme mixture containing
2.55 mL of water, 2.0 mL of NEB buffer, 0.2 mL of 1003 BSA, and 0.25 mL of an
enzyme stock solution was added to 15 mL of PCR products and incubated
overnight at 37°C. The restricted PCR products were resolved on 2% agarose
gels in 13 TAE and visualized by ethidium bromide staining under ultraviolet
light.
Supplemental Data
The following supplemental materials are available.
Supplemental Figure S1. Segment of the A. tuberculatus EPSPS gene spanning the amino acid residues, at Thr-102 and Pro-106 in GS and GR plants.
ACKNOWLEDGMENT
This manuscript is approved for publication as Kansas Agricultural Experiment Station Contribution no. 17-015-J.
Received October 28, 2016; accepted December 10, 2016; published December
12, 2016.
LITERATURE CITED
Alibhai MF, Stallings WC (2001) Closing down on glyphosate inhibition—
with a new structure for drug discovery. Proc Natl Acad Sci USA 98:
2944–2946
Amrhein N, Deus B, Gehrke P, Steinrücken HC (1980) The site of inhibition of
shikimate pathway by glyphosate: II. Interference of glyphosate with chorismate formation in vivo and in vitro. Plant Physiol 66: 830–834
Baerson SR, Rodriguez DJ, Tran M, Feng Y, Biest NA, Dill GM (2002)
Glyphosate-resistant goosegrass. Identification of a mutation in the
target enzyme 5-enolpyruvylshikimate-3-phosphate synthase. Plant
Physiol 129: 1265–1275
Bell MS, Hager AG, Tranel PJ (2013) Multiple resistance to herbicides from
four site-of-action groups in waterhemp (Amaranthus tuberculatus).
Weed Sci 61: 460–468
Brookes G, Barfoot P (2014) Economic impact of GM crops: the global
income and production effects 1996–2012. GM Crops Food 5: 65–75
Chatham LA, Riggins CW, Martin JR, Kruger GR, Bradley KW, Peterson
DE, Jugulam M, Tranel P (2015a) A multi-state study of the association
between glyphosate resistance and EPSPS gene amplification in waterhemp (Amaranthus tuberculatus). Weed Sci 63: 569–577
Chatham LA, Wu C, Riggins CW, Hager AG, Young BG, Roskamp GK,
Tranel PJ (2015b) EPSPS gene amplification is present in the majority of
glyphosate-resistant Illinois waterhemp (Amaranthus tuberculatus) populations. Weed Technol 29: 48–55
Chen J, Huang H, Zhang C, Wei S, Huang Z, Chen J, Wang X (2015)
Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica). Planta 242: 859–868
Corpet F (1988) Multiple sequence alignment with hierarchical clustering.
Nucleic Acids Res 16: 10881–10890
Costea M, Weaver SE, Tardif FJ (2005) The biology of invasive alien plants
in Canada. 3. Amaranthus tuberculatus (Moq.) Sauer var. rudis (Sauer)
Costea & Tardiff. Can J Plant Sci 85: 507–522
Dhar MK, Friebe B, Koul AK, Gill BS (2002) Origin of an apparent B
chromosome by mutation, chromosome fragmentation and specific
DNA sequence amplification. Chromosoma 111: 332–340
Dill G, Sammons RD, Feng P, Kohn F, Mehrsheikh A, Bleek M, Honegger
JL, Farmer D, Wright D, Haupfear EA (2010) Glyphosate: discovery, development, applications, and properties. In VK Nandula, ed, Glyphosate
Resistance in Crops and Weeds: History, Development, and Management.
John Wiley & Sons, Hoboken, NJ, pp 1–34
Plant Physiol. Vol. 173, 2017
1233
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Dillon et al.
Duke SO, Powles SB (2008) Glyphosate: a once-in-a-century herbicide. Pest
Manag Sci 64: 319–325
Eichler EE (2008) Copy number variation and human disease. New Educator 1: 1
Fedoroff NV (2012) Presidential address. Transposable elements, epigenetics, and genome evolution. Science 338: 758–767
Feng PCC, Tran M, Chiu T, Sammons RD, Heck GR, Cajacob CA (2004)
Investigations into glyphosate-resistant horseweed (Conyza canadensis):
retention, uptake, translocation, and metabolism. Weed Sci 52: 498–505
Gaines TA, Ward SM, Bukun B, Preston C, Leach JE, Westra P (2012)
Interspecific hybridization transfers a previously unknown glyphosate
resistance mechanism in Amaranthus species. Evol Appl 5: 29–38
Gaines TA, Wright AA, Molin WT, Lorentz L, Riggins CW, Tranel PJ,
Beffa R, Westra P, Powles SB (2013) Identification of genetic elements
associated with EPSPS gene amplification. PLoS One 8: e65819
Gaines TA, Zhang W, Wang D, Bukun B, Chisholm ST, Shaner DL,
Nissen SJ, Patzoldt WL, Tranel PJ, Culpepper AS, et al (2010) Gene
amplification confers glyphosate resistance in Amaranthus palmeri. Proc
Natl Acad Sci USA 107: 1029–1034
Gaut BS, Wright SI, Rizzon C, Dvorak J, Anderson LK (2007) Recombination: an underappreciated factor in the evolution of plant genomes.
Nat Rev Genet 8: 77–84
Ge X, d’Avignon DA, Ackerman JJH, Ostrander E, Sammons RD (2013)
Application of 31P-NMR spectroscopy to glyphosate studies in plants:
insights into cellular uptake and vacuole sequestration correlated to
herbicide resistance. In Handbook on Herbicides: Biological Activity,
Classification and Health & Environmental Implications. Nova Science
Publishers, Hauppauge, NY, pp 55-84
Gerlach WL, Bedbrook JR (1979) Cloning and characterization of ribosomal
RNA genes from wheat and barley. Nucleic Acids Res 7: 1869–1885
Hager AG, Wax LM, Stoller EW, Bollero GA (2002) Common waterhemp
(Amaranthus rudis) interference in soybean. Weed Sci 50: 607–610
Healy-Fried ML, Funke T, Priestman MA, Han H, Schönbrunn E (2007)
Structural basis of glyphosate tolerance resulting from mutations of
Pro101 in Escherichia coli 5-enolpyruvylshikimate-3-phosphate synthase.
J Biol Chem 282: 32949–32955
Herrmann KM, Weaver LM (1999) The shikimate pathway. Annu Rev
Plant Physiol Plant Mol Biol 50: 473–503
Jones N, Houben A (2003) B chromosomes in plants: escapees from the A
chromosome genome? Trends Plant Sci 8: 417–423
Jugulam M, Niehues K, Godar AS, Koo DH, Danilova T, Friebe B, Sehgal S,
Varanasi VK, Wiersma A, Westra P, Stahlman PW, Gill BS (2014) Tandem
amplification of a chromosomal segment harboring 5-enolpyruvylshikimate-3phosphate synthase locus confers glyphosate resistance in Kochia scoparia. Plant
Physiol 166: 1200–1207
Kato A, Albert PS, Vega JM, Birchler JA (2006) Sensitive fluorescence in
situ hybridization signal detection in maize using directly labeled probes
produced by high concentration DNA polymerase nick translation.
Biotech Histochem 81: 71–78
Kato A, Lamb JC, Birchler JA (2004) Chromosome painting using repetitive DNA sequences as probes for somatic chromosome identification in
maize. Proc Natl Acad Sci USA 101: 13554–13559
Kaundun SS, Dale RP, Zelaya IA, Dinelli G, Marotti I, McIndoe E, Cairns
A (2011) A novel P106L mutation in EPSPS and an unknown mechanism(s)
act additively to confer resistance to glyphosate in a South African Lolium
rigidum population. J Agric Food Chem 59: 3227–3233
Kaundun SS, Zeleya IA, Dale RP, Lycett AJ, Carter P, Sharples KR,
McIndoe E (2008) Importance of the P106S target-site mutation in conferring resistance to glyphosate in a goosegrass (Eleusine indica) population from the Phillipines. Weed Sci 56: 637–646
Lorentz L, Gaines TA, Nissen SJ, Westra P, Strek HJ, Dehne HW, RuizSantaella JP, Beffa R (2014) Characterization of glyphosate resistance in
Amaranthus tuberculatus populations. J Agric Food Chem 62: 8134–8142
Lorraine-Colwill DF, Powles SB, Hawkes TR, Hollinshead PH, Warner
SAJ, Preston C (2003) Investigations into the mechanism of glyphosate
resistance in Lolium rigidum. Pestic Biochem Physiol 74: 62–72
Ma J, Bennetzen JL (2006) Recombination, rearrangement, reshuffling, and
divergence in a centromeric region of rice. Proc Natl Acad Sci USA 103:
383–388
Malone JM, Morran S, Shirley N, Boutsalis P, Preston C (2016) EPSPS
gene amplification in glyphosate-resistant Bromus diandrus. Pest Manag
Sci 72: 81–88
Mohseni-Moghadam M, Schroeder J, Ashigh J (2013) Mechanism of resistance
and inheritance in glyphosate resistant Palmer amaranth (Amaranthus palmeri) populations from New Mexico, USA. Weed Sci 61: 517–525
Nandula VK, Ray JD, Ribeiro DN, Pan Z, Reddy KN (2013) Glyphosate
resistance in tall waterhemp (Amaranthus tuberculatus) from Mississippi
is due to both altered target-site and nontarget-site mechanisms. Weed
Sci 61: 374–383
Nandula VK, Wright AA, Bond JA, Ray JD, Eubank TW, Molin WT (2014)
EPSPS amplification in glyphosate-resistant spiny amaranth (Amaranthus spinosus): a case of gene transfer via interspecific hybridization
from glyphosate-resistant Palmer amaranth (Amaranthus palmeri ). Pest
Manag Sci 70: 1902–1909
Pfaffl MW (2006) Relative quantification. In MT Dorak, ed, Real-Time PCR.
Taylor and Francis Group, New York, pp 63–82
Pline-Srinc W (2006) Physiological mechanisms of glyphosate resistance.
Weed Technol 20: 290–300
Powles SB, Preston C (2006) Evolved glyphosate resistance in plants: biochemical and genetics basis of resistance. Weed Technol 20: 282–289
Salas RA, Dayan FE, Pan Z, Watson SB, Dickson JW, Scott RC, Burgos NR
(2012) EPSPS gene amplification in glyphosate-resistant Italian ryegrass (Lolium
perenne ssp. multiflorum) from Arkansas. Pest Manag Sci 68: 1223–1230
Sammons RD, Gaines TA (2014) Glyphosate resistance: state of knowledge. Pest Manag Sci 70: 1367–1377
Sellers BA, Smeda RJ, Johnson WG, Kendig JA, Ellersieck MR (2003)
Comparative growth of six Amaranthus species in Missouri. Weed Sci
51: 329–333
Shaner DL, Lindenmeyer RB, Ostlie MH (2012) What have the mechanisms of resistance to glyphosate taught us? Pest Manag Sci 68: 3–9
Shaner DL, Nadler-Hasser T, Henry WB, Koger CH (2005) A rapid in vivo
shikimate accumulation assay with excised leaf discs. Weed Sci 53: 769–774
She X, Horvath JE, Jiang Z, Liu G, Furey TS, Christ L, Clark R, Graves T,
Gulden CL, Alkan C, et al (2004) The structure and evolution of centromeric
transition regions within the human genome. Nature 430: 857–864
Slotkin RK, Martienssen R (2007) Transposable elements and the epigenetic regulation of the genome. Nat Rev Genet 8: 272–285
Steckel LE (2007) The dioecious Amaranthus spp.: here to stay. Weed
Technol 21: 567–570
Steckel LE, Sprague CL (2004) Common waterhemp (Amaranthus rudis)
interference in corn. Weed Sci 52: 359–364
Steinrücken HC, Amrhein N (1980) The herbicide glyphosate is a potent
inhibitor of 5-enolpyruvyl-shikimic acid-3-phosphate synthase. Biochem
Biophys Res Commun 94: 1207–1212
Tamaru H (2010) Confining euchromatin/heterochromatin territory: jumonji crosses the line. Genes Dev 24: 1465–1478
Thomas JW, Schueler MG, Summers TJ, Blakesley RW, McDowell JC,
Thomas PJ, Idol JR, Maduro VV, Lee-Lin SQ, Touchman JW, et al
(2003) Pericentromeric duplications in the laboratory mouse. Genome
Res 13: 55–63
Trucco F, Tranel PJ (2011) Amaranthus. In C Kole, ed, Wild Crop Relatives:
Genomic and Breeding Resources: Vegetables. Springer, New York, pp 11–21
Varanasi VK, Godar AS, Currie RS, Dille AJ, Thompson CR, Stahlman
PW, Jugulam M (2015) Field-evolved resistance to four modes of action
of herbicides in a single kochia (Kochia scoparia L. Schrad.) population.
Pest Manag Sci 71: 1207–1212
Wakelin AM, Preston C (2006a) A target-site mutation is present in a
glyphosate-resistant Lolium rigidum population. Weed Res 46: 432–440
Wakelin AM, Preston C (2006b) Inheritance of glyphosate resistance in
several populations or rigid ryegrass (Lolium rigidum) from Australia.
Weed Sci 54: 212–219
Ward SM, Webster TM, Steckel LE (2013) Palmer Amaranth (Amaranthus
palmeri ): a review. Weed Technol 27: 12–27
Wetzel DK, Horak MJ, Skinner DZ, Kulakow PA (1999) Transferal of
herbicide resistance traits from Amaranthus palmeri to Amaranthus rudis.
Weed Sci 47: 538–543
Wiersma AT, Gaines TA, Preston C, Hamilton JP, Giacomini D, Robin
Buell C, Leach JE, Westra P (2015) Gene amplification of 5-enolpyruvylshikimate-3-phosphate synthase in glyphosate-resistant Kochia
scoparia. Planta 241: 463–474
Yu Q, Jalaludin A, Han H, Chen M, Sammons RD, Powles SB (2015) Evolution
of a double amino acid substitution in the 5-enolpyruvylshikimate-3phosphate synthase in Eleusine indica conferring high-level glyphosate resistance. Plant Physiol 167: 1440–1447
1234
Plant Physiol. Vol. 173, 2017
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2017 American Society of Plant Biologists. All rights reserved.