MHC Class I Presentation and Regulation by
IFN in Bony Fish Determined by Molecular
Analysis of the Class I Locus in Grass Carp
This information is current as
of June 18, 2017.
Weihong Chen, Zhenghu Jia, Ting Zhang, Nianzhi Zhang,
Changyou Lin, Feng Gao, Li Wang, Xiaoying Li, Yinan
Jiang, Xin Li, George F. Gao and Chun Xia
J Immunol published online 21 July 2010
http://www.jimmunol.org/content/early/2010/07/21/jimmun
ol.1000347
http://www.jimmunol.org/content/suppl/2010/07/20/jimmunol.100034
7.DC1
Subscription
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Permissions
Email Alerts
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Supplementary
Material
Published July 21, 2010, doi:10.4049/jimmunol.1000347
The Journal of Immunology
MHC Class I Presentation and Regulation by IFN in Bony
Fish Determined by Molecular Analysis of the Class I Locus
in Grass Carp
Weihong Chen,*,†,1 Zhenghu Jia,*,1 Ting Zhang,*,1 Nianzhi Zhang,*,1 Changyou Lin,*,1
Feng Gao,† Li Wang,* Xiaoying Li,* Yinan Jiang,* Xin Li,* George F. Gao,†,‡ and
Chun Xia*,x
T
he key molecules, cells, and lymphoid organs in the adaptive immune system (AIS) emerged in jawed vertebrates
and play a crucial role in protection against numerous pathogenic infections (1, 2). Although it is difficult to extrapolate the
origin of the AIS, it is possible to track the evolutionary footprints well before the evolution of the AIS. For example, V regioncontaining chitin-binding protein (3) and V and C domain-bearing
protein in amphioxus (4) and CD4 and TCR-like molecules in
lamprey (5) were found to have ancient molecules possibly related
*Department of Microbiology and Immunology, College of Veterinary Medicine,
China Agricultural University; †Key Laboratory of Pathogenic Microbiology and
Immunology, Institute of Microbiology and ‡Beijing Institutes of Life Science, Chinese Academy of Sciences; and xKey Laboratory for Preventive Veterinary Medicine,
Ministry of Agriculture of China, Beijing, People’s Republic of China
1
W.C., Z.J., T.Z., N.Z., and C.L. contributed equally to this work.
Received for publication February 2, 2010. Accepted for publication June 9, 2010.
This work was supported by the National Natural Science Foundation of China (Grant
30371098) and the National Basic Research Program (Project 973) of China (Grant
2007CB815805).
The sequences presented in this article have been submitted to GenBank under accession numbers EF584535 and EF584536.
Address correspondence and reprint requests to Prof. Chun Xia, Department of
Microbiology and Immunology, College of Veterinary Medicine, China Agricultural
University, Beijing 100094, People’s Republic of China. E-mail address: xiachun@
cau.edu.cn
The online version of this article contains supplemental material.
Abbreviations used in this paper: AIS, adaptive immune system; CO, grass carp ovary;
CPE50, 50% cytopathic effect inhibition; CY, cytoplasmic; 3D, three-dimensional; EPC,
epithelioma papulosum cyprinid; GCFL, grass carp fosmid library; GCHV, grass carp
hemorrhagic virus; GcIFN, grass carp IFN; IHNV, infectious hematopoietic necrosis
virus; ISRE, IFN-stimulated regulatory element; b2m, b2-microglobulin; mya,
million years ago; PBD, peptide-binding domain; PFGE, pulsed-field gel electrophoresis; SVCV, spring viremia of carp virus; TAPBP, TAP-associated glycoprotein; TCID50,
50% tissue culture infective dose; TM, transmembrane.
Copyright Ó 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1000347
to the AIS. MHC, TCR, and BCR are pivotal molecules that can
recognize and initiate a protective immune response against potentially lethal pathogens (2, 6–8). In particular, MHC class I and
class II molecules determine which Ag peptides are presented to
CD8/CD4-positive T cells, which leads to the triggering of specific
immune responses via intracellular signaling pathways (8–11).
The classical class I molecule is composed of a1, a2, and a3
domains, a transmembrane (TM) domain, and cytoplasmic (CY)
regions. This molecule forms a trimolecular complex with b2microglobulin (b2m) and a CTL epitope on the surface of APCs
(12). The trimolecular complex further combines with the TCR
and its coreceptors, which activates the CTL to trigger specific
CTL responses (13, 14). Thus, MHC class I-restricted viral Ag
control is a primary domino effect that functions to eliminate
these cells infected by various viruses. However, the full force of
the CTL response is determined by the structure and affinity of
the class I H chain and b2m with a CTL epitope as well as the
TCR in the immunological synapse (9, 15). Therefore, the survival strategy from early to higher vertebrates is to evolve a
large genetic region encoding polymorphic class I genes for multiple peptide presentations to defend against fatal viral diseases
and tumors.
Thus far, the genomic sequences of humans, mammals, reptiles,
amphibians, birds, and fish indicate that there are one or more class
I loci in jawed vertebrates (2, 16–19). The MHC of humans, well
known as HLA, is located on chromosome 6 at 6p21.31 and is
∼3600 kb in length (20). The HLA class I gene is ∼1500 kb and
includes three classical loci, HLA-A, HLA-B, and HLA-C. The
common features of classical class I in humans and mammals are
high polymorphism, conservation of the antigenic peptide-binding
amino acids, and expression on the surface of all nucleated cells.
Crystallography studies have shown that the Ag-binding grooves
of MHC class I in humans (21, 22), mice (21, 23, 24), monkeys
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Beyond their sequences, little is known regarding MHC class I presentation and regulation by IFN in bony fish. In this work, the
class I locus (Ctid-UBA) was isolated from a grass carp fosmid library, and its polymorphisms and tissue expression were
investigated. The Ctid-UBA and Ctid-b2–microglobulin genes then were expressed and refolded, and tetramer techniques were
used to identify the CTL response. The interaction between grass carp type I IFN and Ctid-UBA genes was investigated. Two
fosmids coding for Ctid-UBA *0101 and Ctid-UBA *0201 genes were sequenced. The SXY box and IFN-stimulated regulatory
element motifs were located from the start codons to 2800 bp in Ctid-UBA. A Southern blot showed three to four bands,
suggesting that grass carp contains at least three class I loci. In addition, the Ctid-UBA allelic genes are expressed in all tissue
of grass carp. The three-dimensional structure of Ctid-UBA *0102 showed that the peptide-binding domain was formed by the a1
and a2 domains, which could bind several nonapeptides of grass carp hemorrhagic virus. There were 1.60% more PEpositive cells in P1(QPNEAIRSL)-immunized fish than in blank and adjuvant control groups. Additionally, recombinant grass
carp IFN could regulate the expression of Ctid-UBA. These results characterize the class I presentation, CTL response, and
regulation by type I IFN in bony fish. The Journal of Immunology, 2010, 185: 000–000.
2
MHC PRESENTATION AND REGULATION BY IFN IN BONY FISH
results represent the first characterization of class I presentation
and regulation by IFN in early vertebrate bony fish.
Materials and Methods
Animals, cell lines, and viruses
Two-year-old grass carp (mean weight of 1.2 kg) were obtained from the Beijing Fishes Company, Beijing, China. The fish were acclimated for 2 d in an
aerated freshwater system at 25˚C before further experiments. Spring viremia of carp virus (SVCV) (59), infectious hematopoietic necrosis virus
(IHNV), and grass carp ovary (CO) and epithelioma papulosum cyprinid
(EPC) cell lines were maintained in our laboratory (60). This study was
conducted according to the management regulations of experimental animals
in Beijing and was approved by the Animal Care Committee of China Agricultural University, Beijing, People’s Republic of China.
Construction of the PCR cDNA libraries
The PCR cDNA libraries were constructed following the Takara cDNA PCR
library kit’s instructions (Takara Biotechnology, Dalian, China) (61).
Briefly, first-strand cDNA was synthesized using an oligo(dT) RNA primer.
Then, Escherichia coli RNase H, E. coli DNA polymerase I, and E. coli
DNA ligase were used for the synthesis of second-strand cDNA. Next, T4
DNA polymerase was used to perform the blunt end ligation of doublestranded cDNA with the cytosine and adenine cassette adaptor.
Construction and characterization of the fosmid library
The fosmid library was constructed according to the protocol provided with
the CopyControl fosmid library production kit (Epicentre Biotechnologies,
Madison, WI). Briefly, high-m.w. DNA from the RBCs of a grass carp
(fish-C) was sheared by back-pipetting 40 times with a 1-ml 16-pinhead
syringe. The sheared DNA was end-repaired and then size-selected as 35–
45 kb fragments by running in a 20-cm-long 1% agarose gel at 30–50 V
overnight. The collected fragments were ligated into the pCCIFOS CopyControl vector at a 10:1 (vector/insert) ratio for 2 h at room temperature using
fast link ligase. The ligation reaction was heat-inactivated at 70˚C for 10 min,
and then the DNA was packaged into phage particles using MaxPlax l
packaging extracts (Epicentre Biotechnologies). The packaged fosmid
clones were titered by serial dilutions and used to infect 100 ml of phage
T1-resistant EPI300 E. coli, and strain cells were plated onto Luria-Bertani
agar containing 12.5 mg/ml chloramphenicol. Titering of the packaged
CopyControl fosmid clones was carried out in accordance with the manufacturer’s instructions (Epicentre Biotechnologies). All of the clones were
selected and distributed into 96-well plates. The library was replicated and
stored at 280˚C. The pCCIFOS vector features an inducible copy number,
which allows the maintenance and storage of single-copy constructs for
improved stability of cloned inserts as well as culture at a high copy number
for efficient DNA purification. To evaluate the average insert size in pCCIFOS, 22 clones were randomly selected from the fosmid library. Enzyme
digestion and pulsed-field gel electrophoresis (PFGE) were carried out essentially as previously described by Liu et al. (62). Briefly, 22 plasmids
isolated from the positive recombinant EPI300-T1R E. coli clones were
digested completely using NotI, and the insert size was estimated by PFGE.
Screening of Ctid-MHC I genes
To clone the key immune genes (MHC class I, MHC class II a, MHC class II b,
CD8a, IFN-a, and IgM CH), six sets of degenerate primers were synthesized
based on their interrelated sequences (Table I). Two primers (E4P1/E4P2)
were designed from the highly conserved region of Ctid-MHC I a3 and were
used for a PCR amplification termed E4-PCR. All of the PCR assays were
carried out in a final volume of 50 ml. The PCR products were inserted into
the pGEM T-easy vector (Promega, Fitchburg, WI), and the positive clones
were sequenced on an ABI 377 DNA sequencer (Beijing Genomics Institute,
Beijing, China) using T7 and SP6 primers. These cloned genes were identified by searching the DNA Data Bank of Japan/European Molecular Biology
Laboratory/GenBank Database.
A total of 129,408 independent fosmid clones were isolated and arrayed in
1348 96-well plates. A total of 112 superpools were created from the fosmid
library, and each superpool covered 12 96-well plates, except for the last one
(Supplemental Fig. 1). The 3D-PCR screening strategy consisted of two steps.
In the first step, 50 ml from a superpool was used as a template for the E4-PCR
screening. When a positive clone was found in a superpool, the screening was
further converged. At the same time, the plate pooled from one positive superpool located in all 12 columns of the same row and all 8 rows of the same
column was used for E4-PCR (Supplemental Fig. 1). In this way, one positive
clone was found by performing 144 E4-PCR reactions. Finally, two positive
clones corresponding to classical class I a3 domains (47) were obtained.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
(25), and chickens (26) are formed by two a helices in the a1 and
a2 domains. CTL epitopes are anchored in six small pockets in the
bottom of the binding groove (27). The anchor residues in classical MHC class I are comparatively conserved, with the result that
class I molecules can recognize different peptides and multiple
peptides can be recognized by the same class I molecule. Chicken
MHC, known as the B complex, is located on chromosome 16 and
contains two MHC class I (B-F) and MHC class II (B-L) loci (28).
The gene order of the B complex is very different from that of
MHC class I of other higher vertebrates. The B-F genes are simpler and more compact, and only B-F2 of classical class I determines the antiviral response (29).
Bony fish are an early and the largest group of vertebrates,
comprising approximately half of the living vertebrates on earth.
Most existing bony fish evolved from a common ancestor in a large
expansion that occurred 400–500 million years ago (mya) (2).
Studies have shown that the immune organs, cells, and molecules in
bony fish have unique characteristics (30). For example, although
bony fish have neither bone marrow nor lymph nodes, four types of
Igs (31, 32) and B lymphocytes with potent phagocytic and
microbicidal abilities have been found (33). In addition, two loci for
CD4 (34), three loci for b2m (35), and .22 TLRs (36) have been
detected. Surprisingly, LPS cannot combine with TLR4 and cannot
further activate the NF-kB pathway (37). These differences shed
light on the origin and evolutionary trajectory of the AIS. The
common carp is a representative bony fish, and its MHC class I
gene was first cloned by Hashimoto et al. (38). Since then, the
class I genes have been reported in at least nine species, including
shark (39), rainbow trout (40), Atlantic salmon (41), zebrafish (42),
fugu (43), catfish (44), Atlantic cod (45), and grass carp (46, 47).
Presently, the genomes of the MHC region in zebrafish (48), fugu
(49), medaka (50), rainbow trout (51), and Atlantic salmon have
been fully sequenced. The economically important fish rainbow
trout and Atlantic salmon have only one classical but highly
polymorphic MHC class I locus, but other regions paralogous to
class I have been detected (52). This implies that a whole-genome
duplication occurred in their common ancestor some 25–100 mya
(2, 19). Unlike mammals and chickens, bony fish class I and class II
genes are not linked and are located on different chromosomes.
At the same time, the polymorphic residues of the peptide-binding
domain (PBD) of class I show up to 60% intraspecies sequence
divergence, but the interspecies homology of the PBD is .88%
(53–55). However, some reports have confirmed that in bony fish
the class I genes also can confer resistance to bacterial and viral
pathogens (56, 57). However, beyond these gene sequences, little is
known about the actual functions of class I in early bony fish. It is
important to accurately define when and how MHC class I evolved.
Grass carp (Ctenopharyngodon idella) is classified as a member
of the cyprinid family of bony fish. This species is distributed in
the inland water area of the Eastern hemisphere, particularly in the
Yangtze River in China. Because the fish is herbivorous and grows
rapidly, man has bred this fish for the past century, and it has become the main source of food protein from freshwater worldwide.
In this study, the classical class I genes (Ctid-UBA) are sequenced
from a fosmid library, and the polymorphisms and tissue expression
are investigated. To further characterize the class I presentation in
bony fish and its regulation by IFN, the Ctid-UBA and Ctid-b2m
genes were expressed and purified. Next, a series of Ag peptides
from grass carp hemorrhagic virus (GCHV) (58) were refolded
with Ctid-UBA and Ctid-b2m, and the three-dimensional (3D)
structure of the class I complex was analyzed. Finally, the specific
CTL response was identified by refolding and tetramer techniques.
Additionally, we investigated whether recombinant grass carp IFN
(GcIFN-a) could regulate the expression of Ctid-UBA. These
The Journal of Immunology
Sequencing strategy and analysis of two positive fosmids
The two positive fosmids from the grass carp fosmid library (GCFL),
GCFL-0405E6 and GCFL-07311G8, were further sequenced by the shotgun
method. First, each fosmid DNA sample was extracted and broken up by
ultrasonication. Subsequently, two subcloned libraries of T-vectors were
constructed from the two fosmids as described previously by Taghian
et al. (63). The sequences of 1000 positive clones having an insert size
of 2–3 kb from each library were determined with the ABI PRISM Big
Dye Primer Cycle Sequencing Ready Reaction Kit (Applied Biosystems)
and the ABI 377 DNA sequencer using T7 and SP6 sequence primers (The
Beijing Genomics Institute). Finally, the sequence assembly was completed with Phrap (www.phrap.org/consed/consed.html#howToGe). The
coding regions were identified by GENSCAN (http://genes.mit.edu/GENSCAN.html), and the homology analysis was performed by a BLAST
analysis (www.ncbi.nlm.nih.gov/blast). The promoter was analyzed using
Genomatix MatInspector software (www.genomatix.de/products/MatInspector/index.html) (64). Polymorphisms and the phylogenetic tree were
analyzed using DDBJ (www.ddbj.nig.ac.jp/search/clustalw-e.html), Maga
3.1, and Genetics 6.0. GCFL-0405E6 and GCFL-07311G8 were deposited
in GenBank under accession numbers EF584535 (www.ncbi.nlm.nih.gov/
nuccore/EF584535.1) and EF584536 (www.ncbi.nlm.nih.gov/nuccore/
EF584536.1), respectively.
The Ctid-UBA allele-specific primers (UBAP1/UBAP2) were designed to
bind to the exon 1 and exon 5 domains according to the genomic sequencing of EF584535 (www.ncbi.nlm.nih.gov/nuccore/EF584535.1) (Table I).
RNA was extracted from 12 kidney samples and used as the template in the
RT-PCR. PCR conditions were as follows: first, a hot start at 98˚C for
5 min, then Taq polymerase and paraffin added at 72˚C, followed by 32
cycles at 94˚C for 1 min, 55˚C for 1 min, and 72˚C for 2 min, and a final
cycle at 72˚C for 10 min. PCR products were recovered and further ligated
with the T-vector. Approximately 5–10 positive clones were sequenced
from each kidney sample. Multiple alignments of MHC class I sequences
from fish, chicken, mammals, and human were created using ClustalW at
DDBJ (www.ddbj.nig.ac.jp/search/clustalw-e.html).
Southern blot hybridization
A probe termed UBA-P was labeled by digoxigenin and used in a Southern
blot according to the protocol provided with the Digoxigenin DNA Labeling
System Kit (Roche, Basel, Switzerland). First, 1 mg of genomic DNA isolated from fish-C was digested by EcoRI, HindIII, and BamHI, separated in
a 1% agarose gel, and transferred to a Hybond N+ nylon membrane (Amersham Biosciences, Uppsala, Sweden). Ten milliliters of efficient hybrid
solution (Hyb-100) then was added, and the membrane was prehybridized
for 2 h at 65˚C. Next, 3 ng/ml UBA-P was added and hybridized overnight.
Finally, the membrane was washed, and the fluorescent signal was detected
according to the protocol.
fragments encoding extracellular domains of Ctid-UBA *0102 (residues 1–
272) and Ctid-b2m (residues 1–98) were cloned into pET-21a vectors and
expressed in BL21(DE3)pLysS cells (Novagen, Darmstadt, Germany). Additionally, seven CTL-like epitopes from GCHV were predicted according
to the motifs P2L9 and A2I9 defined in our preliminary experiments as described previously (67). Briefly, CTL-like epitopes from GCHV have been
predicted according to HLA/B/C allelic anchor and subanchor residues (http://
syfpeithi.bmi-heidelberg.com/Scripts/MHCServer.dll). The Ctid-UBA *0102
gene then was linked to the Ctid-b2m gene via (G4S)3 by splicing overlapextension PCR. Finally, the refolded Ctid-UBA *0102-(G4S)3-b2m protein
was used to bind some peptides, which were detected subsequently by mass
spectrometry (67). Seven peptide (P1–P7) matched GCHV-873 (AF403396;
www.ncbi.nlm.nih.gov/nuccore/22128445) amino acid sequences were synthesized and purified by reverse-phase HPLC (SciLight Biotechnology Beijing, China). The purities of the peptides were .90%. The Ctid-UBA *0102
and Ctid-b2m inclusion bodies were prepared essentially as previously
described by Garboczi et al. (7) with minor modifications (66). Briefly,
transformed BL21(DE3)pLysS cells were grown at 37˚C in Luria-Bertani
medium containing 50 mg ml21 carbenicillin. Isopropyl-D-thiogalactoside
(Sigma-Aldrich, St. Louis, MO) was added to a final concentration of 0.5
mM when the culture reached an OD600 of 0.6. After a further 3–4 h of
incubation at 37˚C, the bacteria were harvested and suspended in cold PBS
buffer. After lysis using a sonicator and centrifugation at 18,000 3 g, the pellet
was washed twice with a solution of 20 mM Tris-HCl, 100 mM NaCl, 1 mM
EDTA, 1 mM DTT, and 0.5% Triton X-100. Ctid-UBA *0102 and Ctid-b2m
inclusion bodies constituted most of the pellet. Next, the Ctid-UBA *0102 H
chain and Ctid-b2m inclusion bodies were dissolved separately in a solution
of 10 mM Tris-HCl (pH 8) and 8 M urea. The synthetically prepared GCHVderived peptide was dissolved in DMSO. Ctid-UBA-*0102 H chain, Ctidb2m, and peptide were combined in a 1:1:3 molar ratio and refolded by
dilution. After 24–48 h of incubation at 4˚C, the soluble portion was
concentrated and then purified by chromatography on a Superdex 200 pg
size-exclusion column (Hiload 16/60 or 10/300GL; GE Healthcare, Uppsala,
Sweden). Additionally, the binding strength after refolding with P1 was tested
by purifying the monomers using a Superdex 200 16/60 column followed by
Resource Q anion-exchange chromatography (GE Healthcare). Whether the
peptide bound to Ctid-UBA *0102 H chain and Ctid-b2m was determined
using 12% SDS-PAGE electrophoresis.
Modeling of the Ctid-UBA *0102 complex
The 3D structure of Ctid-UBA *0102 with Ctid-b2m and P1 (QPNEAIRSL)
was predicted by amino acid homology modeling using the SWISS-MODEL
html server (www.expasy.org/swissmod/) based on the existing 3D structure
of chicken B-F2 *2101 (PDB code 3BEW; www.pdb.org/pdb/explore/
explore.do?structureId=3BEV) (26) in the Protein Data Bank (www.rcsb.
org/pdb/home/home.do). DNAMAN was used to analyze the differences
in these molecules, and figures were prepared using the PyMOL Molecular
Graphics System (www.pymol.org).
Tetramer preparation
Tissue distribution of Ctid-UBA genes
Two primers (UBAP3/UBAP4) and a fluorescently labeled probe (TaqmanUBA P) against the Ctid-UBA genes were designed by Primer Express II
and DNAMAN software (Table I). As an internal control, two primers and
a probe for amplifying Ctid-b-actin were designed according to the data in
GenBank (DQ211096; www.ncbi.nlm.nih.gov/nuccore/77166569). Plasmids containing Ctid-UBA and Ctid-b-actin were constructed and serially
diluted 10-fold (1010, 109, 108, 107,…100). Real-time quantitative PCR was
performed on an ABI 7500 machine (Applied Biosystems) according to the
instructions of the Premis Ex Taq Kit and PrimeScript RT Reagent Kit
(Takara Biotechnology). Real-time PCR conditions were as described previously (Table I). cDNAs from grass carp organs (brain, heart, head kidney,
kidney, spleen, gill, gut, skin, and liver) were analyzed by real-time PCR. The
DCt value of the two samples was calculated by the formula: DCt = CtTarget 2
CtActin. The DDCt value of the two samples was calculated by the formula:
DDCt(Ctid-UBA one organ) = DCt(Ctid-UBA one organ) 2 DCt(Ctid-UBA the lowest value).
The log10(22DDCt) value was used to show the expression situation of the
Ctid-UBA gene as previously described by Yuan et al. (65).
Expression and refolding of Ctid-UBA *0102 and Ctid-b2m
with peptides of GCHV
The prokaryotic expression system pET-21a/BL21(DE3) (R&D Systems,
Minneapolis, MN) was used to express the Ctid-UBA *0102 and Ctidb2m genes as described previously (66). UBAP7 and UBAP8 were used
to amplify the extracellular domains of Ctid-UBA *0102 (Table I). cDNA
The tetrameric Ctid-UBA *0102 complex was constructed according to our
previous method (68). Briefly, a sequence containing a BirA enzymatic
biotinylation site was added to the C terminus of the Ctid-UBA *0102
H chain. The entire construct was cloned into the pET-21a plasmid and
transfected into competent E. coli for protein expression. The purified
recombinant Ctid-UBA *0102 H chain containing the BirA site and
Ctid-b2m were refolded with peptide P1 as described above. The complex was purified by chromatography using a Superdex 200 size-exclusion
column followed by Mono Q anion-exchange chromatography and, finally,
with biotin using the BirA enzyme (Avidity Aurora, CO). The complex
was tetramerized by mixing biotinylated Ctid-UBA *0102-P1 and PElabeled streptavidin (BioSource International, Camarillo, CA) at a molar
ratio of 4:1. SDS-PAGE electrophoresis was used to determine tetramerization efficiency.
Determination of the Ctid-UBA-restricted response
A total of nine grass carp were divided into three groups: the immunization,
adjuvant, and blank groups. The immunization group was injected with an
attenuated GCHV vaccine according to the manufacturer’s instructions
(Pearl River Fishery Research Institute, Chinese Academic of Fishery
Science, Zhujiang, China). Two weeks later, the fish in the immunization
and adjuvant control groups were further injected with the P1 peptide
mixed with CFA (1:1 emulsification) or PBS mixed with CFA, respectively. After one week, P1 or PBS mixed with IFA were injected again for
an additional immunization. After one week, fish splenocytes were isolated
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Polymorphism and comparative analysis of Ctid-UBA genes
3
Ctid-UBA
1
4
.60
CD8a
MHC class I (E4-PCR)
9
1
1
1
Ctid-UBA probe
Genotyping RT-PCR
Expression of Ctid-UBA
Expression of Ctid-b2m
Expression of Ctid-IFN I
Real-time quantitative PCR
UBA allele-specific promoters
Ctid-MHC I
2
IFN
Ctid-IFN I
Ctid-b2m
Ctid-UBA *0102
Ctid-UBA
Ctid-CD8a
Ctid-IFN-a
Ctid-IgM CH4
1
IgM H chain CH4
500
294
820
1000
1000
276
230
209
363
292
Ctid-MHC II b
1
MHC class IIb
281
Ctid-MHC II a
1
Length of
PCR Product (bp)
Name of
Positive Clones
3D-PCR MHC class IIa
No. of
Positive Clones
IFNIP2: TACAAGCTTTCGTCTGTTGGCAATGCTTGCGATG
B2mP2: CCGCTCGAGTTACATGTTGGACTCCCAAAC
IFNIP1: TCAGGATCCTGCGAATGGCTCGGCCGATAA
UBAP9: CCGCTCGAGTTAAATGATGTCATCCTCTGTCT
B2mP1: CGCCATATGAAAGTCTCCAGTCCCAAG
UBAP6: AACAGGTTTAAAGCCTTTCTTTTTCTGATA
UBAP7: TTCCATATGGGAACACACTCTCTGAAATA
UBAP2: AACAGGTTTAAAGCCTTTCTTTTTCTGATA
UBAP3: TCCTCAGGTGTCTCTGTTGCA
UBAP4: GTTCACCAAGATCCACATCCTC
CCTCTTCTCCAGTGACGTGTCATGCTAC
UBAP5: ACTGTTTCTCATGCAACAGCAAGGATG
Reverse: GTAATGATGTCATCCTCTGTCTTTCTGATGG
UBAP1: ACTGTTTCTCATGCAACAGCAAGGATG
Reverse: CAAAGACGACAATATCCAAGTCTCACA
Forward: CTCCTCAGGTGTCTCTGTTGCAGAAGGATC
Reverse: ACATTCTTTAAGATCAGATGACTGCC
Forward: GTGACTGCTACAACAAAATCACCATG
Reverse: TCTAGTCCTTGCAGGATGCAGGGG
Forward: GTACCAAGGTGTCATTTCCAGGACG
Reverse: ATGATGATTCCCAGCACCAGACCAG
Forward: GACCCTCTGTTTACCTGTTAGCACC
Reverse: ACTCCACARAACACWGCTGGACCAAC
Forward: TGTGCAGTGCATAYGAMTTCTACCC
Forward: AACACWCTCATCTGTCWTGTGACTGG
Primer Sequence (59–39)
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Sequenced Gene
Table I. Primers and PCR conditions used in this study
—
—
—
28 cycles (94˚C 1 min, 55˚C 1 min,
72˚C 1.5 min)
28 cycles (94˚C 1 min, 55˚C 1 min,
72˚C 40 s)
32 cycles (94˚C 1 min, 60˚C 1 min,
72˚C 1 min)
—
—
—
40 cycles (95˚C 10 s, 60˚C 1 min)
32 cycles (94˚C 1 min, 55˚C 1 min,
72˚C 2 min)
—
04005E6, 06801F5
01011E8
36 cycles (94˚C 45 s, 60˚C 45 s,
72˚C 45 s)
32 cycles (94˚C 1 min, 55˚C 1 min,
72˚C 2 min)
02607C11
36 cycles (94˚C 30 s, 55˚C 30 s,
72˚C 30 s)
03005C3
35 cycles (94˚C 1 min, 65˚C 1 min,
72˚C 1 min)
00909G8 01607A8
11012H7
36 cycles (94˚C 1 min, 55˚C 1 min,
72˚C 1 min)
35 cycles (94˚C 45 s, 60˚C 45 s,
72˚C 45 s)
06203F4
Clone Address
in Library
36 cycles (94˚C 45 s, 55˚C 45 s,
72˚C 45 s)
PCR Condition
4
MHC PRESENTATION AND REGULATION BY IFN IN BONY FISH
The Journal of Immunology
and incubated at 37˚C for 30 min in staining buffer (PBS with 0.1% BSA
and 0.1% sodium azide) containing the PE-labeled tetrameric complex.
The cells were washed once with staining buffer and detected by flow
cytometry. Over 106 cell events were acquired for each sample.
The cells were stained with PE-labeled tetramer and counted as the CTL
response cells (68). Simultaneously, the Ctid-UBA genes from the grass
carp were genotyped by RT-PCR using UBAP5/UBAP6 primers and sequenced according to the method described above.
5
Interaction between IFN and Ctid-UBA expression
The GcIFN-a gene was cloned using two primers (IFNP1/IFNP2) designed
in National Center for Biotechnology Information according to the sequence (DQ357216; www.ncbi.nlm.nih.gov/nuccore/86211357). The forward primer IFNP1 (59-TCAGGATCCTGCG AATGGCTCGGCCGATACA-39) contained a BamHI restriction site, and the reverse primer IFNP2
(59-TACAAGCTTTCGTCTGTTGGCAATGCTTGCGATG-39) contained a
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 1. Alignment and sequence analysis of Ctid-UBA, its exon–intron organization, and its promoter region. A, Comparison of predicted amino acid
sequences of the two Ctid-UBA genes. The first amino acid of each exon is considered as position 1. Identity with the Ctid-UBA *0101 sequences is
indicated with a dash, and gaps are indicated by dots. The N-linked glycosylation site is underlined. B, Exon–intron organization of the Ctid-UBA genes.
The exon sizes are noted above the sequences, and the intron sizes are noted below. C, The promoter in Ctid-UBA *0201. Putative transcription factorbinding sites are indicated. Enhancer elements including the ISRE are underlined, and conserved motifs involved in the constitutive expression of MHC
class I sequences are indicated above in bold.
6
MHC PRESENTATION AND REGULATION BY IFN IN BONY FISH
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 2. Comparison of the PBD domains of Ctid-UBA amino acid sequences to the classical MHC class I of other fish and vertebrates. The a1 and a2
domains of the expressed Ctid-UBA genes contained 85–89 and 91–93 aa, respectively. The amino acid identities of Ctid-UBA ranged from 65.0 to 99.9%. The
motif (Y7, Y59, R84, T142, K145, W146, Y157, and Y171), which is crucial for peptide binding, was conserved in partial Ctid-UBA allelic genes. Numbers above
and below the line indicate amino acid sequence numbers of the Ctid-UBA *0102 sequences and HLA-A2, respectively. Asterisks and dashes indicate gaps and
sequence identity, respectively, and were inserted to optimize the Ctid-UBA *0102 sequence alignments and identities. Solid circles indicate the eight conserved
residues of the motif, and the symbol p indicates the associated amino acids believed to interact with antigenic peptide termini in HLA-A2. The b symbols show the
amino acids binding to b2m in HLA-A2; the equal and pound signs above the Ctid-UBA *0102 sequences indicate the structural position of the residues in the b
strands and a helix, respectively. On the basis of the HLA-A2 structure, the number 3 below the HLA-A2 indicates the residues involved in intradomain contacts with
the a3 domain. The sequence sources are as follows: UBA 0101 (EF584535; www.ncbi.nlm.nih.gov/nuccore/156602009), UBA 0102 (AB190929; http://getentry.
ddbj.nig.ac.jp/search/SearchServlet), UBA 0103 (AB540132; http://getentry.ddbj.nig.ac.jp/search/SearchServlet), UBA 0104 (AB540133; http://getentry.ddbj.nig.
ac.jp/search/SearchServlet), UBA 0105 (AB540134; http://getentry.ddbj.nig.ac.jp/search/SearchServlet), UBA 0106 (AB540135; http://getentry.ddbj.nig.ac.jp/
search/SearchServlet), UBA 0107 (AB540136; http://getentry.ddbj.nig.ac.jp/search/SearchServlet), UBA 0108 (AB540137; http://getentry.ddbj.nig.ac.jp/search/
SearchServlet), UBA 0109 (AB540138; http://getentry.ddbj.nig.ac.jp/search/SearchServlet), UBA 0110 (AB540139; http://getentry.ddbj.nig.ac.jp/search/SearchServlet), UBA 0111 (AB540140; http://getentry.ddbj.nig.ac.jp/search/SearchServlet), UBA 0112 (AB540141; http://getentry.ddbj.nig.ac.jp/search/SearchServlet),
UBA 0113 (AB540142; http://getentry.ddbj.nig.ac.jp/search/SearchServlet), UBA 0114 (AB540143; http://getentry.ddbj.nig.ac.jp/search/SearchServlet), UBA
0201 (AB540144; http://getentry.ddbj.nig.ac.jp/search/SearchServlet), Ctid-AB109779 (AB109779; www.ncbi.nlm.nih.gov/nuccore/38229055), Ctid-AB109780
The Journal of Immunology
Results
GCFL contains Ctid-UBA and relevant immune genes
A GCFL was constructed to determine the genomic sequence of
Ctid-UBA and other relevant immune genes. A total of 22 clones
were selected randomly from the GCFL, and their plasmid DNA
was analyzed by PFGE. The results showed that the insert size
ranged from 30 to 45 kb without empty fosmid clones (Supplemental Fig. 1). The GCFL contained a total of 129,014 clones,
and the average insert size was 35 kb. Therefore, the genomic coverage of this library was 4.1 times ([35,000 3 129,014]/1.1 3 109;
the grass carp genome is 1.1 3 109 bp). The 129,014 clones were
distributed into 1334 96-well plates, and 12 plates were combined
to form a superpool, for a total of 112 superpools (Supplemental
Fig. 1). Six relevant immune genes, MHC I, MHC II a, MHC II b,
IFN-a, CD8a, and IgM CH chain, were screened using 3D-PCR.
Except for Ctid-UBA, these immune genes will be described in later
reports.
Sequences of Ctid-UBA in the grass carp genome
Two positive fosmids from the GCFL termed GCFL-0405E6 and
GCFL-07311G8 were further subcloned into over 1000 T-vectors
and sequenced. The results showed that GCFL-0405E6 and GCFL07311G8 were 33 and 36.3 kb in length, and these sequences have
been deposited in GenBank under accession numbers EF584535
(www.ncbi.nlm.nih.gov/nuccore/EF584535.1) and EF584536 (www.
ncbi.nlm.nih.gov/nuccore/EF584536.1), respectively. The coding
genes of EF584535 (www.ncbi.nlm.nih.gov/nuccore/EF584535.1) and
EF584536 (www.ncbi.nlm.nih.gov/nuccore/EF584536.1) were analyzed using GENSCAN.
In EF584535 (www.ncbi.nlm.nih.gov/nuccore/EF584535.1), a
tapasin and a Ctid-UBA gene were assembled, and the Ctid-UBA gene
was named Ctid-UBA *0101. Ctid-UBA *0101 started at 14,140 bp
and ended at 29,162 bp, spanning a region of 15,022 bp. Exon 1
contained 49 bp and encoded the signal peptide. Exon 2 had 261 bp
and encoded the a1 domain. Intron 1, between exon 1 and exon 2, was
1454 bp. Exon 3 contained 276 bp and encoded the a2 domain. Intron
2 was 10,920 bp. Exon 4 was 276 bp and encoded the a3 domain.
Intron 3 was 440 bp. Exon 4 was 99 bp and encoded the TM domain.
Intron 4 was 595 bp. Exon 5 was only 18 bp and encoded the CY1
domain. Intron 5 was 138 bp. Exon 6 was 42 bp and encoded the CY2
domain of Ctid-UBA *0101. Intron 6, located between exon 6 and
exon 7, was 439 bp. In total, the Ctid-UBA *0101 gene encoded 339
aa. The signal peptide was 17 aa, the a1, a2, and a3 domains were
87, 92, and 96 aa, respectively, and the TM/CY domains were 48
aa (Fig. 1A).
A complete contig of 36.3 kb contained part of the tapasin and
Ctid-UBA genes in EF584536 (www.ncbi.nlm.nih.gov/nuccore/
EF584536.1). The Ctid-UBA was termed Ctid-UBA *0201. The
gene started at 4505 bp and ended at 20,980 bp, consisting of
16,475 bp. Exon 1 contained 49 bp and encoded a signal peptide.
Exon 2 was 261 bp and encoded the a1 domain. Intron 1 was 1018
bp. Exon 3 contained 276 bp and encoded the a2 domain. Intron 2
was 12,282 bp. Exon 4 was 288 bp and encoded the a3 domain.
Intron 3 was 1572 bp. Exon 4 was 99 bp and encoded the TM
domain. Intron 4 was 335 bp. Exon 5 was 18 bp and encoded the
CY1 domain. Intron 5 was 172 bp. Exon 6 was 53 bp and encoded
the CY2 domain. Intron 6, located between exon 6 and exon 7,
was 249 bp. The Ctid-UBA *0201 gene encoded 342 aa. Both
Ctid-UBA *0101 and Ctid-UBA *0201 had seven exons and six
introns, and they had similar exon–intron arrangements (Fig. 1B).
A glycosylation site was found at positions 100–102 in Ctid-UBA.
The identity of the a1 and a3 domains was over 75%, and the
identity of the a2 domains was just over 50%. The identity of the
Ctid-UBA *0101 and Ctid-UBA *0201 introns was 51–63%. Although their exon–intron sizes and sequences were obviously different, the tapasin genes existed at the 59 end of the two genes, and
therefore, they were determined to be possibly an allelic version.
Promoter organization was analyzed in the genomic sequences
800 bp before the start codons of the Ctid-UBA genes. In Ctid-UBA
*0101, GAAA motifs were found at positions 2764, 2589, 2501,
and 228. An IFN-stimulated regulatory element (ISRE) sequence
was found at position 2291. The SXY box, composed of an S-box,
X1 3 2, and EnhB (Y), is a common promoter for expression of the
MHC class I, MHC class II, and b2m genes, and was found at positions 2277, 2244, and 2220 in Ctid-UBA *0101 (EF584535; www.
ncbi.nlm.nih.gov/nuccore/EF584535.1). However, GAAA motifs
were found at positions 2108, 2314, 2384, 2654, and 2733 in CtidUBA *0201. The ISRE sequence was found at position 2232, and
(AB109780; www.ncbi.nlm.nih.gov/nuccore/38229057), Ctid-AB126179 (AB126179; www.ncbi.nlm.nih.gov/nuccore/38423532), Ctid-AB126180 (AB126180; www.ncbi.nlm.nih.gov/nuccore/38423534), Ctid-AB126181 (AB126181; www.ncbi.nlm.nih.gov/nuccore/38423536), Ctid-AB126186 (AB126186;
www.ncbi.nlm.nih.gov/nuccore/38423546), Ctid-AB126187 (AB126187; www.ncbi.nlm.nih.gov/nuccore/38423548), Ctid-AB126188 (AB126188; www.ncbi.nlm.
nih.gov/nuccore/38423550), Ctid-AB126189 (AB126189; www.ncbi.nlm.nih.gov/nuccore/38423552), Ctid-AB182701 (AB182701; www.ncbi.nlm.nih.gov/nuccore/
49387487), Onmy-UBA*4801 (AF318188; www.ncbi.nlm.nih.gov/nuccore/12407973), Sasa-UBA*1401 (AF504016; www.ncbi.nlm.nih.gov/nuccore/25573065),
Satr-UBA*0801 (AF296381; www.ncbi.nlm.nih.gov/nuccore/9937604), Dare-UDA*01 (AF182155; www.ncbi.nlm.nih.gov/nuccore/6636420), BF2-15 (L28958;
www.ncbi.nlm.nih.gov/nuccore/11067754), BF2-21 (AY234769; www.ncbi.nlm.nih.gov/nuccore/30171203), SLA-*0401 (ABW24123; www.ncbi.nlm.nih.gov/
protein/158253220), BoLA-A11 (AAZ74685; www.ncbi.nlm.nih.gov/protein/73328772), H-2K-F (M58156; www.ncbi.nlm.nih.gov/nuccore/199429), HLA-A2
(K02883; www.ncbi.nlm.nih.gov/nuccore/187605).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
HindIII restriction site (Table I). The GcIFN-a gene was amplified from the
cDNA library using a Takara ExTaq PCR Kit (Takara Biotechnology). A
prokaryotic expression plasmid (pQE30/GcIFN-a) was constructed in two
steps: first, GcIFN was inserted into the pGEM-T easy vector and then double-digested with BamHI and HindIII; then, the target fragment was recovered
and inserted into the pQE30 vector. The positive clone was sequenced by the
Shanghai Jingtai Biotechnology Company (Shanghai, China). The 63Histagged rGcIFN-a protein was expressed in the QIAexpress IV system and
purified as described in our previous study (60). The effects of rGcIFN-a on
the inhibition of SVCVand IHNV in different cell lines were measured by the
50% cytopathic effect inhibition (CPE50) assay (60). In brief, the cells were
seeded in a 96-well microplate at a density of 1 3 104 cells per well and
cultured for 24 h. Groups 1–8 were stimulated with 0.1 ml of one of a series
of 5-fold serial dilutions (51–58) of the purified rGcIFN-a preparations. Three
control groups (PBS, positive, and negative) were stimulated with PBS or not
(positive and negative) After 18 h of culture, the cells (except the negative
control group) were challenged with 100 50% tissue culture infective dose
(TCID50) per 0.1 ml of the virus per well. The results were expressed as the
reciprocals of the dilutions that resulted in 50% virus-induced cell lysis, determined 36–48 h after SVCV or IHNV infection. The experiments were repeated three times (n = 3), and the Student t test was used to evaluate the effects
of rGcIFN-a on these rhabdoviruses.
A total of nine healthy grass carp were divided randomly into three
groups: the rGcIFN-a, PBS, and blank groups. The rGcIFN-a and PBS
groups were injected i.p. with 700 ml rGcIFN-a (7.8 3 105 U) or 10 mM
PBS, respectively. The blank group did not receive any injection. Spleen
samples were collected after 24 h, and the total RNA was extracted and
reverse-transcribed to first-strand cDNA. The expression status of CtidUBA was detected by real-time PCR as described above. The DDCt value
was calculated by the formula: DDCt ¼ DCtorgan 2 DCtthe lowest organ . The
diagram of the log10(22DDCt) of the test samples was calculated as described above (p , 0.05).
7
8
MHC PRESENTATION AND REGULATION BY IFN IN BONY FISH
the S-box, X1 3 2, and EnhB (Y) sequences were found at positions
2203, 2150, and 2146 (Fig. 1C). These results indicate that a common promoter region exists in Ctid-UBA genes. The Ctid-UBA
*0101 and Ctid-UBA *0201 genes can be expressed and might be
upregulated by IFN.
High polymorphism and universal expression reveal that
Ctid-UBA is a core classical class I gene
Name
P1
P2
P3
P4
P5
P6
P7
Start Position
Sequencea
Refoldingb
74
57
111
119
208
189
257
QPNEAIRSL
APHANVKTI
VAPTADETI
APSKDIVEL
VATAATRAI
CPKTGLLLV
MAHFDCGQI
+
2
2
2
+
2
+
The source (GCHV outer capsid 7) is based on GCHV sequences (AF403396;
www.ncbi.nlm.nih.gov/nuccore/22128445).
a
Motifs: P2L9 and A2I9.
b
Refolding with Ctid-UBA *0102-Ctid-b2m and forms a trimolecular complex.
spleen, liver, gut, and brain. Expression of the Ctid-UBA gene
has been detected in the head kidney. However, as the lowest
value, the log10(22DDCt) value of head kidney is represented as
0. [The log10(22DDCt) value was used to show the expression
situation of the Ctid-UBA gene. The DDCt value of the two samples was calculated by the formula: DDCt(Ctid-UBA one organ) =
DCt (Ctid-UBA one organ) 2 DCt(Ctid-UBA the lowest value, i.e., head kidney).
Thus, DDCthead kidney value = DCt(Ctid-UBA head kidney value) 2
DCt(Ctid-UBA head kidney value) = 0. Therefore, the diagram shows
that log10(220) in the head kidney is 0, although the Ctid-UBA gene
was expressed in the head kidney. These results indicated that CtidUBA is a classical class I gene in grass carp.
Three class I loci revealed in the grass carp genome
To identify how many class I loci are present in grass carp, genomic
DNA was digested completely by EcoRI, HindIII, and BamHI. As
shown in Fig. 3B, three to four bands appeared in the digested
genomes in the Southern blot. Because the grass carp is diploid, at
least three class I loci have been confirmed to exist in grass carp.
Ctid-MHC class I-restricted binding of the nonapeptide of
GCHV
The complex of Ctid-UBA *0102, Ctid-b2m, and the nonapeptide
of GCHV was reconstituted by the diluted refolding method. As
shown in Table II, the Ctid-UBA *0102 H chain, P1/P5/P7, and
Ctid-b2m were reconstituted to form a trimolecular complex.
After the complex was passed through a Superdex 200 column,
peaks 1, 2, and 3 were collected (Fig. 4A). SDS-PAGE analysis
showed that peak 1 represented class I aggregates, peak 2 was the
complex, and peak 3 was Ctid-b2m only (Fig. 4B). Ctid-UBA
*0102 could bind the three nonapeptides among the seven peptides of GCHV. SDS-PAGE analysis showed that the refolding
efficiency of Ctid-UBA *0102 was ∼12%. The results obtained
for Resource Q anion-exchange chromatography showed that P1
possesses a higher strength for and binds specifically to Ctid-UBA
*0102. In addition, after being refolded, the Ctid-UBA *0102 H
chain and Ctid-b2m without peptide showed a smaller peak 2
(Fig. 4C). This indicates that part of Ctid-UBA *0102 and Ctidb2m could form a small dimer.
The 3D structure of the Ctid-UBA *0102 complex
FIGURE 3. Analysis of the expression of Ctid-UBA genes and a Southern blot hybridized with the UBA probe. A, Ctid-UBA genes are expressed
differentially in skin, gill, heart, kidney, spleen, liver, gut, brain, and head
kidney. Ctid-b-actin was used as the reference gene. The log10(22DDCt)
value of head kidney is represented as 0. B, Southern blot of genomic DNA
digested with EcoRI, HindIII, and BamHI and separated on a field inversion gel. The arrowheads indicate three to four visible bands in each lane.
The 3D structure of Ctid-UBA showed that the Ag-binding groove
was formed by the a1 and a2 domains, similar to chicken BF2
(Fig. 4D). The Ag-binding groove was composed of two a helices
and eight b sheets. The helices constructed the two sides of the
groove, and the eight b sheets formed the bottom. There were six
pockets (A–F) in the Ag-binding groove, and A and F pockets
were present at both ends of the groove (Supplemental Fig. 4). The
two pockets were rich in conserved amino acids and formed
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
To investigate the allelic polymorphism of Ctid-UBA genes, 12
grass carp were used to clone the allelic genes using allele-specific
primers. Approximately 5–10 positive clones were sequenced per
individual. Fig. 2 presents and aligns a total of 15 unique CtidUBA cDNA molecules (Ctid-UBA *0102–Ctid-UBA *0114)
cloned in this study and 10 Ctid-MHC I genes reported in our
previous study (47). The a1 and a2 domains (PBD) contained 85–
89 and 91–93 aa, respectively. The 8-aa motif YYRTKWYY (Y7,
Y59, R84, T142, K145, W146, Y159, and Y171) might be crucial
for peptide binding. The Ctid-MHC I genes all have two pairs of
cysteines, and a potential N-glycosylation site exists at positions
84–86 in the a1 domains. Partial conservation also is observed
between the PBD, CD8+ interaction sites, and b2m contacts.
Mutations and variations were found that led to differences in
the PBD size in the Ctid-UBA genes. The amino acid identities
of Ctid-UBA ranged from 65.0 to 100%. The phylogenetic tree of
Ctid-UBA and these class I genes reported in previous studies
suggested that the Ctid-UBA locus showed high polymorphism
(Supplemental Fig. 2).
A standard curve was constructed to detect the Ctid-UBA gene
by real-time PCR using grass carp b-actin as the reference gene
(Supplemental Fig. 3). The DCt values of the Ctid-UBA and Ctidb-actin genes were automatically determined by the software. The
log10(22DDCt) value was calculated and is shown in Fig. 3A. CtidUBA was differentially expressed in skin, gill, heart, kidney,
Table II. Refolding of Ctid-UBA *0102 and Ctid-b2m with seven
peptides from GCHV
The Journal of Immunology
9
hydrogen bonds with the terminal amino acids of a peptide to
strengthen binding with class I. The bottom of b2m consisted of
eight b sheets perpendicular to a helices. The bottom contains
some highly conserved amino acids in positions that are crucial to
binding Ag peptides (Supplemental Fig. 4).
Ctid-UBA-restricted CTL response
The biotinylated Ctid-UBA *0102 was refolded with Ctid-b2m and
P1 (Fig. 5A). The target complex was purified, and a 35-kDa peak
was collected using chromatography. SDS-PAGE showed that the
target peak 2 was a monomer of Ctid-UBA *0102-Ctid-b2-P1 (Fig.
5B). After binding with streptavidin, the tetramer was confirmed
to be .200 kDa by SDS-PAGE (Fig. 5C). Fig. 5D shows a spleencell of grass carp stained by the tetramer. The PE-positive cells
accounted for 0.12% of the total spleen cells in the blank group
and 0.34% in the adjuvant group on average (n = 3). In the group
immunized with attenuated GCHV and P1, the PE-positive cells
accounted for 1.94% of the total cells. The proportions of PEpositive cells were significantly different among the three groups
at p , 0.05. There were significantly more PE-positive cells in
attenuated GCHV- and P1-immunized fish than in the controls.
This result showed that a Ctid-UBA-restricted CTL response
emerged in grass carp.
GcIFN regulates Ctid-UBA expression
The rGcIFN-a gene (AB180663; www.ncbi.nlm.nih.gov/nuccore/
86211357) has been cloned, expressed, and purified (Fig. 6A). The
main band on the gel migrated at ∼20.2 kDa. The antiviral act-
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Refolding and analysis of Ctid-UBA *0102 and Ctid-b2m with P1 from GCHV. A, Chromatographic analysis of the refolding of Ctid-UBA
*0102 and Ctid-b2m with P1. B, SDS-PAGE analysis showed that peak 1 consisted of class I aggregates, peak 2 represented the complex (Ctid-UBA *0102Ctid-b2m-P1), and peak 3 was Ctid-b2m only. C, Chromatographic analysis of the refolding of Ctid-UBA *0102 and Ctid-b2m without any peptide. Peak 1
here represented class I aggregates, and peak 2 was the complex (Ctid-UBA *0102-Ctid-b2m). D, The 3D structure of the Ctid-UBA *0102 and Ctid-b2m
complex. The Ag-binding domain was composed of eight a helices and eight b sheets. The helices constructed the two sides of the groove, and the eight b
sheets formed the bottom of the PBD.
10
MHC PRESENTATION AND REGULATION BY IFN IN BONY FISH
ivities of three lots of rGcIFN-a were assessed by the CPE50
method. The results of an anti-rhabdovirus experiment are presented in Table III. The in vitro effects of rGcIFN-a against
SVCV or IHNV grown on the EPC and CO cell lines were
remarkable. The results indicate that treatment with a higher
concentration of rGcIFN-a could be .50% protective against the
viral CPE. The rGcIFN-a has anti-SVCVor IHNVactivity of .3 3
104 U/mg. In contrast, the PBS and positive control groups displayed extensive pathogenic changes.
To investigate its effect, a blank control group (without injection)
was set as the calibration sample, and two other groups were set as
the test samples: a PBS-injected group and an rGcIFN-a–injected
group. The grass carp injected with rGcIFN-a had a significantly
higher Ctid-UBA expression level than did the other control fish.
After 24 h, the expression of Ctid-UBA reached a peak in fish
injected with rGcIFN-a (Fig. 6B). The Ctid-UBA expression levels were significantly different between the rGcIFN-a–injected
group and the blank group (p , 0.05, n = 3). These results
showed that rGcIFN-a could upregulate the expression of CtidUBA genes.
Discussion
Bony fish formed a separate evolutionary branch ∼400 mya (2).
Because no evidence of the existence of the key molecules has
been demonstrated in invertebrates and jawless vertebrates (1, 5),
it is generally believed that the AIS first emerged in jawed vertebrate fish (2). The CTL response plays a critical role in the AIS
against viral infection and tumors (69, 70). Although some studies
have referred to the cloning of CTL response genes, such as class
I, TAP, and TCR, and have extended the research on cell-mediated
cytotoxicity in bony fish (4, 56, 71), class I-restricted Ag presentation has not been studied until now. In this study, two Ctid-UBA
DNA fosmid clones were sequenced. On the basis of its specific
allele sequences, polymorphism, universal expression, and 3D
structure analysis, the Ctid-UBA gene was proven as the classical
core class I gene. Furthermore, refolding and tetramer techniques
were used to determine the core class I-restricted viral Ag controls
and CTL response. Finally, the IFN system was identified as acting on the expression of class I genes.
Similar to chickens, ducks, and mammals, the class I regions in
most bony fish are composed of seven exons and six introns (40).
Rainbow trout and Atlantic salmon genomes encode only one
classical MHC class I locus designated UBA (72, 73), although
the species have multiple U-lineage genes, such as the class I-like
lineages of ZE and L (74–76). In rainbow trout, the a2 domain
amino acid sequence of Onmy-UA-C32 is more closely related to
that of zebrafish and carp than to that of other salmonid species
(77). This finding suggests that the “chimerism” in bony fish MHC
class I exons predated the divergence of salmonids and cyprinids.
Our earlier reports indicated that the classical MHC class I is
composed of highly divergent sequence lineages that share a single
locus (UBA) in rainbow trout and that eight a1 domain (I–VIII),
three a2 domain (I–III), and three a3 domain (I–III) lineages exist
in salmonids (47, 78). In this study, the classical class I gene was
termed Ctid-UBA, and a hallmark of Ctid-UBA is that it flanks
TAP-associated glycoprotein (TAPBP). The organization here is
similar to that of MHC I-UDA in zebrafish (42, 48), Orla-UBA in
medaka (16, 50), and Sasa-UCA in Atlantic salmon (73). Because
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 5. Tetramer staining of CTL cells in grass
carp. A, Chromatographic analysis of the refolding
product of a monomer for Ctid-UBA *0102-BSPCtid-b2m-P1. B, SDS-PAGE analysis indicated that
peak 1 was class I aggregates and peak 2 was the
monomer. C, SDS-PAGE analysis of Ctid-UBA
*0102 tetramer. Lane 1, After binding with streptavidin, the generation of a tetramer .200 kDa was
confirmed by SDS-PAGE. Lane 2, The PE-labeled
streptavidin. D, Tetramer staining of CTL cells. a,
The blank group. b, The adjuvant group. c, The group
immunized with attenuated GCHVand P1. The staining was significantly different among the three groups
at p , 0.05 (n = 3).
The Journal of Immunology
11
Table III. Biological activities of rGcIFN-a
Rhabdovirus
SVCV
IHNV
Experimenta
1
2
3
1
2
3
EPC Cell Line
(U/mg)b
7.8
1.5
1.5
3.9
7.8
1.5
3
3
3
3
3
3
105
105
105
107
105
105
CO Cell Line
(U/mg)b
1.5
1.5
3
1.5
3
3
3
3
3
3
3
3
105
105
104
105
104
104
The antiviral activity of rGcIFN-a was tested by for CPE50 in CO-SVC/IHNV and
EPC-SVC/IHNV systems using our previous methodology (60). The concentration of
SVCV was 103.6 TCID50 in EPC and 105.0 TCID50 in CO; the concentration of IHNV
was 104.5 TCID50 in EPC and 103.8 TCID50 in CO.
a
The experiments were repeated three times (n = 3), and the Student t test was
used to evaluate the effects of rGcIFNs on these rhabdoviruses.
b
The rGcIFNs have an anti-SVCV or IHNV activity of .3 3 104 U/mg. In
contrast, the PBS and positive control groups displayed extensive pathogenic
changes.
TAPBP is a key member of class I Ag-loading complexes (9, 15),
it was first considered that the TAPBP had an opportunity to coevolve to function in coordination with MHC class I in bony fish.
A GenBank homology BLAST was performed independently with
each a domain, and Ctid-MHC I a1, a2, and a3 were categorized
into two (V and IX), five (II, IV–VII), and four (IV–VII) domain
lineages, respectively. One a1 and four a2 domain lineages were
observed specifically in grass carp (47). Here, the novel a1 domain was more closely related to that of salmonid species than to
that of zebrafish and carp. Therefore, the a1 domain also showed
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 6. Type I rGcIFN regulates Ctid-UBA expression. A, Expression and purification of the rGcIFN-a protein. A prokaryotic expression plasmid (pQE30/GcIFN-a) was constructed, and SDS-PAGE
revealed that the peak was rGcIFN-a. B, rGcIFN-a regulates Ctid-UBA
expression. The Ctid-UBA expression ratio (22DDCt) is shown as a diagram
of log10(22DDCt). The DCt value of the two samples was calculated by the
formula: DCt ¼ CtTarget 2 CtActin . The DDCt value of the samples was
calculated by the formula: DDCt ¼ DCtTarget 2 DCtControl . The Ctid-UBA
gene expression ratios (22DDCt) and the diagram of log10(22DDCt) of the
test samples were calculated as described previously by Yuan et al. (65).
The log10 (22DDCt) value of the blank group has been normalized to 0. The
rGcIFN-a–injected group and blank group were significantly different at
p , 0.05 (n = 3).
“chimerism” in bony fish. The increased variability of the CtidUBA might be produced by shuffling exon 1 onto exon 3 and
downstream regions through recombination events in introns 1
and 2. In addition, alignment of the sequences of the a1 and a2
domains showed that the Ctid-UBA genes matched ∼99%. These
results indicate that locus-specific features did not emerge in grass
carp.
The SXY is generally believed to be the shared promoter for
MHC class I, MHC class II, and b2m (64, 79). Analysis of the
promoter region of Ctid-UBA showed that the promoter had this
original feature in bony fish and then evolved in ducks, mammals,
and humans. The transcriptional regulatory regions were composed
of five conserved domains: S-box, X1 3 2, EnhB (Y), GAAA, and
ISRE motifs (Fig. 1C). This finding implies that IFN might regulate
Ctid-UBA gene expression. Therefore, rGcIFN-a was expressed
and used to confirm the interaction. After stimulation with rGcIFNa in the spleen, the expression of Ctid-UBA was increased and
reached a peak at 24 h. This result was similar to reports on human
IFNs, which can induce classical HLA gene expression (80). This is
the first study showing that the type I IFN system could act on class
I in fish species, although Zou et al. (81) reported that rIFN-g could
enhance the expression of MHC class II genes in rainbow trout.
These results also suggested that the biochemical pathway between
IFN and MHC class I already existed in an evolutionary ancestor as
old as the bony fish.
An optimal CTL response requires multiple antigenic epitopes to
control viral infection, which are well established in humans and
mice (69). A novel approach was used to screen the potential CTL
epitopes [i.e., starting from a computer motif prediction followed
by in vitro complex refolding and then returning to the standard
T2 assay (68, 69)]. The peptide-specific CTL then was detected by
stimulated ELISPOT and tetramer staining. More recently, a series
of HLA-A-restricted CD8+ T cell epitopes specific for HIV, severe
acute respiratory syndrome coronavirus, and avian influenza virus
were identified. However, it is important to define whether the
class I-restricted response evolved in bony fish. Obviously, specific
tools are needed for bony fish, such as mAbs against CD8, CD3,
CD4, and IFN. We conditionally designed two steps to investigate
the class I-restricted response in grass carp. The binding strength of
Ctid-UBA *0102, Ctid-b2m, and P1 is higher than that of P5 and
P7, which is similar to the peptide binding MHC complex in
humans, mice, monkeys, and chickens in our other experiments
(25, 68). Additionally, because the immunization group was first
injected with an attenuated GCHV vaccine, we believe that the
mechanism of CTL response may not be different from the
natural mechanism. However, SDS-PAGE showed that only Ctid-
12
MHC PRESENTATION AND REGULATION BY IFN IN BONY FISH
Acknowledgments
This work was completed partially in Prof. George F. Gao’s laboratory (Key
Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences).
Disclosures
The authors have no financial conflicts of interest.
References
1. Cooper, M. D., and M. N. Alder. 2006. The evolution of adaptive immune
systems. Cell 124: 815–822.
2. Flajnik, M. F., and M. Kasahara. 2001. Comparative genomics of the MHC:
glimpses into the evolution of the adaptive immune system. Immunity 15: 351–
362.
3. Hernández Prada, J. A., R. N. Haire, M. Allaire, J. Jakoncic, V. Stojanoff,
J. P. Cannon, G. W. Litman, and D. A. Ostrov. 2006. Ancient evolutionary origin
of diversified variable regions demonstrated by crystal structures of an immunetype receptor in amphioxus. Nat. Immunol. 7: 875–882.
4. Yu, C., M. Dong, X. Wu, S. Li, S. Huang, J. Su, J. Wei, Y. Shen, C. Mou, X. Xie,
et al. 2005. Genes “waiting” for recruitment by the adaptive immune system: the
insights from amphioxus. J. Immunol. 174: 3493–3500.
5. Pancer, Z., W. E. Mayer, J. Klein, and M. D. Cooper. 2004. Prototypic T cell
receptor and CD4-like coreceptor are expressed by lymphocytes in the agnathan
sea lamprey. Proc. Natl. Acad. Sci. USA 101: 13273–13278.
6. Zhou, T., L. Xu, B. Dey, A. J. Hessell, D. Van Ryk, S. H. Xiang, X. Yang,
M. Y. Zhang, M. B. Zwick, J. Arthos, et al. 2007. Structural definition of
a conserved neutralization epitope on HIV-1 gp120. Nature 445: 732–737.
7. Garboczi, D. N., P. Ghosh, U. Utz, Q. R. Fan, W. E. Biddison, and D. C. Wiley.
1996. Structure of the complex between human T-cell receptor, viral peptide and
HLA-A2. Nature 384: 134–141.
8. Wearsch, P. A., and P. Cresswell. 2007. Selective loading of high-affinity peptides onto major histocompatibility complex class I molecules by the tapasinERp57 heterodimer. Nat. Immunol. 8: 873–881.
9. Purcell, A. W., and T. Elliott. 2008. Molecular machinations of the MHC-I
peptide loading complex. Curr. Opin. Immunol. 20: 75–81.
10. Wallny, H. J., D. Avila, L. G. Hunt, T. J. Powell, P. Riegert, J. Salomonsen,
K. Skjødt, O. Vainio, F. Vilbois, M. V. Wiles, and J. Kaufman. 2006. Peptide
motifs of the single dominantly expressed class I molecule explain the striking
MHC-determined response to Rous sarcoma virus in chickens. Proc. Natl. Acad.
Sci. USA 103: 1434–1439.
11. Maldonado, R. A., D. J. Irvine, R. Schreiber, and L. H. Glimcher. 2004. A role
for the immunological synapse in lineage commitment of CD4 lymphocytes.
Nature 431: 527–532.
12. Lee, K. H., A. D. Holdorf, M. L. Dustin, A. C. Chan, P. M. Allen, and
A. S. Shaw. 2002. T cell receptor signaling precedes immunological synapse
formation. Science 295: 1539–1542.
13. Grakoui, A., S. K. Bromley, C. Sumen, M. M. Davis, A. S. Shaw, P. M. Allen,
and M. L. Dustin. 1999. The immunological synapse: a molecular machine
controlling T cell activation. Science 285: 221–227.
14. Gao, G. F., J. Tormo, U. C. Gerth, J. R. Wyer, A. J. McMichael, D. I. Stuart,
J. I. Bell, E. Y. Jones, and B. K. Jakobsen. 1997. Crystal structure of the complex
between human CD8alpha(alpha) and HLA-A2. Nature 387: 630–634.
15. Elliott, T., and J. Neefjes. 2006. The complex route to MHC class I-peptide
complexes. Cell 127: 249–251.
16. Matsuo, M. Y., S. Asakawa, N. Shimizu, H. Kimura, and M. Nonaka. 2002.
Nucleotide sequence of the MHC class I genomic region of a teleost, the medaka
(Oryzias latipes). Immunogenetics 53: 930–940.
17. Shiina, T., G. Tamiya, A. Oka, N. Takishima, and H. Inoko. 1999. Genome
sequencing analysis of the 1.8 Mb entire human MHC class I region. Immunol.
Rev. 167: 193–199.
18. Kulski, J. K., T. Shiina, T. Anzai, S. Kohara, and H. Inoko. 2002. Comparative
genomic analysis of the MHC: the evolution of class I duplication blocks, diversity and complexity from shark to man. Immunol. Rev. 190: 95–122.
19. Kelley, J., L. Walter, and J. Trowsdale. 2005. Comparative genomics of major
histocompatibility complexes. Immunogenetics 56: 683–695.
20. The MHC Sequencing Consortium. 1999. Complete sequence and gene map of
a human major histocompatibility complex. Nature 401: 921–923.
21. Fremont, D. H., M. Matsumura, E. A. Stura, P. A. Peterson, and I. A. Wilson.
1992. Crystal structures of two viral peptides in complex with murine MHC class
I H-2Kb. Science 257: 919–927.
22. Madden, D. R., J. C. Gorga, J. L. Strominger, and D. C. Wiley. 1992. The threedimensional structure of HLA-B27 at 2.1 A resolution suggests a general mechanism for tight peptide binding to MHC. Cell 70: 1035–1048.
23. Madden, D. R. 1995. The three-dimensional structure of peptide-MHC complexes. Annu. Rev. Immunol. 13: 587–622.
24. Fremont, D. H., E. A. Stura, M. Matsumura, P. A. Peterson, and I. A. Wilson.
1995. Crystal structure of an H-2Kb-ovalbumin peptide complex reveals the
interplay of primary and secondary anchor positions in the major histocompatibility complex binding groove. Proc. Natl. Acad. Sci. USA 92: 2479–2483.
25. Chu, F., Z. Lou, Y. W. Chen, Y. Liu, B. Gao, L. Zong, A. H. Khan, J. I. Bell,
Z. Rao, and G. F. Gao. 2007. First glimpse of the peptide presentation by rhesus
macaque MHC class I: crystal structures of Mamu-A*01 complexed with two
immunogenic SIV epitopes and insights into CTL escape. J. Immunol. 178: 944–
952.
26. Koch, M., S. Camp, T. Collen, D. Avila, J. Salomonsen, H. J. Wallny, A. van
Hateren, L. Hunt, J. P. Jacob, F. Johnston, et al. 2007. Structures of an MHC class
I molecule from B21 chickens illustrate promiscuous peptide binding. Immunity
27: 885–899.
27. Madden, D. R., D. N. Garboczi, and D. C. Wiley. 1993. The antigenic identity of
peptide-MHC complexes: a comparison of the conformations of five viral peptides presented by HLA-A2. Cell 75: 693–708.
28. Kaufman, J., S. Milne, T. W. Göbel, B. A. Walker, J. P. Jacob, C. Auffray,
R. Zoorob, and S. Beck. 1999. The chicken B locus is a minimal essential major
histocompatibility complex. Nature 401: 923–925.
29. Kaufman, J., J. Jacob, I. Shaw, B. Walker, S. Milne, S. Beck, and J. Salomonsen.
1999. Gene organisation determines evolution of function in the chicken MHC.
Immunol. Rev. 167: 101–117.
30. Yoder, J. A., M. G. Mueller, S. Wei, B. C. Corliss, D. M. Prather, T. Willis,
R. T. Litman, J. Y. Djeu, and G. W. Litman. 2001. Immune-type receptor genes
in zebrafish share genetic and functional properties with genes encoded by the
mammalian leukocyte receptor cluster. Proc. Natl. Acad. Sci. USA 98: 6771–
6776.
31. Hansen, J. D., E. D. Landis, and R. B. Phillips. 2005. Discovery of a unique Ig
heavy-chain isotype (IgT) in rainbow trout: implications for a distinctive B cell
developmental pathway in teleost fish. Proc. Natl. Acad. Sci. USA 102: 6919–
6924.
32. Alder, M. N., I. B. Rogozin, L. M. Iyer, G. V. Glazko, M. D. Cooper, and
Z. Pancer. 2005. Diversity and function of adaptive immune receptors in a jawless vertebrate. Science 310: 1970–1973.
33. Li, J., D. R. Barreda, Y. A. Zhang, H. Boshra, A. E. Gelman, S. Lapatra, L. Tort,
and J. O. Sunyer. 2006. B lymphocytes from early vertebrates have potent
phagocytic and microbicidal abilities. Nat. Immunol. 7: 1116–1124.
34. Laing, K. J., J. J. Zou, M. K. Purcell, R. Phillips, C. J. Secombes, and
J. D. Hansen. 2006. Evolution of the CD4 family: teleost fish possess two divergent forms of CD4 in addition to lymphocyte activation gene-3. J. Immunol.
177: 3939–3951.
35. Magor, K. E., B. P. Shum, and P. Parham. 2004. The beta 2-microglobulin locus
of rainbow trout (Oncorhynchus mykiss) contains three polymorphic genes. J.
Immunol. 172: 3635–3643.
36. Oshiumi, H., T. Tsujita, K. Shida, M. Matsumoto, K. Ikeo, and T. Seya. 2003.
Prediction of the prototype of the human Toll-like receptor gene family from the
pufferfish, Fugu rubripes, genome. Immunogenetics 54: 791–800.
37. Sepulcre, M. P., F. Alcaraz-Pérez, A. López-Muñoz, F. J. Roca, J. Meseguer,
M. L. Cayuela, and V. Mulero. 2009. Evolution of lipopolysaccharide (LPS)
recognition and signaling: fish TLR4 does not recognize LPS and negatively
regulates NF-kappaB activation. J. Immunol. 182: 1836–1845.
38. Hashimoto, K., T. Nakanishi, and Y. Kurosawa. 1990. Isolation of carp genes
encoding major histocompatibility complex antigens. Proc. Natl. Acad. Sci. USA
87: 6863–6867.
39. Ohta, Y., K. Okamura, E. C. McKinney, S. Bartl, K. Hashimoto, and M. F. Flajnik.
2000. Primitive synteny of vertebrate major histocompatibility complex class I and
class II genes. Proc. Natl. Acad. Sci. USA 97: 4712–4717.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
UBA *0102 and Ctid-b2m were able to form a dimer, and this
interaction was weak (Fig. 4C). This result indicates that the
empty complex on the cell surface might directly bind a peptide
and might be capable of triggering the CTL response. On the basis
of this discovery, we hypothesize that there was an intermediate
animal between jawless and jawed vertebrates that used the incomplete adaptive and innate immune systems for defense against viral
infection.
The 3D structure of Ctid-UBA-P1-b2m indicated that the C
terminal residue of peptide position was the main anchor residue
and that the CTL epitope binds in the F pocket, which is similar to
the amino acids in chicken (26). These results confirmed that
classical class I molecules in bony fish can selectively bind
a peptide in Ag presentation. Although PE-labeled tetramers are
used currently to stain Ag-specific CD42CD8+ CTL cells, the tetramer was first used to detect the CTL response in bony fish. Meanwhile, streptavidin-coated magnetic beads were used to identify the
biotinylation of Ctid-UBA-BSP-P1-b2m. The group immunized
with attenuated GCHV and P1 peptide was assessed by genotyping Ctid-UBA. Comparing PBD at the amino acid level, the
homology of Ctid-UBA genes in the experimental groups was
∼99%. Our results suggest that once the classical class I evolved
in bony fish Ag presentation and regulation by IFN rapidly appeared
in its AIS.
The Journal of Immunology
62. Liu, W., Z. Liu, X. Hu, Y. Zhang, J. Yuan, R. Zhao, Z. Li, W. Xu, Y. Gao,
X. Deng, and N. Li. 2003. Construction and characterization of a novel 13.34fold chicken bacterial artificial chromosome library. Anim. Biotechnol. 14: 145–
153.
63. Taghian, D. G., and J. A. Nickoloff. 1996. Subcloning strategies and protocols.
Methods Mol. Biol. 58: 221–235.
64. Moon, D. A., S. M. Veniamin, J. A. Parks-Dely, and K. E. Magor. 2005. The
MHC of the duck (Anas platyrhynchos) contains five differentially expressed
class I genes. J. Immunol. 175: 6702–6712.
65. Yuan, J. S., A. Reed, F. Chen, and C. N. Stewart, Jr. 2006. Statistical analysis of
real-time PCR data. BMC Bioinformatics 7: 85.
66. Zhou, M., Y. Xu, Z. Lou, D. K. Cole, X. Li, Y. Liu, P. Tien, Z. Rao, and
G. F. Gao. 2004. Complex assembly, crystallization and preliminary X-ray crystallographic studies of MHC H-2Kd complexed with an HBV-core nonapeptide.
Acta Crystallogr. D Biol. Crystallogr. 60: 1473–1475.
67. Yan, R. Q., Z. M. Wu, Q. M. Fang, Z. L. Zhang, J. Zhang, X. S. Li, H. F. Hao,
and C. Xia. 2008. Reconstruction of a chicken BF2 protein complex and identification of binding nonamer peptides derived from avian influenza virus
hemagglutinin. Vet. Immunol. Immunopathol. 126: 91–101.
68. Zhou, M., D. Xu, X. Li, H. Li, M. Shan, J. Tang, M. Wang, F. S. Wang, X. Zhu,
H. Tao, et al. 2006. Screening and identification of severe acute respiratory
syndrome-associated coronavirus-specific CTL epitopes. J. Immunol. 177: 2138–
2145.
69. Altman, J. D., P. A. Moss, P. J. Goulder, D. H. Barouch, M. G. McHeyzerWilliams, J. I. Bell, A. J. McMichael, and M. M. Davis. 1996. Phenotypic
analysis of antigen-specific T lymphocytes. Science 274: 94–96.
70. Zhou, H., T. B. Stuge, N. W. Miller, E. Bengten, J. P. Naftel, J. M. Bernanke,
V. G. Chinchar, L. W. Clem, and M. Wilson. 2001. Heterogeneity of channel
catfish CTL with respect to target recognition and cytotoxic mechanisms
employed. J. Immunol. 167: 1325–1332.
71. Somamoto, T., N. Okamoto, T. Nakanishi, M. Ototake, and M. Nakao. 2009.
In vitro generation of viral-antigen dependent cytotoxic T-cells from ginbuna
crucian carp, Carassius auratus langsdorfii. Virology 389: 26–33.
72. Aoyagi, K., J. M. Dijkstra, C. Xia, I. Denda, M. Ototake, K. Hashimoto, and
T. Nakanishi. 2002. Classical MHC class I genes composed of highly divergent
sequence lineages share a single locus in rainbow trout (Oncorhynchus mykiss).
J. Immunol. 168: 260–273.
73. Lukacs, M. F., H. Harstad, U. Grimholt, M. Beetz-Sargent, G. A. Cooper, L. Reid,
H. G. Bakke, R. B. Phillips, K. M. Miller, W. S. Davidson, and B. F. Koop. 2007.
Genomic organization of duplicated major histocompatibility complex class I
regions in Atlantic salmon (Salmo salar). BMC Genomics 8: 251.
74. Miller, K. M., S. Li, T. J. Ming, K. H. Kaukinen, and A. D. Schulze. 2006. The
salmonid MHC class I: more ancient loci uncovered. Immunogenetics 58: 571–
589.
75. Shiina, T., J. M. Dijkstra, S. Shimizu, A. Watanabe, K. Yanagiya, I. Kiryu, A. Fujiwara,
C. Nishida-Umehara, Y. Kaba, I. Hirono, et al. 2005. Interchromosomal duplication of
major histocompatibility complex class I regions in rainbow trout (Oncorhynchus
mykiss), a species with a presumably recent tetraploid ancestry. Immunogenetics 56:
878–893.
76. Dijkstra, J. M., T. Katagiri, K. Hosomichi, K. Yanagiya, H. Inoko, M. Ototake,
T. Aoki, K. Hashimoto, and T. Shiina. 2007. A third broad lineage of major
histocompatibility complex (MHC) class I in teleost fish; MHC class II linkage
and processed genes. Immunogenetics 59: 305–321.
77. Hansen, J. D., P. Strassburger, and L. Du Pasquier. 1996. Conservation of an
alpha 2 domain within the teleostean world, MHC class I from the rainbow trout
Oncorhynchus mykiss. Dev. Comp. Immunol. 20: 417–425.
78. Xia, C., I. Kiryu, J. M. Dijkstra, T. Azuma, T. Nakanishi, and M. Ototake. 2002.
Differences in MHC class I genes between strains of rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 12: 287–301.
79. Gobin, S. J., A. Peijnenburg, M. van Eggermond, M. van Zutphen, R. van den
Berg, and P. J. van den Elsen. 1998. The RFX complex is crucial for the constitutive and CIITA-mediated transactivation of MHC class I and beta2microglobulin genes. Immunity 9: 531–541.
80. de Veer, M. J., M. Holko, M. Frevel, E. Walker, S. Der, J. M. Paranjape,
R. H. Silverman, and B. R. Williams. 2001. Functional classification of
interferon-stimulated genes identified using microarrays. J. Leukoc. Biol. 69:
912–920.
81. Zou, J., A. Carrington, B. Collet, J. M. Dijkstra, Y. Yoshiura, N. Bols, and
C. Secombes. 2005. Identification and bioactivities of IFN-gamma in rainbow
trout Oncorhynchus mykiss: the first Th1-type cytokine characterized functionally in fish. J. Immunol. 175: 2484–2494.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
40. Hansen, J. D., P. Strassburger, G. H. Thorgaard, W. P. Young, and L. Du Pasquier. 1999. Expression, linkage, and polymorphism of MHC-related genes in
rainbow trout, Oncorhynchus mykiss. J. Immunol. 163: 774–786.
41. Grimholt, U., I. Hordvik, V. M. Fosse, I. Olsaker, C. Endresen, and O. Lie. 1993.
Molecular cloning of major histocompatibility complex class I cDNAs from
Atlantic salmon (Salmo salar). Immunogenetics 37: 469–473.
42. Michalová, V., B. W. Murray, H. Sültmann, and J. Klein. 2000. A contig map of
the Mhc class I genomic region in the zebrafish reveals ancient synteny. J.
Immunol. 164: 5296–5305.
43. Timón, M., G. Elgar, S. Habu, K. Okumura, and P. C. Beverley. 1998. Molecular
cloning of major histocompatibility complex class I cDNAs from the pufferfish
Fugu rubripes. Immunogenetics 47: 170–173.
44. Antao, A. B., V. G. Chinchar, T. J. McConnell, N. W. Miller, L. W. Clem, and
M. R. Wilson. 1999. MHC class I genes of the channel catfish: sequence analysis
and expression. Immunogenetics 49: 303–311.
45. Persson, A. C., R. J. Stet, and L. Pilström. 1999. Characterization of MHC class I
and beta(2)-microglobulin sequences in Atlantic cod reveals an unusually high
number of expressed class I genes. Immunogenetics 50: 49–59.
46. Kruiswijk, C. P., T. T. Hermsen, A. H. Westphal, H. F. Savelkoul, and R. J. Stet.
2002. A novel functional class I lineage in zebrafish (Danio rerio), carp (Cyprinus carpio), and large barbus (Barbus intermedius) showing an unusual conservation of the peptide binding domains. J. Immunol. 169: 1936–1947.
47. Yang, T. Y., H. F. Hao, Z. H. Jia, W. H. Chen, and C. Xia. 2006. Characterisation
of grass carp (Ctenopharyngodon idellus) MHC class I domain lineages. Fish
Shellfish Immunol. 21: 583–591.
48. Sambrook, J. G., F. Figueroa, and S. Beck. 2005. A genome-wide survey of
Major Histocompatibility Complex (MHC) genes and their paralogues in zebrafish. BMC Genomics 6: 152.
49. Clark, M. S., L. Shaw, A. Kelly, P. Snell, and G. Elgar. 2001. Characterization of
the MHC class I region of the Japanese pufferfish (Fugu rubripes). Immunogenetics 52: 174–185.
50. Tsukamoto, K., S. Hayashi, M. Y. Matsuo, M. I. Nonaka, M. Kondo, A. Shima,
S. Asakawa, N. Shimizu, and M. Nonaka. 2005. Unprecedented intraspecific
diversity of the MHC class I region of a teleost medaka, Oryzias latipes. Immunogenetics 57: 420–431.
51. Shum, B. P., P. M. Mason, K. E. Magor, L. R. Flodin, R. J. Stet, and P. Parham.
2002. Structures of two major histocompatibility complex class I genes of the
rainbow trout (Oncorhynchus mykiss). Immunogenetics 54: 193–199.
52. Grimholt, U., F. Drabløs, S. M. Jørgensen, B. Høyheim, and R. J. Stet. 2002. The
major histocompatibility class I locus in Atlantic salmon (Salmo salar L.):
polymorphism, linkage analysis and protein modelling. Immunogenetics 54:
570–581.
53. Stet, R. J., C. P. Kruiswijk, J. P. Saeij, and G. F. Wiegertjes. 1998. Major histocompatibility genes in cyprinid fishes: theory and practice. Immunol. Rev. 166:
301–316.
54. Flajnik, M. F., Y. Ohta, C. Namikawa-Yamada, and M. Nonaka. 1999. Insight
into the primordial MHC from studies in ectothermic vertebrates. Immunol. Rev.
167: 59–67.
55. Nakanishi, T., U. Fischer, J. M. Dijkstra, S. Hasegawa, T. Somamoto, N. Okamoto,
and M. Ototake. 2002. Cytotoxic T cell function in fish. Dev. Comp. Immunol. 26:
131–139.
56. Utke, K., H. Kock, H. Schuetze, S. M. Bergmann, N. Lorenzen, K. Einer-Jensen,
B. Köllner, R. A. Dalmo, T. Vesely, M. Ototake, and U. Fischer. 2008. Cellmediated immune responses in rainbow trout after DNA immunization against
the viral hemorrhagic septicemia virus. Dev. Comp. Immunol. 32: 239–252.
57. Dijkstra, J. M., U. Fischer, Y. Sawamoto, M. Ototake, and T. Nakanishi. 2001.
Exogenous antigens and the stimulation of MHC class I restricted cell-mediated
cytotoxicity: possible strategies for fish vaccines. Fish Shellfish Immunol. 11:
437–458.
58. Mohd Jaafar, F., A. E. Goodwin, M. Belhouchet, G. Merry, Q. Fang,
J. F. Cantaloube, P. Biagini, P. de Micco, P. P. Mertens, and H. Attoui. 2008.
Complete characterisation of the American grass carp reovirus genome (genus
Aquareovirus: family Reoviridae) reveals an evolutionary link between aquareoviruses and coltiviruses. Virology 373: 310–321.
59. Zhang, N. Z., L. F. Zhang, Y. N. Jiang, T. Zhang, and C. Xia. 2009. Molecular
analysis of spring viraemia of carp virus in China: a fatal aquatic viral disease
that might spread in East Asian. PLoS One 4: e6337.
60. Wang, L., L. Wang, H.-X. Zhang, J.-H. Zhang, W.-H. Chen, X.-F. Ruan, and
C. Xia. 2006. In vitro effects of recombinant zebrafish IFN on spring viremia of
carp virus and infectious hematopoietic necrosis virus. J. Interferon Cytokine
Res. 26: 256–259.
61. Xia, C., C. Y. Lin, G. X. Xu, T. J. Hu, and T. Y. Yang. 2004. cDNA cloning and
genomic structure of the duck (Anas platyrhynchos) MHC class I gene. Immunogenetics 56: 304–309.
13