From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
RAPID COMMUNICATION
Identification of Yeast Artificial Chromosomes Containing the Inversion
16 p-arm Breakpoint Associated With Acute Myelomonocytic Leukemia
By Pu Liu, David F. Claxton, Paula Marlton, Amitav Hajra, Jeanette Siciliano, Matthew Freedman,
Settara C. Chandrasekharappa, Kohsuke Yanagisawa, Raymond L. Stallings, Francis S . Collins, and Michael J. Siciliano
We report the cloning of the chromosome 1 6 p-arm breakpoint involved in inversion 16(pl3;q22) associated with
subtype of acute myelomonocytic leukemia (AMML)
M4Eo. Inter-Alu polymerase chain reaction (PCR) products
from a series of interspecificsomatic cell hybrids that contain only small portions of the human chromosome 1 6 parm were generated for use as fluorescent in-situ hybridization (FISH) probes. When applied to patient cells, rapid and
unambiguous identificationof the inversion resulted. Using
FISH analysis, cosmid clones associated with the hybrids
were identified that bracketed the p-arm breakpoint.
A repeat-free fragment of one of these cosmids
(3581 1) when used as probe on Southern blots from
pulsed-field gels identified rearranged macrorestriction
fragments in patient DNA. Yeast artificial chromosomes
(YACs) were isolated using sequences derived from cosmids flanking 3 5 B l l in a cosmid contig. Of 4 YACs so
identified, 3 were shown by FISH to cross the inversion-16
p-arm breakpoint. Therefore, the breakpoint has been molecularly cloned, and identified as being within these 3
YACs. These clones will facilitate the unravelingof the genetic events associated with inversion-l 6 and are available tools with immediate clinical application.
0 1993 by The American Society of Hematology.
N
the molecular level. Genetic events associated with this chromosomal aberration and their relationship to leukemogenesis thus remain unidentified. Therefore, sensitive molecular
analyses are not yet available for diagnosis and monitoring
of patients with inv- 16 leukemia. Identification of the inversion by standard cytogenetics of dividing BM cells remains
the only practical genetic means of identifying the abnormal
cells associated with this disorder.
Some progress in identifying the molecular events associated with inv- I6 has been made. The long arm breakpoint
of inv-16 has been mapped between two anonymous DNA
sequence markers found to be within 450 kb from each
other.’ By fluorescence in situ hybridization (FISH), the parm breakpoint was mapped between anonymous cosmids
located in band 16~13.13separated by an unknown distance,” and it was suggested that the breakpoint is within a
chromosome 16-specific repeat sequence that may play a
role in the origin of chromosome 16 rearrangements in the
leukemia.
We have recently mapped the human DNA repair gene,
Excision Repair Cross Complementing 4 (ERCC4), to
16~13.3-p13.2by complementation analysis of a series of
interspecific somatic cell hybrids made between normal human cells and the DNA repair deficient Chinese hamster
ovary cell (CHO) mutant UV41 . I 3 This region overlaps with
the position ofthe p a r m breakpoint of inv- 16. Here, several
UV4 1-complementing hybrids containing only small portions of 16 p-arm and little else of the human genome were
used as starting material for making FISH probes for rapid
and unambiguous diagnosis of the inversion. Subsequently,
the same hybrids were used to isolate and identify cosmid
clones sufficiently close to the inversion breakpoint to identify macrorestriction fragments altered by the event. One
such cosmid was identified and used for the isolation of
three yeast artificial chromosomes (YACs) containing the
inv- 16 p-arm breakpoint.
ONRANDOM chromosomal abnormalities have
been identified in many hematologic malignancies.
Cloning of the breakpoints involved has led to the identification of the affected genes and the molecular genetic consequences of the rearrangements. Known proto-oncogenes
have been found to be deregulated by translocations and
new biomedically important genes have been identified at
the breakpoints with resultant insights into the mechanisms
of normal hematopoiesis as well as 1eukemogenesis.l4
Inversion (inv)( 16)(p13;q22), and the related t( 16;
16)(p13;q22), were originally seen in leukemic cells from
acute myelomonocytic leukemia (AMML) patients with abnormal bone marrow (BM) eosinophilia (M4Eo) after the
report of del( 16)(q22) in similar patient^.^-^ In several studies, treated patients had the inversion chromosome disappear on
Therefore, a cytogenetic-clinicopathologic association appears to exist between a subset of
AMML cases and these chromosomal abnormalities. The
associated breakpoints have yet to be cloned and studied at
From the Departments of Hematology and Molecular Genetics,
The University of Texas M.D. Anderson Cancer Center, Houston,
TX; the Howard Hughes Medical Institute, Departments of Internal
Medicine and Human Genetics, and Michigan Human Genome
Center, University of Michigan Medical Center, Ann Arbor, MI;
The First Department of Internal Medicine, School of Medicine,
Ehime University, Shigenobu, Ehime, Japan; and the Department
of Human Genetics, Graduate School of Public Health, University
of Pittsburgh, PA.
Submitted April 26, 1993; accepted May 1, 1993.
Supported in part by National Institutes of Health Grant No.
CA65164toD.F.C. andM.J.S. P.L. isanAssociateandF.S.C. isan
Investigator of the Howard Hughes Medical Institute.
Address reprint requests to Michael J. Siciliano. PhD, Department of Molecular Genetics, The University of Texas M.D. Anderson Cancer Center, 1514 Holcombe, Houston, TX 77030.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1993 by The American Society ofHematology.
0006-4971/93/8203-0l13$3.00/0
716
‘3’’
MATERIALS AND METHODS
Cell lines andpatient samples. Human x CHO somatic cell hybrids, 4 1XF’9 1-3-30, 1-E, and 4 1XP92-2, containing different portions of the p-arm of human chromosome 16 as illustrated in Fig 1
Blood, Vol82, No 3 (August 1). 1993: pp 716-721
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
AMML INVERSION 16 p-ARM BREAKPOINT
717
A
e
”
c
-
Fig 1. Diagramatic representations of the locations of the human genomic chromosome 16p content of hybrid cells and recombinant clones used in
the study. (a) The broken line indicates the
1 6 ~ 1 3 . 1 3 -3.2
I region and the positions marked by
the CY19 hybrid (which contains chromosome sequences from the site marked to the end of the qarm) and by the CY185 hybrid (containing sequences from its site marked to the end of the
q-arm).25 Above the line are the cosmids used in
the study located according to their ability to identify fragments in the CY hybrids, eg, c41 HA2 does
not hybridize to CY185 or CY1913 whereas the
other cosmids hybridize to CY19 but not CY185.’6
The blocks below the line indicate the regions contained in the designated hybrids. (b) Above are a
series of five cosmids that represent the tile-path of
a 10-member cosmid contig containing cosmid
3581 1 Positionsof the 43F6-T3 and 46C7-T7 terminal primers are indicated as small horizontal bars
on the appropriate cosmids. (46C7 was used as a
terminal cosmid of the contig instead of 57B2 because the latter contained vector/insert rearrangements; based on gel analysis, data not shown.) Positions of the isolated YACs relative to the contig
and the terminal primers are indicated in the lower
part of the panel.
41W-2
1
.
have been described.” A leukemic cell line, ME-1, had been established from the peripheral blood (PB) leukemia cells of an M4Eo
patient with ir1v-16.’~PB cells were obtained by pheresis of six
AMML patients (nos. 1 through 6) and were cryopreserved. Vials
were thawed and cells cultured for metaphase preparation or cells
were embedded in agarose for DNA as described.15Standard cytogenetics on all patients studied showed the presence of
invl6(pl3;q22) in all dividing cells at presentation. In addition to
the inversion, patient 2 had a t(3p;7p); patient 3 had a +22; and
patient 5 had a +8. Abnormal eosinophilia was present in patients
1, 4, 5, and 6.
Cosmid clones. Cosmid clones marking the p13.13 to p13.2
region of human chromosome 16 were used to help define the inv16 parm breakpoint region by FISH. Cosmid c41HA2 had been
defined as being closely linked to the ERCC4 locus and was isolated
from a cosmid library made from hybrid 41XP9 1-3-30.’’ Cosmids
308B2, 45G5, 329F7, and 35B11 had been isolated from a flowsorted chromosome 16 library and assigned as being within cosmid
contigs located in the region of interest.16 Cosmids of the contig
identified by 35B11 were also used.
DNA sequencing and primer design. Cosmid DNA was sequenced directly using T3 and T7 primers that flank the cloning site
on Cos- 1” using the Sequenase kit (United States Biochemical,
Cleveland, OH). Primers were designed using the PRIMER program (designed and kindly provided by Drs E. Lander, S. Lincoln,
and M. Daly at Whitehead Institute, MIT).
YAC library screening. Screening of both the Washington University and Centre #Etude du Polymorphisme Humain (CEPH)
libraries was performed by polymerase chain reaction (PCR) essentially as described before.’*Primer sequences for cosmid 43F6 at
the T3 end were GGTTAAATTGACTGAAGGCACCand ATGCATCCAAACTCGGGATA;and the PCR conditions were 94°C
for 4 minutes for initial denaturation, 35 cycles of 94°C for 1 min-
ute, 60°C for 1 minute, and 72°C for 2 minutes, and then a 10-minUte final extension at 72°C. Primer sequences for cosmid 46C7 at
the T7 end were TTTGCGGCCGGAACCGAC and GCTCCGGATCCCTAGAGAAA.The PCR condition was the same as that
for 43F6 except the annealing temperature was at 5 7 T instead of
60°C. PCR reactions were conducted in 20 pL of 10 mmol/L Tris
pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgC12, 0.01% gelatin, 2
mmol/L dithiothreitol (DTT), 0.1 mmol/L deoxynucleotide triphosphates(dNTP), 200 ng ofeach primer, and 1U of Taq polymerase. YAC DNA isolation was performed as described.Ig
PFGE, Southern blotting, and filter hybridization. Pulse field
gel electrophoresis (PFGE): DNA samples in agarose plugs were
digested for 4 to 6 hours with restriction enzymes as des~ribed’~
using the manufacturer’s recommended buffers. After digestion
plugs were loaded into gels and electrophoresed for 18 hours in a
transverse alternating field electrophoresis ( “ T A W ) apparatus
(Beckman Instruments, Irvine, CA) according to the manufacturer’s recommended protocol. Electrophoresis switch time was 1
minute and power was set to 280 mA. Gels were stained with ethidium bromide and photographed before treatment in 0.25 N HCl
for 7 minutes. After Southern transfer nylon membranes were hybridized with DNA fragmentslabeled by random priming to greater
than lo9 cpmlpg using Quick-Hyb buffer (Amersham, Arlington
Heights, IL) at 65°C for 2 hours. Final washing was 0.1 X sodium
chloride sodium citrate buffer (SSC) and 0.1%sodium dodecyl sulfate (SDS) at 60°C to 65°C for 20 minutes. Autoradiography was
performed for I to 14 days at -70°C.
FZSH. Human DNA was amplified out of interspecific hybrid
cell DNA by inter-Alu-PCR using dual, bidirection, consensusAlu
primers and conditions as described.*’ Human DNA was prepared
from YACs in the same way except that the temperature of annealing was reduced to 55”C, and DNA from cosmids was used directly.
The DNAs were prepared for FISH by biotin-labeling and then
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
LIU ET AL
718
competitively hybridized with human low-Cot DNA to block nonspecific repetitive DNA.” FISH reagents were obtained from ONCOR (Gaithersberg, MD) and were used according to the instructions supplied by the manufacturer. Probe was detected by avidin
fluorescein following in situ hybridizationonto human metaphase
preparation^.^^^^^^^^ Two-color FISH was conducted as originally
de~cribed.2~
Briefly, DNA from cosmid 4565 was labeled with biotin and detected with Texas red-avidin while DNA from cosmid
35B11 was labeled with digoxigenin and detected with fluoresceinconjugated antidigoxigenin. All slides were counterstained with
propidium iodide/antifade and photographed under UV light epiillumination using a multiple-pass filter.
RESULTS
In the process of regional mapping of the human DNA
excision repair gene ERCC4, human x UV4 I hybrids were
identified as containing portions of human chromosome 16
p-arm (illustrated in Fig lA), overlapping at the position
where ERCC4 is located, 16~13.13-~13.2.’~
Because this is
also the region of the p-arm breakpoint of inv-16 of
AMML,“ the hybrids were tested to determine if they contained the inversion breakpoint region. Inter-Ah-PCR was
performed with DNA from three hybrids that had little human DNA in them except the 16p region described,
4 1XP9 1-3-30, - 1-E, and 4 1XP92-2. The PCR products
were labeled with biotin and used as competitive FISH
probes” on metaphases from normal lymphocytes and leukemia cells from the patients with inv- 16. Because 4 1XP9 13-30 contained segments from the proximal, middle, and
distal portions of the 16p-arm, probe from it brightly identified the entire p-arm of the normal chromosome13and, as
expected, was split by the inversion, readily distinguishing
the inversion chromosome with bands of fluorescence on
the resultant p- and q-arms (Fig 2A). Signal from 41XP922, containing only DNA from the ERCC4 region, was also
split by the inversion (Fig 2B) indicating that it also contained the p-arm inversion breakpoint. The two p-arm resolvable signals visualized by probe from 1-E, one from just
distal to the centromere and the other from the ERCC4
region, were separated by the inversion (Fig 2C) placing the
p-arm breakpoint proximal to ERCC4 and the ERCC4 region retained in hybrid 1-E.
Using as markers a pair of cosmids, 327A7 and 309D3,
that we had mapped to the distal tip of the q-arm (data not
shown), we determined the position of a series of p-arm
cosmids relative to the inversion breakpoint by FISH. They
were tested on the ME- 1 cells and representative patient cell
preparations. Signal from cosmids located distal to the
breakpoint should remain on the p-arm well separated from
the q-arm markers such that the pattern of hybridization on
the inversion chromosome should be indistinguishable
from the normal chromosome in the cell (Fig 2D). However, signal from cosmids proximal to the breakpoints
should be brought adjacent to the q-arm markers on the
inversion chromosome (Fig 2E).
The first cosmid tested was one we had shown to be in all
three hybrids (above) and closely linked to ERCC4,
c41HA2. As expected from the results with hybrid 1-E, it
proved to be distal to the p-arm inversion breakpoint (Fig
2D). Because we had shownI3that c41HA2 was in an inter-
val of human chromosome 16 distal to the portion of the
chromosome contained in hybrid CY 19 ofthe Callen chromosome 16 hybrid mapping panel,” we tested a series of
cosmids that had been shown16to be members of different
cosmid-contigs located proximal to CY 19 breakpoint (yet
distal to the next proximal interval). The positions of the
relevant CY breakpoints and test cosmids, relative to the
regions of chromosome 16 retained in the hybrids tested for
containing the inversion breakpoint, are illustrated in Fig
1A. All cosmids tested, with the exception of 35B11, gave
results identical to those of c4 1HA2 and were therefore located distal to the inversion breakpoint. Only 35B11 (tested
on the same patient material: ME-I cells and cells from
patients 1, 2, 4, and 5) was centromeric to the parm inversion breakpoint in these analyses. As confirmation that
probe from 35B11 identified a segment on the p-arm of
normal chromosome 16s, two-color FISH indicated that
35Bll colocalized with c41HA2 on the chromosomes of
normal control cells (Fig 2F). To verify that 35B11 swung to
the q-arm as a result of the inversion, signals from the two
cosmids were separated from each other on one of the chromosome 16s when cohybridized onto metaphases from patient cells (Fig 2G).
Probes from representative cosmids in the CY185 to
CY 19 interval were then used for analysis of pulsed-fieldseparated macrorestriction fragments from normal and leukemic cells. A 1.2-kb EcoRI single copy fragment from cosmid 35B11 identified a novel 800-kb Not1 fragment from
the leukemic cells of four patients so examined: I , 2,4, and
5, which was not seen in normal cells (Fig 3). Two of these
samples, from patients 2 and 5, were similarly examined
after Sac11 digestion and were seen to have a novel 200-kb
fragment in addition to the germline 240-kb fragment (Fig
3). Probes from the other cosmids in the region did not
identify any rearranged bands with either restriction enzyme in any patient material. These data indicated that cosmid 35B11 contained DNA sequenceswithin 240 kb of the
parm inversion breakpoint in at least some patients. Because this cosmid has been identified as nested within a
120-kb, 10-member cosmid contig at the Los Alamos National Laboratory,I6cosmids (43F6 and 46C7) at or near the
two opposite ends of the contig (see Fig 1B) were then used
as FISH probe on inv-16 cells. Both gave results identical to
35B I 1 indicating that the entire 120-kb contig did not contain, but was centromeric to, the p-arm inversion breakpoint.
Therefore, cosmids 43F6 and 46C7 were used to identify
YACs containing human genomic DNA that might span
the breakpoint. Several hundred base pairs from each of the
two ends of both cosmids were sequenced from the two
vector arms (T3 and T7) into the inserts. From these four
sequences, PCR primer pairs were designed (one pair from
each end of each of the two cosmids). Each of the four
primer pairs were tested on each of the cosmids of the contig. The primer pair at the T3 end of 43F6 (43F6-T3) was
found to be unique to this cosmid whereas the pair at T7
end could amplify from adjacent cosmidsin the contig. Likewise, the primer pair at the T7 end of 46C7 (46C7-T7) was
unique to the cosmid and the pair at T3 end was not. There-
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
719
AMML INVERSION 16 p-ARM BREAKPOINT
I
E
-.
.
- . A
1
1
Fig 2. FISH photomicrographs using inter-Alu-PCR products from interspecific somatic cell hybrids (A, B, C) and YACs (H, I. J-1) as well
as directly labeled cosmid DNAs (D. E, F. G) as probes on inv-16 (A-E, G, I-L) and normal (F, H) cells. (A) Probe is from hybrid41XP91-3-30on
a BM metaphase of patient 1. Note that the p-arm of one chromosome 1 6 is brightly labeled whereas on the other the signal is clearly split.
(B) Probe is from hybrid 41XP92-2 on similar material again showing the signal split on one of the two chromosome 16s (the one on the left)
in this partial metaphase. (C) Probe from 1-E on inv-16 cells. Probe from this hybrid identifies two zones of hybridization on normal human
chromosome 1 6 p-arms; one on the distal edge of the centromere and the other in the region of ERCC4 (16pl3.13-13.2)."The arrows lie in
the longitudinal planes of the chromosomes and are pointed at a region of hybridization adjacent to the centromere. In patient cells, the
distance between that centromere-associated spot and the ERCC4 region is increased in one of the chromosomes (the one on the left in this
photomicrograph) indicating that, as a result of the inversion, the spot adjacent to the centromere is swung to the q-arm. (D) Probe from
c41 HA2 combined with cosmids marking the tip of the q-arm on inv-16 cells in a partial metaphase. The arrows indicatethe positions of the
q-arm markers. On both the normal and inv-16 chromosome, c41HA2 remains separated from the q-arm markers indicating that it is distal
to the p-arm inversion breakpoint. Similar results were obtained with cosmids 30882,4505. and 329F7. (E) Probe from 3 5 B l l combined
with q-arm marker cosmids (once again the arrows indicate the position of markers) on inv-16 cells in a partial metaphase. On the chromosome 1 6 on the right, the signals are clustered indicating that the region identified by 35811 has been brought adjacent to the q-arm
markers. (F) Two-color (35811 yellow-green and c41HA2 red) FISH on chromosomes in a partial metaphase from normal cells verifying the
colocalization of these markers on the 1 6 p-arm. (G) Cohybridization (single color) of 3581 1 and c41HA2 on an inv-16 partial metaphase
indicating the separation of the markers on one of the chromosomes, far right versus far left. (H) Probe from y757D7 on a normal human
metaphase. Probe shows good specificity to the 1 6 p-arm with only tiny dots of hybridization (arrows) on the q-arm. DNAs from the other
YACs did not show similar hybridizationon the q-arm. (I)Probefrom y757D7 on an ME-1 partial metaphase. The signal isclearlyspliion one
of the chromosome 16s. On the one where it is not split, the same faint hybridization(as in H) is seen on the q-arm. (J) Probe from yC8E12 on
an ME-1 partial metaphase. The signal is not splii on either 16. (K) Probe from yB80B9 on an ME-1 partial metaphase. The signal is splii on
one of the two chromosome 16s (arrows). (1)Probe from yB54E2 on a partial metaphase from patient 4. The chromosomes are overcontracted yet the signal is clearly splii in one (arrows) of the two chromosome 16s.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
LIU ET AL
720
contig that was shown to be proximal to the breakpoint, the
FISH signal from yC8E I2 was not split by the inversion in
patient cells (Fig 25). Like probe from y757D7, probe from
yB80B9 and y854E2 clearly detected split signal on one of
the two chromosome 16s in the leukemic cells from all patients in the study as well as cell line ME-l (Figs 2K and 2L).
Therefore, it is concluded that yB80B9, y854E2, and
y757D7 contain human genomic DNA sequences that span
the p-arm inversion breakpoint in AMML.
DISCUSSION
Fig 3. Southem blot hybridization of a 1.2-kb repeat-free fragment from cosmid 3581 1 identiQing Nod (top panel) and Sacll
(bottom panel) macrorestrictionfragments from samples from two
normal volunteers (N)and patients 2 and 5.
fore, 43F6-T3 and 46C7-T7 primers are located at or near
the far ends of the contig (Fig I b) and, therefore, were used
to screen two YAC libraries (Washington University and
CEPH).
Two positive YAC clones were identified from each YAC
library (yB80B9 and yC8E 12 from Washington University,
and y854E2 and y757D7 from CEPH). The inserts measured 300 kb, 100 kb, 550 kb, and 780 kb, respectively,
when sized on a pulsed-field gel, blotted, and probed with
human Cot-1 DNA (data not shown). All the YACs gave
positive signals with primer sets from both cosmids at opposite ends of the contig except yC8E 12. It was positive only
for the primer set from 46C7 suggesting, as its size would
predict, that it did not span the entire contig.
Inter-Alu-PCRs were performed on YAC DNAs. Products were then labeled with biotin and used as FISH probes
on metaphases of normal lymphoblasts. DNA from y854E2
and yC8E 12 proved to be nonchimeric by this assay giving
single signals only on chromosome 16 parms. DNA from
yB80B9 was found to be chimeric, because its DNA produced signals on 17p and an unidentified chromosome in
addition to the single signals on 16p (data not shown). DNA
from y757D7 was also nonchimeric but appears to contain
the previously described"*I2 chromosome 16-specific low
abundance repetitive sequences (CH 16LARs) because
inter-Ah-PCR product from it produced, in addition to the
bright signal on chromosome 16 p a r m , a very faint pair of
signals on the q-arm (Fig 2H). Despite the presence of the
repeat sequences, when applied to leukemic cells, y757D7
probe clearly detected that the bright p-arm signal was split
between the p and q-arms on the inversion chromosome
(Fig 21). As expected, because yC8E12 does not span the
This combination of genomic resources and molecular
techniques brought to bear on the inv-16 problem has resulted in immediate as well as long-term potential applications to the management and understanding of the basis of
the disease. Standard G-band cytogenetics for diagnosis of
the malady is difficult given the clarity of marrow metaphase preparations and the subtle nature of the differences
between the inversion and normal chromosomes. The use
of FISH for the detection of the separation ofcosmid probes
located on either side of the breakpoint on the parm,26
though useful, has difficult application in all but the most
sophisticated experimental cytogenetic laboratories because
of weak signal and background problems associated with
such small FISH probes. Here, the bright, specific signals
provided by either hybrid 41XP91-3-30, or YACs y757D7
or y854E2, should prove to be useful for the rapid and unambiguous identification of inv-16 in even the poorest of
metaphase preparations.
The results impact on the hypothesis suggesting that
CH 16LARs located on the p and q-arms of chromosome
16 might play a role in the origin of the chromosome 16
rearrangements in AMML-M~."s'~
While we see some evidence of hybridization on the q-arm using the largest (and
therefore farthest reaching) of the YACs, the smaller YACs
containing the inversion breakpoint and the 120-kb cosmid
contig just proximal to it, do not produce FISH signals on
the q-arm. Because all known cosmid and YAC clones that
contain CH I6LARs produce FISH signals on both arms of
chromosome 16,"*12*27
the repeats do not appear to be at or
immediately adjacent to the p a r m breakpoint. Also, refined physical mapping of the q-arm repeats places them a
considerable distance distal from that inversion breakpoint.27 Therefore, a role for CHl6LARs several hundred
kb proximal to the p a r m breakpoint participating with homologous sequences, similarly distant from the q-arm
breakpoint, in the genesis of the inversion has become a less
compelling hypothesis. The possibility that movement of
CH16LARs from the p- to q-arm has some unknown position effect on genes is another hypothesis for future investigation.
Finally, the molecular cloning of the genomic DNA overlapping the breakpoints is a most significant step in the
identification of genes involved in a chromosomal rearrangement associated with a neoplastic process. By analogy
with other malignancy-associated nonrandom chromosomal rearrangements, one could speculate on the molecular mechanisms operational in the inv- 16 event. A gene located on the p-arm may be fused to a q-arm gene resulting in
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
AMML INVERSION 16 p-ARM BREAKPOINT
chimeric transcripts and gene products. It is also possible
that a cis-acting regulatory element located on one arm may
be brought into proximity with a gene on the other arm
resulting in aberrant expression. Either one or both of these
mechanisms could contribute to dysregulated hematopoiesis and leukemogenesis. The stage is now set for the elucidation of the p-arm elements in this event.
ACKNOWLEDGMENT
We appreciate the help of Denis LePaslier at CEPH for sending
YAC clones. We acknowledge B. Andersson, M. Beran, and J. Hester from the Department of Hematology, the University of Texas
M.D. Anderson Cancer Center, Houston, TX for contributing
cryopreserved leukemic cells for this study.
REFERENCES
1. Solomon E, Borrow J, Goddard AD: Chromosome aberrations and cancer. Science 254: 1153, 1991
2. Nichols J, Nimer SD: Transcription factors, translocations,
and leukemia. Blood 802953, 1992
3. Rabbits TH: Translocations, master genes, and differences between the origins of acute and chronic leukemias. Cell 67:64 l , 199I
4. Yunis JJ, Tanzer J: Molecular mechanisms of hematologic
malignancies. Crit Rev Oncog 4: 161, 1993
5. Arthur DC,Bloomfield C D Partial deletion of the long ann of
chromosome 16 and bone marrow eosinophilia in acute nonlymphocytic leukemia, a new association. Blood 61:994, 1983
6. Le Beau MM, Larson RA, Bitter MA, Vardiman JW, Golomb
HM, Rowley JD: Association of an inversion of chromosome 16
with abnormal marrow eosinophils in acute myelomonocytic leukemia: a unique cytogenetic-clinical pathological association. N
Engl J Med 309:630, 1983
7. Hogge DE, Misawa S, Parsa NZ, Pollak A, Testa JR: Abnormalities of chromosome 16 in association with acute myelomonocytic leukemia and dysplastic bone marrow eosinophils. J Clin Oncol 2550, 1984
8. Larson RA, Williams SF, Le Beau MM, Bitter MA, Vardiman
JW, Rowley J D Acute myelomonocytic leukemia with abnormal
eosinophils and inv( 16) or t( 16;16) has a favorable prognosis. Blood
68:1242, 1986
9. Callen DF, Kuss B, Willman CL, Eyre H, Nancarrow J,
Lapsys N, Richards RI, Sutherland GR: Precise localization of the
long arm breakpoint of the inv( 16) of ANNL M4Eo and progress
towards cloning this breakpoint. Am J Hum Genet 5 1:A57, 1992
10. Wessels JW, Mollevanger P, Dauwerse JG, Cluitmans FHM,
Breuning MH, Beverstock GC: Two distinct loci on the short arm
of chromosome 16 are involved in myeloid leukemia. Blood
77:1555, 1991
1 1. Dauwerse JG, Jumelet EA, Wessels JW, Saris JJ, Hagemeijer
A, Beverstock GC, van Ommen GJB, Breuning MH: Extensive
cross-homology between the long and the short arm of chromosome I6 may explain leukemic inversions and translocations.
Blood 79: 1299, 1992
12. Stallings RO, Doggett NA, Okumura K, Ward DC: Chromosome 16 specific repetitive DNA sequences that map to chromosomal regions known to undergo breakage rearrangement in leukemia cells. Genomics 13:332, 1992
721
13. Liu P, Siciliano J, White B, Legerski R, Callen D, Reeders S,
Siciliano MJ, Thompson LH: Regional mapping of human DNA
excision repair gene ERCC4 to chromosome 16~13.13-p13.2.Mutagenesis 8:199, 1993
14. Yanagisawa K, Horiuchi T, Fujita S:Establishment andcharacterization ofa new human leukemia cell line derived from M4Eo.
Blood 78:451, 1991
15. Claxton DF, Reading CL, Nagarajan L, Tsujimoto Y, Andersson BS, Estey E, Cork A, Huh YO, Trujillo J, Deisseroth AB:
Rapid Communication: Correlation of CD2 expression with PML
gene breakpoints in patients with acute promyelocytic leukemia.
Blood 80582, 1992
16. Stallings RL, Doggett NA, Callen D, Apostolou S, Chen LZ,
Nancarrow JK, Whitmore SA, Hams P, Michison H, Breuning M,
Sans JJ, Fickett J, Cinkosky M, Torney DC, Hildebrand CE, Moyzis R K Evaluation of a cosmid contig physical map of human
chromosome 16. Genomics 13:1031, 1992
17. Evans GA, Lewis K, Rothenberg BE: High efficiency vectors
for cosmid microcloning and genomic analysis. Gene 79:9, 1989
18. Green ED, Olson MV. Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction.
Proc Natl Acad Sci USA 87:1213, 1990
19. Chandrasekharappa SC, Marchuk DA, Collins FS: Analysis
of yeast artificial chromosome clones, in Burmeister M, Ulanovsky
L (eds): Methods in Molecular Biology, vol 12. Totowa, NJ, Humana, 1992, p235
20. Liu P, Siciliano J, Seong D, Craig J, Zhao Y, de Jong PJ,
Siciliano MJ: Inter-Alu-PCR primers and conditions for isolating
human chromosome painting probes from hybrid cells. Cancer
Genet Cytogenet 65:93, 1993
2 1. Lichter P. Ledbetter SA, Ledbetter DH, Ward DC: Fluorescence in-situ hybridization with Alu and L1 polymerase chain reaction probes for rapid characterization of human chromosomes in
hybrid cell lines. Proc Natl Acad Sci USA 87:6634, 1990
22. Pinkel D, Staume T, Gray J W Cytogenetic analysis using
quantitative, high-resolution fluorescence hybridization. Proc Natl
Acad Sci USA 83:2934, 1986
23. Dolf G, Meyn R, Curley D, Prather N, Story MD, Boman
BM, Siciliano MJ, Hewitt RR: Extrachromosomal amplification of
the epidermal growth factor receptor gene in a human colon carcinoma cell line. Genes, Chromosom Cancer 3:48, 199 I
24. Kallioniemi 0-P, Kallioniemi A, Kurisu W, Thor A, Chen
L-C, Smith HS, Waldman FM, Pinkel D, Gray JW: ERBBZ amplification in breast cancer analyzed by fluorescence in situ hybridization. Proc Natl Acad Sci USA 89:5321, 1992
25. Callen DF, Doggett NA, Stallings RL, Chen LZ, Whitmore
SA, Lane SA, Nancarrow JK, Apostolou S, Thompson AD, Lapsys
NM, Eyre HJ, Baker EG, Shen Y, Holman K, Phillips H, Richards
RI, Sutherland GR: High-resolution cytogenetic-based physical
map of human chromosome 16. Genomics 13:1178, 1992
26. Dauwerse JG, Kievits T, Beverstock GC,van der Keur D,
Smit E, Wessels HW, Hagemeijer A, Pearson PL, Van Ommen
G-JB, Breuning MH: Rapid detection of chromosome 16 inversion
in acute nonlymphocytic leukemia, subtype M4, regional localization of the breakpoint in 16p. Cytogenet Cell Genet 53:126, 1990
27. Stallings RL, Whitmore SA, Doggett NA, Callen D F Refined physical mapping of chromosome 16 specific low abundance
repetitive DNA sequences. Cytogenet Cell Genet 63:97, 1993
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1993 82: 716-721
Identification of yeast artificial chromosomes containing the inversion
16 p-arm breakpoint associated with acute myelomonocytic leukemia
P Liu, DF Claxton, P Marlton, A Hajra, J Siciliano, M Freedman, SC Chandrasekharappa, K
Yanagisawa, RL Stallings and FS Collins
Updated information and services can be found at:
http://www.bloodjournal.org/content/82/3/716.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.